EP1579014A2

EP1579014A2 - Method for the detection of legionella-type bacteria

Info

Publication number: EP1579014A2
Application number: EP04762665A
Authority: EP
Inventors: Antje Breitenstein; Tarja Rosilainen; Peter Neubauer
Original assignee: Scanbec GmbH
Current assignee: Scanbec GmbH
Priority date: 2003-08-15
Filing date: 2004-08-13
Publication date: 2005-09-28
Also published as: WO2005017194A3; US20070184437A1; DE112004002047D2; WO2005017194A2; DE10338123B3

Abstract

The invention relates to methods for detecting legionella-type bacteria by means of the sandwich hybridization process at temperatures of 50 to 55 °C. According to the invention, newly developed oligonucleotides whose sequences allow the bacteria and the legionella type to be detected in a type-specific or species-specific manner are used as collector probes and detection probes for said detection method. The collector probes and detection probes can advantageously be interchanged for the type-specific and species-specific detection of legionella species. Moreover, the inventive method can be carried out for species-specific probes by means of combinations of oligonucleotides.

Description

Method for the detection of bacteria of the genus Legionella

The invention relates to a method for the detection of bacteria of the genus Legionella by means of the sandwich hybridization method.

Legionella spp. are gram-negative, rod-shaped and facultative intracellular pathogens. There are more than 42 species with 64 sero groups.

They are found as intracellular parasites of amoeba and ciliates, usually in an aqueous environment and in wet soil. They are also found in or on artificially made places or products such as cooling towers, clinical ventilators, whirlpools or showers.

Humans become infected with Legionella after inhaling contaminated aerosol drops from the above-mentioned habitats. In the lungs, Legionella bacteria infect macrophages and can cause a form of pneumonia known as Legionnaires' disease. The symptoms begin with a weak cough, malaise, muscle pain, mild fever, and gastrointestinal disorders and increase to high fever, alveolitis and bronchitis. Legionella pneumophila is the most important pathogen for legionellosis, but other species of the genus L. can also be considered as pathogens in humans.

For the detection of the Legionella species in water samples, the culture method, methods based on polymerase chain reactions and the use of monoclonal antibodies are known from the literature. Hybridization with fluorescence-labeled probes is also used.

Furthermore, US 5,569,568 A disclosed the use of the sandwich hybridization method. This method is based on the use of two oligonucleotide probes - a capture probe and a detection probe. The capture probe is covalently bound to a solid surface. First, the target nucleic acid to be examined hybridizes with the two probes at specific temperatures. The target nucleic acid and the probe complex then bind to the solid surface of the capture probe. The detection can be done with fluorescence or chemiluminescence, color reactions or radioactive labels. The properties of the are important for the success of this method Probes for the specific hybridization. This is only partially guaranteed by the current state of the art.

The object of the invention is therefore to produce and use new genus and species-specific oligonucleotides for the detection of bacteria of the genus Legionella.

According to the invention, the object is achieved in that a) for the detection of the entire genus Legionella, an oligonucleotide of the sequence 5- CCTCCTCCCCACTGAAAGT-3 ^' as a capture probe and an oligonucleotide of the sequence 5 ^' -CACTGTATGTCAAGGGTAGG as a detection probe; b) for the detection of Legionella pneumophila as a capture probe an oligonucleotide of the sequence 5 ^' -ATCTGACCGTCCCAGGTT-3 ^' and as a detection probe an oligonucleotide of the sequence 5 ^' -TTCGCCGCCCTCTGTATCG-3'; c) for the detection of Legionella feelei as capture probe an oligonucleotide of the sequence 5 ^{^{'-GCGCCACTAACCTCATTCAT-3'}} and as a detection probe, an oligonucleotide of the sequence 5 ^{^{'-TATACAACCACCTACGCACC-3'}} and d) for detection of Legionella Jordan capture probe is an oligonucleotide of Sequence 5 ^' -CCACTCCTCCCCACTGAAAG-3 ^' and an oligonucleotide of sequence 5 TrACGGTCCCCAGCTTTTT-3 ^{'can be used} as detection probe and the hybridization takes place at temperatures from fifty to fifty-five degrees Celsius.

The most important data of the new oligonucleotide probes are shown in Table 1 below.

Name of the sequence Target position Probe in the specific probe .. Species in E.coli sandwich hybridization 16SrRNA hybridization temp.

legpneu l 5 ^' -TTCGCCGCCCTCTGTATCG-3' L. 575-594 detection 50 ° Iegpne 2 5 ^' -ATCTGACCGTCCCAGGTT-3 ^' pneumo- 626-643 catcher phila legfeeM 5 ^' -GCGCCACTAACCTCAπCAT-3 ^' L. 840-859 catcher 55 ° C legfeel 2 5 ^' -TATACAACCACCTACGCACC-3 ^' feelei 575-594 detection

legjor 1 5'-CTTACGGTCCCCAGCI 1 1 1 1-3 ^'L. 192-211 detection legjor 50 ° C 2 ^5' -CCACTCCTCCCCACTGAAAG-3 ^'435-454 scavenger jordanis

legall 11 5 ^' - CCTCCTCCCCACTGAAAGT-3 ^' Genus 433-451 catcher legall 22 5 ^' - CACTGTATGTCAAGGGTAGG legionella 983-1001 detection 50 ° C

In species-specific detection of Legionella species, the oligonucleotides for capture probes and detection probes are interchangeable according to claim 2.

Furthermore, the detection of bacteria of the genus Legionella according to claim 3 is carried out with combinations of oligonucleotides for genus-specific probes and oligonucleotides for species-specific probes.

Another advantage is that the new genus and species-specific oligonucleotide probes were all developed for hybridization at temperatures of 50-55 ° C. This enables combinations of more than 2 probes, which are the prerequisite for the detection of more than 1 Legionella species in one test. For this purpose, magnetic beads are mixed with different capture probes for the detection of individual Legionella species (multiplex analysis), for example capture probes for the detection of L. p. with capture probes for the detection of L. f. or others in combination with a genus-specific detection probe.

The method according to the invention is explained in more detail below with reference to the accompanying drawings.

Figure 1 p.8 shows a schematic representation of the sand wipe hybridization method.

The capture probe 1 is labeled with biotin 4; binds to magnetic beads 7 coated with streptavidin 7. After hybridization of the target nucleic acid with the two probes 1 and 2, detection is carried out with alkaline phosphatase 6 which is attached to the digoxigenin labeled detection probe 2 binds via Anti DIG Fab fragments. The detection of the amplified fluorescence signal can be quantified by a fluorescence reader. Another possibility of detection is the detection of the activity of the alkaline phosphatase by electrochemical sensors.

Total DNA samples from different Legionella species are used for sample preparation. The 16S ribosomal DNA (rDNA) was amplified from the total DNA of various Legionella species using the fD1 and rP2 universal primers for the 16SrDNA by means of PCR. The promoter region of the T7 polymerase was contained in the fD1. 166Sr RNA transcribed in vitro was prepared from the corresponding PCR products from Legionella (16SrDN A) using the DIG RNA LabelingKit (SP6 / T7) (Röche) or the MAXIscript-Kit / Ambion.

The effectiveness of the oligonucleotide probe was tested by the slot blot method. In vitro transcribed 16SrRNA (ribosomal of the small subunit of bacterial ribosomes) was used as the target molecule.

The slot blot hybridizations were carried out according to the protocol of the DIG System User ^'s guide for Filter Hybridiziation, Boehringer Mannheim (1995). 1000 fmol of 16SrRNA of various Legionella species transcribed in vitro were prepared in RNA solution buffer (DEPC-HO, 20xSC, formaldehyde (5: 3: 2) and denatured for 10 minutes at 65 ° C. Then the

Samples are applied to a positively charged nylon membrane (Hybond-N) using a vacuum slot blotter (Bio-Rad). This membrane had been washed with 20xSSC (3MNaCI and 300 mM sodium citrate pH 7.0) before and after blotting. The nucleic acids were then bound to the membrane using UV light (for 2 minutes.

The pre-hybridization was carried out in high SDS buffer (7% SDS; 50% formaldehyde, 5x SSC, 2% Blocking Reagent (Roche), 50mM sodium phosphate pH 7 = and 0.1% lauryl sarcosine) for two hours at hybridization temperature The hybridization then took place overnight in high SDS buffer with 100 pmol DIG-labeled oligonucleotide probe at 50-55 ° C. depending on the melting temperature of the probe. The samples were triple at the 3 ^' end with the DIG oligonucleotide Labeling kit (Röche Diagnostics GmbH) labeled with digoxigenin according to the manufacturer's protocol.

After hybridization, the membrane was washed twice with 2x SSC; 0.1% SDS washed for 5 minutes followed by two washes with 0.1 x SSC; 0.1% SDS, 0.2 x SSC; 0.1% SDS or 0.5 x SSC; 0.1% SDS for 20 minutes at hybridization temperature to remove the unbound probe. The membrane was then incubated in maleic acid buffer (0.1 M maleic acid and 0.15 M NaCl, pH 7.5) with 0.3% Tween 20 ™ for 5 minutes at room temperature in order to avoid non-specific binding of the alkaline phosphatase. The membrane was incubated for 30 minutes in maleic acid buffer with 0.1% blocking solution (Röche). The anti-digoxigenin-alkaline phosphatase (AP) was then diluted 1: 20,000 in maleic acid buffer with 1% blocking solution and the membrane was incubated in the antibody solution for 30 minutes. The membrane was washed twice with maleic acid buffer with 0.3% Tween 20 for 15 minutes and 1-equilibrated in detection buffer (100 mM Tris-HCl, pH 9.5 and 100 mM NaCl) for 5 minutes. The CDP-Star ™ substrate (Röche) used as substrate for the alkaline phosphase was diluted 1: 100 in detection buffer, applied to the surface of the membrane and sealed in plastic film for 10 minutes. The membrane was exposed (Hyperfilm ECL, Amersham Pharmacia Biotech). The time period was first 1 hour and later 10 or 5 minutes to reduce the color of the background.

The results of the slot blot test ^'s show the following. 1. Probes for the detection of the genus Legionella The Legall 11 probe hybridizes with the 16 rRNA transcribed in vitro to all examined Legionella species (15 species - see Table 2, p. 9). The binding was specific for all Legionella species. The Legall 22 probe also hybridized specifically with the in vitro transcribed 16SrRNA of all examined Legionella species. Both probes are suitable for detection of the genus Legionella in the sand hybridization detection with Legall 11 as a capture probe and Legall 22 as a detection probe. The hybridization temperature was 50 ° C.

2. Probes for the detection of Legionella pneumophila The Legpneu 1 probe hybridized with the 16SrRNA of Legionella pneumo- phila serogroup 1 ATCC33152, Legionella pneumophila seragroup 6, Legionella pneumophila Philadelphia I R32 WT and with Legionella micdadei. The Legpneu 2 probe hybridizes with in vitro transcribed 16S rRNA from Legionella pneumophila Philadelphia f JR32 WT. This probe is highly specific and can be used as a capture probe with the Legneu 1 probe in sandwich hybridization detection. The hybridization pe temperature ar50 ° C.

3. Probes for the detection of Legionella feelei The Legfeel 1 probe hybridizes only with the in vitro transcribed 16S rRNA from Legionella feelei and is specific. It can be used as a capture probe together with Leggfeel2 to detect Legionella feelei. The Legfeeß probe hybridized only with the in vitro transcribed 16S RNA from Legionella feelei and is specific. It can be used as a detection probe because it has a lower binding efficiency than the Legfeell probe. These two Legfeel probes can be used to detect Legionella feelei in sandwich hybridization approaches. The specific hybridization temperature of both probes was 55 ° C.

4, probes for the detection of Legionella jordanis. The Legjor 2 probe hybridizes with the in vitro transcribed 16S rRNA from Legionella jordanis and Legionella feelei. Binding to the Legionella jordanis sample was specific and binding to the Legionella feelei sample was unspecific. This probe can be used as a detection probe together with the Legjorl probe. The Legjor 1 probe hybridized only with the in vitro transcribed 16S rRNA from Legionella jordanis. The binding of this probe to the target molecule was specific. The probe can be used as a capture probe together with the Legjor2 probe. The hybridization temperature for both probes was also 55 ° C.

The advantages of the invention are that the new oligonucleotides are particularly suitable for the sandwich hybridization method in terms of genus and species. The use of combinations of the new oligonucleodites also has an advantageous effect. Combinations with are also possible other oligonucleotide probes, for example for use as primers for PCR, fluorescence-labeled for microscopic detection, for fluorescence sandwich hybridization and for sandwich hybridization with electrical signal reading.

Table 2: Legionella species examined

Claims

claims

1. A method for the detection of bacteria of the genus Legionella using the sandwich hybridization method, characterized in that a) genus-specific for the detection of the genus Legionella as a capture probe is an oligonucleotide of the sequence 5 ^' - CCTCCTCCCCACTGAAAGT-3 ^' and as a detection probe an oligonucleotide Sequence 5 ^' - CACTGTATGTCAAGGGTAGG; b) an oligonucleotide of the sequence 5 ^' -ATCTGACCGTCCCAGGTT-3 ^' for the detection of Legionella pneumophila as a capture probe and an oligonucleotide of the sequence 5 ^' - TTCGCCGCCCTCTGTATCG-3 ^' as a detection probe; c species specific) for detection of Legionella feelei as capture probe an oligonucleotide of the sequence 5 ^'-GCGCCA ^{CTAACCTCATTAT-3'} and as a detection probe, an oligonucleotide of the sequence 5 ^{^{'-TATACAACCACCTACGCACC-3'}} and d species specific) for detection of Legionella jordanis as Catcher probe an oligonucleotide of the sequence 5 ^' -CCACTCCTCCCCACTGAAAG-3 ^' and as a detection probe an oligonucleotide of the sequence 5 ^' -CTTACGGTCCCCAGCTTTTT-3 are used and the hybridization takes place at temperatures from 50 to 55 ° C.

2. The method according to patent claim 1, characterized in that, in the case of species-specific detection of Legionella species, the oligonucleotides for the capture probes and detection probes are interchangeable.

3. The method according to claim 1, characterized in that the detection combinations of oligonucleotides for genus-specific probes and oligonucleotides for species-specific probes are made.