Classifications

• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
  • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K31/00—Medicinal preparations containing organic active ingredients
  • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
  • A61K31/7088—Compounds having three or more nucleosides or nucleotides
  • A61K31/713—Double-stranded nucleic acids or oligonucleotides
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P27/00—Drugs for disorders of the senses
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P37/00—Drugs for immunological or allergic disorders
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K38/00—Medicinal preparations containing peptides
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2310/00—Structure or type of the nucleic acid
  • C12N2310/10—Type of nucleic acid
  • C12N2310/11—Antisense
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2310/00—Structure or type of the nucleic acid
  • C12N2310/10—Type of nucleic acid
  • C12N2310/11—Antisense
  • C12N2310/111—Antisense spanning the whole gene, or a large part of it
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2310/00—Structure or type of the nucleic acid
  • C12N2310/10—Type of nucleic acid
  • C12N2310/14—Type of nucleic acid interfering N.A.
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2310/00—Structure or type of the nucleic acid
  • C12N2310/50—Physical structure
  • C12N2310/53—Physical structure partially self-complementary or closed

Definitions

• eIF-5Al Apoptosis-specific eIF-5A
• eIF-5Al Antisense Oligonucleotides and siRNAs as Anti-Inflammatory Therapeutics
• provisional 60/504,731 filed on September 22, 2003; U.S. provisional 60/528,249 filed on December 10, 2003; U.S. provisional 60/557,671 filed on March 21, 2004 and U.S. provisional 60/(awaited) filed on June 2, 2004, all of which are herein inco ⁇ orated in their entirety.
• the present invention relates to apoptosis-specific eucaryotic initiation factor ("eIF-5A") or referred to as "apoptosis-specific eIF-5A” or “eIF-5Al” and deoxyhypusine synthase (DHS).
• eIF-5A eucaryotic initiation factor
• DHS deoxyhypusine synthase
• the present invention relates to apoptosis-specific eIF-5A and DHS nucleic acids and polypeptides and methods for inhibiting expression of apoptosis-specific eIF-5A and DHS.
• Apoptosis is a genetically programmed cellular event that is characterized by well- defined mo ⁇ hological features, such as cell shrinkage, chromatin condensation, nuclear fragmentation, and membrane blebbing. Kerr et al. (1972) Br. J. Cancer, 26, 239-257; Wyllie et al. (1980) Int. Rev. Cytol., 68, 251-306. It plays an important role in normal tissue development and homeostasis, and defects in the apoptotic program are thought to contribute to a wide range of human disorders ranging from neurodegenerative and autoimmunity disorders to neoplasms. Thompson (1995) Science, 267, 1456-1462; Mullauer et al.
• Caspases trigger apoptosis in response to apoptotic stimuli by cleaving various cellular proteins, which results in classic manifestations of apoptosis, including cell shrinkage, membrane blebbing and DNA fragmentation. Chang & Yang (2000) Microbiol. Mol. Biol. Rev., 64, 821-846.
• Pro-apoptotic proteins such as Bax or Bak, also play a key role in the apoptotic pathway by releasing caspase-activating molecules, such as mitochondrial cytochrome c, thereby promoting cell death through apoptosis. Martinou & Green (2001) Nat. Rev. Mol. Cell. Biol., 2, 63-67; Zou et al. (1997) Cell, 90, 405-413.
• Anti-apoptotic proteins such as Bcl-2, promote cell survival by antagonizing the activity of the pro-apoptotic proteins, Bax and Bak. Tsujimoto (1998) Genes Cells, 3, 697-707; Kroemer (1997) Nature Med., 3,
• the ratio of Bax:Bcl-2 is thought to be one way in which cell fate is determined; an excess of Bax promotes apoptosis and an excess of Bcl-2 promotes cell survival.
• Salomons et al. (1997) Int. J. Cancer, 71, 959-965; Wallace-Br justify & Lowe (1999) Cell Mol. Life Sci.,55, 64-75.
• Another key protein involved in apoptosis is a protein that encoded by the tumor suppressor gene p53. This protein is a transcription factor that regulates cell growth and induces apoptosis in cells that are damaged and genetically unstable, presumably through up-regulation of Bax.
• Cytokines are pleiotropic molecules that can exert many different effects on many different cell types, but are especially important in regulation of the immune response and hematopoietic cell proliferation and differentiation.
• the actions of cytokines on target cells can promote cell survival, proliferation, activation, differentiation, or apoptosis depending on the particular cytokine, relative concentration, and presence of other mediators.
• the use of anti-cytokines to treat autoimmune disorders such as psoriasis, rheumatoid arthritis, and Crohn's disease is gaining popularity.
• the pro-inflammatory cytokines IL-1 and TNF play a large role in the pathology of these chronic disorders.
• Interleukin 1 is an important cytokine that mediates local and systemic inflammatory reactions and which can synergize with TNF in the pathogenesis of many disorders, including vasculitis, osteoporosis, neurodegenerative disorders, diabetes, lupus nephritis, and autoimmune disorders such as rheumatoid arthritis.
• IL-I Interleukin 1
• the importance of IL- l ⁇ in tumour angiogenesis and invasiveness was also recently demonstrated by the resistance of IL-l ⁇ knockout mice to metastases and angiogenesis when injected with melanoma cells (Voronov et al, 2003).
• Interleukin 18 is a recently discovered member of the IL-1 family and is related by structure, receptors, and function to IL-1.
• IL-18 is a central cytokine involved in inflammatory and autoimmune disorders as a result of its ability to induce interferon- gamma (IFN- ⁇ ), TNF- ⁇ , and IL-1.
• IFN- ⁇ interferon- gamma
• IL-l ⁇ and IL-18 are both capable of inducing production of TNF- ⁇ , a cytokine known to contribute to cardiac dysfunction during myocardial ischemia (Maekawa et al, 2002).
• Inhibition of IL-18 by neutralization with an IL-18 binding protein was found to reduce ischemia-induced myocardial dysfunction in an ischemia/reperfusion model of suprafused human atrial myocardium (Dinarello, 2001).
• Neutralization of IL-18 using a mouse IL-18 binding protein was also able to decrease IFN- ⁇ , TNF- ⁇ , and IL-1 ⁇ transcript levels and reduce joint damage in a collagen-induced arthritis mouse model (Banda et al., 2003).
• a reduction of IL-18 production or availability may also prove beneficial to control metastatic cancer as injection of IL-18 binding protein in a mouse melanoma model successfully inhibited metastases (Carrascal et al, 2003).
• IL-18 As a further indication of its importance as a pro-inflammatory cytokine, plasma levels of IL-18 were elevated in patients with chronic liver disease and increased levels were correlated with the severity of the disease (Ludwiczek et al, 2002). Similarly, IL-18 and TNF- ⁇ were elevated in the serum of diabetes mellitus patients with nephropathy (Moriwaki et al, 2003). Neuroinflammation following traumatic brain injury is also mediated by pro-inflammatory cytokines and inhibition of IL-18 by the IL-18 binding protein improved neurological recovery in mice following brain trauma (Yatsiv et al, 2002).
• TNF- ⁇ a member of the TNF family of cytokines, is a pro-inflammatory cytokine with pleiotropic effects ranging from co-mitogenic effects on hematopoietic cells, induction of inflammatory responses, and induction of cell death in many cell types.
• TNF- ⁇ is normally induced by bacterial lipopolysaccharides, parasites, viruses, malignant cells and cytokines and usually acts beneficially to protect cells from infection and cancer.
• inappropriate induction of TNF- ⁇ is a major contributor to disorders resulting from acute and chronic inflammation such as autoimmune disorders and can also contribute to cancer, AIDS, heart disease, and sepsis (reviewed by Aggarwal and Natarajan, 1996; Sharma and Anker, 2002).
• TNF- ⁇ The ability of TNF- ⁇ to promote the survival and growth of B lymphocytes is also thought to play a role in the pathogenesis of B-cell chronic lymphocytic leukemia (B-CLL) and the levels of TNF- ⁇ being expressed by T cells in B-CLL was positively correlated with tumour mass and stage of the disease (Bojarska-Junak et al, 2002).
• Interleukin-l ⁇ (IL-l ⁇ ) is a cytokine known to induce TNF- ⁇ production.
• DHS Deoxyhypusine synthase
• eIF-5A hypusine-containing eucaryotic translation initiation Factor-5A
• Hypusine a unique amino acid, is found in all examined eucaryotes and archaebacteria, but not in eubacteria, and eIF-5A is the only known hypusine-containing protein.
• Active eIF-5A is formed in two post-translational steps: the first step is the formation of a deoxyhypusine residue by the transfer of the 4-aminobutyl moiety of spermidine to the ⁇ -amino group of a specific lysine of the precursor eIF-5A catalyzed by deoxyhypusine synthase; the second step involves the hydroxylation of this 4-aminobutyl moiety by deoxyhypusine hydroxylase to form hypusine.
• eIF-5A hypusine residue of modified eIF-5A was found to be essential for sequence-specific binding to RNA, and binding did not provide protection from ribonucleases.
• intracellular depletion of eIF-5A results in a significant accumulation of specific mRNAs in the nucleus, indicating that eIF-5 A may be responsible for shuttling specific classes of mRNAs from the nucleus to the cytoplasm.
• eIF-5A is a nucleocytoplasmic shuttle protein, rather than a component of polysomes. Rosorius et al. (1999) J. Cell Science, 112, 2369-2380.
• the first cDNA for eIF-5A was cloned from human in 1989 by Smit-McBride et al., and since then cDNAs or genes for eEF-5A have been cloned from various eukaryotes including yeast, rat, chick embryo, alfalfa, and tomato. Smit-McBride et al. (1989) J. Biol.
• eIF-5 A changes in eIF-5 A expression have been observed in human fibroblast cells after addition of serum following serum deprivation.
• Chen & Chen (1997) J. Cell Physiol., 170, 248-254.
• the present invention relates to apoptosis specific eucaryotic initiation factor 5A (eIF-5A), referred to as "apoptosis specific eIF-5A" or “eIF-5Al.”
• eIF-5A eucaryotic initiation factor 5A
• the present invention also relates to apoptosis-specific eIF-5 A nucleic acids and polypeptides and methods for inhibiting or suppressing apoptosis in cells using antisense nucleotides or siRNAs to inhibit expression of apoptosis-specific eIF-5 A.
• the present invention relates to a method of delivering siRNA to mammalian lung cells in vivo.
• the invention also relates to suppressing or inhibiting expression of pro-inflammatory cytokines by inhibiting expression of apoptosis-specific eIF-5A. Further, the present invention relates to inhibiting or suppressing expression of p53 by inhibiting expression of apoptosis-specific eIF-5A. The present invention also relates to a method of increasing Bcl-2 expression by inhibiting or suppression expression of apoptosis factor 5 A using antisense nucleotides or siRNAs. The present invention also provides a method of inhibiting production of cytokines, especially TNF- ⁇ in human epithelial cells.
• suppressing expression of apoptosis-specific eIF-5A by the use of antisense oligonucleotides targeted at apoptosis-specific eIF-5A provides methods of preventing retinal ganglion cell death in a glaucomatous eye.
• Figure 1 depicts the nucleotide sequence (SEQ ID NO: 11) and derived amino acid sequence (SEQ ID NO: 12) of the 3' end of rat apoptosis-specific eIF-5A.
• Figure 2 depicts the nucleotide sequence (SEQ ID NO: 15) and derived amino acid sequence (SEQ ID NO: 16) of the 5' end of rat apoptosis-specific eIF-5A cDNA.
• Figure 3 depicts the nucleotide sequence of rat co ⁇ us luteum apoptosis-specific eIF-5A full-length cDNA (SEQ ID NO: 1). The amino acid sequence is shown in SEQ ID NO: 2.
• Figure 4 depicts the nucleotide sequence (SEQ ID NO: 6) and derived amino acid sequence (SEQ ID NO: 7) of the 3' end of rat apoptosis-specific DHS cDNA.
• Figure 5 is an alignment of the full-length nucleotide sequence of rat co ⁇ us luteum apoptosis-specific eIF-5A cDNA (SEQ ID NO: 20) with the nucleotide sequence of human eIF-5A (SEQ ID NO: 3) (Accession number BC000751 or NM_001970, SEQ ID NO:3).
• Figure 6 is an alignment of the full-length nucleotide sequence of rat co ⁇ us luteum apoptosis-specific eIF-5 A cDNA (SEQ ID NO: 20) with the nucleotide sequence of human eIF-5A (SEQ ID NO: 4) (Accession number NM-020390, SEQ ID NO:4).
• Figure 7 is an alignment of the full-length nucleotide sequence of rat co ⁇ us luteum apoptosis-specific eIF-5A cDNA (SEQ ID NO: 20) with the nucleotide sequence of mouse eIF-5A (Accession number BC003889).
• Mouse nucleotide sequence (Accession number BC003889) is SEQ ID NO:5.
• Figure 8 is an alignment of the derived full-length amino acid sequence of rat co ⁇ us luteum apoptosis-specific eIF-5A (SEQ ID NO: 2) with the derived amino acid sequence of human eIF-5A (SEQ ID NO: 21) (Accession number BC000751 or NM_001970).
• Figure 9 is an alignment of the derived full-length amino acid sequence of rat co ⁇ us luteum apoptosis-specific eIF-5A (SEQ ID NO: 2) with the derived amino acid sequence of human eIF-5A (SEQ ID NO: 22) (Accession number NM_020390).
• Figure 10 is an alignment of the derived full-length amino acid sequence of rat co ⁇ us luteum apoptosis-specific eIF-5A (SEQ ID NO: 2) with the derived amino acid sequence of mouse eIF-5A (SEQ ID NO: 23) (Accession number BC003889).
• Figure 11 is an alignment of the partial-length nucleotide sequence of rat co ⁇ us luteum apoptosis-specific DHS cDNA (residues 1-453 of SEQ ID NO: 6) with the nucleotide sequence of human DHS (SEQ ID NO: 8) (Accession number BC000333, SEQ ID NO:8).
• Figure 12 is a restriction map of rat co ⁇ us luteum apoptosis-specific eIF-5A cDNA.
• Figure 13 is a restriction map of the partial-length rat apoptosis-specific DHS cDNA.
• Figure 14 is a Northern blot (top) and an ethidium bromide stained gel (bottom) of total RNA probed with the P-dCTP-labeled 3'-end of rat co ⁇ us luteum apoptosis-specific eIF-5A cDNA.
• Figure 15 is a Northern blot (top) and an ethidium bromide stained gel (bottom) of total RNA probed with the 32 P-dCTP-labeled 3'-end of rat co ⁇ us luteum apoptosis-specific DHS cDNA.
• Figure 16 depicts a DNA laddering experiment in which the degree of apoptosis in superovulated rat co ⁇ us lutea was examined after injection with PGF-2 ⁇ .
• Figure 17 is an agarose gel of genomic DNA isolated from apoptosing rat co ⁇ us luteum showing DNA laddering after treatment of rats with PGF F-2 ⁇ .
• Figure 18 depicts a DNA laddering experiment in which the degree of apoptosis in dispersed cells of superovulated rat co ⁇ ora lutea was examined in rats treated with spermidine prior to exposure to PGF-2 ⁇ .
• Figure 19 depicts a DNA laddering experiment in which the degree of apoptosis in superovulated rat co ⁇ us lutea was examined in rats treated with spermidine and/or PGF- 2 ⁇ .
• Figure 20 is a Southern blot of rat genomic DNA probed with 32 P-dCTP-labeled partial- length rat co ⁇ us luteum apoptosis-specific eIF-5A cDNA.
• Figure 21 depicts pHM6, a mammalian epitope tag expression vector (Roche Molecular Biochemicals).
• Figure 22 is a Northern blot (top) and ethidium bromide stained gel (bottom) of total RNA isolated from COS-7 cells after induction of apoptosis by withdrawal of serum probed with the 32 P-dCTP-labeled 3 '-untranslated region of rat co ⁇ us luteum apoptosis-specific DHS cDNA.
• Figure 23 is a flow chart illustrating the procedure for transient transfection of COS-7 cells.
• Figure 24 is a Western blot of transient expression of foreign proteins in COS-7 cells following transfection with pHM6.
• Figure 25 illustrates enhanced apoptosis as reflected by increased caspase activity when COS-7 cells were transiently transfected with pHM6 containing full-length rat apoptosis- specific eIF-5A in the sense orientation.
• Figure 26 illustrates enhanced apoptosis as reflected by increased DNA fragmentation when COS-7 cells were transiently transfected with pHM6 containing full-length rat apoptosis-specific eIF-5A in the sense orientation.
• Figure 27 illustrates detection of apoptosis as reflected by increased nuclear fragmentation when COS-7 cells were transiently transfected with pHM6 containing full-length rat apoptosis-specific eIF-5A in the sense orientation.
• Figure 28 illustrates enhanced apoptosis as reflected by increased nuclear fragmentation when COS-7 cells were transiently transfected with pHM6 containing full-length rat apoptosis-specific eIF-5A in the sense orientation.
• Figure 29 illustrates detection of apoptosis as reflected by phosphatidylserine exposure when COS-7 cells were transiently transfected with pHM6 containing full-length rat apoptosis-specific eIF-5A in the sense orientation.
• Figure 30 illustrates enhanced apoptosis as reflected by increased phosphatidylserine exposure when COS-7 cells were transiently transfected with pHM6 containing full-length rat apoptosis-specific eIF-5A in the sense orientation.
• Figure 31 illustrates enhanced apoptosis as reflected by increased nuclear fragmentation when COS-7 cells were transiently transfected with pHM6 containing full-length rat apoptosis-specific eIF-5A in the sense orientation.
• Figure 32 illustrates enhanced apoptosis when COS-7 cells were transiently transfected with pHM6 containing full-length rat apoptosis-specific eIF-5A in the sense orientation.
• Figure 33 illustrates down-regulation of Bcl-2 when COS-7 cells were transiently transfected with pHM6 containing full-length rat apoptosis-specific eIF-5 A in the sense orientation.
• the top photo is the Coomassie-blue-stained protein blot; the bottom photo is the corresponding Western blot.
• Figure 34 is a Coomassie-blue-stained protein blot and the corresponding Western blot of COS-7 cells transiently transfected with pHM6 containing full-length rat apoptosis- specific eIF-5A in the antisense orientation using Bcl-2 as a probe.
• Figure 35 is a Coomassie-blue-stained protein blot and the corresponding Western blot of COS-7 cells transiently transfected with pHM6 containing full-length rat apoptosis- specific eIF-5A in the sense orientation using c-Myc as a probe.
• Figure 36 is a Coomassie-blue-stained protein blot and the corresponding Western blot of COS-7 cells transiently transfected with pHM6 containing full-length rat apoptosis- specific eIF-5A in the sense orientation when p53 is used as a probe.
• Figure 37 is a Coomassie-blue-stained protein blot and the corresponding Western blot of expression of pHM6-full-length rat apoptosis-specific eIF-5A in COS-7 cells using an anti-[HA]-peroxidase probe and a Coomassie-blue-stained protein blot and the corresponding Western blot of expression of pHM6-full-length rat apoptosis-specific elF- 5A in COS-7 cells when a p53 probe is used.
• Figure 38 is an alignment of human eIF5A2 isolated from RKO cells (SEQ ID NO: 24) with the sequence of human eIF5A2 (SEQ ID NO: 22) (Genbank accession number XM_113401). The consensus sequence is shown in SEQ ID NO: 28.
• Figure 39 is a graph depicting the percentage of apoptosis occurring in RKO and RKO-E6 cells following transient transfection.
• RKO and RKO-E6 cells were transiently transfected with pHM6-LacZ or pHM6-apoptosis-specific eIF-5A.
• RKO cells treated with Actinomycin D and transfected with pHM6-apoptosis-specific eIF-5 A showed a 240% increase in apoptosis relative to cells transfected with pHM6-LacZ that were not treated with Actinomycin D.
• Figure 40 is a graph depicting the percentage of apoptosis occurring in RKO cells following transient transfection.
• RKO cells were transiently transfected with pHM6-LacZ, pHM6-apoptosis-specific eIF-5A, pHM6-eIF5A2, or pHM6-truncated apoptosis-specific eIF-5A.
• Cells transfected with pHM6-apoptosis-specific eIF-5A showed a 25% increase in apoptosis relative to control cells transfected with pHM6-LacZ. This increase was not apparent for cells transfected with pHM6-eIF5A2 or pHM6-truncated apoptosis-specific eIF-5A.
• Figure 41 is a graph depicting the percentage of apoptosis occurring in RKO cells following transient transfection.
• RKO cells were either left untransfected or were transiently transfected with pHM6-LacZ or pHM6-apoptosis-specific eIF-5A. After correction for transfection efficiency, 60 % of the cells transfected with pHM6-apoptosis- specific eIF-5A were apoptotic.
• FIG. 42 provides the results of a flow cytometry analysis of RKO cell apoptosis following transient transfection.
• RKO cells were either left untransfected or were transiently transfected with pHM6-LacZ, pHM6-apoptosis-specific eIF-5A, pHM6- eIF5 A2, or pHM6-truncated apoptosis-specific eIF-5A.
• the table depicts the percentage of cells undergoing apoptosis calculated based on the area under the peak of each gate. After correction for background apoptosis in untransfected cells and for transfection efficiency, 80% of cells transfected with pHM6-apoptosis-specific eIF-5A exhibited apoptosis.
• Cells transfected with pHM6-LacZ, pHM6-eIF5A2 or pHM6-truncated apoptosis-specific eIF-5 A exhibited only background levels of apoptosis
• Figure 43 provides Western blots of protein extracted from RKO cells treated with 0.25 ⁇ g/ml Actinomycin D for 0, 3, 7, 24, and 48 hours.
• the top panel depicts a Western blot using anti-p53 as the primary antibody.
• the middle panel depicts a Western blot using anti-apoptosis-specific eIF-5A as the primary antibody.
• the bottom panel depicts the membrane used for the anti-apoptosis-specific eIF-5A blot stained with Coomassie blue following chemiluminescent detection to demonstrate equal loading.
• p53 and apoptosis- specific eIF-5 A are both upregulated by treatment with Actinomycin D.
• Figure 44 is a bar graph showing that both apoptosis-specific eIF-5A and proliferation elF- 5A are expressed in heart tissue.
• the heart tissue was taken from patients receiving coronary artery bypass grafts ("CABG").
• CABG coronary artery bypass grafts
• Gene expression levels apoptosis-specific elF- 5A (light gray bar) are compared to proliferation eIF-5A (dark gray bar).
• the X-axis is patient identifier numbers.
• the Y-axis is pg/ng of 18s (picograms of message RNA over nanograms of ribosomal RNA 18S).
• Figure 45 is a bar graph showing that both apoptosis-specific eIF-5A and proliferation elF- 5 A are expressed in heart tissue.
• the heart tissue was taken from patients receiving valve replacements.
• Gene expression levels of apoptosis-specific eIF-5A (light gray bar) are compared to proliferation eIF-5A (dark gray bar).
• the X-axis is patient identifier numbers.
• the Y-axis is pg/ng of 18s (picograms of message RNA over nanograms of ribosomal RNA 18S).
• Figure 46 is a bar graph showing the gene expression levels measured by real-time PCR of apoptosis-specific eIF-5A (elf5a) versus proliferation eIF-5A (eIF5b) in pre-ischemia heart tissue and post ischemia heart tissue.
• the Y-axis is pg/ng of 18s (picograms of message RNA over nanograms of ribosomal RNA 18S).
• Figure 47 depicts schematically an experiment performed on heart tissue.
• the heart tissue was exposed to normal oxygen levels and the expression levels apoptosis-specific eIF-5A and proliferating eIF-5A measured. Later, the amount of oxygen delivered to the heart tissue was lowered, thus inducing hypoxia and ischemia, and ultimately, a heart attack in the heart tissue.
• the expression levels of apoptosis-specific eIF-5A and proliferating elF- 5 A were measured and compared to the expression levels of the heart tissue before it was damaged by ischemia.
• Figure 48 shows EKGs of heart tissue before and after the ischemia was induced.
• Figure 49 shows the lab bench with the set up of the experiment depicted in Figure 47.
• Figures 50A-F report patient data where the levels of apoptosis-specific eIF-5A are correlated with levels of IL- 1 ⁇ and IL- 18.
• Figure 50A is a chart of data obtained from coronary artery bypass graft (CABG) patients.
• Figure 50B is a chart of data obtained from valve replacement patients.
• Figure 50C is a graph depicting the correlation of apoptosis- specific eIF-5A to IL-18 in CABG patients.
• Figure 50D is a graph depicting the correlation of proliferating eIF-5A to IL-18 in CABG patients.
• Figure 50E is a graph depicting the correlation of apoptosis-specific eIF-5A to IL-18 in valve replacement patients.
• Figure 50F is a graph depicting the correlation of proliferating eIF-5A to IL-18 in valve replacement patients.
• Figure 51 is a chart of the patient's data from which patients data used in figures 50A-F was obtained.
• Figure 52 shows the levels of protein produced by RKO cells after being treated with antisense oligo 1, 2 and 3 (of apoptosis-specific eIF-5A)(SEQ ID NO: 35, 37 and 39, respectively).
• the RKO cells produced less apoptosis-specific eIF-5A as well as less p53 after having been transfected with the antisense apoptosis-specific eIF-5A oligonucleotides.
• Figure 53 shows uptake of the fluorescently labeled antisense oligonucleotide.
• Figures 54 -58 show a decrease in the percentage of cells undergoing apoptosis in the cells having being treated with antisense apoptosis-specific eIF-5A oligonucleotides as compared to cells not having been transfected with the antisense apoptosis-specific eIF-5A oligonucleotides.
• Figure 59 shows that treating lamina cribrosa cells with TNF- ⁇ and/or camptothecin caused an increase in the number of cells undergoing apoptosis.
• Figure 60 and 61 shows a decrease in the percentage of cells undergoing apoptosis in the cells having being treated with antisense apoptosis-specific eIF-5A oligonucleotides as compared to cells not having been transfected with the antisense apoptosis-specific eIF-5A oligonucleotides.
• Figure 62 shows that the lamina cribrosa cells uptake the labeled siRNA either in the presence of serum or without serum.
• Figure 63 shows that cells transfected with apoptosis-specific eIF-5 A siRNA produced less apoptosis-specific eIF-5A protein and in addition, produced more Bcl-2 protein. A decrease in apoptosis-specific eIF-5A expression correlates with an increase in BCL-2 expression.
• Figure 64 shows that cells transfected with apoptosis-specific eIF-5A siRNA produced less apoptosis factor 5a protein.
• Figures 65 -67 shows that cells transfected with apoptosis-specific eIF-5A siRNA had a lower percentage of cells undergoing apoptosis after exposure to amptothecin and TNF- ⁇ than untransfected cells.
• Figure 68 are photographs of Hoescht-stained lamina cribrosa cell line # 506 transfected with siRNA and treated with camptothecin and TNF- ⁇ from the experiment described in figure 67 and Example 13.
• the apoptosing cells are seen as more brightly stained cells. They have smaller nucleic because of chromatin condensation and are smaller and irregular in shape.
• Figure 69 shows that IL-1 exposed HepG2 cells transfected with apoptosis-specific eIF-5A cells secreted less TNF- ⁇ than non-transfected cells.
• Figure 70 shows the sequence of human apoptosis-specific eIF-5A (SEQ ID NO:29) and the sequences of 5 siRNAs of the present invention (SEQ ID NO:30, 31, 32, 33 and 34).
• Figure 71 shows the sequence of human apoptosis-specific eIF-5A (SEQ ID NO: 29) and the sequences of 3 antisense oligonucleotides of the present invention (SEQ ID NO:35, 37, and 39, respectively in order of appearance ).
• Figure 72 shows the binding position of three antisense oligonucleotides (SEQ ID NO:25- 27, respectively in order of appearance) targeted against human apoptosis-specific eIF-5 A.
• the full-length nucleotide sequence is SEQ ID NO: 19.
• Figure 73a and b shows the nucleotide alignment (SEQ ID NO: 41 and 42, respectively in order of appearance) and amino acid alignment (SEQ ID NO: 43 and 22, respectively in order of appearance) of human apoptosis-specific eIF-5A against human proliferating elF- 5A.
• Figure 74A provides a picture of a Western blot where siRNAs against apoptosis-specific eIF-5 A have reduced if not inhibited the production of TNF- ⁇ in transfected HT-29 cells.
• Figure 74B provides the results of an ELISA.
• Figure 75 provides the results of an ELISA. TNF- ⁇ production was reduced in cells treated with siRNAs against apoptosis-specific eIF-5A as compared to control cells.
• Figure 76 shows the time course of the U-937 differentiation experiment. See Example 16.
• Figure 77 shows the results of a Western blot showing that apoptosis-specific eIF-5A is up-regulated during monocyte differentiation and subsequence TNF- ⁇ secretion.
• Figure 78 depicts stem cell differentiation and the use of siRNAs against apoptosis- specific eIF-5A to inhibit cytokine production.
• Figure 79 is a bar graph showing that IL-8 is produced in response to TNF-alpha as well as in response to interferon. This graph shows that siRNA against apoptosis-specific eIF-5A blocked almost all IL-8 produced in response to interferon as well as a significant amount of the IL-8 produced as a result of the combined treatment of interferon and TNF.
• Figure 80 is another bar graph showing that IL-8 is produced in response to TNF-alpha as well as in response to interferon. This graph shows that siRNA against apoptosis-specific eIF-5A blocked almost all IL-8 produced in response to interferon as well as a significant amount of the IL-8 produced as a result of the combined treatment of interferon and TNF.
• Figure 81 is a western blot of HT-29 cells treated with IFN gamma for 8 and 24 hours. This blot shows up-regulation in HT-29 cells (4 fold at 8 hours) of against apoptosis- specific eIF-5A in response to interferon gamma.
• Figure 82 is a characterization of lamina cribrosa cells by immunofluorescence.
• Lamina cribrosa cells (# 506) isolated from the optic nerve head of an 83-year old male were characterized by immunofluorescence.
• Primary antibodies were a) actin; b) fibronectin; c) laminin; d) GFAP. All pictures were taken at 400 times magnification.
• Figure 83 is a graph showing percent apoptosis of lamina cribrosa cell line # 506 in response to treatment with camptothecin and TNF- ⁇ .
• Lamina cribrosa cell line # 506 cells were seeded at 40,000 cells per well onto an 8-well culture slide. Three days later the confluent LC cells were treated with either 10 ng/ml TNF- ⁇ , 50 ⁇ M camptothecin, or 10 ng/ml TNF- ⁇ plus 50 ⁇ M camptothecin.
• An equivalent volume of DMSO, a vehicle control for camptothecin was added to the untreated control cells.
• the cells were stained with Hoescht 33258 48 hours after treatment and viewed by fluorescence microscopy using a UV filter. Cells with brightly stained condensed or fragmented nuclei were counted as apoptotic.
• Figure 84 shows expression levels of against apoptosis-specific eIF-5A during camptothecin or TNF-a plus camptothecin treatment.
• Lamina cribrosa cell # 506 cells were seeded at 40,000 cells per well onto a 24-well plate. Three days later the LC cells were treated with either 50 ⁇ M camptothecin or 10 ng/ml TNF- ⁇ plus 50 ⁇ M camptothecin and protein lysate was harvested 1, 4, 8, and 24 hours later. An equivalent volume of DMSO was added to control cells as a vehicle control and cell lysate was harvested 1 and 24 hours later.
• Figure 85 shows expression levels of apoptosis-specific eIF-5A in lamina cribosa cell lines # 506 and # 517 following transfection with siRNAs.
• Lamina cribrosa cell # 506 and # 517 cells were seeded at 10,000 cells per well onto a 24-well plate.
• the LC cells were transfected with either GAPDH siRNA, apoptosis-specific eIF-5A siRNAs #1-4 (SEQ ID NO:30-33) or control siRNA # 5 (SEQ ID NO:34).
• the protein lysate was harvested and 5 ⁇ g of protein from each sample was separated by SDS-PAGE, transferred to a PVDF membrane, and Western blotted with anti-eIF5A antibody.
• Figure 86 shows the percent apoptosis of lamina cribosa cell line # 506 cells transfected with apoptosis-specific eIF-5A siRNAs and treated with TNF- ⁇ and camptothecin.
• Lamina cribrosa cell line # 506 cells were seeded at 7500 cells per well onto an 8-well culture slide. Three days later the LC cells were transfected with either GAPDH siRNA, apoptosis-specific eIF-5A siRNAs #1-4 (SEQ ID NO:30-33), or control siRNA # 5 (SEQ ID NO:34). 72 hours after transfection, the transfected cells were treated with 10 ng/ml TNF- ⁇ plus 50 ⁇ M camptothecin.
• Figure 87 shows percent apoptosis of lamina cribosa cell line # 517 cells transfected with apoptosis-specific eIF-5A siRNA # 1 and treated with TNF- ⁇ and camptothecin.
• Lamina cribrosa cell line # 517 cells were seeded at 7500 cells per well onto an 8-well culture slide. Three days later the LC cells were transfected with either apoptosis-specific eIF-5 A siRNA #1 (SEQ ID NO:30) or control siRNA # 5 (SEQ ID NO:34). 72 hours after transfection, the transfected cells were treated with 10 ng/ml TNF- ⁇ plus 50 ⁇ M camptothecin.
• Figure 88 shows TUNEL-labeling of lamina cribosa cell line # 506 cells transfected with apoptosis-specific eIF-5A siRNA # 1 and treated with TNF- ⁇ and camptothecin.
• Lamina cribrosa cell line # 506 cells were seeded at 7500 cells per well onto an 8-well culture slide. Three days later the LC cells were transfected with either apoptosis-specific eIF-5 A siRNA #1 (SEQ ID NO:30) or control siRNA # 5 (SEQ ID NO:34). 72 hours after transfection, the transfected cells were treated with 10 ng/ml TNF- ⁇ plus 50 ⁇ M camptothecin.
• TUNEL terminal deoxynucleotidyl transferase- mediated dUTP-digoxigenin nick end labeling
• Figure 89 depicts the design of siRNAs against apoptosis-specific eIF-5A.
• the siRNAs have the SEQ ID NO: 45, 48, 51, 54 and 56.
• the full-length nucleotide sequence is shown in SEQ ID NO: 29.
• Figure 90 shows the results of an experiment where siRNAs directed against apoptosis- specific eIF-5A provided for a reduction in NKkB activation in the presence of interferon gamma and LPS.
• Figure 91 shows the time course for PBMC experiments (see Example 18).
• Figure 92 shows a Western blot of a cell lysate from PBMCs collected from two donors over a time course. The PBMCs were treated with PMA and subsequently stimulated with LPS to have an increased apoptosis-specific eIF-5A expression.
• Figure 93 shows that PBMCs treated with PMA and subsequently stimulated with LPS have an increased apoptosis-specific eIF-5A expression, which coincides with increased TNF production.
• Figure 94 demonstrates that PBMCs respond to LPS without PMA differentiation.
• Figure 95 shows that PBMCs transfected with apoptosis-specific eIF-5A siRNAs demonstrate suppression of expression of apoptosis-specific eIF-5A.
• Figure 96 shows that PBMCs transfected with apoptosis-specific eIF-5A siRNAs and stimulated with LPS produce less TNF than PBMCs not transfected with apoptosis- specific eIF-5A siRNAs.
• Figure 97 shows a western blot of cell lysate from HT-29 cells treated with or without gamma interferon.
• Figure 98 shows a western blot of cell lysate from HT-29 cells that were transfected with either control siRNA or apoptosis-specific eIF-5 A siRNAs. This figure shows that siRNAs of apoptosis-specific eIF-5A inhibit expression of apoptosis-specific eIF-5A.
• Figure 99 shows that HT-29 cells transfected with apoptosis-specific eIF-5A siRNAs have a reduced level of TNF production.
• Figure 100 shows that HT-29 cells transfected with apoptosis-specific eIF-5A siRNAs exhibit a decreased in apoptosis as compared to control cells. Both control and siRNA- transfected cells were primed with interferon gamma and also treated with TNF- ⁇ .
• Figure 101 shows that HT-29 cells transfected with apoptosis-specific eIF-5A siRNAs express less TLR4 protein than control cells.
• Figure 102 shows that HT-29 cells transfected with apoptosis-specific eIF-5A siRNAs express less TNFR1 protein than control cells.
• Figure 103 shows that HT-29 cells transfected with apoptosis-specific eIF-5A siRNAs express less iNOS protein than control cells.
• Figure 104 shows that HT-29 cells transfected with apoptosis-specific elF-5A siRNAs express less TLR4 mRNA than control cells.
• Figure 105 shows the time course for U937 treatments.
• Figure 106 shows that apoptosis-specific eIF-5A is upregulated with PMA in U937 cells.
• Figure 107 shows that apoptosis-specific eIF-5A is upregulated with LPS in U937 cells.
• Figure 108 shows that apoptosis-specific eIF-5A protein expression is still reduced after numerous hours following siRNA treatment.
• Figure 109 shows that siRNA mediated down-regulation of apoptosis-specific eIF-5A coincides with a reduction of TLR4.
• Figure 110 shows that siRNA mediated down-regulation of apoptosis-specific eIF-5A coincides with fewer glycosylated forms of the interferon gamma receptor in U937 cells.
• Figure 111 shows that siRNA mediated down-regulation of apoptosis-specific eIF-5A coincides with a reduction in TNFR1 in U937 cells.
• Figure 112 shows that siRNA mediated down-regulation of apoptosis-specific eIF-5A coincides with a reduction in LPS-induced TNF- ⁇ production in U937 cells.
• Figure 113 shows that siRNA mediated down-regulation of apoptosis-specific eIF-5A coincides with a reduction in LPS-induced IL-l ⁇ production in U937 cells.
• Figure 114 shows that siRNA mediated down-regulation of apoptosis-specific eIF-5A coincides with a reduction in LPS-induced IL-8 production in U937 cells.
• Figure 115 shows that IL-6 production is independent of siRNA mediated down-regulation of apoptosis-specific eIF-5A in U937 cells.
• eIF-5A eukaryotic initiation factor 5 A
• the subject of the present invention is apoptosis-specific elF- 5 A and DHS, which is involved in the activation of eIF-5A.
• Apoptosis-specific eIF-5A is likely to be a suitable target for intervention in apoptosis-causing disease states since it appears to act at the level of post-transcriptional regulation of downstream effectors and transcription factors involved in the apoptotic pathway.
• apoptosis-specific eIF-5A appears to selectively facilitate the translocation of mRNAs encoding downstream effectors and transcription factors of apoptosis from the nucleus to the cytoplasm, where they are subsequently translated.
• the present invention provides a method of suppressing or reducing apoptosis in a cell by administering an agent that inhibits or reduces expression of either apoptosis-specific eIF-5A or DHS.
• One agent that can inhibit or reduce expression of apoptosis-specific eIF-5A or DHS are antisense oligonucleotides of apoptosis-specific eIF-5A or DHS.
• antisense oligonucleotides By reducing activation of apoptosis-specific eIF-5A or by reducing or inhibiting expression of apoptosis-specific eIF-5A, cellular apoptosis can be delayed or inhibited.
• Antisense oligonucleotides have been successfully used to accomplish both in vitro as well as in vivo gene-specific suppression.
• Antisense oligonucleotides are short, synthetic strands of DNA (or DNA analogs), RNA (or RNA analogs), or DNA/RNA hybrids that are antisense (or complimentary) to a specific DNA or RNA target. Antisense oligonucleotides are designed to block expression of the protein encoded by the DNA or RNA target by binding to the target mRNA and halting expression at the level of transcription, translation, or splicing.
• antisense oligonucleotides By using modified backbones that resist degradation (Blake et al, 1985), such as replacement of the phosphodiester bonds in the oligonucleotides with phosphorothioate linkages to retard nuclease degradation (Matzura and Eckstein, 1968), antisense oligonucleotides have been used successfully both in cell cultures and animal models of disease (Hogrefe, 1999). Other modifications to the antisense oligonucleotide to render the oligonucleotide more stable and resistant to degradation are known and understand by one skilled in the art.
• Antisense oligonucleotide as used herein encompasses double stranded or single stranded DNA, double stranded or single stranded RNA, DNA/RNA hybrids, DNA and RNA analogs, and oligonucleotides having base, sugar, or backbone modifications.
• the oligonucleotides may be modified by methods known in the art to increase stability, increase resistance to nuclease degradation or the like. These modifications are known in the art and include, but are not limited to modifying the backbone of the oligonucleotide, modifying the sugar moieties, or modifying the base.
• the antisense oligonucleotides of the present invention have a nucleotide sequence encoding a portion or the entire coding sequence of an apoptosis- specific eIF-5A polypeptide or a DHS polypeptide.
• the inventors have transfected various cell lines with antisense nucleotides encoding a portion of an apoptosis-specific eIF-5A polypeptide as described below and measured the number of cells undergoing apoptosis.
• the cell populations that were transfected with the antisense oligonucleotides showed a decrease in the number of cells undergoing apoptosis as compared to like cell populations not having been transfected with the antisense oligos.
• Figures 54 -58 show a decrease in the percentage of cells undergoing apoptosis in the cells having being treated with antisense apoptosis-specific eIF-5A oligonucleotides as compared to cells not having been transfected with the antisense apoptosis-specific eIF-5A oligonucleotides.
• the present invention contemplates the use of many suitable nucleic acid sequences encoding an apoptosis-specific eIF-5A polypeptide or DHS polypeptide.
• the present invention provides antisense oligonucleotides of the following apoptosis-specific eIF-5A nucleic acid sequences (SEQ ID NOS:l, 3, 4, 5, 11, 12, 15, 16, 19, 20, and 21) and DHS sequences (SEQ ID NOS:6, 7, 8).
• Antisense oligonucleotides of the present invention need not be the entire length of the provided SEQ ID NOs. They need only be long enough to be able to bind to the mRNA and inhibit expression of such mRNA.
• “Inhibition or reduction of expression” or “suppression of expression” refers to the absence or detectable decrease in the level of protein and/or mRNA product from a target gene, such as apoptosis-specific eIF-5A.
• exemplary antisense oligonucleotides of apoptosis-specific eIF-5 A that do not comprise the entire coding sequence are antisense oligonucleotides of apoptosis-specific eIF-5A having the following SEQ ID NO: 35, 37, and 39.
• Antisense oligonucleotide of apoptosis-specific eIF-5A includes oligonucleotides having substantial sequence identity or substantial homology to apoptosis-specific eIF-5 A. Additional antisense oligonucleotides of apoptosis-specific eIF-5A of the present invention include those that have substantial sequence identity to those enumerated above (i.e. 90%) homology) or those having sequences that hybridize under highly stringent conditions to the enumerated SEQ ID NOs. As used herein, the term “substantial sequence identity” or “substantial homology” is used to indicate that a sequence exhibits substantial structural or functional equivalence with another sequence.
• any structural or functional differences between sequences having substantial sequence identity or substantial homology will be de minimus; that is, they will not affect the ability of the sequence to function as indicated in the desired application. Differences may be due to inherent variations in codon usage among different species, for example. Structural differences are considered de minimus if there is a significant amount of sequence overlap or similarity between two or more different sequences or if the different sequences exhibit similar physical characteristics even if the sequences differ in length or structure. Such characteristics include, for example, the ability to hybridize under defined conditions, or in the case of proteins, immunological crossreactivity, similar enzymatic activity, etc. The skilled practitioner can readily determine each of these characteristics by art known methods.
• two nucleotide sequences are "substantially complementary” if the sequences have at least about 70 percent or greater, more preferably 80 percent or greater, even more preferably about 90 percent or greater, and most preferably about 95 percent or greater sequence similarity between them.
• Two amino acid sequences are substantially homologous if they have at least 70%, more preferably at least 80%>, even more preferably at least 90%, and most preferably at least 95%> similarity between the active, or functionally relevant, portions of the polypeptides.
• the sequences are aligned for optimal comparison pu ⁇ oses (e.g., gaps can be introduced in one or both of a first and a second amino acid or nucleic acid sequence for optimal alignment and non-homologous sequences can be disregarded for comparison pu ⁇ oses).
• at least 30% 40%, 50%, 60%, 70%, 80%, or 90% or more of the length of a reference sequence is aligned for comparison pu ⁇ oses.
• the amino acid residues or nucleotides at corresponding amino acid positions or nucleotide positions are then compared.
• amino acid or nucleic acid “identity” is equivalent to amino acid or nucleic acid "homology”
• the percent identity between the two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps, and the length of each gap, which need to be introduced for optimal alignment of the two sequences.
• the comparison of sequences and determination of percent identity and similarity between two sequences can be accomplished using a mathematical algorithm.
• nucleic acid and protein sequences of the present invention can further be used as a "query sequence" to perform a search against sequence databases to, for example, identify other family members or related sequences. Such searches can be performed using the NBLAST and XBLAST programs (version 2.0) of Altschul, et al. (1990) J.
• BLAST nucleotide searches can be performed with the NBLAST program.
• BLAST protein searches can be performed with the XBLAST program to obtain amino acid sequences homologous to the proteins of the invention.
• Gapped BLAST can be utilized as described in Altschul et al. (1997) Nucleic Acids Res. 25(17):3389-3402.
• the default parameters of the respective programs e.g., XBLAST and NBLAST
• the term "apoptosis-specific eIF-5A" includes functional derivatives thereof.
• apoptosis-specific eIF-5A polypeptide or functional derivatives of antisense oligonucleotides of apoptosis-specific eIF-5A as described herein are fragments, variants, analogs, or chemical derivatives of apoptosis-specific eIF-5A that retain Apoptosis-specific eIF-5 A activity or immunological cross reactivity with an antibody specific for apoptosis-specific eIF-5A.
• a fragment of the apoptosis-specific eIF-5A polypeptide refers to any subset of the molecule.
• Functional variants can also contain substitutions of similar amino acids that result in no change or an insignificant change in function.
• Amino acids that are essential for function can be identified by methods known in the art, such as site-directed mutagenesis or alanine-scanning mutagenesis (Cunningham et al. (1989) Science 244:1081-1085). The latter procedure introduces single alanine mutations at every residue in the molecule. The resulting mutant molecules are then tested for biological activity such as kinase activity or in assays such as an in vitro proliferative activity.
• Sites that are critical for binding partner/substrate binding can also be determined by structural analysis such as crystallization, nuclear magnetic resonance or photoaffmity labeling (Smith et al. (1992) J. Mol. Biol. 224:899-904; de Vos et al. (1992) Science 255:306-312).
• a “variant” refers to a molecule substantially similar to either the entire gene or a fragment thereof, such as a nucleotide substitution variant having one or more substituted nucleotides, but which maintains the ability to hybridize with the particular gene or to encode mRNA transcript which hybridizes with the native DNA.
• a “homolog” refers to a fragment or variant sequence from a different animal genus or species.
• an "analog” refers to a non-natural molecule substantially similar to or functioning in relation to the entire molecule, a variant or a fragment thereof.
• Variant peptides include naturally occurring variants as well as those manufactured by methods well known in the art. Such variants can readily be identified/made using molecular techniques and the sequence information disclosed herein. Further, such variants can readily be distinguished from other proteins based on sequence and/or structural homology to the eIF-5A or DHS proteins of the present invention. The degree of homology/identity present will be based primarily on whether the protein is a functional variant or non-functional variant, the amount of divergence present in the paralog family and the evolutionary distance between the orthologs.
• Non-naturally occurring variants of the eIF-5A or DHS polynucleotides, antisense oligonucleotides, or proteins of the present invention can readily be generated using recombinant techniques.
• Such variants include, but are not limited to deletions, additions and substitutions in the nucleotide or amino acid sequence.
• one class of substitutions are conserved amino acid substitutions.
• Such substitutions are those that substitute a given amino acid in a protein by another amino acid of like characteristics.
• conservative substitutions are the replacements, one for another, among the aliphatic amino acids Ala, Val, Leu, and He; interchange of the hydroxyl residues Ser and Thr; exchange of the acidic residues Asp and Glu; substitution between the amide residues Asn and Gin; exchange of the basic residues Lys and Arg; and replacements among the aromatic residues Phe and Tyr.
• Guidance concerning which amino acid changes are likely to be phenotypically silent are found in Bowie et al., Science 247:1306- 1310 (1990).
• hybridization is generally used to mean hybridization of nucleic acids at appropriate conditions of stringency as would be readily evident to those skilled in the art depending upon the nature of the probe sequence and target sequences.
• Conditions of hybridization and washing are well known in the art, and the adjustment of conditions depending upon the desired stringency by varying incubation time, temperature and/or ionic strength of the solution are readily accomplished. See, e.g. Sambrook, J. et al., Molecular Cloning: A Laboratory Manual, 2 nd edition, Cold Spring Harbour Press, Cold Spring Harbor, New York, 1989.
• the choice of conditions is dictated by the length of the sequences being hybridized, in particular, the length of the probe sequence, the relative G-C content of the nucleic acids and the amount of mismatches to be permitted.
• Low stringency conditions are preferred when partial hybridization between strands that have lesser degrees of complementarity is desired.
• high stringency conditions are preferred.
• High stringency conditions means that the hybridization solution contains 6X S.S.C., 0.01 M EDTA, IX Denhardt's solution and 0.5% SDS.
• Hybridization is carried out at about 68°C for about 3 to 4 hours for fragments of cloned DNA and for about 12 to 16 hours for total eucaryotic DNA.
• the temperature of hybridization is reduced to about 42° C below the melting temperature (T m ) of the duplex.
• T m is known to be a function of the G-C content and duplex length as well as the ionic strength of the solution.
• the phrase "hybridizes to a corresponding portion" of a DNA or RNA molecule means that the molecule that hybridizes, e.g., oligonucleotide, polynucleotide, or any nucleotide sequence (in sense or antisense orientation) recognizes and hybridizes to a sequence in another nucleic acid molecule that is of approximately the same size and has enough sequence similarity thereto to effect hybridization under appropriate conditions.
• a 100 nucleotide long sense molecule will recognize and hybridize to an approximately 100 nucleotide portion of a nucleotide sequence, so long as there is about 70% or more sequence similarity between the two sequences.
• the size of the "corresponding portion” will allow for some mismatches in hybridization such that the "corresponding portion” may be smaller or larger than the molecule which hybridizes to it, for example 20-30% larger or smaller, preferably no more than about 12-15% larger or smaller.
• functional variants of polypeptides can also contain substitution of similar amino acids that result in no change or an insignificant change in function.
• Amino acids that are essential for function can be identified by methods known in the art, such as site-directed mutagenesis or alanine-scanning mutagenesis (Cunningham et al., Science 244:1081-1085 (1989)). The latter procedure introduces single alanine mutations at every residue in the molecule. The resulting mutant molecules are then tested for biological activity or in assays.
• the present invention also provides other agents that can inhibit or reduce expression of apoptosis-specific eIF-5A or DHS.
• One such agent includes small inhibitory RNAs ("siRNA").
• siRNA technology has been emerging as a viable alternative to antisense oligonucleotides since lower concentrations are required to achieve levels of suppression that are equivalent or superior to those achieved with antisense oligonucleotides (Thompson, 2002).
• Long double-stranded RNAs have been used to silence the expression of specific genes in a variety of organisms such as plants, nematodes, and fruit flies.
• An RNase-III family enzyme called Dicer processes these long double stranded RNAs into 21-23 nucleotide small interfering RNAs which are then inco ⁇ orated into an RNA-induced silencing complex (RISC).
• RISC RNA-induced silencing complex
• siRNA Unwinding of the siRNA activates RISC and allows the single-stranded siRNA to guide the complex to the endogenous mRNA by base pairing. Recognition of the endogenous mRNA by RISC results in its cleavage and consequently makes it unavailable for translation. Introduction of long double stranded RNA into mammalian cells results in a potent antiviral response, which can be bypassed by use of siRNAs. (Elbashir et al, 2001). siRNA has been widely used in cell cultures and routinely achieves a reduction in specific gene expression of 90 % or more. The use of siRNAs has also been gaining popularity in inhibiting gene expression in animal models of disease.
• siRNA has the potential to be a very potent drug for the inhibition of specific gene expression in vitro in light of their long-lasting effectiveness in cell cultures and their ability to transfect cells in vivo and their resistance to degradation in serum in vivo (Bertrand et al, 2002) in vivo.
• the present inventors have transfected cells with siRNAs of apoptosis-specific eIF-5A and studied the effects on expression of apoptosis-specific eIF-5A.
• Figure 64 shows that cells transfected with apoptosis-specific eIF-5A siRNA produced less apoptosis-specific eIF-5A protein.
• Figures 65-67 show that cell populations transfected with apoptosis-specific eIF-5A siRNAs have a lower percentage of cells undergoing apoptosis after exposure to amptothecin and TNF- ⁇ as compared to cells not having been transfected with apoptosis-specific eIF-5A siRNAs.
• one embodiment of the present invention provides for inhibiting expression of apoptosis-specific eIF-5A in cells by transfecting the cells with a vector comprising a siRNAs of apoptosis-specific eIF-5A.
• siRNAs of apoptosis-specific eIF-5A include those that have SEQ ID NO: 31, 31, 32, and 33. Additional siRNAs include those that have substantial sequence identity to those enumerated (i.e. 90%) homology) or those having sequences that hybridize under highly stringent conditions to the enumerated SEQ ID NOs. What is meant by substantial sequence identity and homology is described above with respect to antisense oligonucleotides of the present invention.
• the term "siRNAs of apoptosis-specific elF- 5A" include functional variants or derivatives as described above with respect to antisense oligonucleotides of the present invention.
• siRNA and expression constructs/vectors comprising siRNA are known by those skilled in the art.
• U.S. applications 2004/106567 and 2004/0086884, which are herein inco ⁇ orated by reference in their entirety, provide numerous expression constructs/vectors as well as delivery mechanism including viral vectors, non viral vectors, liposomal delivery vehicles, plasmid injection systems, artificial viral envelopes and poly- lysine conjugates to name a few.
• regulatory sequences useful in expression constructs/vectors with antisense oligonucleotides or siRNA may be a constitutive promoter, an inducible promoter, a tissue-specific promoter, or a combination thereof.
• the methods and compositions of the present invention can be used to prevent or treat the following apoptosis-associated diseases and disorders: neurological/ neurodegenerative disorders (e.g., Alzheimer's, Parkinson's, Huntington's, Amyotrophic Lateral Sclerosis (Lou Gehrig's Disease), autoimmune disorders (e.g., rheumatoid arthritis, systemic lupus erythematosus (SLE), multiple sclerosis), Duchenne Muscular Dystrophy (DMD), motor neuron disorders, ischemia, heart ischemia, chronic heart failure, stroke, infantile spinal muscular atrophy, cardiac arrest, renal failure, atopic dermatitis, sepsis and septic shock, AIDS, hepatitis, glaucoma
• Glaucoma is a group of eye conditions arising from damage to the optic nerve that results in progressive blindness. Apoptosis has been shown to be a direct cause of this optic nerve damage.
• IOP intraocular pressure
• TNF- ⁇ tumor necrosis factor- ⁇
• iNOS inducible form of nitric oxide synthase
• HVJ inactivated hemagglutinating virus of Japan
• HVJ liposomes Intravitreal injection into mice of FITC-labeled antisense oligonucleotides encapsulated in HVJ liposomes resulted in high fluorescence within 44 %> of the cells in the ganglion layer which lasted three days while fluorescence with naked FITC-labeled antisense oligonucleotide disappeared after one day.
• One method of preventing or reducing apoptosis of the present invention is directed to preventing or reducing apoptosis in cells and tissues of the eye, such as but not limited to, astrocytes, retinal ganglion, retinal glial cells and lamina cribosa. Death of retinal ganglion cells in glaucoma occurs by apoptosis and which leads to blindness.
• providing a method of inhibiting or reducing apoptosis in retinal ganglion cells or by protecting retinal ganglion cells from degeneration by apoptosis provides a novel treatment for prevention of blindness due to glaucoma.
• the present invention provides a method for preventing or inhibiting retinal ganglion cell death in a glaucomatous eye, by suppressing expression of apoptosis-specific eIF-5A. Inhibiting the expression of apoptosis-specific eIF-5A reduces apoptosis.
• Apoptosis-specific eIF-5A is a powerful gene that appears to regulate the entire apoptotic process. Thus, controlling apoptosis in the optic nerve head indicates that blocking expression of apoptosis-specific eIF-5A provides a treatment for glaucoma.
• Suppression of expression of apoptosis-specific eIF-5A is accomplished by administering an antisense oligonucleotides or a siRNA of human apoptosis-specific elF- 5 A to cells of the eye such as, but not limited to lamina cribrosa, astrocytes, retinal ganglion, or retinal glial cells.
• Antisense oligonucleotides and siRNAs are as defined above, i.e. have a nucleotide sequence encoding at least a portion of an apoptosis-specific eIF-5A polypeptide.
• Exemplary antisense oligonucleotides useful in this aspect of the invention comprise SEQ ID NO:26 or 27 or oligonucleotides that bind to a sequence complementary to SEQ ID NO:26 or 27 under high stringency conditions and which inhibit expression of apoptosis-specific eIF-5A.
• Another embodiment of the invention provides a method of suppressing expression of apoptosis-specific eIF-5A in lamina cribosa cells, astrocyte cells, retinal ganglion cells or retinal glial cells.
• Antisense oligonucleotides or siRNAs such as but not limited to,
• SEQ ID NO:26 and 27 targeted against human apoptosis-specific eIF-5A are administered to lamina cribosa cells, astrocyte cells, retinal ganglion cells or retinal glial cells.
• the cells may be of human origin.
• eIF5A may also play a role in the immune response.
• the present inventors have discovered that apoptosis-specific eIF-5A levels correlate with elevated levels of two cytokines (Interleukin 1-beta "IL-l ⁇ " and interleukin 18 "IL-18”) in ischemic heart tissue, thus further proving that apoptosis-specific eIF-5A is involved in cell death as it is present in ischemic heart tissue.
• apoptosis-specific eIF-5A The correlation of apoptosis-specific eIF-5A to these potent interleukins further suggests that the inflammation and apoptosis pathways in ischemia may be controlled via controlling levels of apoptosis-specific eIF-5A. Further evidence that apoptosis-specific eIF-5 A is involved in the immune response is suggested by the fact that human peripheral blood mononuclear cells (PBMCs) normally express very low levels of eIF-5 A, but upon stimulation with T-lymphocyte-specific stimuli expression of apoptosis-specific eIF-5A increases dramatically (Bevec et al, 1994). This suggests a role for apoptosis-specific eIF-5A in T-cell proliferation and/or activation.
• PBMCs peripheral blood mononuclear cells
• eIF-5A may be required as a nucleocytoplasmic shuttle for cytokine mRNAs.
• the authors of the above referenced article also found elevated levels of eIF5A in the PBMCs of HIV- 1 patients which may contribute to efficient HIV replication in these cells as eIF5A has been demonstrated to be a cellular binding factor for the HIV Rev protein and required for HIV replication (Ruhl et al, 1993). More recently, eIF-5A expression was found to be elevated during dendritic cell maturation (Kruse et al, 2000).
• Dendritic cells are antigen-presenting cells that sensitize helper and killer T cells to induce T cell-mediated immunity (Steinman, 1991). Immature dendritic cells lack the ability to stimulate T cells and require appropriate stimuli (i.e. inflammatory cytokines and/or microbial products) to mature into cells capable of activating T cells.
• eIF5A may facilitate dendritic cell maturation by acting as a nucleocytoplasmic shuttle for CD83 mRNA.
• the present invention relates to controlling the expression of apoptosis-specific eIF-5A to control the rate of dendritic cell maturation and PBMC activation, which in turn may control the rate of T cell-mediated immunity.
• U-937 is known to express eIF-5A mRNA (Bevec et al., 1994).
• U-937 is a human monocyte cell line that grows in suspension and will become adherent and differentiate into macrophages upon stimulation with PMA. When PMA is removed by changing the media, the cells become quiescent and are then capable of producing cytokines (Barrios-Rodiles et al., J. Immunol., 163:963-969 (1999)).
• one aspect of the invention provides for a method of inhibiting or delaying maturation of macrophages to inhibit or reduce the production of cytokines.
• This method involves providing an agent that is capable of reducing the expression of either DHS or apoptosis- specific eIF-5A.
• DHS apoptosis-specific elF- 5A activation will be reduced or eliminated. Since, apoptosis-specific eIF-5A is upregulated during monocyte differentiation and TNF- ⁇ secretion, it is believed that it is necessary for these events to occur.
• apoptosis-specific eIF-5 A by reducing or eliminating activation of apoptosis-specific eIF-5 A or by directly reducing or eliminating apoptosis-specific eIF-5 A expression, monocyte differentiation and TNF- ⁇ secretion can be reduced or eliminated.
• Any agent capable of reducing the expression of DHS or apoptosis-specific eIF-5A may be used and includes, but is not limited to antisense oligonucleotides or siRNAs as described herein.
• the present inventors have studied the ability of human apoptosis-specific eIF-5A to promote translation of cytokines by acting as a nucleocytoplasmic shuttle for cytokine mRNAs in vitro using a cell line known to predictably produce cytokine(s) in response to a specific stimulus. Some recent studies have found that human liver cell lines can respond to cytokine stimulation by inducing production of other cytokines. HepG2 is a well characterized human hepatocellular carcinoma cell line found to be sensitive to cytokines.
• HepG2 cells In response to IL-1 ⁇ , HepG2 cells rapidly produce TNF- ⁇ mRNA and protein in a dose-dependent manner (Frede et al., 1996; Rowell et al., 1997; Wordemann et al., 1998). Thus, HepG2 cells were used as a model system to study the regulation of TNF- ⁇ production. The present inventors have shown that inhibition of human apoptosis-specific eIF-5A expression in HepG2 cells caused the cells to produce less TNF- ⁇ after having been transfected with antisense oligonucleotide of directed toward apoptosis factor 5 A. Thus one embodiment of the present invention provides a method for reducing levels of a cytokine.
• the method involves administering an agent capable of reducing expression of apoptosis factor 5A1. Reducing expression of apoptosis factor 5A1 also reduces expression of the cytokine and thus leads to a decreased amount of the cytokine produced by cell.
• the cytokine is a preferably a pro-inflammatory cytokine, including, but not limited to IL-1, IL-18, IL-6 and TNF- ⁇ . Antisense oligonucleotides are as discussed above.
• Exemplary antisense oligonucleotides of human apoptosis-specific eIF-5A are selected from the group consisting of SEQ ID NO: 35, 37, and 39 or is an antisense nucleotide that hybridizes under highly stringent conditions to a sequence selected from the group consisting of SEQ ID NO: 35, 37, and 39.
• An agent may also comprise a siRNA of human apoptosis-specific eIF-5A and are as discussed above.
• Exemplary siRNAs have a sequence selected from the group consisting of SEQ ID NO: 30, 31, 32 and 33 or is a siRNA that hybridizes under highly stringent conditions to a sequence selected from the group consisting of SEQ ID NO: 30, 31, 32 and 33.
• Figures 65 -67 show that cells transfected with human apoptosis-specific eIF-5A siRNAs have a lower percentage of cells undergoing apoptosis after exposure to amptothecin and TNF- ⁇ .
• the present invention is also directed to a method for reducing the expression of p53. This method involves administering an agent capable of reducing expression of apoptosis factor 5A, such as the antisense oligonucleotides or the siRNAs described above. Reducing expression of apoptosis-specific eIF-5A reduces expression of p53 as shown in figure 52 and example 10.
• the present invention is also directed to a method for increasing the expression of Bcl-2.
• This method entails administering an agent capable of reducing expression of human apoptosis-specific eIF-5A.
• Preferred agents include antisense oligonucleotides and siRNAs described above. Reducing expression of apoptosis-specific eIF-5 A increases expression of Bcl-2 as shown in figure 63 and example 13.
• Figure 63 shows that cells transfected with apoptosis-specific eIF-5A siRNA produced less apoptosis-specific eIF-5A protein and in addition, produced more Bcl-2 protein.
• a decrease in apoptosis-specific eIF-5A expression correlates with an increase in BCL-2 expression.
• the present invention also provides a method for reducing levels of TNF-alpha in a patient in need thereof comprising administering to said patient either antisense oligonucleotide or siRNAs of apoptosis-specific eIF-5A as described above.
• apoptosis-specific eIF-5A as described above.
• cells transfected with antisense apoptosis- specific eIF-5A oligonucleotides of the present invention produced less TNF- ⁇ after induction with IL-1 than cells not transfected with such antisense oligonucleotides.
• the present invention provides a method of treating pathological conditions characterized by an increased IL-1, TNF-alpha, IL-6 1 or IL-18 level comprising administering to a mammal having said pathological condition, agents to reduce expression of apoptosis-specific eIF-5A as described above (antisense oligonucleotides and siRNA).
• agents to reduce expression of apoptosis-specific eIF-5A as described above antisense oligonucleotides and siRNA.
• 11-6 levels include, but are not limited to arthritis-rheumatoid and osteo arthritis, asthma, allergies, arterial inflammation, crohn's disease, inflammatory bowel disease, (ibd), ulcerative colitis, coronary heart disease, cystic fibrosis, diabetes, lupus, multiple sclerosis, graves disease, periodontitis, glaucoma & macular degeneration, ocular surface diseases including keratoconus, organ ischemia- heart, kidney, repurfusion injury, sepsis, multiple myeloma, organ transplant rejection, psoriasis and eczema.
• reducing expression of apoptosis-specific eIF-5A with the antisense oligonucleotids, siRNAs and methods of the present invention may provide relief from these pathological conditions.
• the present invention also provides a method of delivering siRNA to mammalian lung cells in vivo.
• siRNAs directed against apoptosis-specific eIF-5A were administered intranasally (mixed with water) to mice. 24 hours after administration of the siRNA against apoptosis-specific eIF-5A, lipopolysaccharide (LPS) was administered intranasally to the mice. After another 24 hours, the right lung was removed and myeloperoxidase was measured.
• LPS lipopolysaccharide
• the results of this study show that siRNA can be delivered successfully in vivo to lung tissue in mammals, and that siRNA directed against apoptosis-specific eIF-5A inhibits the expression of apoptosis-specific eIF-5A resulting in a suppression of myeloperoxidase production.
• Myeloperoxidase (“MPO") is a lysosomal enzyme that is found in neutrophils.
• the myeloperoxidase is an enzyme that uses hydrogen peroxidase to convert chloride to hypochlorous acid.
• the hypochlorous acid reacts with and destroys bacteria. Myeloperoxidase is also produced when arteries are inflamed. Thus, it is clear that myeloperoxidase is associated with neutrophils and the inflammation response.
• the present inventors have shown that by down regulating apoptosis-specific eIF-5A with siRNAs shows a marked decrease in the myeloperoxidase in lung tissue after exposed to LPS (which normally produces an inflammatory response involving the production of myeloperoxidase). Thus, the present inventors have shown that using siRNAs against apoptosis-specific eIF-5A can decrease or suppress the amount of myeloperoxidase in lung tissue and thus decrease or suppress the inflammation response.
• LPS is a macromolecular cell surface antigen of bacteria that when applied in vivo triggers a network of inflammatory responses. Intranasally delivering LPS causes an increase in the number of neutrophils in the lungs. One of the primary events is the activation of mononuclear phagocytes through a receptor-mediated process, leading to the release of a number of cytokines, including TNF- ⁇ . In turn, the increased adherence of neutrophils to endothelial cells induced by TNF- ⁇ leads to massive infiltration in the pulmonary space.
• siRNAs against apoptosis-specific eIF-5A an suppress the production of myeloperoxidase (i.e. part of the inflammation response).
• the inventors have also shown that it is possible to deliver siRNAs in vivo to lung tissue by simple intranasal delivery.
• the siRNAs were mixed only in water. This presents a major breakthrough and discovery as others skilled in the art have attempted to design acceptable delivery methods for siRNA.
• MPO levels are a critical predictor of heart attacks and cytokine-induced inflammation caused by autoimmune disorders.
• mice were similarly treated with siRNAs directed against apoptosis-specific eIF-5A.
• Lipopolysaccharide (LPS) was administered to the mice to induce inflammation and an immune system response. Under control conditions, LPS kills thymocytes, which are important immune system precursor cells created in the thymus to fend off infection.
• LPS Lipopolysaccharide
• NFkB NFk beta
• NFk beta is a major cell-signaling molecule for inflammation — its activation induces the expression of COX-2, which leads to tissue inflammation.
• the expression of the COX-2-encoding gene believed to be responsible for the massive production of prostaglandins at inflammatory sites, is transcriptionaly regulated by NFkB.
• NFkB resides in the cytoplasm of the cell and is bound to its inhibitor. Injurious and inflammatory stimuli release NFkB from the inhibitor. NFkB moves into the nucleus and activates the genes responsible for expressing COX-2.
• inflammation can be reduced.
• HT-29 cells human epithelial cells
• siRNA targeted at apoptosis-specific eIF-5A Inflammation was then induced by NFkB by addition of TNF or interferon gamma and LPS for one hour.
• the results of this experiment show that inhibiting the expression of apoptosis-specific eIF-5A with siRNAs provided for a reduction in the levels of NFkB that were activated by the gamma interferon and LPS. See figure 74.
• One embodiment of the present invention provides methods of inhibition expression of endogenous apoptosis-specific eIF-5A in a cell.
• Inhibiting expression is preferably carried out by the use of antisense polynucleotides or siRNAs of apoptosis- specific eIF-5A of the present invention described previously.
• antisense polynucleotides or siRNAs of apoptosis- specific eIF-5A of the present invention described previously.
• various effects on the cell result. For example, a reduction in expression of the various proteins, factors, receptors, cytokines are seen: p53; pro-inflammatory cytokines (See FIG 112, 113, 114); myeloperoxidase; active NFk beta; TLR4 (See FIG. 109); TNFR-1 (See FIG. 111) and iNOS.
• RNAs of the present invention where used in an animal for the pu ⁇ ose of prophylaxis or treatment, will be administered in the form of a composition additionally comprising a pharmaceutically acceptable carrier.
• suitable pharmaceutically acceptable carriers include, for example, one or more of water, saline, phosphate buffered saline, dextrose, glycerol, ethanol and the like, as well as combinations thereof.
• compositions of the injection can, as is well known in the art, be formulated so as to provide quick, sustained or delayed release of the active ingredient after administration to the mammal.
• the compositions of this invention can be in a variety of forms. These include, for example, solid, semi-solid and liquid dosage forms, such as tablets, pills, powders, liquid solutions, dispersions or suspensions, liposomes, suppositories, injectable and infusible solutions. The preferred form depends on the intended mode of administration and therapeutic application.
• Such compositions can be prepared in a manner well known in the pharmaceutical art.
• the active ingredient will usually be mixed with a carrier, or diluted by a carrier, and/or enclosed within a carrier which can, for example, be in the form of a capsule, sachet, paper or other container.
• a carrier which can, for example, be in the form of a capsule, sachet, paper or other container.
• the carrier serves as a diluent, it can be a solid, semi-solid, or liquid material, which acts as a vehicle, excipient or medium for the active ingredient.
• the composition can be in the form of tablets, lozenges, sachets, cachets, elixirs, suspensions, aerosols (as a solid or in a liquid medium), ointments containing for example up to 10% by weight of the active compound, soft and hard gelatin capsules, suppositories, injection solutions, suspensions, sterile packaged powders and as a topical patch.
• EXAMPLE 1 Visualization of Apoptosis in Rat Corpus luteum by DNA Laddering The degree of apoptosis was determined by DNA laddering. Genomic DNA was isolated from dispersed co ⁇ us luteal cells or from excised co ⁇ us luteum tissue using the QIAamp DNA Blood Kit (Qiagen) according to the manufacturer's instructions. Co ⁇ us luteum tissue was excised before the induction of apoptosis by treatment with PGF-2 ⁇ , 1 hour and 24 hours after induction of apoptosis.
• the isolated DNA was end-labeled by incubating 500 ng of DNA with 0.2 ⁇ Ci [ ⁇ - 32 P]dCTP, 1 mM Tris, 0.5 mM EDTA, 3 units of Klenow enzyme, and 0.2 pM each of dATP, dGTP, and dTTP at room temperature for 30 minutes. Uninco ⁇ orated nucleotides were removed by passing the sample through a 1 ml Sepadex G-50 column according to Sambrook et al. The samples were then resolved by Tris-acetate-EDTA (1.8 %) gel electrophoresis. The gel was dried for 30 minutes at room temperature under vacuum and exposed to x-ray film at - 80° C for 24 hours.
• the degree of apoptosis in superovulated rat co ⁇ us lutea was examined either 0, 1 , or 24 hours after injection with PGF-2 ⁇ .
• the ovaries were removed without PGF-2 ⁇ injection.
• Laddering of low molecular weight DNA fragments reflecting nuclease activity associated with apoptosis is not evident in control co ⁇ us luteum tissue excised before treatment with PGF-2 ⁇ , but is discernible within 1 hour after induction of apoptosis and is pronounced by 24 hours after induction of apoptosis, which is shown in FIG. 16.
• the top panel is an autoradiograph of the Northern blot probed with the P-dCTP-labeled 3'-untranslated region of rat co ⁇ us luteum apoptosis-specific DHS cDNA.
• the lower panel is the ethidium bromide stained gel of total RNA. Each lane contains 10 ⁇ g RNA.
• the data indicate that there is down- regulation of apoptosis-specific eIF-5A transcript following serum withdrawal.
• the corresponding control animals were treated with saline instead of PGF-2 ⁇ . Fifteen minutes after treatment with saline or PGF-2 ⁇ , co ⁇ ora lutea were removed from the animals.
• Genomic DNA was isolated from the co ⁇ ora lutea at 3 hours and 6 hours after removal of the tissue from the animals. DNA laddering and increased end labeling of genomic DNA are evident 6 hours after removal of the tissue from the PGF-2 ⁇ -treated animals, but not at 3 hours after removal of the tissue. See FIG. 17. DNA laddering reflecting apoptosis is also evident when co ⁇ ora lutea are excised 15 minutes after treatment with PGF-2 ⁇ and maintained for 6 hours under in vitro conditions in EBSS (Gibco). Nuclease activity associated with apoptosis is also evident from more extensive end labeling of genomic DNA. In another experiment, superovulation was induced by subcutaneous injection with 500 ⁇ g of PGF-2 ⁇ . Control rats were treated with an equivalent volume of saline solution. Fifteen to thirty minutes later, the ovaries were removed and minced with collagenase.
• Control cells from rats treated with saline were dispersed with collagenase and incubated for 1 hour and a further 5 hours in glutamine only (lane 1). Five hundred nanograms of DNA from each sample was labeled with [ ⁇ - 32 P]-dCTP using klenow enzyme, separated on a 1.8 %> agarose gel, and exposed to film for 24 hours.
• Results are shown in FIG. 18.
• superovulated rats were injected subcutaneously with 1 mg/100 g body weight of spermidine, delivered in three equal doses of 0.333 mg/100 g body weight, 24, 12, and 2 hours prior to a subcutaneous injection with 500 ⁇ g PGF-2 ⁇ .
• Control rats were divided into three sets: no injections, three injections of spermidine but no PGF-2 ⁇ ; and three injections with an equivalent volume of saline prior to PGF-2 ⁇ treatment.
• Ovaries were removed front the rats either 1 hour and 35 minutes or 3 hours and 45 minutes after prostaglandin treatment and used for the isolation of DNA.
• RNA Isolation Total RNA was isolated from co ⁇ us luteum tissue removed from rats at various times after PGF-2 ⁇ induction of apoptosis. Briefly, the tissue (5 g) was ground in liquid nitrogen. The ground powder was mixed with 30 ml guanidinium buffer (4 M guanidinium isothiocyanate, 2.5 mM NaOAc pH 8.5, 0.8%) ⁇ -mercaptoethanol). The mixture was filtered through four layers of Miracloth and centrifuged at 10,000g at 4° C for 30 minutes. The supernatant was then subjected to cesium chloride density gradient centrifugation at 1 l,200g for 20 hours.
• guanidinium buffer 4 M guanidinium isothiocyanate, 2.5 mM NaOAc pH 8.5, 0.8%) ⁇ -mercaptoethanol
• RNA was rinsed with 75% ethanol, resuspended in 600 ml DEPC-treated water and the RNA precipitated at -70° C with 1.5 ml 95% ethanol and 60 ml of 3M NaOAc.
• Genomic DNA Isolation and Laddering Genomic DNA was isolated from extracted co ⁇ us luteum tissue or dispersed co ⁇ us luteal cells using the QIAamp DNA Blood Kit (Qiagen) according to the manufacturer's instructions. The DNA was end-labeled by incubating 500 ng of DNA with 0.2 ⁇ Ci [ ⁇ - 32 P]dCTP, 1 mM Tris, 0.5 mM EDTA, 3 units of Klenow enzyme, and 0.2 pM each of dATP, dGTP, and dTTP, at room temperature for 30 minutes. Uninco ⁇ orated nucleotides were removed by passing the sample through a 1-ml Sephadex G-50 column according to the method described by Maniatis et al.
• full length rat DHS cDNA (SEQ ID NO:6) labeled with 32 P-dCTP using a random primer kit (Boehringer) was used to probe the membranes (7 x 10 7 cpm).
• the membranes were washed once with lx SSC, 0.1%> SDS at room temperature and three times with 0.2x SSC, 0.1 % SDS at 65° C.
• the membranes were dried and exposed to X-ray film overnight at -70° C.
• apoptosis-specific eIF-5A and DHS are both upregulated in apoptosing co ⁇ us luteum tissue.
• apoptosis-specific eIF-5A is significantly enhanced after induction of apoptosis by treatment with PGF-2 ⁇ - low at time zero, increased substantially within 1 hour of treatment, increased still more within 8 hours of treatment and increased slightly within 24 hours of treatment (FIG. 14).
• Expression of DHS was low at time zero, increased substantially within 1 hour of treatment, increased still more within 8 hours of treatment and increased again slightly within 24 hours of treatment (FIG. 15).
• a partial-length apoptosis-specific eIF-5A sequence (SEQ ID NO:l 1) corresponding to the 3' end of the gene was generated from apoptosing rat co ⁇ us luteum RNA template by RT-PCR using a pair of oligonucleotide primers designed from yeast, fungal and human apoptosis-specific eIF-5A sequences.
• the upstream primer used to isolate the 3'end of the rat apoptosis-specific eIF-5A gene is a 20 nucleotide degenerate primer: 5' TCSAARACHGGNAAGCAYGG 3' (SEQ ID NO:9), wherein S is selected from C and G; R is selected from A and G; H is selected from A, T, and C; Y is selected from C and T; and N is any nucleic acid.
• RT-PCR reverse transcriptase polymerase chain reaction
• a partial-length apoptosis-specific eIF-5A sequence (SEQ ID NO: 15) corresponding to the 5' end of the gene and overlapping with the 3' end was generated from apoptosing rat co ⁇ us luteum RNA template by RT-PCR.
• the 5' primer is a 24-mer having the sequence, 5' CAGGTCTAGAGTTGGAATCGAAGC 3' (SEQ ID NO: 13), that was designed from human eIF-5A sequences.
• the 3' primer is a 30-mer having the sequence, 5' ATATCTCGAGCCTT GATTGCAACAGCTGCC 3' (SEQ ID NO: 14) that was designed according to the 3' end RT-PCR fragment.
• RT-PCR reverse transcriptase- polymerase chain reaction
• the cDNA sequence of the 5' end is SEQ ID NO:15, and the amino acid sequence of the 5' end is SEQ ID NO:16. See FIG. 2.
• the sequences of the 3' and 5' ends of the rat apoptosis-specific eIF-5A (SEQ ID NO:l 1 and SEQ ID NO: 15, respectively) overlapped and gave rise to the full-length cDNA sequence (SEQ ID NO:l). This full-length sequence was aligned and compared with sequences in the GeneBank data base. See FIGS. 1-2.
• the cDNA clone encodes a 154 amino acid polypeptide (SEQ ID NO:2) having a calculated molecular mass of 16.8 KDa.
• the nucleotide sequence, SEQ ID NO:l, for the full length cDNA of the rat apoptosis-specific co ⁇ us luteum eIF-5 A gene obtained by RT-PCR is depicted in FIG. 3 and the corresponding derived amino acid sequence is SEQ ID NO:9.
• the derived full- length amino acid sequence of eIF-5A was aligned with human and mouse eIF-5a sequences. See FIG. 7-9.
• a partial-length DHS sequence (SEQ ID NO:6) corresponding to the 3' end of the gene was generated from apoptosing rat co ⁇ us luteum RNA template by RT-PCR using a pair of oligonucleotide primers designed from a human DHS sequence.
• the 5' primer is a 20-mer having the sequence, 5' GTCTGTGTATTATTGGGCCC 3' (SEQ ID NO. 17).
• the 3' primer is a 42-mer having the sequence, 5" GCGAAGCTTCCATGGC TCGAGTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 3' (SEQ ID NO: 18).
• RT-PCR reverse transcriptase polymerase chain reaction
• the nucleotide sequence (SEQ ID NO:6) for the partial length cDNA of the rat apoptosis-specific co ⁇ us luteum DHS gene obtained by RT-PCR is depicted in FIG. 4 and the corresponding derived amino acid sequence is SEQ ID NO.7.
• Genomic DNA for southern blotting was isolated from excised rat ovaries. Approximately 100 mg of ovary tissue was divided into small pieces and placed into a 15 ml tube. The tissue was washed twice with 1 ml of PBS by gently shaking the tissue suspension and then removing the PBS using a pipette. The tissue was resuspended in 2.06 ml of DNA-buffer (0.2 M Tris-HCl pH 8.0 and 0.1 mM EDTA) and 240 ⁇ l of 10 % SDS and 100 ⁇ l of proteinase K (Boehringer Manheim; 10 mg/ml) was added. The tissue was placed in a shaking water bath at 45° C overnight.
• DNA-buffer 0.2 M Tris-HCl pH 8.0 and 0.1 mM EDTA
• tissue suspension was incubated in a water- bath at 45 °C for an additional 4 hours. After the incubation the tissue suspension was extracted once with an equal volume of phenol:chloroform:iso-amyl alcohol (25:24:1) and once with an equal volume of chloroform:iso-amyl alcohol (24:1). Following the extractions 1/10th volume of 3M sodium acetate (pH 5.2) and 2 volumes of ethanol were added. A glass pipette sealed and formed into a hook using a Bunsen burner was used to pull the DNA threads out of solution and to transfer the DNA into a clean microcentrifuge tube.
• the DNA was washed once in 70 % ethanol and air-dried for 10 minutes.
• the DNA pellet was dissolved in 500 ⁇ l of 10 mM Tris-HCl (pH 8.0), 10 ⁇ l of RNase A (10 mg/ml) was added, and the DNA was incubated for 1 hour at 37 °C.
• the DNA was extracted once with phenol:chloroform:iso-amyl alcohol (25 :24: 1) and the DNA was precipitated by adding 1/lOth volume of 3 M sodium acetate (pH 5.2) and 2 volumes of ethanol.
• the DNA was pelleted by centrifugation for 10 minutes at 13,000 x g at 4° C.
• genomic DNA isolated from rat ovaries was digested with various restriction enzymes that either do not cut in the endogenous gene or cut only once. To achieve this, 10 ⁇ g genomic DNA, 20 ⁇ l 10X reaction buffer and 100 U restriction enzyme were reacted for five to six hours in a total reaction volume of 200 ⁇ l. Digested DNA was loaded onto a 0.7 % agarose gel and subjected to electrophoresis for 6 hours at 40 volts or overnight at 15 volts.
• the gel was depurinated for 10 minutes in 0.2 N HCl followed by two 15-minute washes in denaturing solution (0.5 M NaOH, 1.5 M NaCl) and two 15 minute washes in neutralizing buffer (1.5 M NaCl, 0.5 M Tris-HCl pH 7.4).
• the DNA was transferred to a nylon membrane, and the membrane was prehybridized in hybridization solution (40 %> formamide, 6 X SSC, 5 X Denhart's, solution (1 X Denhart's solution is 0.02 % Ficoll, 0.02 % PVP, and 0.02 % BSA), 0.5 % SDS, and 1.5 mg of denatured salmon sperm DNA).
• a 700 bp PCR fragment of the 3' UTR of rat eIF-5A cDNA (650 bp of 3' UTR and 50 bp of coding) was labeled with [a- 32P]-dCTP by random priming and added to the membrane at 1 X 106 cpm/ml.
• a 606 bp PCR fragment of the rat DHS cDNA (450 bp coding and 156 bp 3' UTR) was random prime labeled with [ ⁇ - 32 P]-dCTP and added at 1 X 10 6 cpm/ml to a second identical membrane.
• the blots were hybridized overnight at 42° C and then washed twice with 2 X SSC and 0.1 % SDS at 42° C and twice with 1 X SSC and 0.1 % SDS at 42° C. The blots were then exposed to film for 3-10 days.
• Rat co ⁇ us genomic DNA was cut with restriction enzymes as indicated on FIG. 20 and probed with 32 P-dCTP-labeled full-length eIF-5A cDNA.
• Hybridization under high stringency conditions revealed hybridization of the full-length cDNA probe to several restriction fragments for each restriction enzyme digested DNA sample, indicating the presence of several isoforms of eIF-5A.
• Figure 21 shows a Southern blot of rat genomic DNA probed with 32 P-dCTP- labeled partial-length rat co ⁇ us luteum DHS cDNA.
• the genomic DNA was cut with EcoRV, a restriction enzyme that does not cut the partial-length cDNA used as a probe. Two restriction fragments are evident indicating that there are two copies of the gene or that the gene contains an intron with an EcoRV site.
• EXAMPLE 2 The present example demonstrates modulation of apoptosis apoptosis-specific elF-
• COS-7 an African green monkey kidney fibroblast-like cell line transformed with a mutant of SV40 that codes for wild-type T antigen
• DMEM Dulbecco's Modified Eagle's medium
• FBS fetal bovine serum
• the cells were subcultured every 3 to 4 days by detaching the adherent cells with a solution of 0.25 %> trypsin and 1 mM EDTA.
• the detached cells were dispensed at a split ratio of 1 : 10 in a new culture dish with fresh media.
• COS-7 cells to be used for isolation of RNA were grown in 150-mm tissue culture treated dishes (Corning).
• the cells were harvested by detaching them with a solution of trypsin-EDTA.
• the detached cells were collected in a centrifuge tube, and the cells were pelleted by centrifugation at 3000 ⁇ m for 5 minutes. The supernatant was removed, and the cell pellet was flash- frozen in liquid nitrogen.
• RNA was isolated from the frozen cells using the GenElute Mammalian Total RNA Miniprep kit (Sigma) according to the manufacturer's instructions.
• Recombinant Plasmids and Transfection of COS-7 Cells Recombinant plasmids carrying the full-length coding sequence of rat apoptosis- specific eIF-5A in the sense orientation and the 3' untranslated region (UTR) of rat apoptosis-specific eIF-5A in the antisense orientation were constructed using the mammalian epitope tag expression vector, pHM6 (Roche Molecular Biochemicals), which is illustrated in FIG. 21.
• the vector contains the following: CMV promoter - human cytomegalovims immediate-early promoter/enhancer; HA - nonapeptide epitope tag from influenza hemagglutinin; BGH pA - Bovine growth hormone polyadenylation signal; fl ori - fl origin; SV40 ori - SV40 early promoter and origin; Neomycin - Neomycin resistance (G418) gene; SV40 pA - SV40 polyadenylation signal; Col El- ColEl origin; Ampicillin- Ampicillin resistance gene.
• the full-length coding sequence of rat apoptosis- specific eIF-5A and the 3' UTR of rat apoptosis-specific eIF-5A were amplified by PCR from the original rat eEF-5A RT-PCR fragment in pBluescript (SEQ ID NO: 1).
• the primers used were as follows: Forward 5' GCCAAGCTTAATGGCAGATGATTT GG 3' (SEQ ID NO: 59) (Hind3) and Reverse 5' CTGAATTCCAGT TATTTTGCCATGG 3' (SEQ ID NO:60) (EcoRl).
• the primers used were as follows: forward 5' AATGAATTCCGCCATGACAGAGGAGGC 3' (SEQ ID NO: 61) (EcoRl) and reverse 5' GCGAAGCTTCCATGGCTCGAGTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT
• Both PCR products were subcloned into the Hind 3 and EcoRl sites of pHM6 to create pHM6-full-length apoptosis-specific eIF-5A and pHM6-antisense 3'UTReIF-5A.
• the full-length rat apoptosis-specific eIF-5A PCR product was subcloned in frame with the nonapeptide epitope tag from influenza hemagglutinin (HA) present upstream of the multiple cloning site to allow for detection of the recombinant protein using an anti-[HA]-peroxidase antibody.
• Expression is driven by the human cytomegalovirus immediate-early promoter/enhancer to ensure high level expression in mammalian cell lines.
• the plasmid also features a neomycin-resistance
• COS-7 SV40 early promoter and origin, which allows episomal replication in cells expressing SV40 large T antigen, such as COS-7.
• COS-7 cells to be used in transfection experiments were cultured in either 24 well cell culture plates (Corning) for cells to be used for protein extraction, or 4 chamber culture slides (Falcon) for cells to be used for staining. The cells were grown in DMEM media supplemented with 10 % FBS, but lacking penicillin/streptomycin, to 50 to 70 % confluency.
• Transfection medium sufficient for one well of a 24-well plate or culture slide was prepared by diluting 0.32 ⁇ g of plasmid DNA in 42.5 ⁇ l of serum-free DMEM and incubating the mixture at room temperature for 15 minutes.
• 1.6 ⁇ l of the transfection reagent, LipofectAMINE (Gibco, BRL) was diluted in 42.5 ⁇ l of serum-free DMEM and incubated for 5 minutes at room temperature. After 5 minutes the LipofectAMINE mixture was added to the DNA mixture and incubated together at room temperature for 30 to 60 minutes.
• the cells to be transfected were washed once with serum-free DMEM before overlaying the transfection medium and the cells were placed back in the growth chamber for 4 hours.
• DMEM + 20 % FBS was added to the cells.
• the cells were the cultured for a further 40 hours before either being induced to undergo apoptosis prior to staining or harvested for Western blot analysis.
• mock transfections were also performed in which the plasmid DNA was omitted from the transfection medium.
• Protein Extraction and Western Blotting Protein was isolated for Western blotting from transfected cells by washing the cells twice in PBS (8 g/L NaCl, 0.2 g/L KC1, 1.44 g/L Na 2 HPO 4 , and 0.24 g/L KH 2 PO 4 ) and then adding 150 ⁇ l of hot SDS gel-loading buffer (50 mM Tris-HCl pH 6.8, 100 mM dithiothreitol, 2 % SDS, 0.1 %> bromophenol blue, and 10 %> glycerol). The cell lysate was collected in a microcentrifuge tube, heated at 95° C for 10 minutes, and then centrifiiged at 13,000 x g for 10 minutes.
• PBS g/L NaCl, 0.2 g/L KC1, 1.44 g/L Na 2 HPO 4 , and 0.24 g/L KH 2 PO 4
• 150 ⁇ l of hot SDS gel-loading buffer 50 mM Tri
• the supernatant was transferred to a fresh microcentrifuge tube and stored at -20° C until ready for use.
• 2.5 or 5 ⁇ g of total protein was separated on a 12 % SDS- polyacrylamide gel.
• the separated proteins were transferred to a polyvinylidene difluoride membrane.
• the membrane was then incubated for one hour in blocking solution (5 % skim milk powder, 0.02 %> sodium azide in PBS) and washed three times for 15 minutes in PBS-T (PBS + 0.05 % Tween-20).
• the membrane was stored overnight in PBS-T at 4 °C. After being warmed to room temperature the next day, the membrane was blocked for 30 seconds in 1 ⁇ g/ml poly vinyl alcohol.
• the membrane was rinsed 5 times in deionized water and then blocked for 30 minutes in a solution of 5 %> milk in PBS.
• the primary antibody was preincubated for 30 minutes in a solution of 5 %> milk in PBS prior to incubation with the membrane.
• Several primary antibodies were used.
• An anti-[HA]-peroxidase antibody (Roche Molecular Biochemicals) was used at a dilution of 1 :5000 to detect expression of the recombinant proteins. Since this antibody is conjugated to peroxidase, no secondary antibody was necessary, and the blot was washed and developed by chemiluminescence.
• the other primary antibodies that were used are monoclonal antibodies from Oncogene that recognize p53 (Ab-6), Bcl-2 (Ab-1), and c-Myc (Ab-2).
• the monoclonal antibody to p53 was used at a dilution of 0.1 ⁇ g/ml, and the monoclonal antibodies to Bcl-2 and c- Myc were both used at a dilution of 0.83 ⁇ g/ml.
• the membrane was washed 3 times for 15 minutes in PBS-T. Secondary antibody was then diluted in 1 % milk in PBS and incubated with the membrane for 60 to 90 minutes.
• the secondary antibody used was a goat anti-mouse IgG conjugated to alkaline phosphatase (Rockland) at a dilution of 1:1000.
• Bcl-2 (Ab-1) and c-Myc (Ab-2) were used as the primary antibody, a rabbit anti-mouse IgG conjugated to peroxidase (Sigma) was used at a dilution of 1 :5000.
• the membrane was washed 3 times in PBS-T. Two detection methods were used to develop the blots, a colorimetric method and a chemiluminescent method.
• the colorimetric method was used only when p53 (Ab-6) was used as the primary antibody in conjunction with the alkaline phosphatase-conjugated secondary antibody. Bound antibody was visualized by incubating the blot in the dark in a solution of 0.33 mg/mL nitro blue tetrazolium, 0.165 mg/mL 5-bromo-4-chloro-3-indolyl phosphate, 100 mM NaCl, 5 mM MgCl 2 , and 100 mM Tris-HCl (pH 9.5). The color reaction was stopped by incubating the blot in 2 mM EDTA in PBS.
• a chemiluminescent detection method was used for all other primary antibodies, including anti- [HA] - peroxidase, Bcl-2 (Ab-1), and c-Myc (Ab-2).
• the ECL Plus Western blotting detection kit (Amersham Pharmacia Biotech) was used to detect peroxidase-conjugated bound antibodies.
• the membrane was lightly blotted dry and then incubated in the dark with a 40: 1 mix of reagent A and reagent B for 5 minutes.
• the membrane was blotted dry, placed between sheets of acetate, and exposed to X-ray film for time periods varying from 10 seconds to 10 minutes.
• Control cells were grown in antibiotic-free DMEM supplemented with 10 %> FBS and an equivalent volume of methanol. For both methods, the percentage of apoptotic cells was determined 48 hours later by staining with either Hoescht or Annexin V-Cy3. Induction of apoptosis was also confirmed by Northern blot analyses, as shown in FIG. 22.
• Hoescht Staining The nuclear stain, Hoescht, was used to label the nuclei of transfected COS-7 cells in order to identify apoptotic cells based on mo ⁇ hological features such as nuclear fragmentation and condensation.
• a fixative consisting of a 3:1 mixture of absolute methanol and glacial acetic acid, was prepared immediately before use.
• Mcllvaine's buffer 0.021 M citric acid, 0.058 M Na 2 HPO 4 .7H O; pH 5.6
• the buffer was discarded, the cells were air-dried for 5 minutes in the dark and the chambers separating the wells of the culture slide were removed.
• a few drops of Vectashield mounting media for fluorescence (Vector Laboratories) was added to the slide and overlaid with a coverslip. The stained cells were viewed under a fluorescence microscope using a UV filter. Cells with brightly stained or fragmented nuclei were scored as apoptotic.
• Annexin V-Cy3 Staining An Annexin V-Cy3 apoptosis detection kit (Sigma) was used to fluorescently label externalized phosphatidylserine on apoptotic cells. The kit was used according to the manufacturer's protocol with the following modifications. In brief, transfected COS-7 cells growing on four chamber culture slides were washed twice with PBS and three times with 1 X Binding Buffer. 150 ⁇ l of staining solution (1 ⁇ g/ml AnnCy3 in 1 X Binding Buffer) was added, and the cells were incubated in the dark for 10 minutes. The staining solution was then removed, and the cells were washed 5 times with 1 X Binding Buffer.
• the chamber walls were removed from the culture slide, and several drops of 1 X Binding Buffer were placed on the cells and overlaid with a coverslip.
• the stained cells were analyzed by fluorescence microscopy using a green filter to visualize the red fluorescence of positively stained (apoptotic) cells.
• the total cell population was determined by counting the cell number under visible light.
• EXAMPLE 3 The present example demonstrates modulation of apoptosis apoptosis-specific elF-
• FIG. 23 is a flow chart illustrating the procedure for transient transfection of COS-7 cells, in which cells in serum- free medium were incubated in plasmid DNA in lipofectAMINE for 4 hours, serum was added, and the cells were incubated for a further 40 hours. The cells were then either incubated in regular medium containing serum for a further 48 hours before analysis (i.e. no further treatment), deprived of serum for 48 hours to induce apoptosis before analysis, or treated with actinomycin D for 48 hours to induce apoptosis before analysis.
• FIG. 22 is a Western blot illustrating transient expression of foreign proteins in
• COS-7 cells following transfection with pHM6 Protein was isolated from COS-7 cells 48 hours after either mock transfection, or transfection with pHM6-LacZ, pHM6-Antisense 3' rF5A (pHM6-Antisense 3' UTR rat apoptosis-specific eIF-5A), or pHM6-Sense rF5A (pHM6-Full length rat apoptosis-specific eIF-5A).
• Five ⁇ g of protein from each sample was fractionated by SDS-PAGE, transferred to a PVDF membrane, and Western blotted with anti-[HA]-peroxidase. The bound antibody was detected by chemiluminescence and exposed to x-ray film for 30 seconds.
• LacZ (lane 2) and of sense rat apoptosis-specific eIF-5A (lane 4) is clearly visible.
• COS-7 cells were either mock transfected or transfected with pHM6-Sense rF5 A (pHM6-Full length rat apoptosis-specific eIF-5A). Forty hours after transfection, the cells were induced to undergo apoptosis by withdrawal of serum for 48 hours. The caspase proteolytic activity in the transfected cell extract was measured using a fluorometric homogenous caspase assay kit (Roche Diagnostics).
• DNA fragmentation was also measured using the FragEL DNA Fragmentation Apoptosis Detection kit (Oncogene) which labels the exposed 3'-OH ends of DNA fragments with fluorescein- labeled deoxynucleotides. Additional COS-7 cells were either mock transfected or transfected with pHM6- Sense rF5A (pHM6-Full length rat apoptosis-specific eIF-5 A).
• the cells Forty hours after transfection, the cells were either grown for an additional 48 hours in regular medium containing serum (no further treatment), induced to undergo apoptosis by withdrawal of serum for 48 hours or induced to undergo apoptosis by treatment with 0.5 ⁇ g/ml of Actinomycin D for 48 hours.
• the cells were either stained with Hoescht 33258, which depicts nuclear fragmentation accompanying apoptosis, or stained with Annexin V-Cy3, which depicts phosphatidylserine exposure accompanying apoptosis. Stained cells were also viewed by fluorescence microscopy using a green filter and counted to determine the percentage of cells undergoing apoptosis. The total cell population was counted under visible light.
• FIG. 25 illustrates enhanced apoptosis as reflected by increased caspase activity when COS-7 cells were transiently transfected with pHM6 containing full-length rat apoptosis-specificeIF-5A in the sense orientation. Expression of rat apoptosis-specificelF- 5A resulted in a 60%o increase in caspase activity.
• FIG. 26 illustrates enhanced apoptosis as reflected by increased DNA fragmentation when COS-7 cells were transiently transfected with pHM6 containing full- length rat apoptosis-specificeIF-5A in the sense orientation. Expression of rat apoptosis- specificeIF-5A resulted in a 273% increase in DNA fragmentation.
• FIG. 27 illustrates detection of apoptosis as reflected by increased nuclear fragmentation when COS-7 cells were transiently transfected with pHM6 containing full-length rat apoptosis-specific elF- 5 A in the sense orientation. There is a greater incidence of fragmented nuclei in cells expressing rat apoptosis-specificeIF-5A.
• FIG. 28 illustrates enhanced apoptosis as reflected by increased nuclear fragmentation when COS-7 cells were transiently transfected with pHM6 containing full-length rat apoptosis-specific eIF-5A in the sense orientation.
• FIG. 29 illustrates detection of apoptosis as reflected by phosphatidylserine exposure when COS-7 cells were transiently transfected with pHM6 containing full-length rat apoptosis-specific eIF-5A in the sense orientation.
• FIG. 30 illustrates enhanced apoptosis as reflected by increased phosphatidylserine exposure when COS-7 cells were transiently transfected with pHM6 containing full-length rat apoptosis-specific eIF-5A in the sense orientation.
• FIG. 31 illustrates enhanced apoptosis as reflected by increased nuclear fragmentation when COS-7 cells were transiently transfected with pHM6 containing full- length rat apoptosis-specificeIF-5A in the sense orientation.
• Expression of rat apoptosis- specific eIF-5A resulted in a 115 %> and 62 %> increase in nuclear fragmentation over control in untreated and treated samples, respectively.
• FIG. 32 illustrates a comparison of enhanced apoptosis under conditions in which COS-7 cells transiently transfected with pHM6 containing full-length rat apoptosis-specific eIF-5 A in the sense orientation were either given no further treatment or treatment to induce apoptosis.
• EXAMPLE 4 The present example demonstrates modulation of apoptotic activity following administration of apoptosis-specific eIF-5A.
• COS-7 cells were either mock transfected, transfected with pHM6-LacZ or transfected with pHM6-Sense rF5A (pHM6-Full length rat apoptosis-specific eIF-5A) and incubated for 40 hours.
• pHM6-Sense rF5A pHM6-Sense rF5A
• Five ⁇ g samples of protein extract from each sample were fractionated by SDS-PAGE, transferred to a PVDF membrane, and Western blotted with a monoclonal antibody that recognizes Bcl-2.
• Additional COS-7 cells were either mock transfected, transfected with pHM6- antisense 3' rF5A (pHM6-antisense 3' UTR of rat apoptosis-specific eIF-5A) or transfected with pHM6-Sense rF5A (pHM6-Full length rat apoptosis-specific eIF-5A). Forty hours after transfection, the cells were induced to undergo apoptosis by withdrawal of serum for 48 hours. Five ⁇ g samples of protein extract from each sample were fractionated by SDS- PAGE, transferred to a PVDF membrane, and Western blotted with a monoclonal antibody that recognizes Bcl-2.
• COS-7 cells were either mock transfected, transfected with pHM6-LacZ or transfected with pHM6-Sense rF5A (pHM6-Full length rat apoptosis-specific eIF-5A) and incubated for 40 hours. Five ⁇ g samples of protein extract from each sample were fractionated by SDS-PAGE, transferred to a PVDF membrane, and probed with a monoclonal antibody that recognizes p53.
• FIG. 33 illustrates downregulation of Bcl-2 when COS-7 cells were transiently transfected with pHM6 containing full-length rat apoptosis-specific eIF-5A in the sense orientation.
• the upper panel illustrates the Coomassie-blue-stained protein blot; the lower panel illustrates the corresponding Western blot.
• FIG. 34 illustrates upregulation of Bcl-2 when COS-7 cells were transiently transfected with pHM6 containing the 3' end of apoptosis-specific eIF-5A in the antisense orientation.
• the upper panel illustrates the Coomassie-blue-stained protein blot; the lower panel illustrates the corresponding Western blot.
• More Bcl-2 is detectable in cells transfected with pHM6-antisense 3' rF5A than in those mock transfected or transfected with pHM6-Sense rF5A.
• FIG. 34 illustrates upregulation of Bcl-2 when COS-7 cells were transiently transfected with pHM6 containing the 3' end of apoptosis-specific eIF-5A in the antisense orientation.
• the upper panel illustrates the Coomassie-blue-stained protein blot; the lower panel illustrates the corresponding Western blot.
• More Bcl-2 is detectable in cells transfected with pH
• FIG. 35 illustrates upregulation of c-Myc when COS-7 cells were transiently transfected with pHM6 containing full-length rat apoptosis-specific eIF-5A in the sense orientation.
• the upper panel illustrates the Coomassie-blue-stained protein blot; the lower panel illustrates the corresponding Western blot. Higher levels of c-Myc is detected in cells transfected with pHM6-Sense rF5A than in those transfected with pHM6-LacZ or the mock control.
• FIG. 36 illustrates upregulation of p53 when COS-7 cells were transiently transfected with pHM6 containing full-length rat apoptosis-specific eIF-5A in the sense orientation.
• the upper panel illustrates the Coomassie-blue-stained protein blot; the lower panel illustrates the corresponding Western blot.
• Higher levels of p53 is detected in cells transfected with pHM6-Sense rF5 A than in those transfected with pHM6-LacZ or the mock control.
• FIG. 37 illustrates the dependence of p53 upregulation upon the expression of pHM6-full length rat apoptosis-specificeIF-5 A in COS-7 cells. More rat apoptosis- specificeIF-5A is detectable in the first transfection than in the second transfection.
• the panel illustrates a corresponding Coomassie-blue- stained protein blot and the panel illustrates the Western blot with p53.
• the panel illustrates a corresponding Coomassie-blue- stained protein blot and the panel illustrates the Western blot with p53.
• For the first transfection more p53 is detectable in cells transfected with pHM6-Sense rF5A than in those transfected with pHM6-LacZ or the mock control.
• For the second transfection in which there was less expression of rat apoptosis-specific eIF-5A there was no detectable difference in levels of p53 between cells transfected with pHM6-Sense rF5A, pHM6-LacZ or the mock control.
• Figure 47 depicts an experiment run on heart tissue to mimic the beating of a human heart and the subsequent induced heart attack.
• Figure 49 shows the laboratory bench set up. A slice of human heart tissue removed during valve replacement surgery was hooked up to electrodes. A small weight was attached to the heart tissue to ease in measuring the strength of the heart beats. The electrodes provided an electrical stimulus to get the tissue to start beating. The levels of gene expression for both apoptosis-specific eIF-5A and proliferating eIF-5A were measured in the heart tissue before ischemia was induced. See Figure 46. In the pre-ischemic heart tissue low levels both apoptosis- specific eIF-5A and proliferating eIF-5A were produced and their levels were in relative balance.
• FIG. 48 The EKG results are depicted in Figure 48. On the left side of the panels a normal heart beat is shown (the pre-ischemic heart tissue). After the "heart attack” (straight line), and the re-initiation of the heart beat, the EKG shows decreased activity due to muscle cell death. The EKG shows relative loss in strength of heart beat.
• EXAMPLE 6 The following examples provide cell culture conditions.
• LC cells lamina cribrosa (LC) and astrocyte cell populations.
• LC cells were subcultured in 25 cm 2 flasks in DMEM supplemented with gentamycin, glutamine, and 10%) FBS, whereas astrocytes were expanded in 25cm 2 flasks containing EBM complete medium (Clonetics) with no FBS.
• FBS was added to astrocyte cultures following 10 days of subculture. Cells were maintained and subcultured as per this protocol.
• Cell populations obtained by differential subculturing were characterized for identity and population purity using differential fluorescent antibody staining on 8 well culture slides.
• DPBS Dulbecco's Phosphate Buffered Saline
• LC cells Following washing with DPBS, the chambers separating the wells of the culture slide were removed from the slide, and the slide was immersed in double distilled water and then allowed to air-dry. Fluoromount (Vector Laboratories) was applied to each slide and overlayed by 22x60 mm coverglass slips. Immunofluorescent staining was viewed under a fluorescent microscope with appropriate filters and compared to the control wells that were not treated with primary antibody. All primary antibodies were obtained from Sigma unless otherwise stated. All secondary antibodies were purchased from Molecular Probes. Primary antibodies used to identify LC cells were: anti-collagen I, anti-collagen IV, anti-laminin, anti-cellular fibronectin.
• astrocytes Primary antibodies used to identify astrocytes were: anti-galactocerebroside (Chemicon International), anti-A2B5 (Chemicon International), anti-NCAM, anti-human Von willebrand Factor. Additional antibodies used for both cell populations included anti- glial fibrillary (GFAP) and anti-alpha-smooth muscle actin. Cell populations were determined to be comprised of LC cells if they stained positively for collagen I, collagen IV, laminin, cellular fibronectin, alpha smooth muscle actin and negatively for glial fibrillary (GFAP).
• GFAP glial fibrillary
• LC cell lines # 506, # 517, and # 524 were established from the optic nerve heads of and 83-year old male, a 17-year old male, and a 26-year old female, respectively. All LC cell lines have been fully characterized and found to contain greater than 90 % LC cells.
• RKO Cell Culture RKO (American Type Culture Collection CRL-2577), a human colon carcinoma cell line expressing wild-type p53, was used to test the antisense oligonucleotides for the ability to suppress apoptosis-specific eIF-5 A protein expression.
• RKO were cultured in Minimum Essential Medium Eagle (MEM) with non-essential amino acids, Earle's salts, and L-glutamine. The culture media was supplemented with 10 % fetal bovine serum (FBS) and 100 units of penicillin/streptomycin. The cells were grown at 37 °C in a humidified environment of 5 % CO and 95 % > air.
• MEM Minimum Essential Medium Eagle
• FBS fetal bovine serum
• the cells were subcultured every 3 to 4 days by detaching the adherent cells with a solution of 0.25 %> trypsin and 1 mM EDTA.
• the detached cells were dispensed at a split ratio of 1 :10 to 1 :12 into a new culture dish with fresh media.
• HepG2 Cell Culture HepG2, a human hepatocellular carcinoma cell line, was used to test the ability of an antisense oligo directed against human apoptosis-specific eIF-5A to block production of TNF- ⁇ in response to treatment with IL-1 ⁇ .
• HepG2 cells were cultured in DMEM supplemented with gentamycin, glutamine, and 10%o FBS and grown at 37 °C in a humidified environment of 5 % CO 2 and 95 % air.
• RNA polymerase inhibitor and camptothecin, a topoisomerase inhibitor, respectively.
• Actinomycin D was used at a concentration of 0.25 ⁇ g/ml and camptothecin was used at a concentration of 20, 40, or 50 ⁇ M.
• Apoptosis was also induced in lamina cribrosa cells using a combination of camptothecin (50 ⁇ M) and TNF- ⁇ (10 ng/ml). The combination of camptothecin and TNF- ⁇ was found to be more effective at inducing apoptosis than either camptothecin or TNF- ⁇ alone.
• Antisense Oligonucleotides A set of three antisense oligonucleotides targeted against human apoptosis-specific eIF-5A were designed by, and purchased from, Molecula Research Labs.
• the sequence of the first antisense oligonucleotide targeted against human apoptosis-specific eIF-5A (#1) was 5' CCT GTC TCG AAG TCC AAG TC 3' (SEQ ID NO: 63).
• the sequence of the second antisense oligonucleotide targeted against human apoptosis-specific eIF-5A was 5' GGA CCT TGG CGT GGC CGT GC 3' (SEQ ID NO: 64).
• the sequence of the third antisense oligonucleotide targeted against human apoptosis-specific eIF-5A was 5' CTC GTA CCT CCC CGC TCT CC 3' (SEQ ID NO: 65).
• the control oligonucleotide had the sequence 5" CGT ACC GGT ACG GTT CCA GG 3' (SEQ ID NO: 66).
• a fluorescein isothiocyanate (FITC)-labeled antisense oligonucleotide (Molecula Research Labs) was used to monitor transfection efficiency and had the sequence 5' GGA CCT TGG CGT GGC CGT GCX 3' (SEQ ID NO: 67), where X is the FITC label. All antisense oligonucleotides were fully phosphorothioated.
• RKO cells were either mock transfected, or transfected with 100 nM or 200 nM of antisense oligonucleotide.
• Transfection medium sufficient for one well of a 24 well plate was prepared by diluting 0, 1.25, or 2.5 ⁇ l of a 20 ⁇ M stock of antisense oligonucleotide with serum- free MEM to a final volume of 42.5 ⁇ l and incubating the mixture at room temperature for 15 minutes.
• 1.5 ⁇ l of Oligofectamine was diluted in 6 ⁇ l of serum-free MEM and incubated for 7.5 minutes at room temperature. After 5 minutes the diluted Oligofectamine mixture was added to the DNA mixture and incubated together at room temperature for 20 minutes.
• the cells were washed once with serum-free MEM before adding 200 ⁇ l of MEM to the cells and overlaying 50 ⁇ l of transfection medium. The cells were placed back in the growth chamber for 4 hours. After the incubation, 125 ⁇ l of MEM + 30 % FBS was added to the cells. The cells were then cultured for a further 48 hours, treated with 0.25 ⁇ g/ml Actinomycin D for 24 hours, and then cell extract was harvested for Western blot analysis. Transfection of lamina cribrosa cells was also tested using 100 and 200 nM antisense oligonucleotide and Oligofectamine using the same procedure described for RKO cells.
• RKO and lamina cribrosa cells were transfected with the FITC-labeled antisense oligonucleotide on an 8-well culture slide. Forty-eight hours later the cells were washed with PBS and fixed for 10 minutes in 3.7 % formaldehyde in PBS. The wells were removed and mounting media (Vectashield) was added, followed by a coverslip. The cells were then visualized under UV light on a fluorescent microscope nucleus using a fluorescein filter (Green H546, filter set 48915) and cells fluorescing bright green were determined to have taken up the oligonucleotide.
• a fluorescein filter Green H546, filter set 48915
• Detection of Apoptosis Following transfection of lamina cribosa cells with antisense oligonucleotides and induction of apoptosis with camptothecin, the percentage of cells undergoing apoptosis in cells treated with either control antisense oligonucleotide or antisense oligonucleotide apoptosis-specific eIF-5A SEQ ID NO:26 was determined. Two methods were used to detect apoptotic lamina cribosa cells - Hoescht staining and DeadEndTM Fluorometric TUNEL.
• the nuclear stain was used to label the nuclei of lamina cribosa cells in order to identify apoptotic cells based on mo ⁇ hological features such as nuclear fragmentation and condensation.
• a fixative consisting of a 3:1 mixture of absolute methanol and glacial acetic acid, was prepared immediately before use. An equal volume of fixative was added to the media of cells growing on a culture slide and incubated for 2 minutes. The media fixative mixture was removed from the cells and discarded and 1 ml of fixative was added to the cells. After 5 minutes the fixative was discarded and 1 ml of fresh fixative was added to the cells and incubated for 5 minutes.
• the fixative was discarded and the cells were air-dried for 4 minutes before adding 1 ml of Hoescht stain (0.5 ⁇ g/ml Hoescht 33258 in PBS). After a 10 minute incubation in the dark, the staining solution was discarded, the chambers separating the wells of the culture slide were removed, and the slide was washed 3 times for 1 minute with deionized water. After washing, a few drops of Mcllvaine's buffer (0.021 M citric acid, 0.058 M Na 2 HPO 4 .7H 2 O; pH 5.6) was added to the cells and overlaid with a coverslip. The stained cells were viewed under a fluorescent microscope using a UV filter.
• the cells were permeabilized by immersing them in 0.2 %> Triton X-100 in PBS for 5 minutes. The cells were then washed again by immersing the slide twice for 5 minutes in PBS and blotting the slide on paper towel between washes. 25 ⁇ l of equilibration buffer [200 mM potassium cacodylate (pH 6.6), 25 mM Tris-HCl (pH 6.6), 0.2 mM dithiothreitol, 0.25 mg/ml bovine serum albumin, and 2.5 mM cobalt chloride] was added per well and incubated for 5 to 10 minutes.
• equilibration buffer 200 mM potassium cacodylate (pH 6.6), 25 mM Tris-HCl (pH 6.6), 0.2 mM dithiothreitol, 0.25 mg/ml bovine serum albumin, and 2.5 mM cobalt chloride
• reaction mixture was prepared for each well by mixing in a ratio of 45:5:1, respectively, equilibration buffer, nucleotide mix [50 ⁇ M fluorescein- 12-dUTP, 100 ⁇ M dATP, 10 mM Tris-HCl (pH 7.6), and 1 mM EDTA], and terminal deoxynucleotidyl transferase enzyme (Tdt, 25 U/ ⁇ l).
• nucleotide mix 50 ⁇ M fluorescein- 12-dUTP, 100 ⁇ M dATP, 10 mM Tris-HCl (pH 7.6), and 1 mM EDTA
• Tdt terminal deoxynucleotidyl transferase enzyme
• the reaction was terminated by immersing the slide in 2 X SSC [0.3 M NaCl, and 30mM sodium citrate (pH 7.0)] and incubating for 15 minutes. The slide was then washed by immersion in PBS three times for 5 minutes. The PBS was removed by sponging around the wells with a Kim wipe, a drop of mounting media (Oncogene research project, JA1750-4ML) was added to each well, and the slide was overlayed with a coverslip. The cells were viewed under a fluorescent microscope using a UV filter (UV- G 365, filter set 487902) in order to count the Hoescht-stained nuclei. Any cells with brightly stained or fragmented nuclei were scored as apoptotic.
• 2 X SSC 0.3 M NaCl, and 30mM sodium citrate (pH 7.0)
• the cells were then viewed using a fluorescein filter (Green H546, filter set 48915) and any nuclei fluorescing bright green were scored as apoptotic.
• the percentage of apoptotic cells in the field of view was calculated by dividing the number of bright green nuclei counted using the fluorescein filter by the total number of nuclei counted under the UV filter. A minimum of 200 cells were counted per well.
• Figures 54-57 depict the results of these studies. The percentage of apoptotic cells in samples having been transfected with apoptosis-specific eIF-5A is clearly much less than seen in cells having been transfected with the control oligonucleotide.
• Protein Extraction and Western Blotting Protein from transfected RKO cells was harvested for Western blot analysis by washing the cells with PBS, adding 40 ⁇ l of hot lysis buffer [0.5% SDS, 1 mM dithiothreitol, 50 mM Tris-HCl (pH 8.0)] per well. The cells were scraped and the resulting extract was transferred to a microfuge tube, boiled for 5 minutes, and stored at - 20°C. The protein was quantitated using the Bio-Rad Protein Assay (Bio-Rad) according to the manufacturer's instructions. For Western blotting 5 ⁇ g of total protein was separated on a 12 %> SDS- polyacrylamide gel.
• the separated proteins were transferred to a polyvinylidene difluoride membrane.
• the membrane was then incubated for one hour in blocking solution (5 %> skim milk powder in PBS) and washed three times for 15 minutes in 0.05 % Tween-20/PBS.
• the membrane was stored overnight in PBS-T at 4 °C. After being warmed to room temperature the next day, the membrane was blocked for 30 seconds in 1 ⁇ g/ml polyvinyl alcohol.
• the membrane was rinsed 5 times in deionized water and then blocked for 30 minutes in a solution of 5 %> milk in 0.025 %> Tween-20/PBS.
• the primary antibody was preincubated for 30 minutes in a solution of 5 %> milk in 0.025% Tween- 20/PBS prior to incubation with the membrane.
• Several primary antibodies were used.
• a monoclonal antibody from Oncogene which recognizes p53 (Ab-6) and a polyclonal antibody directed against a synthetic peptide (amino-CRLPEGDLGKEIEQKYD-carboxy) (SEQ ID NO: 68) homologous to the c-terminal end of human apoptosis-specific eIF-5A that was raised in chickens (Gallus Immunotech).
• An anti- ⁇ -actin antibody was also used to demonstrate equal loading of protein.
• the monoclonal antibody to p53 was used at a dilution of 0.05 ⁇ g/ml, the antibody against apoptosis-specific eIF-5A was used at a dilution of 1 : 1000, and the antibody against actin was used at a dilution of 1 :20,000.
• the membrane was washed 3 times for 15 minutes in 0.05% Tween-20/PBS. Secondary antibody was then diluted in 1 % milk in 0.025 % Tween- 20/PBS and incubated with the membrane for 60 to 90 minutes.
• the secondary antibody used was a rabbit anti-mouse IgG conjugated to peroxidase (Sigma) at a dilution of 1 :5000.
• a rabbit anti-chicken IgY conjugated to peroxidase (Gallus Immunotech) was used at a dilution of 1 :5000.
• the secondary antibody used with actin was a goat anti-mouse IgM conjugated to peroxidase
• the membrane was washed 3 times in PBS-T.
• the ECL Plus Western blotting detection kit (Amersham Pharmacia Biotech) was used to detect peroxidase-conjugated bound antibodies.
• the membrane was lightly blotted dry and then incubated in the dark with a 40:1 mix of reagent A and reagent B for 5 minutes.
• the membrane was blotted dry, placed between sheets of acetate, and exposed to X-ray film for time periods varying from 10 seconds to 30 minutes.
• the membrane was stripped by submerging the membrane in stripping buffer [100 mM 2- Mercaptoethanol, 2 % SDS, and 62.5 mM Tris-HCl (pH 6.7)], and incubating at 50°C for 30 minutes. The membrane was then rinsed in deionized water and washed twice for 10 minutes in large volumes of 0.05 %> Tween-20/PBS. Membranes were stripped and re- blotted up to three times.
• stripping buffer 100 mM 2- Mercaptoethanol, 2 % SDS, and 62.5 mM Tris-HCl (pH 6.7)
• siRNA Small inhibitory RNAs directed against human apoptosis-specific elF- 5 A were used to specifically suppress expression of apoptosis-specific eIF-5A in RKO and lamina cribrosa cells.
• siRNAs were generated by in vitro transcription using the SilencerTM siRNA Construction Kit (Ambion Inc.).
• siRNAs were generated against human apoptosis-specific eIF-5A (siRNAs # 1 to # 4)(SEQ ID NO:30-33).
• siRNA # 5 siRNA directed against GAPDH provided in the kit
• siRNA # 5 siRNA directed against GAPDH
• siRNA # 1 siRNA # 1 (SEQ ID NO:30) but does not itself target apoptosis-specific eIF-5A.
• the siRNAs were generated according to the manufacturer's protocol. In brief, DNA oligonucleotides encoding the desired siRNA strands were used as templates for T7 RNA polymerase to generate individual strands of the siRNA following annealing of a T7 promoter primer and a fill-in reaction with Klenow fragment.
• the SilencerTM siRNA Labeling Kit - FAM Ambion was used to label GAPDH siRNA with FAM in order to monitor the uptake of siRNA into RKO and lamina cribrosa cells. After transfection on 8-well culture slides, cells were washed with PBS and fixed for 10 minutes in 3.7 % formaldehyde in PBS.
• the wells were removed and mounting media (Vectashield) was added, followed by a coverslip. Uptake of the FAM-labeled siRNA was visualized under a fluorescent microscope under UV light using a fluorescein filter. The GAPDH siRNA was labeled according to the manufacturer's protocol.
• Lipofectamine 2000 was diluted to a final volume of 21.2 ⁇ l in Opti-Mem and incubated for 7 to 10 minutes at room temperature. The diluted Lipofectamine 2000 mixture was then added to the diluted siRNA mixture and incubated together at room temperature for 20 to 30 minutes. The cells were washed once with serum- free media before adding 135 ⁇ l of serum-free media to the cells and overlaying the 42.4 ⁇ l of transfection medium. The cells were placed back in the growth chamber for 4 hours. After the incubation, 65 ⁇ l of serum-free media + 30 % FBS was added to the cells.
• HepG2 TNF- Production HepG2 cells were plated at 20,000 cells per well onto 48-well plates. Seventy two hours later the media was removed and fresh media containing either 2.5 ⁇ M control antisense oligonucleotide or 2.5 ⁇ M antisense oligonucleotide apoptosis-specific eIF-5A # 2 was added to the cells. Fresh media containing antisense oligonucleotides was added after twenty four hours. After a total of 48 hours incubation with the oligonucleotides, the media was replaced with media containing interleukin l ⁇ (IL-l ⁇ , 1000 pg/ml; Leinco Technologies) and incubated for 6 hours.
• IL-l ⁇ interleukin l ⁇
• TNF- ⁇ quantification The media was collected and frozen (-20°C) for TNF- ⁇ quantification. Additional parallel incubations with untreated cells (without antisense oligonucleotide and IL-l ⁇ ) and cells treated with only IL-l ⁇ were used for controls. All treatments were done in duplicate. TNF- ⁇ released into the media was measured by ELISA assays (Assay Designs Inc.) according to the manufacturer's protocol.
• EXAMPLE 10 The following experiments show that antisense apoptosis-specific eIF-5A nucleotides were able to inhibit expression of apoptosis-specific eIF-5A as well as p53.
• RKO cells were either left untransfected, mock transfected, or transfected with 200 nM of antisense oligonucleotides apoptosis-specific eIF-5A # 1, # 2, or # 3 (SEQ ID NO: 25, 26, and 27).
• RKO cells were also transfected with 100 nM of antisense oligonucleotide apoptosis-specific eIF-5A # 2 (SEQ ID NO:26).
• the cells were treated with 0.25 ⁇ g/ml Actinomycin D. Twenty-four hours later, the cell extract was harvested and 5 ⁇ g of protein from each sample was separated on an SDS-PAGE gel, transferred to a PVDF membrane, and Western blotted with an antibody against apoptosis-specific eIF-5 A. After chemiluminescent detection, the membrane was stripped and reprobed with an antibody against p53. After chemiluminescent detection, the membrane was stripped again and reprobed with an antibody against actin.
• Figure 52 which shows the levels of protein produced by RKO cells after being treated with antisense oligo 1, 2 and 3 (to apoptosis-specific eIF-5a)(SEQ ID NO:25, 26, and 27, respectively).
• the RKO cells produced less apoptosis-specific elF- 5 A as well as less p53 after having been transfected with the antisense apoptosis-specific eIF-5 A nucleotides.
• EXAMPLE 11 The following experiments show that apoptosis-specific eIF-5 A nucleotides were able to reduce apoptosis.
• the lamina cribrosa cell line # 506 was either (A) transfected with 100 nM of FITC-labeled antisense oligonucleotide using Oligofectamine transfection reagent or (B) transfected with 10 ⁇ M of naked FITC-labeled antisense oligonucleotide diluted directly in serum-free media. After 24 hours fresh media containing 10 % FBS and fresh antisense oligonucleotide diluted to 10 ⁇ M was added to the cells.
• Figure 53 shows uptake of the flourescently labeled antisense oligonucleotide.
• the lamina cribrosa cell line # 506 was transfected with 10 ⁇ M of either the control antisense oligonucleotide or antisense oligonucleotide apoptosis- specific eIF-5A # 2 (SEQ ID NO:26) for a total of 4 days. Forty-eight hours after beginning antisense oligonucleotide treatment, the cells were treated with either 20 ⁇ M or 40 ⁇ M camptothecin for 48 hours.
• Antisense oligonucleotide and camptothecin- containing media was changed daily. The percentage of apoptotic cells was determined by labeling the cells with Hoescht and TUNEL. See figure 54.
• the lamina cribrosa cell line # 506 was transfected with 10 ⁇ M of either the control antisense oligonucleotide or antisense oligonucleotide apoptosis- specific eIF-5A # 2 (SEQ ID NO:26). Twenty-four hours later the media was changed and fresh antisense oligonucleotides were added.
• the antisense-oligonucleotides were removed and the cells were treated with 20 ⁇ M camptothecin for 3 days.
• the camptothecin-containing media was changed daily.
• the percentage of apoptotic cells was determined by labeling the cells with Hoescht and TUNEL. See Figure 55.
• the lamina cribrosa cell line # 517 was transfected with 1 ⁇ M of either the control antisense oligonucleotide or antisense oligonucleotide apoptosis-specific eIF-5A # 2 (SEQ ID NO:26) for a total of five days.
• the cells were treated with 20 ⁇ M camptothecin for either 3 or 4 days.
• Antisense oligonucleotide and camptothecin- containing media was changed daily.
• the percentage of apoptotic cells was determined by labeling the cells with Hoescht and TUNEL. See Figure 56.
• the lamina cribrosa cell line # 517 was transfected with 2.5 ⁇ M of either the control antisense oligonucleotide or antisense oligonucleotide apoptosis- specific eIF-5A # 2 (SEQ ID NO:26) for a total of five days.
• the cells were treated with 40 ⁇ M camptothecin for 3 days.
• Antisense oligonucleotide and camptothecin-containing media was changed daily.
• the percentage of apoptotic cells was determined by labeling the cells with Hoescht. See figure 57.
• the lamina cribrosa cell line # 517 was transfected with either 1 ⁇ M or 2.5 ⁇ M of either the control antisense oligonucleotide or antisense oligonucleotide apoptosis-specific eIF-5A # 2 (SEQ ID NO:26) for a total of five days.
• the cells were treated with 40 ⁇ M camptothecin for 3 days. Antisense oligonucleotide and camptothecin-containing media was changed daily. The percentage of apoptotic cells was determined by labeling the cells with Hoescht. See figure 58.
• the lamina cribrosa cell line # 517 was left either untreated, or was treated with 10 ng/ml TNF- ⁇ , 50 ⁇ M camptothecin, or 10 ng/ml TNF- ⁇ and 50 ⁇ M camptothecin. The percentage of apoptotic cells was determined by labeling the cells with Hoescht. See figure 59.
• the lamina cribrosa cell lines # 506 and # 517 were transfected with either 2.5 ⁇ M or 5 ⁇ M of either the control antisense oligonucleotide or antisense oligonucleotide apoptosis-specific eIF-5A # 2 (SEQ ID NO:26) for a total of two days.
• Fresh media containing antisense oligonucleotides was added after 24 hours.
• Forty- eight hours after beginning antisense oligonucleotide treatment the cells were treated with 50 ⁇ M camptothecin and 10 ng/ml TNF- ⁇ for 2 days. The percentage of apoptotic cells was determined by labeling the cells with Hoescht. See figure 60.
• the lamina cribrosa cell lines # 506, # 517, and # 524 were transfected with 2.5 ⁇ M of either the control antisense oligonucleotide or antisense oligonucleotide apoptosis-specific eIF-5A # 2 (SEQ ID NO:26) for a total of two days.
• Fresh media containing antisense oligonucleotides was added after 24 hours.
• Forty-eight hours after beginning antisense oligonucleotide treatment the cells were treated with 50 ⁇ M camptothecin and 10 ng/ml TNF- ⁇ for 2 days. The percentage of apoptotic cells was determined by labeling the cells with Hoescht. See figure 61.
• EXAMPLE 12 The following experiments show that cells transfected with siRNAs targeted against apoptosis-specific eIF-5A expressed less apoptosis-specific eIF-5A. The experiments also show that siRNAs targeted against apoptosis-specific eIF-5A were able to reduce apoptosis.
• the lamina cribrosa cell line # 517 was transfected with 100 nM of FAM-labeled siRNA using Lipofectamine 2000 transfection reagent either with serum (A) or without serum (B) during transfection.
• the cells, (A) and (B) were fixed after a total of 24 hours and visualized on a fluorescent microscope under UV light using a fluorescein filter. See figure 62.
• RKO cells were transfected with 100 nM of siRNA either in the presence or absence of serum during the transfection.
• Six siRNAs were transfected, two control siRNAs (siRNA # 5 (SEQ ID NO:34) and one targeted against GAPDH) and four targeted against apoptosis-specific eIF-5A (siRNA # 1 to # 4)(SEQ ID NO:30-33).
• the cell extract was harvested and 5 ⁇ g of protein from each sample was separated on an SDS-PAGE gel, transferred to a PVDF membrane, and Western blotted with an antibody against apoptosis-specific eIF-5 A.
• lamina Cribrosa cell lines # 506 and # 517 were transfected with 100 nM of siRNA. Six siRNAs were transfected, two control siRNAs (siRNA # 5 (SEQ ID NO:34) and one targeted against GAPDH) and four targeted against apoptosis- specific eIF-5A (siRNA # 1 to # 4)(SEQ ID NO:30-33).
• the cell extract was harvested and 5 ⁇ g of protein from each sample was separated on an SDS-PAGE gel, transferred to a PVDF membrane, and Western blotted with an antibody against apoptosis-specific eIF-5A. After chemiluminescent detection, the membrane was stripped and re-probed with an antibody against actin. See figure 64.
• the lamina cribrosa cell line # 506 was transfected with 100 nm of siRNA.
• siRNA # 5 (SEQ ID NO:34) and one targeted against GAPDH) and four targeted against apoptosis-specific eIF-5A (siRNA # 1 to # 4)(SEQ ID NO:30-33).
• the media was replaced with media containing 50 ⁇ M camptothecin and 10 ng/ml TNF- ⁇ .
• the percentage of apoptotic cells was determined by labeling the cells with Hoescht. See figure 65
• the lamina cribrosa cell line # 506 was transfected with 100 nm of siRNA.
• siRNA # 5 (SEQ ID NO:34) and one targeted against GAPDH) and four targeted against apoptosis-specific eIF-5A (siRNA # 1 to # 4)(SEQ ID NO:30-33).
• the media was replaced with media containing 50 ⁇ M camptothecin and 10 ng/ml TNF- ⁇ .
• the percentage of apoptotic cells was determined by labeling the cells with Hoescht. See figure 66.
• the lamina cribrosa cell line # 506 was either left untransfected or was transfected with 100 nm of siRNA.
• siRNA # 5 (SEQ ID NO:34) and one targeted against GAPDH) and four targeted against apoptosis-specific eIF-5A (siRNA # 1 to # 4)(SEQ ID NO:30-33).
• the media was replaced with media containing 50 ⁇ M camptothecin and 10 ng/ml TNF- ⁇ . Fresh media was also added to the untransfected, untreated control cells. Forty-eight hours later, the percentage of apoptotic cells was determined by labeling the cells with Hoescht. See figure 67. Photographs of Hoescht-stained lamina cribrosa cell line # 506 transfected with siRNA and treated with camptothecin and TNF- ⁇ from the experiment described in figure 67 and example 13 are provided in figure 68.
• EXAMPLE 13 This example shows that treating a human cell line with antisense oligonucleotides directed against apoptosis-specific eIF-5A causes the cells to produce less TNF- ⁇ .
• HepG2 cells were treated with 2.5 ⁇ M of either the control antisense oligonucleotide or antisense oligonucleotide apoptosis-specific eIF-5A # 2 for a total of two days.
• Fresh media containing antisense oligonucleotides was added after 24 hours. Additional cells were left untreated for two days. Forty-eight hours after the beginning of treatment, the cells were treated with IL-l ⁇ (1000 pg/ml) in fresh media for 6 hours.
• TNF- ⁇ quantification TNF- ⁇ released into the media was measured using ELISA assays purchased from Assay Designs Inc. See figure 69. Cells that were transfected with antisense oligonucleotides of apoptosis-specific eIF-5A produced less TNF- ⁇ .
• HT-29 cells human colon adenocarcinoma
• siRNA against apoptosis-specific eIF-5A or with a control siRNA with the reverse sequence.
• the siRNA used is as follows:
• U-937 is a human monocyte cell line that grows in suspension and will become adherent and differentiate into macrophages upon stimulation with PMA (ATCC Number CRL-1593.2)(cells not obtained directly from ATCC). Cells were maintained in RPMI
• Cells were split into fresh media (1 :4 or 1 :5 split ratio) twice a week and the cell density was always kept between 105 and 2 x 106 cells/ml.
• Cells were cultured in suspension in tissue culture-treated plastic T-25 flasks and experiments were conducted in 24-well plates.
• Equal volumes of cell suspension and trypan blue solution (0.4%> trypan blue dye in PBS) were mixed and the live cells were counted using a haemocytometer and a microscope.
• the cells were diluted to 4 x 105 cells/ml.
• a 24-well plate was prepared by adding either PMA or DMSO (vehicle control) to each well. 1ml of cell suspension was added to each well so that each well contained 400,000 cells, 0.1 % DMSO +/- 162 nM PMA.
• the cells were maintained in a 37°C CO 2 (5%) incubator. Separate wells of cells were harvested at times 0, 24, 48, 72, 96, 99 and 102 h. See Figure 76 for a summary of the experimental time points and additions.
• the media was changed at 72 h. Since some cells were adherent and others were in suspension, care was taken to avoid disrupting the adherent cells.
• the media from each well was carefully transferred into corresponding microcentrifuge tubes and the tubes were centrifiiged at 14,000 xg for 3 min. The tubes were aspirated, the cell pellets were resuspended in fresh media (1 ml, (-) DMSO, (-) PMA), and returned to their original wells. The cells become quiescent in this fresh media without PMA.
• LPS 100 ng/ml
• the suspension cells and media were transferred from each well into microcentrifuge tubes.
• the cells were pelleted at 14,000 xg for 3 min.
• the media (supernatant) was transferred to clean tubes and stored (-20°C) for ELISA cytokine analysis.
• the cells remaining in the wells were washed with PBS (1ml, 37°C) and this PBS was also used to wash the cell pellets in the corresponding microcentrifuge tubes.
• the cells were pelleted again at 14,000 xg for 3 min.
• the cells were lysed with boiling lysis buffer (50 mM Tris pH 7.4 and 2% SDS).
• the adherent cells and the suspension cells from each well were pooled.
• the samples were boiled and then stored at -20°C.
• the secondary antibody was a horseradish peroxidase-conjugated antimouse antibody (Sigma, 1 :5000 in 1%> skim milk, 1 h).
• the membranes were washed 3x10 mins PBS-t.
• the protein bands were visualized by chemiluminescence (ECL detection system, Amersham Pharmacia Biotech).
• ECL detection system Amersham Pharmacia Biotech
• the membranes were stripped and reprobed for actin.
• Membranes were stripped (100 mM 2- mercaptoethanol, 2% SDS, 62.5 mM Tris-HCl pH 6.7; 50°C for 30 mins), washed, and then blocked as above.
• FIG. 77 shows that eIF5A is upregulated during monocyte (U-397) differentiation and subsequent TNF- ⁇ secretion.
• EXAMPLE 16 Suppression of 11-8 production in response to interferon gamma by apoptosis-specific eIF-5A siRNA
• HT-29 human colon adenocarcinoma cells were transfected with siRNA directed to apoptosis-specific eIF-5A. Approximately 48 hours after transfection the media was changed so that some of the test samples had media with interferon gamma and some of the samples had media without interferon gamma. 16 hours after interferon gamma addition, the cells were washed, and the media, with or without TNF-alpha, was placed on the cells. The media (used for ELISA detection of IL-8) and the cell lysate was harvested 8 or 24 hours later. Figures 79 and 80 show that IL-8 is produced in response to TNF-alpha as well as in response to interferon.
• Figure 81 is a western showing up-regulation (4 fold at 8 hours) of apoptosis-specific eIF-5 A in response to interferon gamma in HT-29 cells.
• LC cells were enriched by subculture in 25 cm 2 flasks in DMEM supplemented with gentamycin, glutamine, and 10%) FBS. Cells were maintained and subcultured as per this protocol. The identity and population purity of cells populations obtained by differential subculturing was characterized using differential fluorescent antibody staining on 8 well culture slides. Cells were fixed in 10 %> formalin solution and washed three times with Dulbecco's Phosphate Buffered Saline (DPBS). Following blocking with 2 % nonfat milk in DPBS, antibodies were diluted in 1% BSA in DPBS and applied to the cells in 6 of the wells. The remaining two wells were treated with only 1 % bovine serum albumin (BSA) solution and only secondary antibody as controls.
• BSA bovine serum albumin
• LC cells Primary antibodies used to identify LC cells were: anti-collagen I, anti-collagen IV, anti-laminin, anti-cellular fibronectin, anti-glial fibrillary acidic protein (GFAP), and anti-alpha-smooth muscle actin.
• Cell populations were determined to be comprised of LC cells if they stained positively for collagen I, collagen IV, laminin, cellular fibronectin, alpha smooth muscle actin and negatively for glial fibrillary (GFAP).
• GFAP glial fibrillary
• siRNAs Small inhibitory RNAs directed against human apoptosis-specific elF- 5 A were used to specifically suppress expression of eIF5A in lamina cribrosa cells.
• Six siRNAs were generated by in vitro transcription using the SilencerTM siRNA Construction Kit (Ambion Inc.).
• siRNAs were generated against human apoptosis-specific eIF-5A (siRNAs # 1 to # 4).
• Two siRNAs were used as controls; an siRNA directed against GAPDH provided in the kit, and an siRNA (siRNA # 5), which had the reverse sequence of the apoptosis-specific eIF-5A specific siRNA # 1, but does not itself target eIF5A.
• the siRNAs were generated according to the manufacturer's protocol.
• the eIF5A and control siRNA targets had the following sequences: siRNA # 1 5'
• AAAGGAATGACTTCCAGCTGA 3' (SEQ ID NO: 81); siRNA # 2 5' AAGATCGTCGAGATGTCTACT 3' (SEQ ID NO: 82); siRNA # 3 5' AAGGTCCATCTGGTTGGTATT 3' (SEQ ID NO: 83); siRNA # 4 5' AAGCTGGACTCCTCCTACACA 3' (SEQ ID NO: 84); siRNA # 5' AAAGTCGACCTTCAGTAAGGA 3 ' (SEQ ID NO: 85). Lamina cribrosa cells were transfected with siRNA using LipofectAMINE 2000.
• Lamina cribrosa cells were transfected when cell confluence was at 40 to 70 %> and were generally seeded onto 8-well culture slides at 7500 cells per well three days prior to transfection.
• Transfection medium sufficient for one well of an 8-well culture slide was prepared by diluting 25.5 pmoles of siRNA to a final volume of 21.2 ⁇ l in Opti-Mem
• Lipofectamine 2000 0.425 ⁇ l was diluted to a final volume of 21.2 ⁇ l in Opti- Mem and incubated for 7 to 10 minutes at room temperature. The diluted Lipofectamine 2000 mixture was then added to the diluted siRNA mixture and incubated together at room temperature for 20 to 30 minutes. The cells were washed once with serum-free media before adding 135 ⁇ l of serum-free media to the cells and overlaying 42.4 ⁇ l of transfection medium. The cells were placed back in the growth chamber for 4 hours. After the incubation, 65 ⁇ l of serum-free media plus 30 %> FBS was added to the cells.
• Transfected cells that had been treated with TNF- ⁇ and camptothecin for 24 hours were stained with Hoescht 33258 in order to determine the percentage of cells undergoing apoptosis. Briefly, cells were fixed with a 3:1 mixture of absolute methanol and glacial acetic acid and then incubated with Hoescht stain (0.5 ⁇ g/ml Hoescht 33258 in PBS). After a 10 minute incubation in the dark, the staining solution was discarded, the chambers separating the wells of the culture slide were removed, and the slide was washed 3 times for 1 minute with deionized water. After washing, a few drops of Mcllvaine's buffer
• the culture slide was washed briefly with distilled water, and further washed by immersing the slide twice for 5 minutes in PBS (137mM NaCl, 2.68mM KC1, 1.47mM KH 2 PO 4 , 8.1mM Na 2 HPO 4 ), blotting the slide on paper towel between washes.
• PBS 137mM NaCl, 2.68mM KC1, 1.47mM KH 2 PO 4 , 8.1mM Na 2 HPO 4
• the cells were permeabilized by immersing them in 0.2 % Triton X-100 in PBS for 5 minutes.
• the cells were then washed again by immersing the slide twice for 5 minutes in PBS and blotting the slide on paper towel between washes.
• equilibration buffer 200 mM potassium cacodylate (pH 6.6), 25 mM Tris-HCl (pH 6.6), 0.2 mM dithiothreitol, 0.25 mg/ml bovine serum albumin, and 2.5 mM cobalt chloride] was added per well and incubated for 5 to 10 minutes.
• reaction mixture was prepared for each well by mixing in a ratio of 45:5:1, respectively, equilibration buffer, nucleotide mix [50 ⁇ M fluorescein- 12-dUTP, 100 ⁇ M dATP, 10 mM Tris-HCl (pH 7.6), and 1 mM EDTA], and terminal deoxynucleotidyl transferase enzyme (Tdt, 25 U/ ⁇ l).
• nucleotide mix 50 ⁇ M fluorescein- 12-dUTP, 100 ⁇ M dATP, 10 mM Tris-HCl (pH 7.6), and 1 mM EDTA
• Tdt terminal deoxynucleotidyl transferase enzyme
• the reaction was terminated by immersing the slide in 2 X SSC [0.3 M NaCl, and 30mM sodium citrate (pH 7.0)] and incubating for 15 minutes. The slide was then washed by immersion in PBS three times for 5 minutes. The PBS was removed by sponging around the wells with a Kim wipe, a drop of mounting media (Oncogene research project, JA1750-4ML) was added to each well, and the slide was overlayed with a coverslip. The cells were viewed under a fluorescent microscope using a UV filter (UV-G 365, filter set 487902) in order to count the Hoescht-stained nuclei. Any cells with brightly stained or fragmented nuclei were scored as apoptotic.
• 2 X SSC 0.3 M NaCl, and 30mM sodium citrate (pH 7.0)
• the cells were then viewed using a fluorescein filter (Green H546, filter set 48915) and any nuclei fluorescing bright green were scored as apoptotic.
• the percentage of apoptotic cells in the field of view was calculated by dividing the number of bright green nuclei counted using the fluorescein filter by the total number of nuclei counted under the UV filter. A minimum of 200 cells were counted per well.
• Protein extraction and Western blot analysis Protein was isolated for Western blotting from lamina cribrosa cells growing on 24-well plates by washing the cells twice in PBS (8 g/L NaCl, 0.2 g/L KC1, 1.44 g/L
• the membrane was then incubated for one hour in blocking solution (5 %> skim milk powder, 0.02 %> sodium azide in PBS) and washed three times for 15 minutes in PBS-T (PBS + 0.05 % Tween-20). The membrane was stored overnight in PBS-T at 4 °C. After being warmed to room temperature the next day, the membrane was blocked for 30 seconds in 1 ⁇ g/ml polyvinyl alcohol. The membrane was rinsed 5 times in deionized water and then blocked for 30 minutes in a solution of 5 % milk in PBS. The primary antibody was preincubated for 30 minutes in a solution of 5 % milk in PBS prior to incubation with the membrane.
• the primary antibodies used were anti-eIF5 A (BD Transduction Laboratories) at 1 :20,000 and anti- ⁇ -actin (Oncogene).
• the membranes were washed three times in PBS-T and incubated for 1 hour with the appropriate HRP-conjugated secondary antibodies diluted in 1 % milk in PBS.
• the blot was washed and the ECL Plus Western blotting detection kit (Amersham Pharmacia Biotech) was used to detect the peroxidase-conjugated bound antibodies.
• LC cells were exposed to either camptothecin, TNF- ⁇ , or a combination of camptothecin and TNF- ⁇ for 48 hours (Fig. 83). Hoescht staining revealed that TNF- ⁇ alone was not cytotoxic to LC cells. Treatment with camptothecin resulted in approximately 30 %> cell death of the LC cells. However, a synergistic increase in apoptosis was observed when LC cells were treated with both camptothecin and TNF- ⁇ , a treatment which resulted in the death of 45 %> of LC cells by 48 hours. These results indicate that LC cells are capable of responding to the cytotoxic effects of TNF- ⁇ when primed for apoptosis by camptothecin.
• EIF5 A is a nucleocytoplasmic shuttle protein known to be necessary for cell division and recently suggested to also be involved during apoptosis.
• the expression of apoptosis-specific eIF-5A protein in LC cells being induced to undergo apoptosis by either camptothecin, or camptothecin plus TNF- ⁇ .
• the expression of apoptosis-specific eIF-5A did not alter significantly upon treatment with camptothecin except perhaps to decrease slightly (Fig. 84A). However, a significant upregulation of apoptosis-specific eIF-5A protein was observed after 8 and 24 hours of camptothecin plus TNF- ⁇ treatment (Fig. 84B).
• siRNAs # 1 to # 4 TNF- ⁇ -induced apoptosis in LC cells
• siRNAs # 1 to # 4 a series of four siRNAs targeting apoptosis-specific eIF-5A were designed and synthesized by in vitro transcription.
• LC cell lines # 506 and # 517 were transfected with each of the siRNAs and expression of apoptosis-specific eIF-5A protein in the cell lysate was examined 72 hours later (Fig. 85).
• siRNA # 5 an siRNA against GAPDH and/or a control siRNA having the same chemical composition as siRNA #1 but which does not recognize apoptosis-specific elF- 5 A. All siRNAs directed against apoptosis-specific eIF-5A were capable of significantly suppressing apoptosis-specific eIF-5A expression in both LC cell lines (Fig. 85).
• the GAPDH siRNA was used as an additional control because, unlike the control siRNA # 5 which simply has the reverse sequence of siRNA # 1 and does not have a cellular target, it is an active siRNA capable of suppressing the expression of it's target protein, GAPDH (data not shown).
• siRNAs against apoptosis-specific eIF-5 A were also capable of protecting transfected LC cells (# 506) from apoptosis induced by 24 hour treatment with TNF- ⁇ and camptothecin (Fig. 86).
• the siRNAs (siRNAs # 1 to # 4) were found to be able to reduce apoptosis of LC cells by 59 % (siRNA # 1), 35 % (siRNA # 2), 50 % (siRNA # 3), and 69 % (siRNA # 4).
• siRNA against GAPDH was also able to reduce apoptosis of LC cells by 42 % (Fig. 86).
• GAPDH is known to have cellular functions outside of it's role as a glycolytic enzyme, including a proposed function during apoptosis of cerebellar neurons (Ishitani and Chuang, 1996; Ishitani et al, 1996a; Ishitani et al, 1996b).
• siRNA # 1 was able to reduce apoptosis of the LC line # 517 by 53 %> in response to TNF- ⁇ and camptothecin indicating that apoptosis- specific eIF-5A siRNAs are protective for LC cells isolated from different optic nerve heads (Fig. 87).
• apoptosis-specific eIF-5A does have a function during apoptosis and may be an important intermediate in the pathway leading to TNF- ⁇ - induced apoptosis in LC cells.
• DNA fragmentation was evaluated in situ using the terminal deoxynucleotidyl transferase-mediated dUTP-digoxigenin nick end labeling (TUNEL) method.
• LC cells (# 506) were treated with TNF- ⁇ and camptothecin for 24 hours, 3 days after transfection with either an apoptosis-specific eIF-5A siRNA (siRNA # 1) or a control siRNA (siRNA # 5). The cells were also stained with Hoescht to facilitate visualization of the nuclei. 46 % of LC cells transfected with the control siRNA were positive for TUNEL staining while only 8 %> of LC cells transfected with apoptosis-specific eIF-5A siRNA # 1 were positively labeled indicating that the apoptosis-specific eIF-5 A siRNA provided greater than 80 % protection from apoptosis (Fig. 88). Similar results were obtained with apoptosis-specific eIF-5 A siRNA # 4 which provided greater than 60 % protection from apoptosis relative to the control siRNA (data not shown).
• PBMCs Blood Collection and Preparation of PBMCs Approximately 10 ml of blood was collected from each healthy donor. The blood was collected by venapuncture in a vacutainer containing sodium citrate as the anticoagulant. The samples were processed within 24 hours of collection. A 60% SIP (9 parts v/v Percoll with 1 part v/v 1.5M NaCl) was cushioned on the bottom of 15ml conical tubes. The blood was then layered overtop with minimal mixing of the blood and Percoll cushion. The samples were centrifiiged for 30 minutes total at lOOOxg with slow acceleration in the first 5 minutes and slow deceleration in the last 5 minutes.
• the pure serum at the very top of the resulting gradient was removed and the white cushion (l-2ml) of PBMCs was collected and added dropwise to a tube containing 10ml of warm RPMI plus 15% FBS.
• the PBMCs were pelleted and counted.
• PBMCs Stimulation to induce cytokine production in PBMCs over a time course
• PBMCs were isolated and seeded at 2xl0 5 to 5xl0 5 cells/well.
• the cells were treated with phorbol 12-myristate 13-acetate (PMA; lOOng/well).
• PMA phorbol 12-myristate 13-acetate
• the media was replaced and did not contain any stimulating factors.
• lipopolysaccharide LPS; 100 ng/well; from E. coli, serotype 0111
• Samples were collected before LPS addition (96h), and at various times after addition as outlined in Figure 91.
• Both adherent cells (likely to be monocytes and macrophages) were collected with the floating cells (likely to be -lymphocytes).
• the media from each well was transferred to clean microcentrifuge tubes and cleared of any debris by centrifugation at 13000 x g for 3 minutes. The resulting pellet was collected with the adherent cells.
• the media was stored at -20°C in 200-250 ⁇ l aliquots prior to analysis.
• the cells were washed with 1 ml of 37°C phosphate buffered saline (PBS) and then lysed in boiling lysis buffer (50 mM Tris pH 7, 2% SDS; lOO ⁇ l per well).
• the cell lysates were boiled and stored frozen at -20°C.
• the Western blot is shown in Figure 92 and the corresponding ELISA in Figure 93.
• PBMC Stimulation to induce apoptosis-specific eIF-5A expression PBMCs were collected and seeded at 2xl0 5 to 5xl0 5 cells/well. To determine which stimulators induce apoptosis-specific eIF-5A, as well as to see if they act synergistically, the PBMCs were stimulated with phytohemagglutinin (PHA; 1 OOng/ml), phorbol 12-myristate 13-acetate (PMA; 1 OOng/ml), lipopolysaccharide (LPS; 1 OOng/ml) or all three (each at lOOng/ml). The samples were collected 12 and 36 hours after stimulation and analyzed for apoptosis-specific eIF-5A expression (Figure 94).
• PHA phytohemagglutinin
• PMA phorbol 12-myristate 13-acetate
• LPS lipopolysaccharide
• PBMCs were transfected the day they were prepared. Cells were seeded at 2xl0 5 to 5xl0 5 cells/well (150 ⁇ l per well for transfection in a 24-well plate). They were either transfected individually in each well (Donors 77, 78 and 79; Figures 95 and 96) or all at once in a conical tube before seeding (Donors 80 and 84; Figure 96).
• siRNA was diluted in 50 ⁇ l of Opti-MEM (Sigma), l ⁇ l of Lipofectamine 2000 (Invitrogen) was diluted in 49 ⁇ l of Opti-MEM, incubated for 7 to 10 minutes, added to the diluted siRNA and incubated 25 minutes.
• the transfection medium was overlayed onto the cells were placed in the 37°C growth chamber for 4 hours. The final transfection medium contained 9 % serum. After the incubation, 250 ⁇ l of serum-free RPMI + 21 %> FBS was added to the cells to make the final serum concentration 15%>.
• LPS lipopolysaccharide
• the media was stored at -20 °C in 200 - 250 ⁇ l aliquots prior to analysis.
• the cells were washed with 1 ml of 37 °C phosphate buffered saline (PBS) and then lysed in boiling lysis buffer (50 mM Tris pH 7, 2% SDS; 1 OO ⁇ l per well).
• the cell lysates were boiled and stored frozen at -20°C for BCA protein quantitation.
• EXAMPLE 19 Cell Culture HT-29, a human colorectal adenocarcinoma cell line, was maintained in RPMI with 10 %> fetal bovine serum (FBS).
• FBS fetal bovine serum
• U937 a histiocytic lymphoma cell line, was grown in suspension in RPMI with 10% FBS. Both cell lines were maintained in a humidified environment at 37 °C and 5 %> CO 2 .
• cells were counted and adjusted to 3 x 10 5 cells/ml two days before the start of the experiment.
• siRNA siRNA sequences were designed based on the human apoptosis-specific eIF-5A sequence and were synthesized by Dharmacon RNA Technologies.
• the apoptosis-specific eIF-5A siRNA (h5Al) target sequence was: 5' NNGCUGGACUCCUCCUACACA 3'.
• the corresponding double stranded siRNA sequence was: 5' GCUGGACUCCUCCUACACAdTdT 3' 3' dTdTCGACCUGAGGAGGAUGUGU 5'
• control siRNA (hcontrol) sequence was 5 ' NNACACAUCCUCCUCAGGUCG 3 ' .
• the corresponding double stranded siRNA sequence was: 5' ACACAUCCUCCUCAGGUCGdTdT 3' 3' dTdTUGUGUAGGAGGAGUCCAGC 5'
• HT-29 cells were seeded at 105,000 cells per well onto a 24-well plate.
• 25.5 pmoles of siRNA was diluted in 50 ⁇ l of Opti-Mem (Sigma).
• 1 ⁇ l of Lipofectamine 2000 (Invitrogen) was diluted in 49 ⁇ l of Opti-Mem, incubated for 7 to 10 minutes and added to the diluted siRNA and incubated 25 minutes.
• the cells to be transfected were washed once with serum-free RPMI before adding 300 ⁇ l of serum- free RPMI and overlaying 100 ⁇ l of transfection medium. The cells were placed back in the growth chamber for 4 hours. After the incubation, 300 ⁇ l of serum-free RPMI + 30 %> FBS was added to the cells.
• Electroporation ofU937 Cells apoptosis-specific eIF-5A and control siRNA were diluted in Opti-Mem media (Sigma). 400 ⁇ l cells (800,000 cells) and 100 pmoles siRNA were mixed in a 0.4mm electroporation cuvette. The cells were electroporated at 300 V, 10 mSec, 1 pulse with an ECM 830 Electrosquare porator (BTX, San Diego, CA). Following electroporation, the cells were gently mixed and added to wells containing RPMI and concentrated FBS so that the final FBS concentration was 10%.
• HT-29 cells were primed with 200 units/ml interferon gamma (Roche Diagnostics) 48 hours after transfection. After 16 hours of interferon gamma (IFN ⁇ ) priming the cells were washed with media and lipopolysaccharide (LPS; 100 ng/ml; from E. coli, serotype 0111; Sigma) was added at 100 ⁇ g/ml. After 8 or 24 hours of LPS stimulation, the media from each well was transferred to microcentrifuge tubes and stored at -20°C until assayed for TNF ⁇ by ELISA.
• IFN ⁇ interferon gamma
• LPS lipopolysaccharide
• the cells were washed with 1 ml of phosphate buffered saline (PBS) heated to 37°C and then lysed in boiling lysis buffer (50 mM Tris pH 7, 2% SDS). The cell lysates were boiled and stored frozen at -20°C. The protein concentration in the cell lysates was determined by bicinchoninic acid assays (BCA) with bovine serum albumin used as the standard. IL-8 production was induced in HT-29 cells by treatment with IFN ⁇ . HT-29 cells were treated with 200 units/ml IFN ⁇ 48 hours after transfection.
• PBS phosphate buffered saline
• BCA bicinchoninic acid assays
• the media from each well was transferred to microcentrifuge tubes and stored at -20°C until assayed for IL-8 by liquid-phase electrochemiluminescence (ECL).
• ECL liquid-phase electrochemiluminescence
• the cells were washed with 1 ml of phosphate buffered saline (PBS) heated to 37°C and then lysed in boiling lysis buffer (50 mM Tris pH 7, 2% SDS).
• the cell lysates were boiled and stored frozen at -20°C.
• the protein concentration in the cell lysates was determined by bicinchoninic acid assays (BCA) with bovine serum albumin used as the standard.
• BCA bicinchoninic acid assays
• U937 cells were collected and counted 16 hours after electroporation. 200,000 cells in 1ml of media were added to each well of 24-well plates. Macrophage differentiation was stimulated by adding phorbol 12-myristate 13-acetate (PMA; 100 ng/ml). After 48h with PMA, >80% of the monocytes had transformed from cells in suspension (monocytes) to adherent cells (macrophages). At 48 hours the media and any non-adherent cells were removed and fresh RPMI media with 10% FBS (1ml per well) was added. The cells were left for 24 hours in fresh media to become quiescent.
• PMA phorbol 12-myristate 13-acetate
• LPS lipopolysaccharide
• IFN ⁇ interferon ⁇
• Samples were collected before stimulator addition (72h), and at various times after addition as outlined in Figure 108.
• the media from each well was transferred to clean microcentrifuge tubes and cleared of any debris by centrifugation at 13000 x g for 3 mins.
• the media was stored at -20°C in 200-250 ul aliquots prior to analysis.
• the cells were washed with 1 ml of 37°C phosphate buffered saline (PBS) and then lysed in boiling lysis buffer (50 mM Tris pH 7, 2% SDS; 75 ⁇ l per well). Like wells were pooled.
• the cell lysates were boiled and stored frozen at -20°C.
• TNF ⁇ was quantified using ELISA kits from Assay Designs according to the manufacturer's instructions with supplied standards for 0-250 pg TNF ⁇ /ml.
• media samples for TNF ⁇ were diluted 20 fold (Oh, 3h LPS) or 80 fold (6h, 24h, 30h LPS) with RPMI + 10% FBS.
• IL-l ⁇ , IL-8, and IL-6 were quantified by liquid-phase electrochemiluminescence (ECL).
• ECL liquid-phase electrochemiluminescence
• IL-8, IL-l ⁇ , and IL-6 were assayed by liquid-phase. Briefly, a purified monoclonal mouse anti- mouse anti-human IL-8, IL-6 or IL-l ⁇ (R & D Systems) were labeled with biotin (Igen, Inc., Gaithersburg, MD). In addition, the goat anti-human IL-8, IL-6, or IL-l ⁇ antibody (R & D) were labeled with ruthenium (Igen) according to the manufacturer's instructions. The biotinylated antibodies were diluted to a final concentration of 1 mg/mL in PBS, pH 7.4, containing 0.25% BSA, 0.5% Tween-20 and 0.01%o azide, (ECL buffer).
• the protein concentration in the cell lysates was determined by bicinchoninic acid assays (BCA) with bovine serum albumin used as the standard. 5 ⁇ g of total cellular protein was separated by either 10%> or 14% SDS-PAGE (sodium dodecyl sulfate polyacrylamide gel electrophoresis). 10%> gels were used for analysis of proteins above 50 kDa (TLR4, IFN ⁇ , TNF-R1, iNOS) while 14% gels were used for apoptosis-specific elF- 5 A (17 kDa).
• PVDF polyvinylidene fluoride
• TLR4 Santa Cruz Biotechnology Inc; TLR4 (H-80): sc-10741; 1 :1000; incubate 2 hours
• IFN- ⁇ R ⁇ Santa Cruz Biotechnology Inc; IFN- ⁇ R ⁇ (C-20): sc-700; 1 : 1000; incubate 1 hour
• TNF-R1 TNF-R1
• HRP horseradish peroxidase-conjugated
• RT-PCR RT-PCR was performed according to Medvedev et al. 2002 in order to observe changes in TLR4 mRNA expression in transfected HT-29 cells in response to IFN ⁇ . Expression of GAPDH was used as a control to show that equal amounts of cDNA were being used between samples. Increasing PCR cycles (20, 25, 30, and 35) were used to determine the optimal cycle number that resulted in detectable amplified products under nonsaturating conditions. PCR products were detected by ethidium bromide-inco ⁇ oration and were separated by agarose gel electrophoresis.
• RT-PCR of total mRNA isolated from siRNA-transfected HT-29 cells treated with or without IFN ⁇ for 6 hours was used to detect TLR4 and GAPDH transcripts.
• HT-29 cells were transfected with siRNA as described above. 48 hours after transfection, the cells were treated with 200 units/ml IFN ⁇ . Control cells which were not treated with IFN ⁇ received only a media change.
• Total mRNA was isolated using the GenElute Mammalian RNA miniprep kit (Sigma) according to the manufacturer's protocol for adherent cells. The media was removed and the cells were washed twice with warm PBS. Lysis buffer was added to the cells and the lysate was transferred to a microcentrifuge tube and total RNA was isolated according to the manufacturer's protocol.
• the primers for TLR4 were: Forward 5' CGGATGGC AAC ATTTAGAATT AGT 3 ' Reverse 5' TGATTGAGACTGTAATCAAGAACC 3' Expected fragment size: 674 bp
• the primers for GAPDH were: Forward 5' CTGATGCCCCC ATGTTCGTC AT 3 ' Reverse 5' CCACCACCCTGTTGCTGTAG 3' Expected fragment size: 599 bp
• the total RNA was reverse transcribed using the following conditions:
• a single PCR reaction was performed using the following conditions:
• the PCR conditions for GAPDH were: Heat to 95°C 5min

Landscapes

• Health & Medical Sciences (AREA)
• Life Sciences & Earth Sciences (AREA)
• Engineering & Computer Science (AREA)
• Chemical & Material Sciences (AREA)
• Genetics & Genomics (AREA)
• Organic Chemistry (AREA)
• Bioinformatics & Cheminformatics (AREA)
• General Health & Medical Sciences (AREA)
• Biomedical Technology (AREA)
• Molecular Biology (AREA)
• Veterinary Medicine (AREA)
• Medicinal Chemistry (AREA)
• Pharmacology & Pharmacy (AREA)
• Animal Behavior & Ethology (AREA)
• Public Health (AREA)
• General Engineering & Computer Science (AREA)
• Zoology (AREA)
• Wood Science & Technology (AREA)
• Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
• General Chemical & Material Sciences (AREA)
• Chemical Kinetics & Catalysis (AREA)
• Biotechnology (AREA)
• Biochemistry (AREA)
• Biophysics (AREA)
• Physics & Mathematics (AREA)
• Plant Pathology (AREA)
• Microbiology (AREA)
• Immunology (AREA)
• Rheumatology (AREA)
• Pain & Pain Management (AREA)
• Epidemiology (AREA)
• Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
• Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
• Micro-Organisms Or Cultivation Processes Thereof (AREA)

Applications Claiming Priority (6)

Publications (1)

Family

ID=34084831

Family Applications (1)

Country Status (9)

Families Citing this family (15)

Family Cites Families (7)

• 2004
  • 2004-06-07 WO PCT/US2004/018012 patent/WO2005007853A2/en active Search and Examination
  • 2004-06-07 CA CA002528372A patent/CA2528372A1/en not_active Abandoned
  • 2004-06-07 JP JP2006515257A patent/JP5666074B2/ja not_active Expired - Fee Related
  • 2004-06-07 TW TW093116334A patent/TW200512293A/zh unknown
  • 2004-06-07 NZ NZ574973A patent/NZ574973A/en unknown
  • 2004-06-07 KR KR1020057023388A patent/KR20060013428A/ko not_active Application Discontinuation
  • 2004-06-07 EP EP04785931A patent/EP1636364A2/de not_active Withdrawn
  • 2004-06-07 NZ NZ544159A patent/NZ544159A/en unknown
  • 2004-06-07 AU AU2004258070A patent/AU2004258070B2/en not_active Ceased
• 2005
  • 2005-12-05 IL IL172365A patent/IL172365A0/en unknown

Non-Patent Citations (1)

Also Published As

Similar Documents

Legal Events