EP1573028A2 - Einen g-protein-gekoppelten rezeptor codierende nukleinsäure und verwendungen davon - Google Patents

Einen g-protein-gekoppelten rezeptor codierende nukleinsäure und verwendungen davon

Info

Publication number
EP1573028A2
EP1573028A2 EP02803191A EP02803191A EP1573028A2 EP 1573028 A2 EP1573028 A2 EP 1573028A2 EP 02803191 A EP02803191 A EP 02803191A EP 02803191 A EP02803191 A EP 02803191A EP 1573028 A2 EP1573028 A2 EP 1573028A2
Authority
EP
European Patent Office
Prior art keywords
gave
gavel
protein
nucleic acid
expression
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP02803191A
Other languages
English (en)
French (fr)
Inventor
Haifeng Eishingdrelo
Jidong Cai
Steven J. Busch
Johann Gassenhuber
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Aventis Pharmaceuticals Inc
Original Assignee
Aventis Pharmaceuticals Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from GBGB0206891.4A external-priority patent/GB0206891D0/en
Application filed by Aventis Pharmaceuticals Inc filed Critical Aventis Pharmaceuticals Inc
Publication of EP1573028A2 publication Critical patent/EP1573028A2/de
Withdrawn legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00—Drugs for disorders of the respiratory system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00—Drugs for disorders of the respiratory system
    • A61P11/06—Antiasthmatics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00—Drugs for skeletal disorders
    • A61P19/02—Drugs for skeletal disorders for joint disorders, e.g. arthritis, arthrosis
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Definitions

  • the present invention relates generally to a novel nucleic acid molecule that encodes for GAVEl 8, a heretofore unknown G-protein-coupled receptor, along with uses of the nucleic acid molecule and GAVE18.
  • GPCRs G protein-coupled receptors
  • GPCRs are a large family of integral membrane proteins that are involved in cellular signal transduction. GPCRs respond to a variety of extracellular signals, including neurotransmitters, hormones, odorants and light, and are capable of transducing signals so as to initiate a second messenger response within the cell. Many therapeutic drugs target GPCRs because those receptors mediate a wide variety of physiological responses, including inflammation, vasodilation, heart rate, bronchodilation, endocrine secretion and peristalsis.
  • GPCRs are characterized by extracellular domains, seven transmembrane domains and intracellular domains. Some of the functions the receptors perform, such as binding ligands and interacting with G proteins, are related to the presence of certain amino acids in critical positions. For example, a variety of studies have shown that differences in amino acid sequence in GPCRs account for differences in affinity to either a natural ligand or a small molecule agonist or antagonist. In other words, minor differences in sequence can account for different binding affinities and activities.
  • the action of the binding of an endogenous ligand to a receptor results in a change in the conformation of the intracellular domain(s) of the receptor allowing for coupling between the intracellular domain(s) and an intracellular component, a G-protein.
  • G proteins exist, such as G q , G s , G, G z and G 0 (see, e.g. Dessauer et al., Clin Sci (Colch) (1996) 91(5):527-37).
  • the IC-3 loop as well as the carboxy terminus of the receptor interact with the G proteins (Pauwels et al., Mol Neurobiol (1998) 17(1-3): 109-135 and Wonerow et. al., supra).
  • Some GPCRs are "promiscuous" with respect to G proteins, i.e., a GPCR can interact with more than one G protein (see, e.g., KenaMn, Life Sciences (1988) 43:1095).
  • Ligand activated GPCR coupling with G protein begins a signaling cascade process (referred to as “signal transduction"). Such signal transduction ultimately results in cellular activation or cellular inhibition.
  • GPCRs exist in the cell membrane in equilibrium between two different conformations: an "inactive" and an “active” state.
  • a receptor in an inactive state is unable to link to the intracellular signaling transduction pathway to produce a biological response (exceptions exist, such as during over- expression of receptor in transduced cells, see e.g., www.creighton.edu/Pharmacologv/inverse.htaTi.).
  • Modulation of the conformation tot he active state allows linkage to the transduction pathway (via the G protein) and produces a biological response. Agonists bind and make the active conformation much more likely.
  • receptors that may be transfected into patients to treat disease
  • the activity of such receptors may be fine-tuned with inverse agonists discovered by such assays.
  • Diseases such as asthma, chronic obstructive pulmonary disease (COPD) and rheumatoid arthritis (RA) generally are considered to have an inflammatory etiology involving T helper cells, monocyte-macrophages and eosinophils.
  • Current anti-inflammatory therapy with corticosteroids is effective in asthma but is associated with metabolic and endocrine side effects. The same is possibly true for inhaled formulations that can be absorbed through lung or nasal mucosa. Satisfactory oral therapies for RA or COPD currently are lacking.
  • Ix ⁇ terleukin-5 is an eosinophil growth and activating cytokine.
  • EL-5 is an eosinophil growth and activating cytokine.
  • TL-5 is made by T-helper-2 cells (Th2) following allergen (e.g. house dust mite antigen) exposure in atopic asthma.
  • RA is believed to result from accumulation of activated macr ⁇ phages in the affected synovium.
  • Merferon ⁇ IFN ⁇
  • Thl T-helper-1
  • LPS Lipopolysaccharide
  • TNFa tumor necrosis factor
  • lung epithelium can be an important source for inflammatory cell chemoattractants and other inflammatory cell-activating agents (see, for example, Thomas et al., J Virol (2000) 74(18):8425-8433; Lamkhioued et al., Am J Respir Crit Care Med (2000) 162(2 Pt. l):723-732; and Sekiya et al., J Immunol (2000) 165(4):2205-2213).
  • GPCRs Given the role GPCRs have in disease and the ability to treat diseases by modulating the activity of GPCRs, identification and characterization of previously unknown GPCRs can provide for the development of new compositions and methods for treating disease states that involve the activity of a GPCR. Accordingly, what is needed is the discovery, isolation and characterization of novel and useful nucleic acid molecules that encode for heretofore unknown GPCRs. What is also needed are assays that utilize such heretofore unknown GPCRs to identify molceules that can serve potential agonists or antagonists of particular GPCRS. These molecules may readily have applications as therapeutic agents for modulating the activity of GPCRs in vivo, and thus, treat a plethora of diseases related to GPCR activity.
  • the instant invention identifies and characterizes the expression of a novel constitutively active GPCR, GAVEl 8, and provides compositions and methods for applying the discovery to the identification and treatment of related diseases.
  • the present invention extends to an isolated nucleic acid molecule comprising a DNA sequence of Figure 5 (SEQ ID NO:l), a variant thereof, a fragment thereof, or an analog or a derivative thereof.
  • a variant of the present invention may be an allelic variant, a degenerate variant, or an allelic variant that results in a degenerate change in the sequence.
  • the present invention extends to an isolated nucleic acid molecule hybridizable to the isolated nucleic acid molecule of SEQ ED NO: 1, or a variant thereof, under stringent hybridization conditions. Yet further, the present invention extends to an isolated nucleic acid molecule hybridizable to a nucleic acid molecule that is complementary to the DNA sequence of SEQ ID NO: 1 under stringent hybridization conditions. Stringent hybridization conditions are described infra.
  • the present invention extends to an isolated nucleic acid molecule comprising a DNA sequence that encodes a polypeptide comprising an amino acid sequence of SEQ ID NO:2.
  • an isolated nucleic acid molecule of the present invention as described above may be detectably labeled.
  • detectable labels having applications herein include, but certainly are not limited to an enzyme, a radioactive isotope, or a chemical which fluoresces. Particular examples of detectable labels are described infra.
  • polypeptides are also encompassed within the present invention.
  • the present invention extends to a purified polypeptide comprising the amino acid sequence of SEQ ID NO:2, a conservative variant thereof, or an analog or derivative thereof.
  • a polypeptide of the present invention may be detectably labeled.
  • the present invention extends to antibodies wherein a polypeptide of the present invention is the immunogen used in production of the antibodies.
  • These antibodies can be monoclonal or polyclonal.
  • the antibodies can be "chimeric" as, for example, they may comprise protein domains of antibodies raised against a purified polypeptide of the present invention in different species.
  • an antibody of the present invention may be "humanized.”
  • an antibody of the present invention may be detectable labeled. Particular examples of detectable labels having applications herein are described infra.
  • an expression vector of the present invention may comprise an isolated nucleic acid molecule hybridizable under stringent hybridization conditions to an isolated nucleic acid molecule comprising a DNA sequence of SEQ ID NO: 1, operatively associated with an expression control element, or is hybridizable under stringent hybridization conditions to a hybridization probe that is complementary to an isolated nucleic acid molecule comprising a DNA sequence of SEQ ED NO: 1, wherein the hybridization probe is operatively associated with an expression control element.
  • a particular example of an expression control element having applications herein is a promoter.
  • promoters include, but are not limited to early promoters of hCMV, early promoters of SV40, early promoters of adenovirus, early promoters of vaccinia, early promoters of polyoma, late promoters of SV40, late promoters of adenovirus, late promoters of vaccinia, late promoters of polyoma, the lac the trp system, the TAC system, the TRC system, the major operator and promoter regions of phage lambda, control regions of fd coat protein, 3- phosphoglycerate kinase promoter, acid phosphatase promoter, or promoters of yeast mating factor.
  • an expression vector of the present invention one may transfect or transform a host cell and produce a polypeptide comprising an amino acid sequence of SEQ ID NO:2, or a variant thereof.
  • the host cell may be either a prokaryotic cell or a eukaryotic cell.
  • unicellar hosts having applications herein include E. coli, Pseudonomas, Bacillus, Strepomyces, yeast, CHO, Rl.l, B- W, L-M, COS1, COS7, BSC1, BSC40, BMT10 and Sf9 cells, to name only a few.
  • the present invention further extends to a method for producing a purified polypeptide comprising the amino acid sequence of SEQ ED NO:2, a variant thereof, or a fragment thereof.
  • a method for producing a purified polypeptide comprising the amino acid sequence of SEQ ED NO:2, a variant thereof, or a fragment thereof.
  • Such a method comprises culturing a host cell transformed or transfected with an expression vector of the present invention under conditions that provide for expression of the purified polypeptide, and then recovering the purified polypeptide from the unicommear host, the culture surrounding the host cell, or from both.
  • the present invention extends to assays for identifying compounds that can modulate the activity of GAVEl 8.
  • Such compounds can be an agonist, an antagonist, or an inverse agonist of GAVEl 8.
  • the present invention extends to a method for identifying an agonist of GAVEl 8 comprising contacting a potential agonist with a cell expressing GAVE 18 in the presence of an endogenous ligand, and determining whether the signaling activity of GAVE 18 is increased when the potential agonist is present, relative to the signaling activity of GAVE 18 in the absence of the potential agonist.
  • the present invention extends to a method for identifying an inverse agonist of GAVE 18.
  • a method for identifying an inverse agonist of GAVE 18 comprises contacting a potential inverse agonist with a cell expressing GAVEl 8, and determining whether the signaling activity of GAVE 18 in the presence of the potential inverse agonist and an endogenous ligand or agonist is decreased relative to the signaling activity of GAVEl 8 under conditions in which the presence of an engogenous ligand or agonist, but in absence of potential inverse agonist, and is decreased in the presence of an endogenous ligand or agonist.
  • the present invention extends to methods for identifying an antagonist of GAVEl 8.
  • a method comprises the steps of contacting a potential antagonist with a cell expressing GAVEl 8, and determining whether in the presence of said potential antagonist the signaling activity of GAVEl 8 is decreased relative to the activity of GAVEl 8 in the presence of an endogenous ligand or agonist.
  • nucleic acid sequence which encodes a GAVE 18 protein, a fragment thereof, or a variant thereof.
  • Yet another object of the present invention involves methods for identify compounds that can modulate the activity of GAVEl 8 protein.
  • Such modulator may be an antagonist of GAVEl 8, an agonist of GAVE 18 , or inverse agonist of GAVE 18.
  • modulation can be used to treat a variety of diseases related to GAVE18 activity, e.g., various inflammatory diseases, asthma, chronic obstructive pulmonary disease (COPD), and rheumatoid arthritis, to name only a few.
  • diseases related to GAVE18 activity e.g., various inflammatory diseases, asthma, chronic obstructive pulmonary disease (COPD), and rheumatoid arthritis, to name only a few.
  • COPD chronic obstructive pulmonary disease
  • FIG. 1 Northern blot that shows the transcription of GAVEl 8 DNA in various types of tissues, particularly "immunologically related" tissues, e.g., thymus and liver.
  • FIG.2 Histogram showing the relative expression of GAVEl 8 DNA in various types cells.
  • FIG. 3 Histogram showing the relative expression of GAVEl 8 DNA in various types of tissues.
  • FIG. 4 GAVEl 8 Expression Profile.
  • the expression profile data shows that GAVEl 8 has elevated expression level in NHBE (normal human bronchial epithelium cells) treated with Tumor Necrosis Factor alpha (TNF ⁇ ).
  • NHBE normal human bronchial epithelium cells
  • TNF ⁇ Tumor Necrosis Factor alpha
  • TNFG! is always seen in inflammation tissues.
  • bronchial epithelium cells play important roles in asthma.
  • FIG. 5 DNA sequence of GAVE18 (SEQ ED NO:l).
  • FIG. 6 Putative amino acid sequence of GAVEl 8 (SEQ ED NO:2).
  • the present invention relates to the surprising and unexpected discovery of a heretofore unl own nucleic acid molecule that encodes a heretofore unlcnown G protein-coupled receptor referred to herein as GAVE 18.
  • GAVE 18 is expressed in immune tissues or organs, such as the kidney, liver and small intestine.
  • GAVEl 8 has elevated expression level in NHBE (normal human bronchial epithelium cells) treated with Tumor Necrosis Factor alpha (TNFo ; ), a protein that is always seen in inflammation tissues. Consequently, modifying the activity of GAVE 18 may have application in treating immune-related diseases and disorders, such as various inflammatory diseases and rheumatoid arthritis.
  • modulator refers to a moiety (e.g., but not limited to a ligand and a candidate compound) that modulates the activity of GAVE18.
  • a modulator of the present invention may be an agonist, a partial agonist, an antagonist, or an inverse agonist of GAVEl 8.
  • agonist refers to moieties (e.g., but not limited to ligands and candidate compounds) that activate the intracellular response when bound to the receptor, or enhance GTP binding to membranes.
  • partial agonist refers to moieties (e.g., but not limited to ligands and candidate compounds) that activate the intracellular response when bound to the receptor to a lesser degree/extent than do agonists, or enhance GTP binding to membranes to a lesser degree/extent than do agonists.
  • an antagonist refers moieties (e.g., but not limited to ligands and candidate compounds) that competitively bind to the receptor at the same site as does an agonist.
  • an antagonist does not activate the intracellular response initiated by the active form of the receptor and thereby can inhibit the intracellular responses by agonists or partial agonists. Ln a related aspect, antagonists do not diminish the baseline intracellular response in the absence of an agonist or partial agonist.
  • inverse agonist refers to moieties (e.g., but not limited to ligand and candidate compound) that bind to a constitutively active receptor and inhibit the baseline intracellular response.
  • the baseline response is initiated by the active form of the receptor below the normal base level of activity that is observed in the absence of agonists or partial agonists, or decrease of GTP binding to membranes.
  • the term “candidate compound” refers to a moiety (e.g., but not limited to a chemical compound) that is amenable to a screening technique. Ln one embodiment, the term does not include compounds that were publicly known to be compounds selected from the group consisting of agonist, partial agonist, inverse agonist or antagonist of GAVEl 8. Those compounds were identified by traditional drug discovery processes involving identification of an endogenous ligand specific for a receptor, and/or screening of candidate compounds against a receptor wherein such a screening requires a competitive assay to assess efficacy.
  • constitutively activated receptor or “autonomously active receptor,” are used herein interchangeably, and refer to a receptor subject to activation in the absence of ligand.
  • Such constitutively active receptors can be endogenous (e.g., GAVEl 8) or non-endogenous; i.e., GPCRs can be modified by recombinant means to produce mutant constitutive forms of wild-type GPCRs (e.g., see EP 1071701; WO 00/22129; WO 00/22131; and U.S. Pat. Nos. 6,150,393 and 6,140,509 which are hereby incorporated by reference herein in their entireties.
  • the term “constitutive receptor activation” refers to the stabilization of a receptor in the active state by means other than binding of the receptor with the endogenous ligand or chemical equivalent thereof.
  • ligand refers to a moiety that binds to another molecule, wherein the moiety includes, but certainly is not limited to a hormone or a neurotransmitter, and further, wherein the moiety stereoselectively binds to a receptor.
  • family when referring to a protein or a nucleic acid molecule of the invention, is intended to mean two or more proteins or nucleic acid molecules having a seemingly common structural domain and having sufficient amino acid or nucleotide sequence identity as defined herein.
  • family members can be naturally occurring and can be from either the same or different species.
  • a family can contain a first protein of human origin and a homologue of that protein of murine origin, as well as a second, distinct protein of human origin and a murine homologue of that second protein.
  • Members of a family also may have common functional characteristics.
  • GAVE18 activity refers to an activity exerted by a GAVE18 protein, polypeptide or nucleic acid molecule on a GAVE 18 responsive cell as determined in vivo or in vitro, according to standard techniques.
  • a GAVE 18 activity can be a direct activity, such as an association with or an enzymatic activity on a second protein or an indirect activity, such as a cellular signaling activity mediated by interaction of the GAVEl 8 protein with a second protein.
  • a GAVE18 activity includes, but is not limited to at least one or more of the following activities: (i) the ability to interact with proteins in the GAVE 18 signaling pathway; (ii) the ability to interact with a GAVE 18 ligand; and (iii) the ability to interact with an intracellular target protein.
  • a “vector” is a replicon, such as plasmid, phage or cosmid, to name only a few, to which another DNA segment may be attached so as to bring about the replication of the attached segment.
  • a “replicon” is any genetic element (e.g., plasmid, chromosome, virus) that functions as an autonomous unit of DNA replication in vivo, i.e., capable of replication under its own control. Particular examples of vectors are described infra.
  • a "cassette” refers to a segment of DNA that can be inserted into a vector at specific restriction sites.
  • the segment of DNA encodes a polypeptide of interest, and the cassette and restriction sites are designed to ensure insertion of the cassette in the proper reading frame for transcription and translation.
  • a cell has been "transfected” by exogenous or heterologous DNA when such DNA has been introduced inside the cell.
  • a cell has been "transformed” by exogenous or heterologous DNA when the transfected DNA effects a phenotypic change.
  • the transforming DNA should be integrated (covalently linked) into chromosomal DNA making up the genome of the cell.
  • Heterologous DNA refers to DNA not naturally located in the cell, or in a chromosomal site of the cell.
  • the heterologous DNA includes a gene foreign to the cell.
  • Homologous recombination refers to the insertion of a foreign DNA sequence of a vector in a chromosome. Ln particular, the vector targets a specific chromosomal site for homologous recombination. For specific homologous recombination, the vector will contain sufficiently long regions of homology to sequences of the chromosome to allow complementary binding and incorporation of the vector into the chromosome. Longer regions of homology, and greater degrees of sequence similarity, may increase the efficiency of homologous recombination.
  • the present invention extends to an isolated nucleic acid molecule comprising DNA sequence of Figure 5 (SEQ ED NO: 1), a variant thereof, a fragment thereof, or an analog or derivative thereof.
  • nucleic acid molecule refers to the phosphate ester polymeric form of ribonucleosides (adenosine, guanosine, uridine or cytidine; "RNA molecules”) or deoxyribonucleosides (deoxyadenosine, deoxyguanosine, deoxythymidine, or deoxycytidine; "DNA molecules”), or any phosphoester analogs thereof, such as phosphorothioates and thioesters, in either single stranded form, or a double-stranded helix. Double stranded DNA-DNA, DNA-RNA and RNA-RNA helices are possible.
  • nucleic acid molecule refers only to the primary and secondary structure of the molecule, and does not limit it to any particular tertiary forms.
  • this term includes double-stranded DNA found, inter alia, in linear or circular DNA molecules (e.g., restriction fragments), plasmids, and chromosomes. Ln discussing the structure of particular double- stranded DNA molecules, sequences may be described herein according to the normal convention of giving only the sequence in the 5 ' to 3 ' direction along the nontranscribed strand of DNA (i. e. , the strand having a sequence homologous to the mRNA).
  • a "recombinant DNA molecule” is a DNA molecule that has undergone a molecular biological manipulation.
  • an “isolated” nucleic acid molecule is one that is separated from other nucleic acid molecules present in the natural source of the nucleic acid.
  • an “isolated” nucleic acid is free of sequences that naturally flank the nucleic acid encoding GAVEl 8 (i.e., sequences located at the 5' and 3' ends of the nucleic acid) in the genomic DNA of the organism from which the nucleic acid is derived.
  • the isolated GAVEl 8 nucleic acid molecule can contain less than about 5 kb, 4 kb, 3 kb, 2 kb, 1 kb, 0.5 kb or 0.1 kb of nucleotide sequences that naturally flank the nucleic acid molecule in genomic DNA of the cell from which the nucleic acid is derived.
  • an "isolated" nucleic acid molecule such as a cDNA molecule, can be substantially free of other cellular material or culture medium when produced by recombinant techniques or substantially free of chemical precursors or other chemicals when synthesized chemically.
  • a nucleic acid molecule of the present invention e.g., a nucleic acid molecule having the nucleotide sequence of SEQ ED NO: 1 or a fragment or complement of any of that nucleotide sequence, or an analog or derivative thereof, can be isolated using standard molecular biology techniques and the sequence information provided herein. Using all or a portion of the nucleic acid sequence of SEQ ED NO: 1 as a hybridization probe, GAVE 18 nucleic acid molecules can be isolated using standard hybridization and cloning techniques (e.g., as described in Sambrook et al).
  • a nucleic acid molecule of the invention can be amplified using cDNA, mRNA or genomic DNA as a template and appropriate oligonucleotide primers according to standard PCR amplification techniques. Such primers may be readily made using information set forth in SEQ ED NO: 1, and routine laboratory techniques.
  • the nucleic acid so amplified can be cloned into an appropriate vector and characterized by DNA sequence analysis.
  • oligonucleotides corresponding to GAVEl 8 nucleotide sequences can be prepared by standard synthetic techniques, e.g., using an automated DNA synthesizer.
  • the present invention further extends to isolated nucleic acid molecules hybridizable to GAVE 18 DNA, hybridizable to a hybridization probe that is complementary under stringent hybridization conditions GAVE 18 DNA, or hybridizable under stringent hybridization conditions to both.
  • the present invention extends to an isolated nucleic acid molecule that is hybridizable under stringent hybridization conditions to a nucleic acid molecule comprising a DNA sequence of SEQ ED NO:l, or to a probe that is complementary to an isolated nucleic acid molecule comprising a DNA sequence of SEQ ED NO: 1.
  • a nucleic acid molecule is "hybridizable" to another nucleic acid molecule, such as a cDNA, genomic DNA, or RNA, when a single stranded form of the nucleic acid molecule can anneal to another nucleic acid molecule under the appropriate conditions of temperature and solution ionic strength (see Sambrook et al., supra).
  • the conditions of temperature and ionic strength determine the "stringency" of the hybridization.
  • low stringency hybridization conditions corresponding to a T m of 55° C, can be used, e.g., 5x SSC, 0.1% SDS, 0.25% milk, and no formamide; or 30% formamide, 5x SSC, 0.5% SDS).
  • Moderate stringency hybridization conditions correspond to a higher T m , e.g., 40% formamide, with 5x or 6x SSC.
  • High stringency hybridization conditions correspond to the highest T m , e.g., 50% formamide, 5x or 6x SSC.
  • Hybridization requires that the two nucleic acids contain complementary sequences, although depending on the stringency of the hybridization, mismatches between bases are possible.
  • the appropriate stringency for hybridizing nucleic acids depends on the length of the nucleic acids and the degree of complementation, variables well known in the art. The greater the degree of similarity or homology between two nucleotide sequences, the greater the value of T m for hybrids of nucleic acids having those sequences.
  • RNA:RNA, DNA:RNA, DNA:DNA The relative stability (corresponding to higher T m ) of nucleic acid hybridizations decreases in the following order: RNA:RNA, DNA:RNA, DNA:DNA.
  • equations for calculating T m have been derived (see Sambrook et al., supra, 9.50-0.51).
  • the position of mismatches becomes more important, and the length of the oligonucleotide determines its specificity (see Sambrook et al., supra, 11.7-11.8).
  • a minimum length for a hybridizable nucleic acid molecule is at least about 20 nucleotides; particularly at least about 30 nucleotides; more particularly at least about 40 nucleotides, even more particularly about 50 nucleotides, and yet more particularly at least about 60 nucleotides.
  • a hybridizable nucleic acid molecule of the invention is at least 300, 325, 350, 375, 400, 425, 450, 500, 550, 600, 650, 700, 800, 900, 1000 or 1100 nucleotides in length and hybridizes under stringent conditions to the nucleic acid molecule comprising the nucleotide sequence, preferably the coding sequence, of SEQ ED NO:l a complement thereof, or a fragment thereof.
  • hybridizes under stringent conditions is intended to describe conditions for hybridization and washing under which nucleotide sequences at least 55%, 60%, 65%, 70% and preferably 75% or more complementary to each other typically remain hybridized.
  • stringent conditions are Icnown to those skilled in the art and can be found in "Current Protocols in Molecular Biology", John Wiley & Sons, N.Y. (1989), 6.3.1-6.3.6.
  • a preferred, non-limiting example of stringent hybridization conditions are hybridization in 6X sodium chloride/sodium citrate (SSC) at about 45° C, followed by one or more washes in 0.2X SSC, 0.1% SDS at 50-65° C.
  • SSC sodium chloride/sodium citrate
  • an isolated nucleic acid molecule of the invention that hybridizes under stringent conditions to the sequence of SEQ ED NO: 1 or the complement thereof corresponds to a naturally occurring nucleic acid molecule.
  • a "naturally-occurring" nucleic acid molecule refers to an RNA or DNA molecule having a nucleotide sequence that occurs in nature (e.g., encodes a natural protein).
  • sequence-specific variables e.g., length, G-C richness etc.
  • the invention contemplates encompassing nucleic acid fragments of GAVEl 8 that are diagnostic of GAVE18-like molecules that have similar properties.
  • the diagnostic fragments can arise from any portion of the GAVEl 8 gene including flanking sequences.
  • the fragments can be used as probe of a library practicing known methods.
  • a nucleic acid molecule of the invention can comprise only a portion of a nucleic acid sequence encoding GAVEl 8, for example, a fragment that can be used as a probe or primer, or a fragment encoding a biologically active portion of GAVE 18.
  • a fragment can comprise, but is not limited to, a region encoding amino acid residues about 1 to about 14 of SEQ ED NO:2.
  • the nucleotide sequence determined from the cloning of the human GAVE 18 gene allows for the generation of probes and primers for identifying and/or cloning GAVE 18 homologues in other cell types, e.g., from other tissues, as well as GAVE 18 homologues from other mammals.
  • the probe/primer typically comprises substantially purified oligonucleotide.
  • the oligonucleotide typically comprises a region of nucleotide sequence that hybridizes under stringent conditions to at least about 12, preferably about 25, more preferably about 50, 75, 100, 125, 150, 175, 200, 250, 300, 350 or 400 consecutive nucleotides of the sense or anti-sense sequence of SEQ ED NO:l or of a naturally occurring mutant of SEQ ED NO: 1.
  • Probes based on the human GAVEl 8 nucleotide sequence can be used to detect transcripts or genomic sequences encoding the similar or identical proteins.
  • fragment or "portion” of an isolated nucleic acid molecule of the present invention comprise at least 12, particularly about 25, more particularly about 50, 75, 100, 125, 150, 175, 200, 250, 300, 350 or 400 consecutive nucleotides. Consequently, a "fragment” of an isolated nucleic acid molecule of the present invention is not merely 1 or 2 nucleotides.
  • a "fragment" or “portion” of a polypeptide of the present invention comprises at least 9 contiguous amino acid residues.
  • a particular example of a fragment of a polypeptide of the present invention comprises is an epitope to which a GAVE 18 antibody, or fragment thereof, binds.
  • a nucleic acid fragment encoding a "biologically active portion of GAVE18" can be prepared by isolating a portion of SEQ ED NO:l that encodes a polypeptide having a GAVEl 8 biological activity, expressing the encoded portion of GAVEl 8 protein (e.g., by recombinant expression in vitro) and assessing the activity of the encoded portion of GAVEl 8.
  • the invention further encompasses nucleic acid molecules that differ from the nucleotide sequence of SEQ ED NO:l due to degeneracy of the genetic code, and thus encode the same GAVE 18 protein as that encoded by the nucleotide sequence shown in SEQ ED NO: 1.
  • the present invention further extends to an isolated nucleic acid molecule that is homologous to a GAVEl 8 DNA molecule, e.g., is homologous to an isolated nucleic acid molecule having a DNA sequence of SEQ ED NO:l.
  • Two DNA sequences are "substantially homologous” or “substantially similar” when at least about 50% (preferably at least about 75%, and most preferably at least about 90 or 95%) of the nucleotides match over the defined length of the DNA sequences.
  • Sequences that are substantially homologous can be identified by comparing the sequences using standard software available in sequence data banks using default parameters, or in a Southern hybridization experiment under, for example, stringent conditions as defined for that particular system. Defining appropriate hybridization conditions is within the skill of the art. See, e.g., Maniatis et al., supra; DNA Cloning, Vols. I & Et, supra; Nucleic Acid Hybridization, supra. Moreover, nucleic acid molecules encoding GAVEl 8 proteins from other species (GAVE 18 homologues) with a nucleotide sequence that differs from that of a human GAVE18, are intended to be within the scope of the invention.
  • variants of an Isolated Nucleic acid Molecule of the present Invention further extends to variants of an isolated nucleic acid molecule comprising a DNA sequence of SEQ ED NO: 1.
  • variants can be degenerate, allelic, or a combination thereof
  • Nucleic acid molecules corresponding to natural allelic variants and homologues of the GAVE 18 cDNA of the invention can be isolated based on identity with the human GAVE 18 nucleic acids disclosed herein using the human cDNA or a portion thereof, as a hybridization probe according to standard hybridization techniques under stringent hybridization conditions.
  • corresponding to is used herein to refer similar or homologous sequences, whether the exact position is identical or different from the molecule to which the similarity or homology is measured.
  • te ⁇ n refers to the sequence similarity, and not the numbering of the amino acid residues or nucleotide bases.
  • a GAVE 18 protein of the present invention can be encoded by numerous isolated nucleic acid molecules. "Degenerate nature” refers to the use of different three-letter codons to specify a particular amino acid pursuant to the genetic code. It is well known in the art that the following codons can be used interchangeably to code for each specific amino acid:
  • Lysine (Lys or K) AAA or AAG Aspartic Acid (Asp or D) GAU or GAC
  • Arginine (Arg or R) CGU or CGC or CGA or CGG or AGA or AGG
  • Glycine GGU or GGC or GGA or GGG Tryptophan (Tip or W) UGG
  • codons specified above are for RNA sequences.
  • the corresponding codons for DNA have a T substituted for U.
  • GAVE 18 nucleotide sequence shown in SEQ ED NO:l
  • DNA sequence polymorphisms that lead to changes in the amino acid sequences of GAVEl 8 may exist within a population (e.g., the human population).
  • Such genetic polymorphism in the GAVEl 8 gene may exist among individuals within a population due to natural allelic variation.
  • An allele is one of a group of genes that occur alternatively at a given genetic locus.
  • the terms "gene” and "recombinant gene” refer to nucleic acid molecules comprising an open reading frame encoding a GAVE 18 protein, preferably a mammalian GAVE 18 protein.
  • allelic variant refers to a nucleotide sequence that occurs at a GAVE 18 locus or to a polypeptide encoded by the nucleotide sequence.
  • Alternative alleles can be identified by sequencing the gene of interest in a number of different individuals. That can be carried out readily by using hybridization probes to identify the same genetic locus in a variety of individuals. Any and all such nucleotide variations and resulting amino acid polymorphisms or variations in GAVE 18 that are the result of natural allelic variation and that do not alter the functional activity of GAVE 18 are intended to be within the scope of the invention.
  • an isolated nucleic acid molecule of the present invention can be readily made by one of ordinary skill in the art using routine laboratory techniques, e.g., site-directed mutagenesis.
  • Antisense Nucleotide Sequences The instant invention also extends to antisense nucleic acid molecules, i.e., molecules that are complementary to a sense nucleic acid encoding a protein, e.g., complementary to the coding strand of a double-stranded cDNA molecule or complementary to an mRNA sequence. Accordingly, an antisense nucleic acid can hydrogen bond to a sense nucleic acid.
  • the antisense nucleic acid can be complementary to an entire GAVE18 coding strand or to only a portion thereof, e.g., all or part of the protein coding region (or open reading frame).
  • An antisense nucleic acid molecule can be antisense to a noncoding region of the coding strand of a nucleotide sequence encoding GAVE 18.
  • the noncoding regions (“5' and 3' untranslated regions") are the 5' and 3' sequences that flank the coding region and are not translated into amino acids.
  • antisense nucleic acids of the invention can be designed according to the rules of Watson & Crick base pairing.
  • the antisense nucleic acid molecule can be complementary to the entire coding region of GAVE 18 mRNA, but more preferably is an oligonucleotide that is antisense to only a portion of the coding or noncoding region of GAVEl 8 mRNA.
  • the antisense oligonucleotide can be complementary to the region surrounding the translation start site of GAVEl 8 mRNA.
  • An antisense oligonucleotide can be, for example, about 5, 10, 15, 20, 25, 30, 35, 40, 45 or 50 nucleotides in length.
  • An antisense nucleic acid of the invention can be constructed using chemical synthesis and enzymatic ligation reactions using procedures known in the art.
  • an antisense nucleic acid e.g., an antisense oligonucleotide
  • an antisense nucleic acid can be synthesized chemically using naturally occurring nucleotides or various chemically modified nucleotides designed to increase the biological stability of the molecules, or to increase the physical stability of the duplex formed between the antisense and sense nucleic acids, e.g., phosphorothioate derivatives, phosphonate derivatives and acridine-substituted nucleotides can be used.
  • modified nucleotides that can be used to generate the antisense nucleic acid include 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xanthine, 4-acetylcytosine, 5 -(carboxyhydroxylmethyl)uracil, 5 -carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylaminomethyluracil, dihydrouracil, ⁇ -D-galactosylqueosine, inosine,
  • N 6 -isopentenyladenine 1-methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N 6 -adenine, 7-methylguanine, 5-methylammomethyluracil, 5-methoxyaminomethyl-2-thiouracil, ⁇ -D-mannosylqueosine, 5-methoxycarboxymethyluracil, 5-methoxyuracil, 2-methylthio-N ⁇ -isopentenyladenine, uracil-5-oxyacetic acid, wybutoxosine, pseudouracil, queosine, 2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil, uracil-5-oxyacetic acid methylester, uracil-5-oxyacetic acid, 5-methyl-2-thiouracil, 3-(3-amino-3
  • the antisense nucleic acid can be produced biologically using an expression vector into that a nucleic acid has been subcloned in an antisense orientation (i.e., RNA transcribed from the inserted nucleic acid will be of an antisense orientation to a target nucleic acid of interest).
  • the antisense nucleic acid molecules of the invention typically are administered to a subject or generated in situ so as to hybridize with or bind to cellular mRNA and/or genomic DNA encoding a GAVE 18 protein thereby to inhibit expression of the protein, e.g., by inhibiting transcription and/or translation.
  • the hybridization can be by conventional nucleotide complementarity to form a stable duplex, or, for example, in the case of an antisense nucleic acid molecule that binds to DNA duplexes, through specific interactions in the major groove of the double helix, or to a regulatory region of GAVEl 8.
  • antisense nucleic acid molecules of the invention includes direct injection at a tissue site.
  • antisense nucleic acid molecules can be modified to target selected cells and then administered systemically.
  • antisense molecules can be modified such that the molecules specifically bind to receptors or antigens expressed on a selected cell surface, e.g., by linking the antisense nucleic acid molecules to peptides or antibodies that bind to cell surface receptors or antigens.
  • the antisense nucleic acid molecules also can be delivered to cells using the vectors described herein. To achieve sufficient intracelluar concentrations of the antisense molecules, vector constructs in which the antisense nucleic acid molecule is placed under the control of a strong pol Et or pol HI promoter are preferred.
  • An antisense nucleic acid molecule of the invention can be an ⁇ -anomeric nucleic acid molecule.
  • An GJ-anomeric nucleic acid molecule forms specific double-stranded hybrids with complementary RNA in that the strands run parallel to each other (Gaultier et al., Nucleic Acids Res (1987)15:6625-6641).
  • the antisense nucleic acid molecule also can comprise a methylribonucleotide (Lnoue et al., Nucleic Acids Res (1987) 15:6131-6148) or a chimeric RNA-DNA analogue (lnoue et al., FEBS Lett (1987) 215:327-330).
  • Ribozvmes The invention also encompasses ribozymes.
  • Ribozymes are catalytic RNA molecules with ribonuclease activity that are capable of cleaving a single-stranded nucleic acid, such as an mRNA, that hybridizes to the ribozyme.
  • ribozymes e.g., hammerhead ribozymes (described in Haselhoff et al., Nature (1988) 334:585-591)) can be used to cleave catalytically GAVE18 mRNA transcripts, and thus inhibit translation of GAVEl 8 mRNA.
  • a ribozyme having specificity for a GAVEl 8-encoding nucleic acid can be designed based on the nucleotide sequence of a GAVEl 8 DNA disclosed herein (e.g., SEQ ED NO: 1).
  • a derivative of a Tetrahymena L-19 EVS RNA can be constructed so that the nucleotide sequence of the active site is complementary to the nucleotide sequence to be cleaved in a GAVEl 8-encoding mRNA, see, e.g., U.S. Patent Nos. 4,987,071 and 5,116,742.
  • GAVEl 8 mRNA can be used to select a catalytic RNA having a specific ribonuclease activity from a pool of RNA molecules, see, e.g., Bartel et al., Science (1993) 261:1411-1418.
  • the invention also encompasses nucleic acid molecules that form triple helical structures.
  • GAVE 18 gene expression can be inhibited by targeting nucleotide sequences complementary to the regulatory region of the GAVEl 8 (e.g., the GAVEl 8 promoter and/or enhancers) to form triple helical structures that prevent transcription of the GAVE 18 gene in target cells, see generally, Helene, Anticancer Drug Des (1991) 6(6):569; Helene Ann NY Acad Sci (1992) 660:27; and Maher, Bioassays (1992) 14(12):807.
  • the nucleic acid molecules of the invention can be modified at the base moiety, sugar moiety or phosphate backbone to improve, e.g., the stability, hybridization or solubility of the molecule.
  • the deoxyribose phosphate backbone of the nucleic acids can be modified to generate peptide nucleic acids (see Hyrup et al., Bioorganic & Medicinal Chemistry (1996) 4:5).
  • the terms "peptide nucleic acids” or "PNAs” refer to nucleic acid mimics, e.g., DNA mimics, in that the deoxyribose phosphate backbone is replaced by a pseudopeptide backbone and only the four natural nucleobases are retained.
  • PNAs The neutral backbone of PNAs has been shown to allow for specific hybridization to DNA and RNA under conditions of low ionic strength.
  • the synthesis of PNA oligomers can be performed using standard solid phase peptide synthesis protocols as described in Hyrup et al. (1996) supra; Perry-O'Keefe et al., Proc Natl Acad Sci USA (1996) 93:14670.
  • PNAs of GAVEl 8 can be used in therapeutic and diagnostic applications.
  • PNAs can be used as antisense or antigene agents for sequence-specific modulation of gene expression by, e.g., inducing transcription or translation arrest or inhibiting replication.
  • PNAs of GAVEl 8 also can be used.
  • a PNA can be used in the analysis of single base pair mutations in a gene by, e.g., PNA-directed PCR clamping; as artificial restriction enzymes when used in combination with other enzymes, e.g., SI nucleases (Hyrup et al. (1996) supra) or as probes or primers for DNA sequence and hybridization (Hyrup et al. (1996) supra; Perry-O'Keefe et al. (1996) supra).
  • PNAs of GAVEl 8 can be modified, e.g., to enhance stability, specificity or cellular uptake, by attaching lipophilic or other helper groups to the PNA, by the formation of PNA-DNA chimeras or by the use of liposomes or other techniques of drug delivery Icnown in the art.
  • the synthesis of PNA-DNA chimeras can be performed as described in Hyrup et al. (1996) supra, Firm et al, Nucleic Acids Res (1996) 24(17):3357-63, Mag et al., Nucleic Acids Res (1989) 17:5973; and Peterser et al., Bioorganic Med Chem Lett (1975) 5:1119.
  • GAVEl 8 Protein Moreover, the present invention extends to an isolated polypeptide comprising the amino acid sequence of Figure 6 (SEQ ED NO:2), a variant thereof, a fragment thereof or an analog or derivative thereof.
  • An isolated nucleic acid molecule encoding a GAVE 18 protein having a sequence that differs from that of SEQ ED NO:2, e.g. a variant, can be created by introducing one or more nucleotide substitutions, additions or deletions into the nucleotide sequence of SEQ ED NO:l such that one or more amino acid substitutions, additions or deletions are introduced into the encoded protein.
  • a mutant GAVEl 8 protein can be assayed for: (1) the ability to form proteimprotein interactions with proteins in the GAVEl 8 signaling pathway; (2) the ability to bind a GAVE 18 ligand; or (3) the ability to bind to an intracellular target protein.
  • a mutant GAVE 18 can be assayed for the ability to modulate cellular proliferation or cellular differentiation.
  • GAVE 18 proteins can be isolated from cells or tissue sources by an appropriate purification scheme using standard protein purification techniques.
  • GAVEl 8 proteins can readily be produced by recombinant DNA techniques.
  • Yet another alternative encompassed by the present invention is the chemical synthesis of a GAVEl 8 protein or polypeptide using standard peptide synthesis techniques.
  • an “isolated” or “purified” protein, or biologically active portion thereof, is substantially free of cellular material or other contaminating proteins from the cell or tissue source from which the GAVEl 8 protein is derived, or is substantially free of chemical precursors or other chemicals when chemically synthesized.
  • the phrase, "substantially free of cellular material” includes preparations of GAVE 18 protein in which the protein is separated from cellular components of the cells from which the protein is isolated or recombinantly produced.
  • GAVE 18 protein that is substantially free of cellular material includes preparations of GAVE 18 protein having less than about 30%, 20%, 10% or 5% or less (by dry weight) of non-GAVE18 protein (also referred to herein as a "contaminating protein").
  • GAVEl 8 protein or biologically active portion thereof when produced recombinantly, it also is preferably substantially free of culture medium, i.e., culture medium represents less than about 20%, 10% or 5% or less of the volume of the protein preparation.
  • culture medium represents less than about 20%, 10% or 5% or less of the volume of the protein preparation.
  • GAVEl 8 protein is produced by chemical synthesis, it is preferably substantially free of chemical precursors or other chemicals, i.e., it is separated from chemical precursors or other chemicals that are involved in the synthesis of the protein. Accordingly, such preparations of GAVE 18 protein have less than about 30%, 20%, 10% or 5% or less (by dry weight) of chemical precursors or non-GAVE18 chemicals.
  • Biologically active portions or fragments of a GAVEl 8 protein include peptides comprising amino acid sequences sufficiently identical to or derived from the amino acid sequence of the GAVEl 8 protein (e.g., the amino acid sequence shown in SEQ ED NO:2), that include fewer amino acids than the full length GAVE 18 protein and exhibit at least one activity of a GAVE 18 protein.
  • biologically active portions comprise a domain or motif with at least one activity of a GAVE 18 protein.
  • a biologically active portion of a GAVEl 8 protein can be a polypeptide that is, for example, 10, 25, 50, 100 or more amino acids in length. Particular biologically active polypeptides include one or more identified GAVE 18 structural domains.
  • GAVE 18 proteins are substantially identical to SEQ ED NO:2 and retain a functional activity of the protein of SEQ ED NO:2 yet differ in amino acid sequence due to natural allelic variation or mutagenesis.
  • GAVEl 8 proteins and polypeptides possess at least one biological activity described herein.
  • a useful GAVE 18 protein is a protein that includes an amino acid sequence at least about 45%, preferably 55%, 65%, 75%, 85%, 95%, 99% or 100%identical to the amino acid sequence of SEQ ED NO:2 and retains a functional activity of a GAVEl 8 protein of SEQ ED NO:2. Ln a particular embodiment, the GAVE 18 protein retains a functional activity of the GAVE 18 protein of SEQ ED NO:2.
  • the sequences are aligned for optimal comparison purposes (e.g., gaps can be introduced in the sequence of a first amino acid or nucleic acid sequence for optimal alignment with a second amino or nucleic acid sequence).
  • the amino acid residues or nucleotides at corresponding amino acid positions or nucleotide positions then are compared. When a position in the first sequence is occupied by the same amino acid residue or nucleotide as the corresponding position in the second sequence, then the ⁇ molecules are considered identical at that position.
  • the determination of percent identity between two sequences can be accomplished using a mathematical algorithm.
  • a particular, non-limiting example of a mathematical algorithm utilized for the comparison of two sequences is the algorithm of Karlin et al., Proc Natl Acad Sci USA (1990) 87:2264, modified as in Karlin et al., Proc Natl Acad Sci USA (1993) 90:5873-5877. Such an algorithm is incorporated into the NBLAST and XBLAST programs of Altschul et al., J Mol Bio ( 1990) 215 :403.
  • Gapped BLAST can be utilized as described in Altschul et al., Nucleic Acids Res (1997) 25:3389.
  • PSI-Blast can be used to perform an iterated search that detects distant relationships between molecules. Altschul et al. (1997) supra.
  • a mathematical algorithm utilized for the comparison of sequences is the algorithm of Myers et al., CABIOS (1988) 4: 11-17. Such an algorithm is incorporated into the ALIGN program (version 2.0) that is part of the GCG sequence alignment software package. When utilizing the ALIGN program for comparing amino acid sequences, a PAM120 weight residue table, a gap length penalty of 12 and a gap penalty of 4 may be used. The percent identity between two sequences can be determined using techniques similar to those described above, with or without allowing gaps. In calculating percent identity, only exact matches are counted.
  • GAVE 18 chimeric or fusion proteins comprises a GAVE 18 polypeptide operably linked to a non-GAVE18 polypeptide.
  • GAVEl 8 polypeptide refers to a polypeptide having an amino acid sequence corresponding to GAVEl 8.
  • non-GAVE18 polypeptide refers to a polypeptide having an amino acid sequence corresponding to a protein that is not substantially identical to the GAVE 18 protein, e.g., a protein that is different from the GAVEl 8 protein and is derived from the same or a different organism.
  • the GAVE 18 polypeptide can correspond to all or a portion of a GAVE 18 protein, preferably at least one biologically active portion of a GAVE 18 protein.
  • the term "operably linked" is intended to indicate that the GAVE18 polypeptide and the non-GAVE18 polypeptide are fused in-frame to each other.
  • the non-GAVE18 polypeptide can be fused to the N-terminus or C-terminus of a GAVEl 8 polypeptide.
  • One useful fusion protein is GST-GAVE 18 in which a GAVE 18 sequence is fused to the C-terminus of glutathione-S-transferase (GST). Such fusion proteins can facilitate the purification of recombinant GAVEl 8.
  • a fusion protein of the present invention extends to a
  • GAVEl 8-immunoglobulin fusion protein in that all or part of GAVEl 8 is fused to sequences derived from a member of the immunoglobulin protein family.
  • the GAVEl 8-immunoglobulin fusion proteins of the invention can be incorporated into pharmaceutical compositions and administered to a subject to inhibit an interaction between a GAVEl 8 ligand and a GAVEl 8 protein on the surface of a cell, thereby to suppress GAVE18-mediated signal transduction in vivo.
  • the GAVEl 8-immunoglobulin fusion proteins can be used to affect the bioavailability of a GAVE 18 cognate ligand.
  • GAVE 18 ligand-GAVE18 interaction may be useful therapeutically, both for treating proliferative and differentiative disorders and for modulating (e.g. promoting or inhibiting) cell survival.
  • the GAVEl 8-immunoglobulin fusion proteins of the invention can be used as immunogens to produce anti-GAVE18 antibodies in a subject, to purify GAVEl 8 ligands and in screening assays to identify molecules that inhibit the interaction of GAVE 18 with a GAVE 18 ligand.
  • a GAVE 18 chimeric or fusion protein of the present invention is produced by standard recombinant DNA techniques.
  • DNA fragments coding for the different polypeptide sequences are ligated together in-frame in accordance with conventional techniques, for example, by employing blunt-ended or stagger-ended termini for ligation, restriction enzyme digestion to provide for appropriate termini, filling-in of cohesive ends as appropriate, alkaline phosphatase treatment to avoid undesirable joining and enzymatic ligation.
  • the fusion gene can be synthesized by conventional techniques including automated DNA synthesizers.
  • PCR amplification of gene fragments can be carried out using anchor primers that give rise to complementary overhangs between two consecutive gene fragments that subsequently can be annealed and reamplified to generate a chimeric gene sequence (see e.g., Ausubel et al., supra).
  • anchor primers that give rise to complementary overhangs between two consecutive gene fragments that subsequently can be annealed and reamplified to generate a chimeric gene sequence
  • many expression vectors are commercially available that already encode a fusion moiety (e.g., a GST polypeptide).
  • a GAVEl 8-encoding nucleic acid can be cloned into such an expression vector so that the fusion moiety is linked in-frame to the GAVE 18 protein.
  • variants of the GAVE 18 protein further extends to variants of the GAVE 18 protein.
  • mutations may be introduced into the amino acid sequence of SEQ ED NO:2 using standard techniques, such as site-directed mutagenesis and PCR-mediated mutagenesis.
  • conservative amino acid substitutions can be made at one or more predicted non-essential amino acid residues.
  • a "conservative amino acid substitution” is one in which the amino acid residue is replaced with an amino acid residue having a similar side chain.
  • one or more amino acids can be substituted by another amino acid of a similar polarity, which acts as a functional equivalent, resulting in a silent alteration.
  • Substitutes for an amino acid within the amino acid sequence of a polypeptide of the present invention may be selected from other members of the class to which the amino acid belongs.
  • the nonpolar (hydrophobic) amino acids include alanine, leucine, isoleucine, valine, proline, phenylalanine, tryptophan and methionine.
  • Amino acids containing aromatic ring structures are phenylalanine, tryptophan, and tyrosine.
  • the polar neutral amino acids include glycine, serine, threonine, cysteine, tyrosine, asparagine, and glutamine.
  • the positively charged (basic) amino acids include arginine, lysine and histidine.
  • the negatively charged (acidic) amino acids include aspartic acid and glutamic acid. Such alterations will not be expected to effect apparent molecular weight as determined by polyacrylamide gel electrophoresis, or isoelectric point.
  • amino acid substitutions may also be introduced to substitute an amino acid with a particularly preferable property.
  • a Cys may be introduced for a potential site for disulfide bridges with another Cys.
  • a His may be introduced as a particularly "catalytic" site (i.e., His can act as an acid or base and is the most common amino acid in biochemical catalysis).
  • Pro may be introduced because of its particularly planar structure, which induces ⁇ -turns in the protein's structure.
  • Mutations can also be introduced randomly along all or part of a GAVE 18 coding sequence, such as by saturation mutagenesis, and the resultant mutants can be screened for GAVE 18 biological activity to identify mutants that retain activity. Following mutagenesis, the encoded protein can be expressed recombinantly and the activity of the protein can be determined.
  • Variants of the present invention can function as a GAVE 18 agonist (mimetic) or as GAVE 18 antagonist.
  • Variants of the GAVE 18 protein can be generated by mutagenesis, e.g., discrete point mutation or truncation of the GAVE 18 protein.
  • An agonist of the GAVE 18 protein can retain substantially the same or a subset of the biological activities of the naturally occurring GAVE 18 protein.
  • an antagonist of the GAVE 18 protein can competitively bind to a downstream or upstream member of a cellular signaling cascade that includes the GAVE 18 protein, and thus inhibit one or more of the activities of the naturally occurring form of the GAVE 18 protein.
  • specific biological effects can be elicited by treatment with a variant of limited function. Treatment of a subject with a variant having a subset of the biological activities of the naturally occurring form of the protein can have fewer side effects in a subject relative to treatment with the naturally occurring form of the GAVEl 8 proteins.
  • Variants of the GAVE 18 protein that function as either GAVE 18 agonists (mimetics) or as GAVE 18 antagonists can be identified by screening combinatorial libraries of mutants, e.g., truncation mutants, of the GAVE18 protein for GAVE18 agonist or antagonist activity.
  • a variegated library of GAVE 18 variants is generated by combinatorial mutagenesis at the nucleic acid level, and is encoded by a variegated gene library.
  • a variegated library of GAVEl 8 variants can be produced by, for example, enzymatically ligating a mixture of synthetic oligonucleotides into gene sequences such that a degenerate set of potential GAVE 18 sequences is expressed as individual polypeptides or alternatively, as a set of larger fusion proteins (e.g., for phage display) containing the set of GAVEl 8 sequences therein.
  • a degenerate set of potential GAVE 18 sequences is expressed as individual polypeptides or alternatively, as a set of larger fusion proteins (e.g., for phage display) containing the set of GAVEl 8 sequences therein.
  • degenerate set of genes allows for the provision, in one mixture, of all of the sequences encoding the desired set of potential GAVE 18 sequences.
  • Methods for synthesizing degenerate oligonucleotides are known in the art (see, e.g., Narang, Tetrahedron (1983) 39:3; Itakura et al., Ann Rev Biochem (1984) 53:323; Itakura et al., Science (1984) 198: 1056; Ike et al. Nucleic Acid Res (1983) 11:477).
  • libraries of fragments of the GAVEl 8 protein coding sequence can be used to generate a variegated population of GAVE 18 fragments for screening and subsequent selection of variants of a GAVE 18 protein.
  • a library of coding sequence fragments can be generated by treating a double-stranded PCR fragment of a GAVEl 8 coding sequence with a nuclease under conditions wherein nicking occurs only about once per molecule, denaturing the double-stranded DNA, renaturing the DNA to form double-stranded DNA that can include sense/antisense pairs from different nicked products, removing single-stranded portions from reformed duplexes by treatment with SI nuclease and ligating the resulting fragment library into an expression vector.
  • an expression library can be derived that encodes N-terminal and internal fragments of various sizes of the GAVE 18 protein.
  • REM Recursive ensemble mutagenesis
  • the present invention also includes derivatives or analogs of GAVE 18 produced from a chemical modification.
  • a GAVEl 8 protein of the present invention may be derivatized by the attachment of one or more chemical moieties to the protein moiety.
  • Chemical Moieties For Derivatization The chemical moieties suitable for derivatization may be selected from among water soluble polymers so that the GAVE 18 analog or derivative does not precipitate in an aqueous environment, such as a physiological environment.
  • the polymer will be pharmaceutically acceptable.
  • the desired polymer based on such considerations as whether the polymer/component conjugate will be used therapeutically, and if so, the desired dosage, circulation time, resistance to proteolysis, and other considerations. For GAVEl 8, these may be ascertained using the assays provided herein.
  • water soluble polymers having applications herein include, but are not limited to, polyethylene glycol, copolymers of ethylene glycol/propylene glycol, carboxymethylcellulose, dextran, polyvinyl alcohol, polyvinyl pyrrolidone, poly-1, 3-dioxolane, poly-1, 3,6-trioxane, ethylene/maleic anhydride copolymer, polyaminoacids (either hombpolymers or random copolymers), dextran, poly(n-vinyl pyrrolidone)polyethylene glycol, propropylene glycol homopolymers, polypropylene oxide/ethylene oxide co- polymers, polyoxyethylated polyols or polyvinyl alcohol.
  • Polyethylene glycol propionaldenhyde may have advantages in manufacturing due to its stability in water.
  • the polymer may be of any molecular weight, and may be branched or unbranched.
  • the preferred molecular weight is between about 2 kDa and about 100 lcDa (the term "about” indicating that in preparations of polyethylene glycol, some molecules will weigh more, some less, than the stated molecular weight) for ease in handling and manufacturing.
  • Other sizes may be used, depending on the desired therapeutic profile (e.g., the duration of sustained release desired, the effects if any, on biological activity, the ease in handling, the degree or lack of antigenicity and other known effects of the polyethylene glycol to a therapeutic protein or analog).
  • the number of polymer molecules so attached to GAVE 18 may vary, and one skilled in the art will be able to ascertain the effect on function.
  • One may mono-derivatize, or may provide for a di-, tri-, tetra- or some combination of derivatization, with the same or different chemical moieties (e.g., polymers, such as different weights of polyethylene glycols).
  • the proportion of polymer molecules to GAVE 18 molecules will vary, as will their concentrations in the reaction mixture.
  • the optimum ratio in terms of efficiency of reaction in that there is no excess unreacted component or components and polymer
  • the desired degree of derivatization e.g., mono, di-, tri-, etc.
  • the molecular weight of the polymer selected whether the polymer is branched or unbranched, and the reaction conditions.
  • polyethylene glycol molecules should be attached to GAVE 18 with consideration of effects on functional or antigenic domains of GAVEl 8.
  • attachment methods available to those skilled in the art, e.g., EP 0 401 384 herein incorporated by reference (coupling PEG to G-CSF), see also Malik et al., 1992, Exp. Hematol. 20:1028-1035 (reporting pegylation of GM-CSF using tresyl chloride).
  • polyethylene glycol may be covalently bound through amino acid residues via a reactive group, such as, a free amino or carboxyl group. Reactive groups are those to which an activated polyethylene glycol molecule may be bound.
  • amino acid residues having a free amino group include lysine residues and the N- terminal amino acid residues; those having a free carboxyl group include aspartic acid residues, glutamic acid residues and the C-terminal amino acid residue.
  • Sulfhydryl groups may also be used as a reactive group for attaching the polyethylene glycol molecule(s). Preferred for therapeutic purposes is attachment at an amino group, such as attachment at the N-terminus or lysine group.
  • N-terminally chemically modified GAVEl 8 One may specifically desire N-terminally chemically modified GAVEl 8.
  • polyethylene glycol as an illustration of the present compositions, one may select from a variety of polyethylene glycol molecules (by molecular weight, branching, etc.), the proportion of polyethylene glycol molecules to GAVEl 8 molecules in the reaction mix, the type of pegylation reaction to be performed, and the method of obtaining the selected N-terminally pegylated protein.
  • the method of obtaining the N- terminally pegylated preparation i.e., separating this moiety from other monopegylated moieties if necessary
  • Selective N-terminal chemical modification may be accomplished by reductive allcylation which exploits differential reactivity of different types of primary amino groups (lysine versus the N-terminal) available for derivatization in GAVEl 8.
  • substantially selective derivatization of GAVE 18 at the N-terminus with a carbonyl group containing polymer is achieved.
  • one may selectively N-terminally pegylate GAVEl 8 by performing the reaction at a pH which allows one to take advantage of the pK a differences between the £ -amino groups of the lysine residues and that of the oi-amino group of the N-terminal residue of GAVEl 8.
  • the water soluble polymer may be of the type described above, and should have a single reactive aldehyde for coupling to GAVEl 8.
  • Polyethylene glycol proprionaldehyde, containing a single reactive aldehyde, may be used.
  • Antibodies of GAVEl 8. variants thereof fragments thereof or analogs or derivatives thereof An isolated GAVE 18 protein or a portion or fragment thereof, can be used as an immunogen to generate antibodies that bind GAVEl 8 using standard techniques for polyclonal and monoclonal antibody preparation.
  • the term "antibody” as used herein refers to immunoglobulin molecules and immunologically active portions of immunoglobulin molecules, i.e., molecules that contain an antigen-binding site that specifically binds an antigen, such as GAVE 18, or a fragment thereof.
  • a molecule that specifically binds to GAVE 18 is a molecule that binds GAVEl 8, but does not substantially bind other molecules in a sample, e.g., a biological sample that naturally contains
  • immunologically active portions of immunoglobulin molecules include F( a b) and F(ab ' )2 fragments that can be generated by treating the antibody with an enzyme such as pepsin.
  • the invention provides polyclonal, monoclonal and chimeric antibodies that have GAVEl 8, a variant thereof, a fragment thereof, or an analog or derivative thereof, as an immunogen. Chimeric antibodies are preferred for use in therapy of human diseases or disorders, since the human or humanized antibodies are much less likely than xenogenic antibodies to induce an immune response, in particular an allergic response, themselves.
  • the full-length GAVE 18 protein can be used or, alternatively, the invention provides antigenic peptide fragments of GAVEl 8 for use as immunogens.
  • the antigenic peptide of GAVEl 8 comprises at least 8 (preferably 10, 15, 20, 30 or more) amino acid residues of the amino acid sequence shown in SEQ ED NO:2 and encompasses an epitope of GAVEl 8 such that an antibody raised against the peptide forms a specific immune complex with GAVEl 8.
  • a GAVEl 8 immunogen typically is used to prepare antibodies by immunizing a suitable subject, (e.g., rabbit, goat, mouse or other mammal) with the immunogen.
  • An appropriate immunogenic preparation can contain, for example, recombinantly expressed GAVE 18 protein or a chemically synthesized GAVEl 8 polypeptide.
  • the preparation further can include an adjuvant, such as Freund's complete or incomplete adjuvant or similar immunostimulatory agent. Immunization of a suitable subject with an immunogenic GAVE 18 preparation induces a polyclonal anti-GAVE18 antibody response.
  • An antibody of the present invention can be a monoclonal antibody, a polyclonal antibody, or a chimeric antibody.
  • the term "monoclonal antibody” or “monoclonal antibody composition”, as used herein, refers to a population of antibody molecules that contain only one species of an antigen-binding site capable of immunoreacting with a particular epitope of GAVEl 8.
  • a monoclonal antibody composition thus typically displays a single binding affinity for a particular GAVE 18 protein epitope.
  • Polyclonal anti-GAVE18 antibodies can be prepared as described above by immunizing a suitable subject with a GAVE 18 immunogen.
  • the anti-GAVE18 antibody titer in the immunized subject can be monitored over time by standard techniques, such as with an enzyme-linked immunosorbent assay (ELISA) using immobilized GAVEl 8.
  • ELISA enzyme-linked immunosorbent assay
  • the antibody molecules directed against GAVE 18 can be isolated from the mammal (e.g., from the blood) and further purified by well-known techniques, such as protein A chromatography, to obtain the IgG fraction.
  • antibody-producing cells can be obtained from the subject and used to prepare monoclonal antibodies by standard techniques, such as the hybridoma technique originally described by Kohler et al., Nature (1975) 256:495-497, the human B cell hybridoma technique (Kohler et al., Immunol Today (1983) 4:72), the EBV hybridoma technique (Cole et al., Monoclonal Antibodies and Cancer Therapy, (1985), Alan R. Liss, Inc., pp. 77-96) or trioma techniques.
  • hybridomas The technology for producing hybridomas is well known (see generally Current Protocols in Immunology (1994) Coligan et al., eds., John Wiley & Sons, Inc., New York, NY). Briefly, an immortal cell line (typically a myeloma) is fused to lymphocytes (typically splenocytes) from a mammal immunized with a GAVE 18 immunogen as described above and the culture supernatants of the resulting hybridoma cells are screened to identify a hybridoma producing a monoclonal antibody that binds GAVEl 8.
  • an immortal cell line typically a myeloma
  • lymphocytes typically splenocytes
  • the immortal cell line e.g., a myeloma cell line
  • the lymphocytes e.g., a myeloma cell line
  • murine hybridomas can be made by fusing lymphocytes from a mouse immunized with an immunogenic preparation of the instant invention with an immortalized mouse cell line, e.g., a myeloma cell line that is sensitive to culture medium containing hypoxanthine, aminopterin and thymidine ("HAT medium").
  • an immortalized mouse cell line e.g., a myeloma cell line that is sensitive to culture medium containing hypoxanthine, aminopterin and thymidine ("HAT medium").
  • HAT medium hypoxanthine, aminopterin and thymidine
  • Any of a number of myeloma cell lines can be used as a fusion partner according to standard techniques, e.g., the P3-NSl/l-Ag4-l, P3-x63-Ag8.653 or
  • Sp2/0-Agl4 myeloma lines are available from ATCC.
  • HAT-sensitive mouse myeloma cells are fused to mouse splenocytes using polyethylene glycol ("PEG").
  • PEG polyethylene glycol
  • Hybridoma cells resulting from the fusion then are selected using HAT medium that kills unfused and unproductively fused myeloma cells (unfused splenocytes die after several days because they are not transformed).
  • Hybridoma cells producing a monoclonal antibody of the invention are detected by screening the hybridoma culture supernatants for antibodies that bind GAVEl 8, e.g., using a standard ELISA assay.
  • a monoclonal anti-GAVE18 antibody can be identified and isolated by screening a recombinant combinatorial immunoglobulin library (e.g., an antibody phage display library) with GAVE18 thereby to isolate immunoglobulin library members that bind GAVEl 8.
  • Kits for generating and screening phage display libraries are commercially available (e.g., the Pharmacia Recombinant Phage Antibody System, Catalog No. 27-9400-01; and the Stratagene "SURFZAP" Phage Display Kit, Catalog No. 240612).
  • recombinant anti-GAVE18 antibodies such as chimeric and humanized monoclonal antibodies comprising both human and non-human portions
  • recombinant anti-GAVE18 antibodies can be made using standard recombinant DNA techniques.
  • Such chimeric and humanized monoclonal antibodies can be produced by recombinant DNA techniques known in the art, for example using methods described in PCT Publication No. WO 87/02671; Europe Patent Application No. 184,187; Europe Patent Application No. 171,496; Europe Patent Application No. 173,494; PCT Publication No. WO 86/01533;
  • Completely human antibodies are particularly desirable for therapeutic treatment of human patients.
  • Such antibodies can be produced using fransgenic mice that are incapable of expressing endogenous immunoglobulin heavy and light chains genes, but can express human heavy and light chain genes.
  • the transgenic mice are immunized in the normal fashion with a selected antigen, e.g., all or a portion of GAVEl 8.
  • Monoclonal antibodies directed against the antigen can be obtained using conventional hybridoma technology.
  • the human immunoglobulin transgenes harbored by the transgenic mice rearrange during B cell differentiation and subsequently undergo class switching and somatic mutation. Thus, using such an epitope, e.g., an antibody that inhibits GAVEl 8 activity is identified.
  • the heavy chain and the light chain of the non-human antibody are cloned and used to create phage display F a b fragments.
  • the heavy chain gene can be cloned into a plasmid vector so that the heavy chain can be secreted from bacteria.
  • the light chain gene can be cloned into a phage coat protein gene so that the light chain can be expressed on the surface of phage.
  • a repertoire (random collection) of human light chains fused to phage is used to infect the bacteria that express the non-human heavy chain.
  • the resulting progeny phage display hybrid antibodies (human light chain/non-human heavy chain).
  • the selected antigen is used in a panning screen to select phage that bind the selected antigen. Several rounds of selection may be required to identify such phage.
  • Human light chain genes are isolated from the selected phage that bind the selected antigen.
  • the selected human light chain genes then are used to guide the selection of human heavy chain genes as follows.
  • the selected human light chain genes are inserted into vectors for expression by bacteria. Bacteria expressing the selected human light chains are infected with a repertoire of human heavy chains fused to phage. The resulting progeny phage display human antibodies (human light chain/human heavy chain).
  • the selected antigen is used in a panning screen to select phage that bind the selected antigen.
  • the selected phage display a completely human antibody that recognizes the same epitope recognized by the original selected, non-human monoclonal antibody.
  • the genes encoding both the heavy and light chains are isolated and can be manipulated further for production of human antibody. The technology is described by Jespers et al. (Bio/Technology (1994) 12:899-903).
  • An anti-GAVE18 antibody (e.g., monoclonal antibody) can be used to isolate GAVE18 by standard techniques, such as affinity chromatography or immunoprecipitation.
  • An anti-GAVE18 antibody can facilitate the purification of natural GAVE 18 from cells and of recombinantly produced GAVE 18 expressed in host cells.
  • an anti-GAVE18 antibody can be used to detect GAVEl 8 protein (e.g., in a cellular lysate or cell supernatant) to evaluate the abundance and pattern of expression of the GAVE 18 protein.
  • Anti-GAVE18 antibodies can be used diagnostically to monitor protein levels in tissue as part of a clinical testing procedure, for example, to determine the efficacy of a given treatment regimen. Detection can be facilitated by coupling the antibody to a detectable substance, which are described infra.
  • Detectable Labels optionally, isolated nucleic acid molecules of the present invention, polypeptides of the present invention, and antibodies of the present invention, as well as fragments of such moieties, may be detectably labeled.
  • Suitable labels include enzymes, fluorophores (e.g., fluorescene isothiocyanate (FITC), phycoerythrin (PE), Texas red (TR), rhodamine, free or chelated lanthanide series salts, especially Eu 3+ , to name a few fluorophores), chromophores, radioisotopes, chelating agents, dyes, colloidal gold, latex particles, ligands (e.g., biotin), bioluminescent materials, and chemiluminescent agents.
  • FITC fluorescene isothiocyanate
  • PE phycoerythrin
  • TR Texas red
  • rhodamine free or chelated lanthanide series salts, especially Eu 3+ , to
  • Direct labels are one example of labels which can be used according to the present invention.
  • a direct label has been defined as an entity, which in its natural state, is readily visible, either to the naked eye, or with the aid of an optical filter and/or applied stimulation, e.g. UN. light to promote fluorescence.
  • colored labels include metallic sol particles, for example, gold sol particles such as those described by Leuvering (U.S. Patent 4,313,734); dye sole particles such as described by Gribnau et al. (U.S. Patent 4,373,932) and May et al.
  • direct labels include a radionucleotide, a fluorescent moiety or a luminescent moiety.
  • indirect labels comprising enzymes can also be used according to the present invention.
  • enzyme linked immunoassays are well known in the art, for example, alkaline phosphatase and horseradish peroxidase, lysozyme, glucose-6- phosphate dehydrogenase, lactate dehydrogenase, urease, these and others have been discussed in detail by Eva Engvall in Enzyme Lmmunoassay ELISA and EMIT in Methods in Enzymology, 70. 419- 439, 1980 and in U.S. Patent 4,857,453.
  • Other labels for use in the invention include magnetic beads or magnetic resonance imaging labels.
  • a phosphorylation site can be created on an isolated polypeptide of the present invention, an antibody of the present invention, or a fragment thereof, for labeling with 32 P, e.g., as described in European Patent No. 0372707 (application No. 89311108.8) by Sidney Pestka, or U.S. Patent No. 5,459,240, issued October 17, 1995 to Foxwell et al.
  • proteins can be labeled by metabolic labeling.
  • Metabolic labeling occurs during in vitro incubation of the cells that express the protein in the presence of culture medium supplemented with a metabolic label, such as [ 35 S]-methionine or [ 32 P]- orthphosphate.
  • a metabolic label such as [ 35 S]-methionine or [ 32 P]- orthphosphate.
  • the invention further contemplates labeling with [ 14 C] -amino acids and [ 3 H] -amino acids (with the tritium substituted at non-labile positions).
  • vectors preferably expression vectors, containing a nucleic acid encoding GAVE 18 (or a portion thereof).
  • a vector preferably expression vectors
  • plasmid which refers to a circular double-stranded DNA loop into which additional DNA segments can be ligated.
  • viral vector Another type of vector
  • certain vectors are capable of autonomous replication in a host cell (e.g., bacterial vectors having a bacterial origin of replication and episomal mammalian vectors).
  • vectors e.g., non-episomal mammalian vectors
  • expression vectors are capable of directing the expression of genes operably linked thereto.
  • expression vectors of utility in recombinant DNA techniques are often in the form of plasmids (vectors).
  • the invention is intended to include such other forms of expression vectors, such as viral vectors (e.g., replication defective retroviruses, adenoviruses and adeno-associated viruses), that serve equivalent functions.
  • a recombinant expression vector of the invention comprises a nucleic acid molecule of the present invention in a form suitable for expression of the nucleic acid in a host cell. That means a recombinant expression vector of the present invention includes one or more regulatory sequences, selected on the basis of the host cells to be used for expression, that is operably linked to the nucleic acid to be expressed.
  • "operably linked" is intended to mean that the nucleotide sequence of interest is linked to the regulatory sequence(s) in a manner that allows for expression of the nucleotide sequence (e.g., in an in vitro transcription/translation system or in a host cell when the vector is introduced into the host cell).
  • regulatory sequence is intended to include promoters, enhancers and other expression control elements (e.g., polyadenylation signals). Such regulatory sequences are described, for example, in Goeddel, Gene Expression Technology: Methods in Enzymology Vol. 185, Academic Press, San Diego, CA (1990). Regulatory sequences include those that direct constitutive expression of the nucleotide sequence in many types of host cells (e.g., tissue specific regulatory sequences). It will be appreciated by those skilled in the art that the design of the expression vector can depend on such factors as the choice of host cell to be transformed, the level of expression of protein desired etc.
  • the expression vectors of the invention can be introduced into host cells to produce proteins or peptides encoded by nucleic acids as described herein (e.g., GAVE 18 proteins, mutant forms of GAVEl 8, fusion proteins etc.).
  • a recombinant expression vector of the invention can be designed for expression of GAVE 18 in prokaryotic or eukaryotic cells, e.g., bacterial cells such as E. coli, insect cells (using baculovirus expression vectors), yeast cells or mammalian cells. Suitable host cells are discussed further in
  • the recombinant expression vector can be transcribed and translated in vitro, for example using phage regulatory elements and proteins, such as, a T7 promoter and/or a T7 polymer ase.
  • Fusion vectors add a number of amino acids to a protein encoded therein, usually to the amino terminus of the recombinant protein.
  • Such fusion vectors typically serve three purposes: 1) to increase expression of recombinant protein; 2) to increase the solubility of the recombinant protein; and 3) to aid in the purification of the recombinant protein by acting as a ligand in affinity purification.
  • a proteolytic cleavage site is introduced at the junction of the fusion moiety and the recombinant protein to enable separation of the recombinant protein from the fusion moiety subsequent to purification of the fusion protein.
  • enzymes and the cognate recognition sequences include Factor Xa, thrombin and enterokinase.
  • Typical fusion expression vectors include pGEX (Pharmacia Biotech Lie; Smith et al.
  • telomere sequence a sequence of RNA sequences in a telomere sequence.
  • GST glutathione 5-transferase
  • suitable inducible non-fusion E. coli expression vectors include pTrc (Amann et al. Gene (1988) 69:301-315) and pET 1 Id (Studier et al. Gene Expression Technology: Methods in Enzymology, Academic Press, San Diego, California (1990) 185:60-89).
  • -Target gene expression from the pTrc vector relies on host RNA polymerase transcription from a hybrid trp-lac fusion promoter.
  • One strategy to maximize recombinant protein expression in E. coli is to express the protein in a host with impaired capacity to cleave proteolytically the recombinant protein (Gottesman, Gene Expression Technology: Methods in Enzymology, Academic Press, San Diego, California (1990) 185:119-128).
  • Another strategy is to alter the nucleic acid sequence of the nucleic acid molecule to be inserted into an expression vector so that the individual codons for each amino acid are those preferentially utilized mE. coli (Wada et al. Nucleic Acids Res (1992) 20:2111-2118). Such alteration of nucleic acid sequences of the invention can be carried out by standard DNA synthesis techniques.
  • the GAVEl 8 expression vector is a yeast expression vector.
  • yeast expression vectors for expression in yeast such as S. cerevisiae include pYepSecl (Baldari et al, EMBO J (1987) 6:229-234), pMFa (Kurjan et al. Cell (1982) 30:933-943), pJRY88 (Schultz et al. Gene (1987) 54:113-123), pYES2 (Invitrogen Corporation, San Diego, CA) and pPicZ (Livitrogen Corp, San Diego, CA).
  • GAVEl 8 can be expressed in insect cells using baculovirus expression vectors.
  • Baculovirus vectors available for expression of proteins in cultured insect cells include the pAc series (Smith et al, Mol Cell Biol (1983) 3:2156-2165) and the pVL series (Lucklow et al. Virology (1989) 170:31-39).
  • a nucleic acid of the invention is expressed in mammalian cells using a mammalian expression vector.
  • mammalian expression vectors having applications herein include, but certainly are not limited to pCDM8 (Seed, Nature (1987) 329:840) and pMT2PC (Kaufman et al, EMBO J (1987) 6:187-195).
  • control functions of the expression vector often are provided by viral regulatory elements.
  • promoters are derived from polyoma, adenovirus 2, cytomegalovirus and simian virus 40.
  • suitable expression systems for both prokaryotic and eukaryotic cells see chapters 16 and 17 of Sambrook et al., supra.
  • a recombinant mammalian expression vector of the present invention is capable of directing expression of the nucleic acid preferentially in a particular cell type (e.g., tissue-specific regulatory elements are used to express the nucleic acid).
  • tissue-specific regulatory elements are known in the art.
  • suitable tissue-specific promoters include the albumin promoter (liver-specific; Pinkert et al.
  • lymphoid-specific promoters Calame et al, Adv Immunol (1988) 43:235-275
  • promoters of T cell receptors Winoto et al, EMBO J (1989) 8:729-733
  • immunoglobulins Bonerji et al. Cell (1983) 33:729-740; Queen et al.
  • neuron-specific promoters e.g., the neurofilament promoter; Byrne et al, Proc Natl Acad Sci USA (1989) 86:5473-5477
  • pancreas-specific promoters e.g., milk whey promoter; U.S. Patent No. 4,873,316 and Europe Application No. 264,166
  • mammary gland-specific promoters e.g., milk whey promoter; U.S. Patent No. 4,873,316 and Europe Application No. 264,166.
  • Developmentally-regulated promoters also are encompassed, for example the murine hox promoters (Kessel et al. Science (1990) 249:374-379) and the ⁇ -fetoprotein promoter (Campes et al. Genes Dev (1989) 3:537-546).
  • the invention further provides a recombinant expression vector comprising a DNA molecule of the invention cloned into an expression vector in an antisense orientation. That is, the DNA molecule is operably linked to a regulatory sequence in a manner that allows for expression (by transcription of the DNA molecule) of an RNA molecule that is antisense to GAVE 18 mRNA. Regulatory sequences operably linked to a nucleic acid cloned in the antisense orientation can be chosen that direct the continuous expression of the antisense RNA molecule in a variety of cell types. For example, viral promoters and/or enhancers or regulatory sequences can be chosen that direct constitutive, tissue-specific or cell type-specific expression of antisense RNA.
  • the antisense expression vector can be in the form of a recombinant plasmid, phagemid or attenuated virus in which antisense nucleic acids are produced under the control of a high efficiency regulatory region, the activity of which can be determined by the cell type into which the vector is introduced.
  • a high efficiency regulatory region the activity of which can be determined by the cell type into which the vector is introduced.
  • host cell and “recombinant host cell” are used interchangeably herein. It is understood that such terms refer not only to the particular subject cell but also to the progeny or potential progeny of such a cell. Because certain modifications may occur in succeeding generations due to either mutation or environmental influences, such progeny may not, in fact, be identical to the parent cell, but still are included within the scope of the term as used herein.
  • a host cell can be any prokaryotic or eukaryotic cell.
  • GAVE 18 protein can be expressed in bacterial cells such as E.
  • Vector DNA can be infroduced into prokaryotic or eukaryotic cells via conventional transformation or transfection techniques.
  • transformation and “transfection” are intended to refer to a variety of art-recognized techniques for introducing foreign nucleic acid (e.g., DNA) into a host cell, including calcium phosphate or calcium chloride co-precipitation, transduction, DEAE-dextran-mediated fransfection, lipofection or electroporation.
  • a gene that encodes a selectable marker (e.g., for resistance to antibiotics) generally is introduced into the host cells along with the gene of interest.
  • selectable markers include those that confer resistance to drugs, such as G418, hygromycin and methofrexate.
  • Nucleic acid encoding a selectable marker can be introduced into a host cell on the same vector as that encoding GAVE 18 or can be introduced on a separate vector. Cells stably transfected with the introduced nucleic acid can be identified by drug selection (e.g., cells that have incorporated the selectable marker gene will survive, while the other cells die).
  • a host cell of the invention such as a prokaryotic or eukaryotic host cell in culture, can be used to produce (i.e., express) GAVEl 8 protein.
  • the invention further provides methods for producing GAVE 18 protein using the host cells of the invention. Ln one embodiment, the method comprises culturing the host cell of invention (into that a recombinant expression vector encoding GAVE 18 has been introduced) in a suitable medium such that GAVE 18 protein is produced. Li another embodiment, the method further comprises isolating GAVEl 8 from the medium or the host cell.
  • GAVE 18 comprises an inducible expression system for the recombinant expression of other proteins subcloned in modified expression vectors.
  • host cells comprising a mutated G protein (e.g., yeast cells, Y2 adrenocortical cells and eye " S49, see U.S. Pat. Nos.
  • a second expression vector is used to transduce the GAVEl 8-comprsing host cells.
  • the second vector comprises a structural gene that complements the G protein mutation of the host cell (i.e., functional mammalian or yeast G s , G, G 0 , or G q , e.g., see PCT Publication No. WO 97/48820; U.S. Pat. Nos. 6,168,927 BI, 5,739,029 and 5,482,835) in addition to the gene of interest to be expressed by the inducible system.
  • the complementary structural gene of the second vector is inducible; i.e., under the control of an exogenously added component (e.g., tetracycline, LPTG, small molecules etc, see Sambrook et al. supra) that activates a promoter which is operably linked to the complementary structural gene.
  • an exogenously added component e.g., tetracycline, LPTG, small molecules etc, see Sambrook et al. supra
  • the protein encoded by the complementary structural gene is functionally expressed such that the constitutively active GAVEl 8 now will form a complex that leads to appropriate downstream pathway activation (e.g., second messenger formation).
  • the gene of interest comprising the second vector possesses an operably linked promoter that is activated by the appropriate second messenger (e.g., CREB, API elements).
  • the promoter upstream from the gene of interest is activated to express the product of said gene.
  • the inducer is absent, expression of the gene of interest is switched off.
  • the host cells for the inducible expression system include, but are not limited to, S49 (eye " ) cells. While cell lines are contemplated that comprise G-protein mutations, suitable mutants may be artificially produced/constructed (see U.S. Pat. Nos. 6,168,927 BI, 5,739,029 and 5,482,835 for yeast cells).
  • the cells are transfected with a vector operably linked to a cDNA comprising a sequence encoding a protein as set forth in SEQ ED NO:2.
  • the first and second vectors comprising said system are contemplated to include, but are not limited to, pCDM8 (Seed, Nature (1987) 329:840) and pMT2PC (Kaufman et al, EMBO J (1987) 6:187-195), pYepSecl (Baldari et al, EMBO J (1987) 6:229-234), pMFa (Kurjan et al. Cell (1982) 30:933-943), pJRY88 (Schultz et al.
  • the host cells may be transfected by such suitable means, wherein transfection results in the expression of a functional GAVEl 8 protein (e.g., Sambrook et al, supra, and Kriegler, Gene Transfer and Expression: A Laboratory Manual, Stockton Press, New York, NY, 1990).
  • functional proteins include, but are not limited to, proteins that once expressed, form complexes with G-proteins, where the G-proteins regulate second messenger formation.
  • transfecting host cells include, but certainly are not limited to transfection, electroporation, microinjection, transduction, cell fusion, DEAE dextran, calcium phosphate precipitation, lipofection (lysosome fusion), use of a gene gun, or a DNA vector transporter (see, e.g., Wu et al, 1992, J. Biol. Chem. 267:963-967; Wu and Wu, 1988, J. Biol. Chem. 263:14621- 14624; Hartmut et al, Canadian Patent Application No. 2,012,311, filed March 15, 1990).
  • promoters have applications in the present invention. Indeed, expression of a polypeptide of the present invention may be controlled by any promoter/enhancer element Icnown in the art, but these regulatory elements must be functional in the host selected for expression.
  • Promoters which may be used to control GAVE 18 expression include, but are not limited to, the SV40 early promoter region (Benoist and Chambon, 1981, Nature 290:304-310), the promoter contained in the 3' long terminal repeat of Rous sarcoma virus (Yamamoto, et al, 1980, Cell 22:787- 797), the herpes thymidine kinase promoter (Wagner et al, 1981, Proc. Natl. Acad. Sci.
  • mouse mammary tumor virus control region which is active in testicular, breast, lymphoid and mast cells (Leder et al, 1986, Cell 45:485-495), albumin gene control region which is active in liver (Pifrkert et al, 1987, Genes and Devel. 1:268-276), alpha-fetoprotein gene control region which is active in liver (Krumlauf et al, 1985, Mol. Cell. Biol. 5:1639-1648; Hammer et al, 1987, Science 235:53-58), alpha 1-antitrypsin gene control region which is active in the liver (Kelsey et al, 1987, Genes and Devel. 1 : 161-171), beta-globin gene control region which is active in myeloid cells
  • Expression vectors containing a nucleic acid molecule of the invention can be identified by four general approaches: (a) PCR amplification of the desired plasmid DNA or specific mRNA, (b) nucleic acid hybridization, (c) presence or absence of selection marker gene functions, and (d) expression of inserted sequences.
  • the nucleic acids can be amplified by PCR to provide for detection of the amplified product.
  • the second approach the presence of a foreign gene inserted in an expression vector can be detected by nucleic acid hybridization using probes comprising sequences that are homologous to an inserted marker gene.
  • the recombinant vector/host system can be identified and selected based upon the presence or absence of certain "selection marker” gene functions (e.g., -galactosidase activity, thymidine kinase activity, resistance to antibiotics, transformation phenotype, occlusion body formation in baculovirus, etc.) caused by the insertion of foreign genes in the vector.
  • selection marker e.g., -galactosidase activity, thymidine kinase activity, resistance to antibiotics, transformation phenotype, occlusion body formation in baculovirus, etc.
  • recombinants containing the insert can be identified by the absence of the GAVEl 8 gene function, hi the fourth approach, recombinant expression vectors can be identified by assaying for the activity, biochemical, or immunological characteristics of the gene product expressed by the recombinant, provided that the expressed protein assumes a functionally active conformation.
  • a wide variety of host/expression vector combinations may be employed in expressing the DNA sequences of this invention.
  • Useful expression vectors may consist of segments of chromosomal, non-chromosomal and synthetic DNA sequences.
  • Suitable vectors include derivatives of SV40 and known bacterial plasmids, e.g., E.
  • coli plasmids col El, pCRl, pBR322, pMal-C2, pET, pGEX (Smith et al., 1988, Gene 67:31-40), pMB9 and their derivatives, plasmids such as RP4; phage DNAS, e.g., the numerous derivatives of phage ⁇ , e.g., NM989, and other phage DNA, e.g., M13 and filamentous single stranded phage DNA; yeast plasmids such as the 2 ⁇ plasmid or derivatives thereof; vectors useful in eukaryotic cells, such as vectors useful in insect or mammalian cells; vectors derived from combinations of plasmids and phage DNAs, such as plasmids that have been modified to employ phage DNA or other expression control sequences; and the like.
  • phage DNAS e.g., the numerous derivatives of phage ⁇ , e.g
  • both non-fusion transfer vectors such as but not limited to pVL941 (BamHl cloning site; Summers), pVL1393 (BamHl, Smal, Xbal, EcdRl, Notl, Xma , BglR, and Pstl cloning site; Lnvitrogen), pVL1392 (BglE, Pstl, Notl, XmaTH., EcoRI, Xbal, Smal, and BaniRl cloning site; Summers and lnvitrogen), and pBlue£ cHI (BamHl, BglK, Pstl, Ncol, and HindlR cloning site, with blue/white recombinant screening possible; lnvitrogen), and fusion transfer vectors, such as but not limited to pAc700 (BamHl and Kpn ⁇ cloning site, in which the
  • Mammalian expression vectors contemplated for use in the invention include vectors with inducible promoters, such as the dihydrofolate reductase (DHFR) promoter, e.g., any expression vector with a DHFR expression vector, or a E>HER/mefhotrexate co-amplification vector, such as p ⁇ D (Pstl, Sa l, Sbal, Smal, and EcoRI cloning site, with the vector expressing both the cloned gene and DHFR; see Kaufman, Current Protocols in Molecular Biology, 16.12 (1991).
  • DHFR dihydrofolate reductase
  • a glutamine synthetase/methionine sulfoximine co-amplification vector such as p ⁇ 14 (Hindm, Xbal, Smal, Sbal, EcoRI, and Bell cloning site, in which the vector expresses glutamine synthase and the cloned gene; Celltech).
  • a vector that directs episomal expression under control of Epstein Barr Virus can be used, such as pREP4 (BamH 1 , Sfll, Xhol, Notl, Nhel, Hindm, Nliel, PvuU, and Kpnl cloning site, constitutive RSV-LTR promoter, hygromycin selectable marker; Lnvitrogen), pCEP4 (BamHl, Sfll, Xhol, Notl, Nliel, Hindm, Nliel, PvuU, and Kpnl cloning site, constitutive hCMV immediate early gene, hygromycin selectable marker; lnvitrogen), pMEP4 (Kpnl, Pvul, Nliel, HindHl, Notl, Xhol, Sfll, BamHl cloning site, inducible metallothionein Iia gene promoter, hygromycin selectable marker: Ln
  • Selectable mammalian expression vectors for use in the invention include pRc/CMV (Hindm, BstXI, Notl, Sbal, and Apal cloning site, G418 selection; lnvitrogen), pRc/RSV (Hindm, Spel, BstXI, Notl, Xbal cloning site, G418 selection; Lnvitrogen), and others.
  • Vaccinia virus mammalian expression vectors for use according to the invention include but are not limited to pSCl 1 (Smal cloning site, TK- and /3-gal selection), pMJ601 (Sail, Smal, Afll, Narl, BspM , BamHl, Apal, Nhel, SacH, Kpnl, and Hindm cloning site; TK- and /3-gal selection), and pTKgptFl S (EcoHI, Pstl, Sail, Accl, Malawi., Sbal, BamHl, and ⁇ pa cloning site, TK or XPRT selection).
  • pSCl 1 Mal cloning site, TK- and /3-gal selection
  • pMJ601 Smal, Afll, Narl, BspM , BamHl, Apal, Nhel, SacH, Kpnl, and Hindm cloning site
  • Yeast expression systems can also be used according to the invention to express GAVE 18 protein, a variant thereof, or an analog or derivative thereof.
  • the non-fusion pYES2 vector (Xbal, Sphl, Shol, Notl, GstXI, EcoRI, BstXI, BamHl, Sad, Kpn 1 , and Hindm cloning sit; lnvitrogen) or the fusion pYESHisA, B, C (Xbal, Sphl, Shol, Notl, BstXI, EcoRI, BamHl, Sad, Kpnl, and Hindm cloning site, N-terminal peptide purified with ProBond resin and cleaved with enterokinase; lnvitrogen), to mention just two, can be employed according to the invention.
  • recombinant expression vectors can be propagated and prepared in quantity.
  • the expression vectors that can be used include, but are not limited to, the following vectors or their derivatives: human or animal viruses such as vaccinia virus or adenovirus; insect viruses such as baculovirus; yeast vectors; bacteriophage vectors (e.g., lambda), and plasmid and cosmid DNA vectors, to name but a few.
  • a host cell strain may be chosen which modulates the expression of the inserted sequences, or modifies and processes the gene product in the specific fashion desired.
  • Different host cells have characteristic and specific mechanisms for the translational and post-translational processing and modification (e.g., glycosylation, cleavage [e.g., of signal sequence]) of proteins.
  • Appropriate cell lines or host systems can be chosen to ensure the desired modification and processing of the foreign protein expressed. For example, expression in a bacterial system can be used to produce an nonglycosylated core protein product.
  • a host cell of the present invention also can be used to produce nonhuman fransgenic animals.
  • a host cell of the invention is a fertilized oocyte or an embryonic stem cell into which GAV ⁇ l ⁇ -coding sequences have been introduced.
  • Such host cells then can be used to create non-human transgenic animals into which exogenous GAVE 18 sequences have been introduced into the genome, or homologous recombinant animals in which endogenous GAVE 18 sequences have been altered.
  • Such animals are useful for studying the function and/or activity of GAVE 18 and for identifying and/or evaluating modulators of GAVEl 8 activity.
  • transgenic animal is a non-human animal, preferably a mammal, more preferably a rodent such as a rat or mouse, in that one or more of the cells of the animal includes a fransgene.
  • rodent such as a rat or mouse
  • transgenic animals include non-human primates, sheep, dogs, cows, goats, chickens, amphibians etc.
  • fransgene refers to exogenous DNA that is integrated into the genome of a cell from which a transgenic animal develops and that remains in the genome of the mature animal.
  • the fransgene directs the expression of an encoded gene product in one or more cell types or tissues of the transgenic animal.
  • a "homologous recombinant animal” is a non-human animal, preferably a mammal, more preferably a mouse, in which an endogenous GAVE 18 gene has been altered by homologous recombination. That is accomplished between the endogenous gene and an exogenous DNA molecule introduced into a cell of the animal, e.g., an embryonic cell of the animal, prior to development of the animal.
  • a transgenic animal of the invention can be created by introducing a GAVEl 8-encoding nucleic acid molecule into the male pronuclei of a fertilized oocyte using one of the transfection methods described above. The oocyte is then allowed to develop in a pseudopregnant female foster animal.
  • the GAVEl 8 cDNA sequence e.g., that of (SEQ ED NO:l), for example, can be infroduced as a fransgene into the genome of a non-human animal.
  • a nonhuman homologue of the human GAVE 18 gene such as a mouse GAVE 18 gene, can be isolated based on hybridization to the human GAVE 18 cDNA, and used as a fransgene.
  • Lntronic sequences and polyadenylation signals also can be included in the fransgene to increase the efficiency of expression of the fransgene.
  • a tissue-specific regulatory sequence(s) can be operably linked to the GAVE 18 fransgene to direct expression of GAVE 18 protein in particular cells.
  • transgenic founder animal can be used to breed additional animals carrying the fransgene.
  • transgenic animals carrying a fransgene encoding GAVE 18 can be bred further to other transgenic animals carrying other fransgenes.
  • a vector is prepared that contains at least a portion of a GAVE18 gene (e.g, a human or a non-human homolog of the GAVE18 gene, e.g., a murine GAVE18 gene) into which a deletion, addition or substitution has been infroduced thereby to alter, e.g, functionally disrupt, the GAVE 18 gene.
  • the vector is designed such that, on homologous recombination, the endogenous GAVEl 8 gene is disrupted functionally (i.e., no longer encodes a functional protein; also referred to as a knock out" vector).
  • the vector can be designed such that, on homologous recombination, the endogenous GAVEl 8 gene is mutated or otherwise altered but still encodes functional protein (e.g, the upstream regulatory region can be altered thereby to alter the expression of the endogenous GAVE 18 protein).
  • the altered portion of the GAVE 18 gene is flanked at the 5' and 3' ends by an additional nucleic acid sequence of the GAVE 18 gene to allow for homologous recombination to occur between the exogenous GAVE 18 gene carried by the vector and an endogenous GAVE 18 gene in an embryonic stem cell.
  • flanking GAVE 18 nucleic acid sequence is of sufficient length for successful homologous recombination with the endogenous gene.
  • flanking DNA both at the 5' and 3' ends
  • flanking DNA are included in the vector (see, e.g, Thomas et al. Cell (1987) 51:503 for a description of homologous recombination vectors).
  • the vector is infroduced into an embryonic stem cell line (e.g, by elecfroporation) and cells in which the infroduced GAVE 18 gene has homologously recombined with the endogenous GAVE 18 gene are selected (see, e.g, Li et al. Cell (1992) 69:915).
  • the selected cells then are injected into a blastocyst of an animal (e.g, a mouse) to form aggregation chimeras (see, e.g, Bradley in Teratocarcinomas and Embryonic Stem Cells: A Practical Approach, Robertson, ed, LRL, Oxford, (1987) pp. 113-152).
  • a chimeric embryo then can be implanted into a suitable pseudopregnant female foster animal and the embryo brought to term.
  • Progeny harboring the homologously recombined DNA in the germ cells can be used to breed animals in that all cells of the animal contain the homologously recombined DNA by germline transmission of the fransgene.
  • fransgenic non-human animals can be produced that contain selected systems to allow for regulated expression of the fransgene.
  • a system is the cre/loxP recombinase system of bacteriophage PI.
  • cre/loxP recombinase system of bacteriophage PI.
  • a recombinase system is the FLP recombinase system of S. cerevisiae (O'Gorrnan et al. Science (1991) 251:1351-1355).
  • a cre/loxP recombinase system is used to regulate expression of the fransgene
  • animals containing fransgenes encoding both the ere recombinase and a selected protein are required.
  • Such animals can be provided through the construction of "double" transgenic animals, e.g, by mating two transgenic animals, one containing a fransgene encoding a selected protein and the other containing a fransgene encoding a recombinase.
  • Clones of the non-human fransgenic animals described herein also can be produced according to the methods described in Wilmut et al. Nature (1997) 385:810-813 and PCT Publication Nos.
  • a cell e.g, a somatic cell
  • the quiescent cell then can be fused, e.g, through the use of elecfrical pulses, to an enucleated oocyte from an animal of the same species from which the quiescent cell is isolated.
  • the reconstructed oocyte then is cultured such that it develops to morula or blastocyte, and then is transferred to a pseudopregnant female foster animal.
  • the offspring borne of the female foster animal will be a clone of the animal from that the cell, e.g, the somatic cell, is isolated.
  • compositions suitable for administration can be incorporated into pharmaceutical compositions suitable for administration.
  • Such compositions typically comprise the nucleic acid molecule, protein or antibody, and a pharmaceutically acceptable carrier.
  • pharmaceutically acceptable carrier is intended to include any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents and the like, compatible with pharmaceutical administration.
  • the use of such media and agents for pharmaceutically active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the active compound, use thereof in the compositions is contemplated. Supplementary active compounds also can be incorporated into the compositions.
  • a pharmaceutical composition of the present invention is formulated to be compatible with the intended route of administration.
  • routes of administration include parenteral, e.g, intravenous, infradermal, subcutaneous, oral (e.g, inhalation), transdermal (topical), fransmucosal and rectal administration.
  • Solutions or suspensions used for parenteral, infradermal or subcutaneous application can include the following components: a sterile diluent such as water for injection, saline solution, fixed oils, polyethylene glycols, glycerine, propylene glycol or other synthetic solvents; antibacterial agents such as benzyl alcohol or methyl parabens; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as EDTA; buffers such as acetates, mecanictes or phosphates and agents for the adjustment of tonicity such as sodium chloride or dextrose. pH can be adjusted with acids or bases, such as HCI or NaOH.
  • a sterile diluent such as water for injection, saline solution, fixed oils, polyethylene glycols, glycerine, propylene glycol or other synthetic solvents
  • antibacterial agents such as benzyl alcohol or methyl parabens
  • antioxidants such as ascorbic acid or sodium bisulfite
  • compositions suitable for injectable use include sterile aqueous solutions (water miscible) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions.
  • suitable carriers include physiological saline, bacteriostatic water, "CREMOPHOR EL” (BASF; Parsippany, NJ) or phosphate buffered saline (PBS). In all cases, the composition must be sterile and should be fluid to the extent that easy syringability exists.
  • the composition must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms such as bacteria and fungi.
  • the carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol and liquid polyetheylene glycol and the like) and suitable mixtures thereof.
  • the proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants.
  • Prevention of the action of microorganisms can be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal and the like.
  • isotonic agents for example, sugars, polyalcohols such as mannitol, sorbitol or sodium chloride in the composition.
  • Prolonged absorption of the injectable compositions can be brought about by including in the composition an agent that delays absorption, for example, aluminum monostearate and gelatin.
  • Sterile injectable solutions can be prepared by incorporating the active compound (e.g, a GAVEl 8 protein, variant thereof, or analog or derivative thereof; or an anti-GAVEl 8 antibody) in the required amount in an appropriate solvent with one or a combination of ingredients enumerated above, as required, followed by filtered sterilization.
  • the active compound e.g, a GAVEl 8 protein, variant thereof, or analog or derivative thereof; or an anti-GAVEl 8 antibody
  • dispersions are prepared by incorporating the active compound into a sterile vehicle that contains a basic dispersion medium and the required other ingredients from those enumerated above.
  • the preferred methods of preparation are vacuum drying and freeze drying to yield a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.
  • Oral compositions generally include an inert diluent or an edible carrier.
  • the compositions can be enclosed in gelatin capsules or compressed into tablets.
  • the active compound can be incorporated with excipients and used in the form of tablets, troches or capsules.
  • Oral compositions also can be prepared using a fluid carrier for use as a mouthwash, wherein the compound in the fluid carrier is applied orally and swished and expectorated or swallowed.
  • Pharmaceutically compatible binding agents, and/or adjuvant materials can be included as part of the composition.
  • the tablets, pills, capsules, troches and the like can contain any of the following ingredients or compounds of a similar nature: a binder such as microcrystalline cellulose, gum tragacanth or gelatin; an excipient such as starch or lactose, a disintegrating agent such as alginic acid, Primogel or corn starch; a lubricant such as magnesium stearate or Sterotes; a glidant such as colloidal silicon dioxide; a sweetening agent such as sucrose or saccharin; or a flavoring agent such as peppermint, methyl salicylate or orange flavoring.
  • a suitable propellant e.g, a gas such as carbon dioxide or a nebulizer.
  • Systemic adminisfration also can be by fransmucosal or transdermal means.
  • peneflops appropriate to the barrier to be permeated are used in the formulation.
  • Such peneflops generally are known in the art and include, for example, for fransmucosal adminisfration, detergents, bile salts and fusidic acid derivatives.
  • Transmucosal administration can be accomplished through the use of nasal sprays or suppositories.
  • the active compounds are formulated into ointments, salves, gels or creams as generally known in the art.
  • the compounds also can be prepared in the form of suppositories (e.g, with conventional suppository bases such as cocoa butter and other glycerides) or retention enemas for rectal delivery.
  • suppositories e.g, with conventional suppository bases such as cocoa butter and other glycerides
  • retention enemas for rectal delivery.
  • the active compounds are prepared with carriers that will protect the compound against rapid elimination from the body, such as a controlled release formulation, including implants and microencapsulated delivery systems.
  • a controlled release formulation including implants and microencapsulated delivery systems.
  • Biodegradable, biocompatible polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters and polylactic acid.
  • Dosage unit form refers to physically discrete units suited as unitary dosages for the subject to be treated; each unit containing a predetermined quantity of active compound calculated to produce the desired therapeutic effect in association with the required pharmaceutical carrier.
  • about 1 ⁇ g/kg to 15 mg/kg (e.g, 0.1 to 20 mg/kg) of compound is an initial candidate dosage for administration to the patient, whether, for example, by one or more separate administrations or by continuous infusion.
  • a typical daily dosage might range from about 1 /kg to 100 mg/kg or more, depending on the factors mentioned above.
  • the freatment is sustained until a desired suppression of disease symptoms occurs.
  • other dosage regimens may be useful.
  • the progress of the therapy is monitored easily by conventional techniques and assays.
  • An exemplary dosing regimen is disclosed in WO 94/04188.
  • the specification for the dosage unit forms of the invention are dictated by and directly dependent on the unique characteristics of the active compound and the particular therapeutic effect to be achieved and the limitations inherent in the art of compounding such an active compound for the freatment of individuals.
  • a nucleic acid molecule of the present invention can be inserted into vectors and used as gene therapy vectors.
  • Gene therapy vectors can be delivered to a subject by, for example, infravenous injection, local adminisfration (U.S. Patent No. 5,328,470) or by stereotactic injection (see, e.g, Chen et al, Proc Natl Acad Sci USA (1994) 91 :3054-3057).
  • the pharmaceutical preparation of the gene therapy vector can include the gene therapy vector in an acceptable diluent or can comprise a slow release matrix in which the gene delivery vehicle is imbedded.
  • the pharmaceutical preparation can include one or more cells that produce the gene delivery system.
  • compositions can be included in a container, pack or dispenser together with instructions for adminisfration.
  • nucleic acid molecules, proteins, protein homologues, antibodies of the present invention, and fragments of such moieties may be used in one or more of the following methods: a) screening assays; b) detection assays (e.g, chromosomal mapping, tissue typing, forensic biology); c) predictive medicine (e.g, diagnostic assays, prognostic assays, monitoring clinical trials and pharmacogenomics); and d) methods of freatment (e.g, therapeutic and prophylactic).
  • a GAVEl 8 protein interacts with other cellular proteins, and thus can be used for (i) regulation of cellular proliferation; (ii) regulation of cellular differentiation; and (iii) regulation of cell survival.
  • the isolated nucleic acid molecules of the invention can be used to express GAVE18 protein (e.g, via a recombinant expression vector in a host cell in gene therapy applications), to detect GAVEl 8 mRNA (e.g, in a biological sample) or to detect a genetic lesion in a GAVEl 8 gene and to modulate GAVE 18 activity.
  • a GAVE 18 protein can be used to screen drugs or compounds that modulate GAVEl 8 activity or expression, as well as to freat disorders characterized by insufficient or excessive production of GAVEl 8 protein. Screening for the production of GAVEl 8 protein forms that have decreased or aberrant activity compared to GAVE 18 wild type protein can also be performed with the present invention.
  • an anti-GAVEl 8 antibody of the invention can be used to detect and to isolate GAVE 18 proteins and to modulate GAVE 18 activity.
  • the invention further pertains to novel agents identified by the above-described screening assays and uses thereof for treatments as described herein.
  • G protein receptor complex formation Activation of a G protein receptor in the presence of endogenous ligand allows for G protein receptor complex formation, thereupon leading to the binding of GTP to the G protein.
  • the GTPase domain of the G protein slowly hydrolyzes the GTP to GDP resulting, under normal conditions, in receptor deactivation. However, constitutively activated receptors continue to hydrolyze GDP to GTP.
  • a non-hydrolyzable substrate of G protein [ 35 S]GTP ⁇ S
  • [ 35 S]GTP ⁇ S can be used to monitor enhanced binding to membranes which express constitutively activated receptors.
  • Traynor and Nahorski reported that [ 35 S]GTP ⁇ S can be used to monitor G protein coupling to membranes in the absence and presence of ligand (Traynor et al, Mol Pharmacol (1995) 47(4): 848-54).
  • a preferred use of such an assay system is for initial screening of candidate compounds, since the system is generically applicable to all G protein-coupled receptors without regard to the particular G protein that binds to the receptor.
  • G S2 o stimulates the enzyme adenylyl cyclase, while G and G 0 inhibit that enzyme.
  • adenylyl cyclase catalyzes the conversion of ATP to cAMP; thus, constitutively activated GPCRs that couple the G s protein are associated with increased cellular levels of c AMP.
  • constitutively activated GCPRs that might couple the Gj (or G 0 ) protein are associated with decreased cellular levels of cAMP. See “Indirect Mechanism of Synaptic Transmission", Chpt. 8, from Neuron to Brain (3 rd Ed.), Nichols et al. eds, Sinauer Associates, Lnc, 1992.
  • assays that detect cAMP can be used to determine if a candidate compound is an inverse agonist to the receptor.
  • a variety of approaches known in the art for measuring cAMP can be utilized. Ln one embodiment, anti-cAMP antibodies are used in an ELISA-based format. In another embodiment, a whole cell second messenger reporter system assay is contemplated (see PCT Publication No.
  • cyclic AMP drives gene expression by promoting the binding of a cAMP- responsive DNA binding protein or transcription factor (CREB) which then binds to the promoter at specific sites called cAMP response elements, and drives the expression of the gene.
  • CREB cAMP- responsive DNA binding protein or transcription factor
  • reporter systems can be constructed which have a promoter containing multiple cAMP response elements before the reporter gene, e.g, /3-galactosidase or luciferase. Further, as a constitutively activated Gs-linked receptor causes the accumulation of cAMP, that then activates the gene and expression of the reporter protein.
  • the reporter protein such as /3-galactosidase or luciferase, then can be detected using standard biochemical assays (PCT Publication No. WO 00/22131).
  • G proteins such as G 0 and G q
  • G proteins are associated with activation of the enzyme, phospholipase C, which in turn hydrolyzes the phospholipid, PEP2, releasing two intracellular messengers: diacylglycerol (DAG) and inositol 1,4,5-triphosphate (EP3).
  • DAG diacylglycerol
  • EP3 inositol 1,4,5-triphosphate
  • Increased accumulation of EP3 is associated with activation of G q -associated receptors and G 0 -associated receptors (PCT Publication No. WO 00/22131).
  • Assays that detect EP3 accumulation can be used to determine if a candidate compound is an inverse agonist to a G q -associated receptor or a G 0 -associated receptor.
  • G q -associated receptors also can be examined using an API reporter assays that measures whether G q -dependent phospholipase C causes activation of genes containing API elements.
  • activated G q -associated receptors will demonstrate an increase in the expression of such genes, whereby inverse agonists will demonsfrate a decrease in such expression.
  • modulators i.e., candidate or test compounds or agents (e.g, peptides, peptidomimetics, small molecules or other drugs) that bind to GAVE 18 proteins or have a stimulatory or inhibitory effect on, for example, GAVE 18 expression or GAVE 18 activity.
  • modulators i.e., candidate or test compounds or agents (e.g, peptides, peptidomimetics, small molecules or other drugs) that bind to GAVE 18 proteins or have a stimulatory or inhibitory effect on, for example, GAVE 18 expression or GAVE 18 activity.
  • the invention provides assays for screening candidate or test compounds that bind to or modulate the activity of the membrane-bound form of a GAVE 18 protein, polypeptide or biologically active portion thereof.
  • the test compounds of the instant invention can be obtained using any of the numerous approaches in combinatorial library methods known in the art, including: biological libraries; spatially addressable parallel solid phase or solution phase libraries; synthetic library methods requiring deconvolution; the "one-bead one-compound” library method; and synthetic library methods using affinity chromatography selection.
  • the biological library approach is limited to peptide libraries, while the other four approaches are applicable to peptide, non-peptide oligomer or small molecule libraries of compounds (Lam, Anticancer Drug Des (1997) 12:145).
  • an assay is a cell-based assay in which a cell that expresses a membrane-bound form of GAVE 18 protein, or a biologically active portion thereof, on the cell surface is contacted with a test compound and the ability of the test compound to bind to a GAVE 18 protein is determined.
  • the cell for example, can be a yeast cell or a cell of mammalian origin. Determining the ability of the test compound to bind to the GAVEl 8 protein can be accomplished, for example, by coupling the test compound with a radioisotope or enzymatic label so that binding of the test compound to the GAVE 18 protein or biologically active portion thereof can be determined by detecting the labeled compound in a complex.
  • test compounds can be labeled with 125 1, 35 S, 14 C or 3 H, either directly or indirectly and the radioisotope detected by direct counting of radioemmission or by scintillation counting.
  • test compounds can be labeled enzymatically with, for example, horseradish peroxidase, alkaline phosphatase or luciferase and the enzymatic label detected by determination of conversion of an appropriate substrate to product.
  • the assay comprises contacting a cell that expresses a membrane-bound form of GAVEl 8 protein or a biologically active portion thereof, on the cell surface with a known compound that binds GAVE 18 to form an assay mixture, contacting the assay mixture with a test compound and determining the ability of the test compound to interact with a GAVE 18 protein, wherein determining the ability of the test compound to interact with a GAVE 18 protein comprises determining the ability of the test compound to bind preferentially to GAVEl 8 or a biologically active portion thereof as compared to the known compound.
  • an assay is a cell-based assay comprising contacting a cell expressing a membrane-bound form of GAVEl 8 protein or a biologically active portion thereof, on the cell surface with a test compound and determining the ability of the test compound to modulate (e.g, stimulate or inhibit) the activity of the GAVEl 8 protein or biologically active portion thereof. Determining the ability of the test compound to modulate the activity of GAVE 18 or a biologically active portion thereof can be accomplished, for example, by determining the ability of the GAVE 18 protein to bind to or to interact with a GAVE 18 target molecule.
  • a "target molecule” is a molecule with which a GAVEl 8 protein binds or interacts in nature, for example, a molecule on the surface of a cell that expresses a GAVE 18 protein, a molecule on the surface of a second cell, a molecule in the extracellular milieu, a molecule associated with the internal surface of a cell membrane or a cytoplasmic molecule.
  • a GAVE 18 target molecule can be a non-GAVE18 molecule or a GAVE 18 protein or polypeptide of the instant invention.
  • a GAVEl 8 target molecule is a component of a signal transduction pathway that facilitates transduction of an extracellular signal (e.g, a signal generated by binding of a compound to a membrane-bound GAVEl 8 molecule) through the cell membrane and into the cell.
  • the target for example, can be a second intercellular protein that has catalytic activity or a protein that facilitates the association of downsfream signaling molecules with GAVE18.
  • Determining the ability of the GAVEl 8 protein to bind to or to interact with a GAVE 18 target molecule can be accomplished by one of the methods described above for determining direct binding. In a particular embodiment, determining the ability of the GAVE 18 protein to bind to or to interact with a GAVE 18 target molecule can be accomplished by determining the activity of the target molecule.
  • the activity of the target molecule can be determined by detecting induction of a cellular second messenger of the target (e.g, infracellular Ca 2+ , diacylglycerol, EP3 etc.), detecting catalytic/enzymatic activity of the target on an appropriate substrate, detecting the induction of a reporter gene (e.g, a GAVE 18 -responsive regulatory element operably linked to a nucleic acid encoding a detectable marker, e.g. luciferase) or detecting a cellular response, e.g, cellular differentiation or cell proliferation.
  • a reporter gene e.g, a GAVE 18 -responsive regulatory element operably linked to a nucleic acid encoding a detectable marker, e.g. luciferase
  • a cellular response e.g, cellular differentiation or cell proliferation.
  • the present invention further extends to a cell-free assay comprising contacting a GAVE 18 protein, or biologically active portion thereof, with a test compound, and determining the ability of the test compound to bind to the GAVE 18 protein or biologically active portion thereof. Binding of the test compound to the GAVEl 8 protein can be determined either directly or indirectly as described above.
  • the assay includes contacting the GAVE 18 protein or biologically active portion thereof with a known compound that binds GAVE 18 to form an assay mixture, contacting the assay mixture with a test compound, and determining the ability of the test compound to interact with a GAVE 18 protein, wherein determining the ability of the test compound to interact with a GAVE 18 protein comprises determining the ability of the test compound to preferentially bind to GAVEl 8 or biologically active portion thereof as compared to the known compound.
  • Another cell-free assay of the present invention involves contacting GAVE 18 protein or biologically active portion thereof, with a test compound and determining the ability of the test compound to modulate (e.g, stimulate or inhibit) the activity of the GAVE18 protein or biologically active portion thereof. Determining the ability of the test compound to modulate the activity of GAVE 18 can be accomplished, for example, by determining the ability of the GAVE 18 protein to bind to a GAVE 18 target molecule by one of the methods described above for determining direct binding. Ln an alternative embodiment, determining the ability of the test compound to modulate the activity of GAVEl 8 can be accomplished by determining the ability of the GAVEl 8 protein to further modulate a GAVE 18 target molecule. For example, the catalytic/enzymatic activity of the target molecule on an appropriate substrate can be determined as described previously.
  • Still another cell-free assay of the present invention comprises contacting the GAVEl 8 protein or biologically active portion thereof, with a Icnown compound that binds GAVE 18 to form an assay mixture, contacting the assay mixture with a test compound and determining the ability of the test compound to interact with a GAVEl 8 protein.
  • the step for determining the ability of the test compound to interact with a GAVE 18 protein comprises determining the ability of the GAVE 18 protein preferentially to bind to or to modulate the activity of a GAVEl 8 target molecule.
  • Receptors can be activated by non-ligand molecules that necessarily do not inhibit ligand binding but cause structural changes in the receptor to enable G protein binding or, perhaps receptor aggregation, dimerization or clustering that can cause activation.
  • antibodies can be raised to the various portions of GAVEl 8 that are exposed at the cell surface. Those antibodies activate a cell via the G protein cascade as determined by standard assays, such as monitoring cAMP levels or intracellular Ca +2 levels. Because molecular mapping, and particularly epitope mapping, is involved, monoclonal antibodies may be preferred. The monoclonal antibodies can be raised both to intact receptor expressed at the cell surface and peptides known to form at the cell surface. The method of Geysen et al, U.S. Pat. No.
  • Antibodies found to activate GAVE 18 may be modified to minimize activities extraneous to GAVE 18 activation, such as complement fixation.
  • the antibody molecules can be truncated or mutated to minimize or to remove activities outside of GAVE 18 activation. For example, for certain antibodies, only the antigen-binding portion is needed. Thus, the F c portion of the antibody can be removed.
  • Cells expressing GAVE 18 are exposed to antibody to activate GAVEl 8. Activated cells then are exposed to various molecules in order to identify which molecules modulate receptor activity, and result in higher activation levels or lower activation levels. Molecules that achieve those goals then can be tested on cells expressing GAVE 18 without antibody to observe the effect on non-activated cells. The target molecules then can be tested and modified as candidate drugs for the freatment of disorders associated with altered GAVE 18 metabolism using known techniques.
  • the cell-free assays of the instant invention are amenable to use of both the soluble form and the membrane-bound form of GAVEl 8.
  • non-ionic detergents such as n-octylglucoside
  • Binding of a test compound to GAVEl 8 or interaction of GAVEl 8 with a target molecule in the presence and absence of a candidate compound can be accomplished in any vessel suitable for containing the reactants. Examples of such vessels include microtitre plates, test tubes and micro-centrifuge tubes.
  • a fusion protein can be provided that adds a domain that allows one or both of the proteins to be bound to a matrix.
  • glutathione-S-fransferase/GAVE18 fusion proteins or glutathione-S-fransferase/target fusion proteins can be adsorbed onto glutathione SEPHAROSE beads (Sigma Chemical, St. Louis, MO).
  • glutathione-derivatized microtitre plates are then combined with the test compound or the test compound. Subsequently, either the non-adsorbed target protein or GAVEl 8 protein and the mixture are incubated under conditions conducive to complex formation (e.g, at physiological conditions for salt and pH). Following incubation, the beads or microtitre plate wells are washed to remove any unbound components, and the presence of complex formation is measured either directly or indirectly. Alternatively, the complexes can be dissociated from the matrix and the level of GAVEl 8 binding or activity determined using standard techniques.
  • GAVEl 8 or a target molecule thereof can be immobilized utilizing conjugation of biotin and streptavidin.
  • Biotinylated GAVEl 8 or target molecules can be prepared from biotin-NHS (N-hydroxy-succinimide) using techniques well known in the art (e.g, biotinylation kit, Pierce Chemicals, Rockford, EL) and immobilized in the wells of sfreptavidin-coated 96-well plates (Pierce Chemicals).
  • antibodies that are reactive with GAVEl 8 or a target molecule, but do not interfere with binding of the GAVE 18 protein to the target molecule can be derivatized to the wells of the plate. Upon incubation, unbound target or GAVEl 8 can be trapped in the wells by antibody conjugation.
  • Methods for detecting such complexes include immunodetection of complexes using antibodies reactive with GAVEl 8 or target molecule, as well as enzyme-linked assays that rely on detecting an enzymatic activity associated with the GAVE 18 or target molecule.
  • modulators of GAVE 18 expression are identified in a method wherein a cell is contacted with a candidate compound, and the expression of GAVEl 8 mRNA or protein in the cell is determined. The level of expression of GAVE 18 mRNA or protein in the presence of the candidate compound is compared to the level of expression of GAVEl 8 mRNA or protein in the absence of the candidate compound. The candidate compound then can be identified as a modulator of GAVE 18 expression based on that comparison. For example, when expression of GAVEl 8 mRNA or protein is greater (statistically significantly greater) in the presence of the candidate compound than in the absence thereof, the candidate compound is identified as a stimulator or agonist of GAVE 18 mRNA or protein expression. Alternatively, when expression of GAVEl 8 mRNA or protein is less
  • the candidate compound is identified as an inhibitor or antagonist of GAVE 18 mRNA or protein expression. If GAVE 18 activity is reduced in the presence of ligand or agonist, or in a constitutive GAVEl 8, below baseline, the candidate compound is identified as an inverse agonist.
  • the level of GAVEl 8 mRNA or protein expression in the cells can be determined by methods described herein for detecting GAVE 18 mRNA or protein.
  • the GAVE 18 proteins can be used as "bait proteins" in a two-hybrid assay or three-hybrid assay (see, e.g, U.S. Patent No. 5,283,317; Zervos et al. Cell (1993) 72:223-232; Madura et al, J Biol Chem (1993) 268:12046-12054; Bartel et al, Bio/Techniques (1993) 14:920-924; Iwabuchi et al, Ohcogene (1993) 8:1693-1696; and PCT Publication No.
  • GAVEl 8-binding proteins proteins that bind to or interact with GAVEl 8
  • GAVE18-bp proteins that bind to or interact with GAVE18 activity.
  • GAVEl 8-binding proteins are also likely to be involved in the propagation of signals by the GAVEl 8 proteins such as, for example, upsfream or downsfream elements of the GAVE 18 pathway.
  • the present invention enables the production of large quantities of pure GAVE18, physical characterization of the conformation of areas of likely function can be ascertained for rational drug design.
  • the IC3 region of the molecule and EC domains are regions of particular interest. Once the shape and ionic configuration of a region is discerned, candidate drugs that should interact with those regions can be configured and then tested in intact cells, animals and patients. Methods that would enable deriving such 3-D structure information include X-ray crystallography, NMR specfroscopy, molecular modeling and so on. The 3-D structure also can lead to identification of analogous conformational sites in other known proteins where known drugs that act at site exist. Those drugs, or derivatives thereof, may find use with GAVEl 8.
  • the invention further pertains to novel agents identified by the above-described screening assays and uses thereof for treatments as described herein.
  • Portions or fragments of the DNA sequences of the present invention can be used in numerous ways as polynucleotide reagents.
  • the sequences can be used to: (i) map the respective genes on a chromosome and, thus, locate gene regions associated with genetic disease; (ii) identify an individual from a minute biological sample (tissue typing); and (iii) aid in forensic identification of a biological sample.
  • the applications are described in the subsections below.
  • the sequence can be used to map the location of the GAVE18 gene on a chromosome.
  • GAVE18 nucleic acid molecules described herein or fragments thereof can been used to map the location of GAVEl 8 in a genome.
  • the mapping of the location of the GAVE 18 sequence in a genome, particularly a human genome is an important first step in correlating the sequences with genes associated with disease. Briefly, GAVEl 8 genes can be mapped in a genome by preparing PCR primers (preferably 15-25 bp in length) from the GAVE 18 sequences. The primers are used for PCR screening of somatic cell hybrids containing individual human chromosomes. Only those hybrids containing the human gene corresponding to the GAVE 18 sequences yield an amplified fragment.
  • Somatic cell hybrids are prepared by fusing somatic cells from different mammals (e.g, human and mouse cells). As hybrids of human and mouse cells grow and divide, generally human chromosomes are lost in random order, but the mouse chromosomes are retained. By using media in which mouse cells cannot grow (because of lack of a particular enzyme), but in which human cells can grow, the one human chromosome that contains the gene encoding the needed enzyme will be retained. By using various media, panels of hybrid cell lines are established. Each cell line in a panel contains either a single human chromosome or a small number of human chromosomes and a full set of mouse chromosomes, allowing easy mapping of individual genes to specific human chromosomes.
  • mammals e.g, human and mouse cells.
  • Somatic cell hybrids containing only fragments of human chromosomes also can be produced by using human chromosomes with franslocations and deletions.
  • PCR mapping of somatic cell hybrids is a rapid procedure for assigning a particular sequence to a particular chromosome. Three or more sequences can be assigned per day using a single thermocycler.
  • mapping strategies that can similarly be used to map a GAVE 18 sequence to a particular chromosome in a genome include in situ hybridization (described in Fan et al, Proc Natl Acad Sci USA (1990) 87:6223-27), pre-screening with labeled flow-sorted chromosomes and pre-selection by hybridization to chromosome-specific cDNA libraries.
  • Fluorescence in situ hybridization (FISH) of a DNA sequence to a metaphase chromosomal spread can also be used to provide a precise chromosomal location in one step.
  • Chromosome spreads can be made using cells in which division has been blocked in metaphase by a chemical, e.g, colcemid, that disrupts the mitotic spindle.
  • the chromosomes can be freated briefly with trypsin and then stained with Giemsa. A pattern of light and dark bands develops on each chromosome so that the chromosomes can be identified individually.
  • the FISH technique can be used with a DNA sequence as short as 500 or 600 bases.
  • clones larger than 1,000 bases have a higher likelihood of binding to a unique chromosomal location with sufficient signal intensity for simple detection.
  • 1,000 bases and more preferably, 2,000 bases will suffice to get good results in a reasonable amount of time.
  • Chromosomal mapping can be inferred in silico, and employing statistical considerations, ' such as lod scores or mere proximity.
  • Reagents for chromosome mapping can be used individually to locate a single site on a chromosome. Furthermore, panels of reagents can be used for marking multiple sites and/or multiple chromosomes. Reagents corresponding to flanking regions of the GAVE 18 gene actually are preferred for mapping purposes. Coding sequences are more likely to be conserved within gene families, thus increasing the chance of cross hybridization during chromosomal mapping.
  • differences in the DNA sequences between individuals affected and unaffected with a disease associated with GAVEl 8 can be determined. If a mutation is observed in some or all of the affected individuals, but not in any unaffected individuals, then the mutation is likely to be the causative agent of the particular disease. Comparison of affected and unaffected individuals generally involves first looking for structural alterations in the chromosomes such as deletions or franslocations that are visible from chromosome spreads or detectable using PCR based on that DNA sequence. Ultimately, complete sequencing of genes from several individuals can be performed to confirm the presence of a mutation and to distinguish mutations from polymorphisms.
  • a GAVEl 8 sequence of the present invention also can be used to identify individuals from minute biological samples.
  • the United States military for example, is considering the use of restriction fragment length polymorphism (RFLP) for identification of personnel.
  • RFLP restriction fragment length polymorphism
  • genomic DNA of an individual is digested with one or more restriction enzymes and probed on a Southern blot to yield unique bands for identification.
  • the method does not suffer from the current limitations of "Dog Tags" that can be lost, switched or stolen, making positive identification difficult.
  • the sequences of the instant invention are useful as additional DNA markers for RFLP (described in U.S. Patent No. 5,272,057).
  • sequences of the instant invention can be used to provide an alternative technique that determines the actual base-by-base DNA sequence of selected portions of the genome of an individual.
  • a GAVEl 8 sequence described herein can be used to prepare two PCR primers from the 5' and 3' ends of the sequences. The primers then can be used to amplify the DNA of an individual and subsequently provide a sequence thereof.
  • Panels of corresponding DNA sequences from individuals, prepared in that manner, can provide unique individual identifications, as each individual will have a unique set of such DNA sequences due to allelic differences.
  • the sequences of the instant invention can be used to obtain such identification sequences from individuals and from tissue.
  • GAVE 18 sequence of the invention uniquely represents portions of the human genome. Allelic variation occurs to some degree in the coding regions of the sequences and to a greater degree in the noncoding regions. It is estimated that allelic variation between individual humans occurs with a frequency of about once per each 500 bases.
  • Each of the sequences described herein can, to some degree, be used as a standard against which DNA from an individual can be compared for identification purposes. Because greater numbers of polymorphisms occur in the noncoding regions, fewer sequences are necessary to differentiate individuals.
  • the noncoding sequences of SEQ ED NO: 1 can provide positive individual identification with a panel of perhaps 10 to 1,000 primers that each yield a noncoding amplified sequence of 100 bases. If predicted coding sequences, such as those in SEQ D NO:l are used, a more appropriate number of primers for positive individual identification would be 500-2,000.
  • a panel of reagents from GAVE 18 sequences described herein is used to generate a unique identification database for an individual, those same reagents can later be used to identify tissue from that individual.
  • Using the unique identification database positive identification of the individual, living or dead, can be made from extremely small tissue samples.
  • DNA-based identification techniques also can be used in forensic biology. Forensic biology is a scientific field employing genetic typing of biological evidence found at a crime scene as a means for positively identifying, for example, a perpetrator of a crime.
  • PCR technology can be used to amplify DNA sequences taken from very small biological samples such as tissues, e.g, hair or skin, or body fluids, e.g, blood, saliva or semen found at a crime scene. The amplified sequence then can be compared to a standard, thereby allowing identification of the origin of the biological sample.
  • sequences of the instant invention can be used to provide polynucleotide reagents, e.g, PCR primers, targeted to specific loci in the human genome, that can enhance the reliability of DNA-based forensic identifications.
  • a nucleic acid of interest can provide another "identification marker" (i.e., another DNA sequence that is unique to a particular individual).
  • actual base sequence information can be used for identification as an accurate alternative to patterns formed by restriction enzyme generated fragments.
  • Sequences targeted to noncoding regions of SEQ ED NO: 1 are particularly appropriate for that use as greater numbers of polymorphisms occur in the noncoding regions, enhancing discrimination to differentiate individuals using that technique.
  • polynucleotide reagents include the GAVEl 8 sequences or portions thereof; e.g, fragments derived from the noncoding regions of SEQ ED NO: 1 having a length of at least 20 or 30 bases.
  • the GAVE18 sequences described herein further can be used to provide polynucleotide reagents, e.g, labeled or labelable probes that can be used in, for example, an in situ hybridization technique, to identify a specific tissue, e.g, brain tissue.
  • polynucleotide reagents e.g, labeled or labelable probes that can be used in, for example, an in situ hybridization technique, to identify a specific tissue, e.g, brain tissue.
  • Such polynucleotide reagents can be very useful in cases in which a forensic pathologist is presented with a tissue of unknown origin.
  • Panels of such GAVEl 8 probes can be used to identify tissue by species and/or by organ type.
  • the reagents e.g, GAVE 18 primers or probes
  • the reagents can be used to screen tissue culture for contamination (i.e., screen for the presence of a mixture of different types of cells in a culture).
  • the instant invention also pertains to the field of predictive medicine in that diagnostic assays, prognostic assays, pharmacogenomics and monitoring clinical trials are used for prognostic (predictive) purposes to freat an individual prophylactically.
  • diagnostic assays for determining GAVE 18 protein and/or nucleic acid expression as well as GAVEl 8 activity in the context of a biological sample (e.g, blood, urine, feces, sputum, serum, cells and tissue).
  • the assay can be used to determine whether an individual is afflicted with a disease or disorder, or is at risk of developing a disorder, associated with aberrant GAVEl 8 expression or activity.
  • the invention also provides for prognostic (or predictive) assays for determining whether an individual is at risk of developing a disorder associated with GAVE 18 protein, nucleic acid expression, or activity. For example, mutations in a GAVE 18 gene can be assayed in a biological sample. Such assays can be used for prognostic or predictive purpose thereby to freat prophylactically an individual prior to the onset of a disorder characterized by or associated with GAVEl 8 protein, nucleic acid expression or activity.
  • Another aspect of the invention provides methods for determining GAVE 18 protein, nucleic acid expression or GAVE 18 activity in an individual thereby to select appropriate therapeutic or prophylactic agents for that individual (referred to herein as "pharmacogenomics").
  • Pharmacogenomics allows for the selection of agents (e.g, drugs) for therapeutic or prophylactic freatment of an individual based on the genotype of the individual (e.g, the genotype of the individual examined to determine the ability of the individual to respond to a particular agent).
  • agents e.g, drugs
  • Yet another aspect of the invention pertains to monitoring the influence of agents (e.g, drugs or other compounds) on the expression or activity of GAVE 18 in clinical trials.
  • agents e.g, drugs or other compounds
  • An exemplary method for detecting the presence or absence of GAVE 18 in a biological sample involves obtaining a biological sample from a test subject and contacting the biological sample with a compound or an agent capable of detecting GAVEl 8 protein or nucleic acid (e.g, mRNA or genomic DNA) that encodes GAVEl 8 protein such that the presence of GAVEl 8 is detected in the biological sample.
  • a preferred agent for detecting GAVE 18 mRNA or genomic DNA is a labeled nucleic acid probe capable of hybridizing to GAVEl 8 mRNA or genomic DNA.
  • the nucleic acid probe can be, for example, a full-length GAVEl 8 nucleic acid, such as the nucleic acid of SEQ ED NO: 1 or a portion thereof, such as an oligonucleotide of at least 15, 30, 50, 100, 250 or 500 or more nucleotides in length and sufficient to specifically hybridize under stringent conditions to GAVE 18 mRNA or genomic DNA.
  • a full-length GAVEl 8 nucleic acid such as the nucleic acid of SEQ ED NO: 1 or a portion thereof, such as an oligonucleotide of at least 15, 30, 50, 100, 250 or 500 or more nucleotides in length and sufficient to specifically hybridize under stringent conditions to GAVE 18 mRNA or genomic DNA.
  • Other suitable probes for use in the diagnostic assays of the invention are described herein.
  • a particular agent for detecting GAVE 18 protein is an antibody capable of binding to GAVE 18 protein, preferably an antibody with a detectable label.
  • Antibodies can be polyclonal, chimeric, or more preferably, monoclonal. An intact antibody or a fragment thereof (e.g, F a b or can be used.
  • the term "biological sample” is intended to include tissues, cells and biological fluids isolated from a subject, as well as tissues, cells and fluids present within a subject. That is, the detection method of the invention can be used to detect GAVE 18 mRNA, protein or genomic DNA in a biological sample in vitro as well as in vivo.
  • in vitro techniques for detection of GAVE 18 mRNA include Northern hybridization and in situ hybridization.
  • In vitro techniques for detection of GAVEl 8 protein include ELISA, Western blot, immunoprecipitation and immunofluorescence.
  • In vitro techniques for detection of GAVE 18 genomic DNA include Southern hybridization.
  • in vivo techniques for detection of GAVEl 8 protein include introducing into a subject a labeled anti-GAVEl 8 antibody.
  • the antibody can be labeled with a radioactive marker, the presence and location of which in a subject can be detected by standard imaging techniques.
  • the biological sample contains protein molecules from the test subject.
  • the biological sample can contain mRNA molecules from the test subject or genomic DNA molecules from the test subject.
  • a particular biological sample having applications herein is a peripheral blood leukocyte sample isolated by conventional means from a subject.
  • association with a disease and identification of nucleic acid or protein polymorphism diagnostic for the carrier or the affected can be beneficial in developing prognostic or diagnostic assays.
  • GAVE 18 expression is elevated in cells associated with activated or inflammatory states.
  • Disorders associated with inflammation include, anaphylactic states, colitis, Crohn's Disease, edematous states, contact hypersensitivity, allergy, other forms of arthritis, meningitis and other conditions wherein the immune system reacts to an insult by vascular dilation, heat, collecting cells, fluids and the like at a site resulting in swelling and the like.
  • a disorder in GAVEl 8 metabolism may be diagnostic for rheumatoid arthritis.
  • the molecular mechanism of rheumatoid arthritis may be detectable, such as, there may be a diagnostic SNP, RFLP, variability of expression level, variability of function and so on, that can be detectable in a tissue sample, such as a blood sample.
  • the methods further involve obtaining a biological sample from a control subject, contacting the control sample with a compound or agent capable of detecting GAVE 18 protein, mRNA or genomic DNA, such that the presence and amount of GAVEl 8 protein, mRNA or genomic DNA is detected in the biological sample, and then comparing the presence and amount of GAVE 18 protein, mRNA or genomic DNA in the control sample with the presence and amount of GAVEl 8 protein, mRNA or genomic DNA in a test sample.
  • High throughput assays of chemical libraries Any of the assays for compounds capable of modulating the activity of GAVE 18 are amenable to high throughput screening.
  • High throughput screening systems are commercially available (see, e.g., Zymarlc Corp, Hopkinton, MA; Air Technical Industries, Mentor, OH; Beckman Instruments, Inc. Fullerton, CA; Precision Systems, Lie, Natick, MA, etc.). These systems typically automate entire procedures including all sample and reagent pipetting, liquid dispensing, timed incubations, and final readings of the microplate in detector(s) appropriate for the assay. These configurable systems provide high thruput and rapid start up as well as a high degree of flexibility and customization. The manufacturers of such systems provide detailed protocols the various high throughput. Thus, for example, Zymark Corp. provides technical bulletins describing screening systems for detecting the modulation of gene transcription, ligand binding, and the like.
  • kits for detecting the presence of GAVEl 8 in a biological sample can be used to determine if a subject is suffering from or is at increased risk of developing a disorder associated with aberrant expression of GAVEl 8 (e.g, an immunological disorder).
  • the kit can comprise a labeled compound or agent capable of detecting GAVE 18 protein or mRNA in a biological sample and means for determining the amount of GAVE 18 in the sample (e.g, an anti-GAVEl 8 antibody or an oligonucleotide probe that binds to DNA encoding GAVEl 8, e.g, SEQ ID NO:l). Kits also can be used to yield results indicating whether the tested subject is suffering from or is at risk of developing a disorder associated with aberrant expression of GAVE 18, if the amount of GAVE 18 protein or mRNA is above or below a normal level.
  • the kit can comprise, for example: (1) a first antibody (e.g, attached to a solid support) that binds to GAVE 18 protein; and, optionally, (2) a second, different antibody that binds to GAVEl 8 protein or to the first antibody and is conjugated to a detectable agent. If the second antibody is not present, then either the first antibody can be detectably labeled, or alternatively, another molecule that binds the first antibody can be detectably labeled. In any event, a labeled binding moiety is included to serve as the detectable reporter molecule, as known in the art.
  • a kit of the present invention can comprise, for example: (1) an oligonucleotide, e.g, a detectably-labeled oligonucleotide, that hybridizes to a GAVE 18 nucleic acid sequence or (2) a pair of primers useful for amplifying a GAVE18 nucleic acid molecule.
  • the kit also can comprise, e.g, a buffering agent, a preservative or a protein stabilizing agent.
  • the kit also can comprise components necessary for detecting the detectable agent (e.g, an enzyme or a substrate).
  • the kit may also contain a confrol sample or series of confrol samples that can be assayed and compared to the test sample. Each component of the kit is usually enclosed within an individual container, and all of the various containers are within a single package. Instructions for observing whether the tested subject is suffering from or is at risk of developing a disorder associated with aberrant expression of GAVE 18 may also be enclosed.
  • the methods described herein furthermore can be utilized as diagnostic or prognostic assays to identify subjects having or are at risk of developing a disease or disorder associated with aberrant GAVEl 8 expression or activity.
  • the assays described herein such as the preceding diagnostic assays or the following assays, can be utilized to identify a subject having, or is at risk of developing, a disorder associated with GAVE 18 protein, nucleic acid expression or activity.
  • the prognostic assays can be utilized to identify a subject having or is at risk for developing such a disease or disorder.
  • test sample refers to a biological sample obtained from a subject of interest.
  • a test sample can be a biological fluid (e.g, serum), cell sample or tissue.
  • the prognostic assays described herein can be used to determine whether a subject can be administered an agent (e.g, an agonist, antagonist, peptidomimetic, protein, peptide, nucleic acid, small molecule or other drug candidate) to freat a disease or disorder associated with aberrant GAVE 18 expression or activity.
  • an agent e.g, an agonist, antagonist, peptidomimetic, protein, peptide, nucleic acid, small molecule or other drug candidate
  • agents e.g, an agonist, antagonist, peptidomimetic, protein, peptide, nucleic acid, small molecule or other drug candidate
  • agents e.g, an agonist, antagonist, peptidomimetic, protein, peptide, nucleic acid, small molecule or other drug candidate
  • such methods can be used to determine whether a subject can be freated effectively with a specific agent or class of agents (e.g, agents of a type that decrease GAVE 18 activity).
  • the instant invention provides methods for determining whether a subject can be freated effectively with an agent for a disorder associated with aberrant GAVE 18 expression or activity in which a test sample is obtained and GAVEl 8 protein or nucleic acid is detected (e.g, wherein the presence of GAVEl 8 protein or nucleic acid is diagnostic of a subject that can be administered the agent to treat a disorder associated with aberrant GAVE 18 expression or activity).
  • the methods of the invention also can be used to detect genetic lesions or mutations in a GAVE 18 gene, and thereby determine whether a subject with the lesioned gene is at risk for a disorder characterized by aberrant cell proliferation and/or differentiation.
  • the methods include detecting, in a sample of cells from the subject, the presence or absence of a genetic lesion or mutation characterized by at least one of an alteration affecting the integrity of a gene encoding a GAVE18-protein or the mis-expression of the GAVE 18 gene.
  • such genetic lesions or mutations can be detected by ascertaining the existence of at least one of: 1) a deletion of one or more nucleotides from a GAVE 18 gene; 2) an addition of one or more nucleotides to a GAVEl 8 gene; 3) a substitution of one or more nucleotides of a GAVEl 8 gene; 4) a chromosomal rearrangement involving a GAVEl 8 gene; 5) an alteration in the level of a messenger RNA transcript of a GAVEl 8 gene; 6) an aberrant modification of a GAVEl 8 gene, such as of the methylation pattern of the genomic DNA; 7) a non-wild type level of a GAVE 18 protein; 8) an allelic loss of a GAVE 18 gene; and 9) an inappropriate post-translational modification of a GAVE 18 protein.
  • assay techniques known in the art that can be used for detecting lesions in a GAVE 18 gene.
  • a preferred biological sample is
  • detection of the lesion involves the use of a probe/primer in a polymerase chain reaction (PCR) (see, e.g, U.S Patent Nos. 4,683,195 and 4,683,202), such as anchor PCR or RACE PCR, or, alternatively, in a ligation chain reaction (LCR) (see, e.g, Landegran et al. Science (1988) 241:1077-1080; and Nakazawa et al, Proc Natl Acad Sci USA (1994) 91:360-364), the latter of which can be particularly useful for detecting point mutations in the GAVEl 8 gene (see, e.g, Abravaya et al.
  • PCR polymerase chain reaction
  • LCR ligation chain reaction
  • the method can include the steps of collecting a sample of cells from a patient, isolating nucleic acid (e.g, genomic, mRNA or both) from the cells of the sample, contacting the nucleic acid sample with one or more primers that specifically hybridize to a GAVEl 8 gene under conditions such that hybridization and amplification of the nucleic acid sample.
  • nucleic acid e.g, genomic, mRNA or both
  • GAVEl 8 gene (if present) occurs and detecting the presence or absence of an amplification product or detecting the size of the amplification product and comparing the length to a control sample. It is anticipated that PCR and/or LCR may be desirable to use as a preliminary amplification step in conjunction with any of the techniques used for detecting mutations described herein.
  • Alternative amplification methods include: self-sustained sequence replication (Guatelli et al, Proc Natl Acad Sci USA (1990) 87:1874-1878), franscriptional amplification system (Kwoh et al, Proc Natl Acad Sci USA (1989) 86:1173-1177), Q- ⁇ replicase (Lizardi et al, Bio/Technology (1988) 6:1197) or any other nucleic acid amplification method, followed by the detection of the amplified molecules using techniques well known to those of skill in the art.
  • the detection schemes are especially useful for the detection of nucleic acid molecules if such molecules are present in very low numbers.
  • mutations in a GAVE 18 gene from a sample cell can be identified by alterations in resfriction enzyme cleavage patterns.
  • sample and confrol DNA is isolated, amplified (optionally), digested with one or more restriction endonucleases and fragment length sizes are determined by gel electrophoresis and compared. Differences in fragment length sizes between sample and confrol DNA indicate mutations in the sample DNA.
  • sequence specific ribozymes see, e.g, U.S. Patent No. 5,498,531 can be used to score for the presence of specific mutations by development or loss of a ribozyme cleavage site.
  • genetic mutations in GAVE 18 can be identified by hybridizing a sample and control nucleic acids, e.g, DNA or RNA, to high density arrays containing hundreds or thousands of oligonucleotides probes (Cronin et al. Human Mutation (1996) 7:244-255; Kozal et al. Nature Medicine (1996) 2:753-759).
  • genetic mutations in GAVE18 can be identified in two-dimensional arrays containing light-generated DNA probes as described in Cronin et al, supra. Briefly, a first hybridization array of probes can be used to scan through long stretches of DNA in a sample and confrol to identify base changes between the sequences by generating linear arrays of sequential overlapping probes.
  • That step allows the identification of point mutations.
  • the step is followed by a second hybridization array that allows the characterization of specific mutations by using smaller, specialized probe arrays complementary to all variants or mutations detected.
  • Each mutation array is composed of parallel probe sets, one complementary to the wild type gene and the other complementary to the mutant gene.
  • any of a variety of sequencing reactions Icnown in the art can be used to directly sequence the GAVE 18 gene and detect mutations by comparing the sequence of the sample GAVEl 8 with the corresponding wild type (confrol) sequence.
  • sequencing reactions include those based on techniques developed by Maxam & Gilbert (Proc Natl Acad Sci USA (1977) 74:560) or Sanger (Proc Natl Acad Sci USA (1977) 74:5463). It also is contemplated that any of a variety of automated sequencing procedures can be utilized when performing the diagnostic assays (Bio/Techniques (1995) 19:448), including sequencing by mass specfrometry (see, e.g, PCT Publication No. WO 94/16101; Cohen et al, Adv Chromatogr (1996) 36: 127-162; and Griffin et al, Appl Biochem Biotechnol (1993) 38:147-159).
  • RNA/RNA or RNA/DNA heteroduplexes Other methods for detecting mutations in the GAVEl 8 gene include methods in which protection from cleavage agents is used to detect mismatched bases in RNA/RNA or RNA/DNA heteroduplexes (Myers et al. Science (1985) 230:1242). Ln general, the technique of "mismatch cleavage" entails providing heteroduplexes formed by hybridizing (labeled) RNA or DNA containing the wild type GAVE 18 sequence with potentially mutant RNA or DNA obtained from a tissue sample. The double-sfranded duplexes are treated with an agent that cleaves single-stranded regions of the duplex such as that will exist due to base pair mismatches between the confrol and sample strands.
  • RNA/DNA duplexes can be treated with RNase to digest mismatched regions and DNA/DNA hybrids can be treated with SI nuclease to digest mismatched regions.
  • either DNA/DNA or RNA/DNA duplexes can be freated with hydroxylamine or osmium tetroxide and with piperidine to digest mismatched regions. After digestion of the mismatched regions, the resulting material then is separated by size on denaturing polyacrylamide gels to determine the site of mutation. See, e.g. Cotton et al, Proc Natl Acad Sci USA (1988) 85:4397; Saleeba et al. Methods Enzymol (1992) 217:286-295. Li a preferred embodiment, the confrol DNA or RNA can be labeled for detection.
  • the mismatch cleavage reaction employs one or more proteins that recognize mismatched base pairs in double-sfranded DNA (so called "DNA mismatch repair" enzymes) in defined systems for detecting and mapping point mutations in GAVE 18 cDNAs obtained from samples of cells.
  • DNA mismatch repair enzymes
  • the mutY enzyme of E. coli cleaves A at G/A mismatches and the thymidine DNA glycosylase from HeLa cells cleaves T at G/T mismatches (Hsu et al, Carcinogenesis (1994) 15:1657-1662).
  • a probe based on a GAVE18 sequence e.g, a wild type GAVEl 8 sequence
  • a cDNA or other DNA product from a test cell(s).
  • the duplex is treated with a DNA mismatch repair enzyme and the cleavage products, if any, can be detected in electrophoresis protocols or the like, see, e.g, U.S. Patent No. 5,459,039.
  • alterations in elecfrophoretic mobility will be used to identify mutations in GAVEl 8 genes.
  • single-strand conformation polymorphism SSCP
  • SSCP single-strand conformation polymorphism
  • Single-stranded DNA fragments of sample and confrol GAVE 18 nucleic acids will be denatured and allowed to renature.
  • the secondary structure of single-stranded nucleic acids varies according to sequence and the resulting alteration in elecfrophoretic mobility enables the detection of even a single base change.
  • the DNA fragments may be labeled or detected with labeled probes.
  • the sensitivity of the assay may be enhanced by using RNA (rather than DNA) because the secondary structure of RNA is more sensitive to a change in sequence.
  • the subject method utilizes heteroduplex analysis to separate double-sfranded heteroduplex molecules on the basis of changes in elecfrophoretic mobility (Keen et al. Trends Genet (1991) 7:5).
  • the movement of mutant or wild type fragments in polyacrylamide gels containing a gradient of denaturant is assayed using denaturing gradient gel electrophoresis (DGGE) (Myers et al. Nature (1985) 313:495).
  • DGGE denaturing gradient gel electrophoresis
  • DNA will be modified to insure that it does not completely denature, for example by adding a GC clamp of approximately 40 bp of high-melting GC-rich DNA by PCR.
  • a temperature gradient is used in place of a denaturing gradient to identify differences in the mobility of confrol and sample DNA (Rosenbaum et al, Biophys Chem (1987) 265:12753).
  • oligonucleotide primers may be prepared in that the known mutation is placed centrally and then hybridized to target DNA under conditions that permit hybridization only if a perfect match is found (Saiki et al. Nature (1986) 324: 163); Saiki et al, Proc Natl Acad Sci USA (1989) 86:6230).
  • Such allele-specific oligonucleotides are hybridized to PCR-amplified target DNA or a number of different mutations when the oligonucleotides are attached to the hybridizing membrane and hybridized with labeled target DNA.
  • Oligonucleotides used as primers for specific amplification may carry the mutation of interest in the center of the molecule (so that amplification depends on differential hybridization) (Gibbs et al. Nucleic Acids Res (1989) 17:2437-2448) or at the extreme 3' end of one primer where, under appropriate conditions, mismatch can prevent or reduce polymerase extension (Prossner, Tibtech (1993) 11:238).
  • amplification also may be performed using Taq ligase for amplification (Barany, Proc Natl Acad Sci USA (1991) 88:189). Ln such cases, ligation will occur only if there is a perfect match at the 3' end of the 5' sequence making it possible to detect the presence of a known mutation at a specific site by looking for the presence or absence of amplification.
  • the methods described herein may be performed, for example, by utilizing pre-packaged diagnostic kits comprising at least one probe nucleic acid or antibody reagent described herein.
  • the method and kit may be used conveniently, e.g, in clinical settings, to diagnose patients exhibiting symptoms or family history of a disease or illness involving a GAVE 18 gene.
  • any cell type or tissue where GAVEl 8 is expressed may be utilized in the prognostic assays described herein.
  • Agents or modulators that have a stimulatory or inhibitory effect on GAVEl 8 activity can be administered to individuals to freat (prophylactically or therapeutically) disorders (e.g, inflammation associated with asthma, chronic obstructive pulmonary disease and rheumatoid arthritis) associated with GAVE 18 activity.
  • freat proliferatively or therapeutically
  • disorders e.g, inflammation associated with asthma, chronic obstructive pulmonary disease and rheumatoid arthritis
  • the pharmacogenomics i.e., the study of the relationship between the genotype of an individual and the response of the individual to a foreign compound or drug
  • Differences in metabolism of therapeutics can lead to severe toxicity or therapeutic failure by altering the relation between dose and blood concentration of the pharmacologically active drug.
  • the pharmacogenomics of the individual permits the selection of effective agents (e.g, drugs) for prophylactic or therapeutic treatments based on a consideration of the genotype of the individual. Such pharmacogenomics further can be used to determine appropriate dosages and therapeutic regimens. Accordingly, the activity of GAVEl 8 protein, expression of GAVE 18 nucleic acid or mutation content of GAVE 18 genes in an individual can be determined thereby to select appropriate agent(s) for therapeutic or prophylactic freatment of the individual.
  • Pharmacogenomics deals with clinically significant hereditary variations in the response to drugs due to altered drug disposition and abnormal action in affected persons. See, e.g, Linder, Clin Chem (1997) 43(2):254-266. Ln general, two types of pharmacogenetic conditions can be differentiated. Genetic conditions transmitted as a single factor altering the way drugs act on the body are referred to as “altered drug action.” Genetic conditions transmitted as single factors altering the way the body acts on drugs are referred to as “altered drug metabolism.” The pharmacogenetic conditions can occur either as rare defects or as polymorphisms.
  • G6PD glucose-6-phosphate dehydrogenase deficiency
  • oxidant drugs anti-malarials, sulfonamides, analgesics or nifrofurans
  • the activity of drug metabolizing enzymes is a major determinant of both the intensity and duration of drug action.
  • drug metabolizing enzymes e.g, N-acetyltransferase 2 (NAT 2) and cytochrome P450 enzymes, CYP2D6 and CYP2C1 9)
  • NAT 2 N-acetyltransferase 2
  • CYP2D6 and CYP2C1 cytochrome P450 enzymes
  • the polymorphisms are expressed in two phenotypes in the population, the extensive metabolizer (EM) and poor metabolizer (PM). The prevalence of PM is different among different populations.
  • the gene coding for CYP2D6 is highly polymorphic and several mutations have been identified in PM, all which lead to the absence of functional CYP2D6. Poor metabolizers of CYP2D6 and CYP2C1 9 quite frequently experience exaggerated drug response and side effects when standard doses are received. If a metabolite is the active therapeutic moiety, a PM will show no therapeutic response, as demonstrated for the analgesic effect of codeine mediated by the CYP2D6-formed metabolite, morphine. The other extreme is the so-called ultra-rapid metabolizers who do not respond to standard doses. Recently, the molecular basis of ultra-rapid metabolism has been identified to be due to CYP2D6 gene amplification.
  • the activity of GAVEl 8 protein, expression of GAVEl 8 nucleic acid or mutation content of GAVE 18 genes in an individual can be determined to select thereby appropriate agent(s) for therapeutic or prophylactic freatment of the individual.
  • pharmacogenetic studies can be used to apply genotyping of polymorphic alleles encoding drug-metabolizing enzymes to the identification of the drug responsiveness phenotype of an individual. That knowledge, when applied to dosing or drug selection, can avoid adverse reactions or therapeutic failure and thus enhance therapeutic or prophylactic efficiency when treating a subject with a GAVEl 8 modulator, such as a modulator identified by one of the exemplary screening assays described herein.
  • GAVEl 8 Monitoring the influence of agents (e.g, drugs or compounds) on the expression or activity of GAVEl 8 (e.g, the ability to modulate aberrant cell proliferation and/or differentiation) can be applied not only in basic drug screening, but also in clinical frials.
  • agents e.g, drugs or compounds
  • the effectiveness of an agent, as determined by a screening assay as described herein, to increase GAVEl 8 gene expression, protein levels or protein activity can be monitored in clinical frials of subjects exhibiting decreased GAVE 18 gene expression, protein levels or protein activity.
  • the effectiveness of an agent, as determined by a screening assay, to decrease GAVE 18 gene expression, protein levels or protein activity can be monitored in clinical frials of subjects exhibiting increased GAVEl 8 gene expression, protein levels or protein activity.
  • GAVE 18 expression or activity and preferably, that of other genes that have been implicated in, for example, a cellular proliferation disorder can be used as a marker of the immune responsiveness of a particular cell.
  • genes, including GAVEl 8 that are modulated in cells by treatment with an agent (e.g, compound, drug or small molecule) that modulates GAVEl 8 activity can be identified.
  • an agent e.g, compound, drug or small molecule
  • GAVEl 8 activity e.g, as identified in a screening assay described herein
  • cells can be isolated and RNA prepared and analyzed for the levels of expression of GAVEl 8 and other genes implicated in the disorder.
  • the levels of gene expression can be quantified by Northern blot analysis or RT-PCR, as described herein, or alternatively by measuring the amount of protein produced by one of the methods as described herein or by measuring the levels of activity of GAVE 18 or other genes.
  • the gene expression pattern can serve as a marker, indicative of the physiological response of the cells to the agent. Accordingly, the response state may be determined before and at various points during freatment of the individual with the agent.
  • the instant invention provides a method for monitoring the effectiveness of treatment of a subject with an agent (e.g, an agonist, antagonist, peptidomimetic, protein, peptide, nucleic acid, small molecule or other drug candidate identified by the screening assays described herein) comprising the steps of (i) obtaining a pre-adminisfration sample from a subject prior to adminisfration of the agent; (ii) detecting the level of expression of a GAVEl 8 protein, mRNA or genomic DNA in the preadministration sample; (iii) obtaining one or more post-administration samples from the subject; (iv) detecting the level of expression or activity of the GAVE 18 protein, mRNA or genomic DNA in the post-administration samples; (v) comparing the level of expression or activity of the GAVE 18 protein, mRNA or genomic DNA in the pre-adminisfration sample with the GAVE 18 protein, mRNA or genomic DNA in the post-administration sample or samples; and (vi) altering the adminis
  • an agent
  • increased adminisfration of the agent may be desirable to increase the expression or activity of GAVEl 8 to higher levels than detected, i.e., to increase the effectiveness of the agent.
  • decreased adminisfration of the agent may be desirable to decrease expression or activity of GAVEl 8 to lower levels than detected, i.e., to decrease the effectiveness of the agent.
  • the instant invention provides for both prophylactic and therapeutic methods of treating a subject at risk of (or susceptible to) a disorder or having a disorder associated with aberrant GAVE 18 expression or activity.
  • disorders include, but are not limited to, for example, inflammatory disorders such as asthma, chronic obstructive pulmonary disease and rheumatoid arthritis.
  • the invention provides a method for preventing in a subject, a disease or condition associated with an aberrant GAVEl 8 expression or activity, by administering to the subject an agent that modulates GAVEl 8 expression or at least one GAVEl 8 activity.
  • Subjects at risk for a disease that is caused by or contributed to by aberrant GAVE 18 expression or activity can be identified by, for example, any or a combination of diagnostic or prognostic assays as described herein.
  • Administration of a prophylactic agent can occur prior to the manifestation of symptoms characteristic of the GAVE 18 aberrancy, such that a disease or disorder is prevented or, alternatively, delayed in progression.
  • a GAVEl 8 agonist or GAVE 18 antagonist agent can be used for treating the subject. The appropriate agent can be determined based on screening assays described herein.
  • the modulatory method of the invention involves contacting a cell with an agent that modulates one or more of the activities of GAVE 18 protein activity associated with the cell.
  • An agent that modulates GAVE 18 protein activity can be an agent as described herein, such as a nucleic acid or a protein, a naturally-occurring cognate ligand of a GAVEl 8 protein, a peptide, a GAVEl 8 peptidomimetic or other small molecule. Ln one embodiment, the agent stimulates one or more of the biological activities of GAVEl 8 protein.
  • Examples of such stimulatory agents include active GAVE 18 protein and a nucleic acid molecule encoding GAVE 18 that has been infroduced into the cell, fri another embodiment, the agent inhibits one or more of the biological activities of GAVEl 8 protein.
  • Examples of such inhibitory agents include antisense GAVEl 8 nucleic acid molecules and anti-GAVEl 8 antibodies.
  • the modulatory methods can be performed in vitro (e.g, by culturing the cell with the agent) or, alternatively, in vivo (e.g, by administering the agent to a subject).
  • the instant invention provides methods of treating an individual afflicted with a disease or disorder characterized by aberrant expression or activity of a GAVEl 8 protein or nucleic acid molecule.
  • the method involves administering an agent (e.g, an agent identified by a screening assay described herein) or combination of agents that modulates (e.g, upregulates or downregulates) GAVEl 8 expression or activity.
  • an agent e.g, an agent identified by a screening assay described herein
  • the method involves administering a GAVE 18 protein or nucleic acid molecule as therapy to compensate for reduced or aberrant GAVE 18 expression or activity.
  • Stimulation of GAVEl 8 activity is desirable in situations in which GAVE 18 is downregulated abnormally and/or in which increased GAVE 18 activity is likely to have a beneficial effect. Conversely, inhibition of GAVEl 8 activity is desirable in situations in which GAVE 18 is upregulated abnormally and/or in which decreased GAVE 18 activity is likely to have a beneficial effect.
  • GAVE 18 Homology searching against human genome sequence database HTG (NCBI/NLH) using various GPCR as queries was carried out using FASTA algorithm (Wisconsin GCG Package Version 10.1). Genomic DNA sequences that returned having statistically significant homology were translated into three forward frames for BLASTp searching of protein databases. A genomic DNA sequence AC083865, from chromosome 7 was identified to contain a putative GPCR sequence and was then named as GAVE18. Chromosome location of GAVE18 is mapped at pl4.1. Cloning of genomic DNA encoding GAVEl 8. Primers specific for the 5' and 3' sequences of the predicted GAVE 18 were designed.
  • PCR polymerase chain reaction
  • PCR conditions were as follows: denaturation at 94 °C for 30 s, annealing at 55 °C for 30 s, and extension at 72 °C for 1 min, for 35 cycles, followed by a 5-min extension at 72 °C.
  • Amplified DNA fragment was cloned into the pCRH-TOPO vector from lnvitrogen. The cloned DNA insert was verified by DNA sequencing. All the PCR amplifications were done in DNA Engine Tetrad (MJ Research, model PTC-225).
  • Northern blot analyses Human multiple tissue Northern blots from Clontech were hybridized according to the manufacturer's instructions with [ ⁇ - 32 P]dCTP labeled full-length open reading frame DNA fragment. Hybridized blots were washed with 2XSSPE and 0.1% SDS at 50 °C for 30 min and with 0.1XSSPE and 0.1%SDS at 50 °C for 1 hour. The blots were then exposed to X-ray film at -70 °C in the presence of an intensifying screen.
  • RNA from human tissues was purchased from Clontech. Prior to cDNA generation, total RNA was subjected to DNAsel treatment to avoid potential genomic DNA contamination. In brief, Total RNA was mixed with 5ul of lOx DNAse I buffer ( 20mM Hepes pH 7.5; lOmM CaCl 2 ;10mM MgCl 2 ; lmM DTT and 50% (v/v) glycerol) (Ambion), RNAse Inhibitor and lul of DNAsel RNase free (2U/ul; Ambion) in a final volume of 50ul at 37° C for one hour.
  • lOx DNAse I buffer 20mM Hepes pH 7.5; lOmM CaCl 2 ;10mM MgCl 2 ; lmM DTT and 50% (v/v) glycerol) (Ambion
  • RNAse Inhibitor and lul of DNAsel RNase free (2U/ul; Ambion
  • cDNA synthesis was performed using Superscript choice system as described by Life Technologies.
  • Taqman primer/probes were designed using the Primer Express 1.0 software (ABI). Gave 18 amplicon spans 72 nucleotides of the open reading frame with the forward primer: 5'GATTCTGTTGGTCTTCCAGGTCTT 3' (SEQ ED NO:5), the reverse primer: 5' CCAGAACTCCTGGTGGGATAGT 3 ' (SEQ ED NO:6) and the Taqman probe sequence: 5 'FAM- TGGCGTAGCTTCTGCACCATCAACA- TAMRA 3' (SEQ LD NO:7). Fam is used as a reporter dye and Tamra as a quencher.
  • Taqman probe was custom synthesized by Operon Technologies. Taqman reactions was performed in a 96-well plate MicroAmp optical tube (PE) in a final volume of 50ul containing: 25ul Taqman PCR Mixture (Perkin Elmer); 1 ul Forward Primer for a final concentration of 900nM; lul Reverse Primer for a final concentration of 900nM and lul Taqman probe for a final concentration of 200nM; 5ul of cDNA template (calculated concentration of lOng/ul) and 17 ul of water.
  • Taqman PCR condition was performed as described by PE Applied Biosystem. Human Beta actin primer probes (designed and purchased from PE applied Biosystem) was used as internal confrol.
  • PCR screening ofcDNA library PCR primers specific to the GAVEl 8 coding region: 5'AAA ACT GCA TGC TGT GGC TGC 3' (SEQ ED NO: 8), and 5 'TTT CAG CTG AGC CCA GAA CTC 3' (SEQ ED NO: 9) were used to screen pooled spleen, placenta, and kidney cDNA libraries. PCR screenings were done in 96-well plates using the following PCR protocol: 94°C, hold for 3 min; 40 cycles of 94 ° C for 30 seconds, 52 ° C for 30 seconds, and 68 ° C for 45 seconds. Positive subpools were subsequently diluted for further round PCR screening.
  • GAVE 18 has restricted expression pattern in the immune system, mostly in bone marrow, peripheral blood leukocytes, spleen and thymus. Inhibition or activation of GAVE 18 GPCR receptor can modulate the immune cell maturation, development and response during the inflammation. It is up- regulated by cytokine TNF-c in granucytes. TNF- ⁇ plays important roles for many inflammation diseases. GAVEl 8 is also induced by TNF- ⁇ in bronchial epithelium providing an excellent drug target for respiratory diseases such as asthma. GAVEl 8 may also be very good targets for other inflammation diseases such as RA, COPD, etc.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Pulmonology (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Rheumatology (AREA)
  • Immunology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Orthopedic Medicine & Surgery (AREA)
  • Pain & Pain Management (AREA)
  • Toxicology (AREA)
  • Physics & Mathematics (AREA)
  • Cell Biology (AREA)
  • Physical Education & Sports Medicine (AREA)
  • Plant Pathology (AREA)
  • Microbiology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
EP02803191A 2001-11-13 2002-11-08 Einen g-protein-gekoppelten rezeptor codierende nukleinsäure und verwendungen davon Withdrawn EP1573028A2 (de)

Applications Claiming Priority (5)

Application Number Priority Date Filing Date Title
US35415001P 2001-11-13 2001-11-13
US354150P 2001-11-13
GBGB0206891.4A GB0206891D0 (en) 2001-11-13 2002-03-22 A nucleic acid encoding a g-protein-coupled receptor and uses thereof
GB0206891 2002-03-22
PCT/US2002/035887 WO2003042399A2 (en) 2001-11-13 2002-11-08 A nucleic acid encoding a g-protein-coupled receptor, and uses thereof

Publications (1)

Publication Number Publication Date
EP1573028A2 true EP1573028A2 (de) 2005-09-14

Family

ID=26247015

Family Applications (1)

Application Number Title Priority Date Filing Date
EP02803191A Withdrawn EP1573028A2 (de) 2001-11-13 2002-11-08 Einen g-protein-gekoppelten rezeptor codierende nukleinsäure und verwendungen davon

Country Status (11)

Country Link
EP (1) EP1573028A2 (de)
JP (1) JP2005515760A (de)
KR (1) KR20050044461A (de)
CN (1) CN1636070A (de)
BR (1) BR0214118A (de)
CA (1) CA2466521A1 (de)
IL (1) IL161952A0 (de)
MX (1) MXPA04004434A (de)
NO (1) NO20042386L (de)
RU (1) RU2004117891A (de)
WO (1) WO2003042399A2 (de)

Also Published As

Publication number Publication date
IL161952A0 (en) 2005-11-20
WO2003042399A8 (en) 2005-11-17
NO20042386L (no) 2004-06-08
MXPA04004434A (es) 2004-11-29
CN1636070A (zh) 2005-07-06
KR20050044461A (ko) 2005-05-12
WO2003042399A9 (en) 2004-04-29
RU2004117891A (ru) 2005-03-27
JP2005515760A (ja) 2005-06-02
WO2003042399A2 (en) 2003-05-22
BR0214118A (pt) 2005-02-09
CA2466521A1 (en) 2003-05-22

Similar Documents

Publication Publication Date Title
US20030232378A1 (en) Novel toll molecules and uses therefor
JP2002528046A (ja) 新規レセプタースーパーファミリー分子およびそれについての用途
US20030186873A1 (en) Nucleic acid encoding a G-protein-coupled receptor, and uses thereof
US20030138418A1 (en) Nucleic acid encoding a G-protein-coupled receptor, and uses thereof
CA2476239A1 (en) A nucleic acid encoding a g-protein-coupled receptor, and uses thereof
WO2003061365A2 (en) A nucleic acid encoding a g-protein-coupled receptor, and uses thereof
US7432361B2 (en) G protein-coupled receptor, GAVE10
AU2002363792A1 (en) A nucleic acid encoding a G-protein-coupled receptor, and uses thereof
EP1573028A2 (de) Einen g-protein-gekoppelten rezeptor codierende nukleinsäure und verwendungen davon
US20030166008A1 (en) Nucleic acid encoding a G-protein-coupled receptor, and uses thereof
AU2003214861A1 (en) A nucleic acid encoding a G-protein-coupled receptor, and uses thereof
US20030059869A1 (en) Novel G protein-coupled receptor, GAVE3
US20030215878A1 (en) Novel G protein-coupled purinergic receptor, GAVE17
US20030236194A1 (en) Novel G protein-coupled receptor, GAVE2
US20020086982A1 (en) Novel EBI-3-ALT protein and nucleic acid molecules and uses therefor
US20030211577A1 (en) Novel G protein-coupled receptor, GAVE7
AU2002341895A1 (en) A novel G protein-coupled receptor, GAVE 10
WO2003087125A2 (en) A novel g protein-coupled purinergic receptor, gave 17
AU2002344837A1 (en) A novel G protein-coupled receptor, GAVE 3
ZA200400383B (en) A novel G protein-coupled receptor, GAVE8.
WO2003008560A2 (en) A novel g protein-coupled receptor, gave8

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION HAS BEEN WITHDRAWN

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR IE IT LI LU MC NL PT SE SK TR

AX Request for extension of the european patent

Extension state: AL LT LV MK RO SI

18W Application withdrawn

Effective date: 20050901