EP1573008A2 - Polynucleotides targeted against htert and use thereof - Google Patents

Abstract

The invention relates to polynucleotides targeted against a gene of a catalytic sub-unit of human telomerase and the use of said polynucleotides for the diagnosis, prophylaxis, reduction and course control of diseases linked to cell growth, differentiation and/or division, such as, for example, tumorous diseases.

Description

 Polynucleotides directed against hTERT and the use of these

description

The present invention relates to polynucleotides which are directed against a gene of a catalytic subunit of human telomerase (hTERT) and to the use of these polynucleotides for the diagnosis, prophylaxis, treatment, monitoring of diseases associated with cell growth, differentiation and / or division , such as tumor diseases.

Replication of the ends of eukaryotic chromosomes is known to require specialized cell components. A linear DNA strand is usually replicated in the 5 '-3' direction. Due to the removal of the RNA primers complementary to the outer 3 'end of the chromosomal DNA, which are essential for replication initiation, the 5' ends of newly synthesized DNA strands remain incomplete with each round of replication. This leads to a progressive shortening of the daughter strands with each round of replication (end replication problem) [Levy et al. ]. This shortening of those called telomeres Chromosome ends are responsible, among other things, for controlling the ability of proliferation and thus for the aging of cells [Harley]. The structure of these telomeres has been studied in numerous living systems.

In a variety of organisms, the ribonucleoenzyrrf telomerase has the task of extending and stabilizing the telomeres of proliferating cells, thereby leveling the end replication problem [Greider et al. ]. This reverse transcriptase consists of two essential subunits: an RNA component (hTR) and a catalytic subunit (hTERT) [Beattie et al. ].

Consistent with the relationship between telomeres and telomerase and the proliferation capacity of the cells, telomerase activity was detected in immortalized cell lines and in> 85% of the tumors examined [Kim et al. ]. This correlates with the expression of the hTERT component, as has been shown in bladder cancer [Ito et al. ]. There is also a connection between the level of hTERT expression in bladder carcinoma and the clinical course of the tumor disease (de Kok et al.). Therefore, human telomerase is an ideal target for the diagnosis and treatment of human diseases associated with cellular proliferation. such as cancer, methods for diagnosing and treating cancer and other diseases associated with telomerase are disclosed, inter alia, in US 5,489,508 or US 5,645,986. Inhibition of telomerase has been shown as a specific way to therapeutically control tumor cells described. Important efforts to modify the activity of telomerase in the context of cancer are disclosed in EP 666313, WO 97/37691, WO 99/50279, US 2002/0045588 AI or WO 98/28442. Such general teachings do not reveal to the skilled person specific teachings on technical action. A substance or a molecule that interacts with the entire sequence region coding for hTERT leads to a reduction in the corresponding telomerase activity, for example in a cell culture, but such substances are not suitable for application in organisms, since they usually are much too large and are attacked and destroyed by the immune system of the organism in question. In addition, a large number of undesirable interactions or side effects can occur. It was therefore an object of the invention to provide alternative compact molecules which have a simple and effective inhibitory interaction with selected, specific structural units which encode the telomerase.

The invention solves this technical problem by

Provision of a polynucleotide against an mRNA of the catalytic subunit of human telomerase

(hTERT) is directed, wherein the polynucleotide specifically interacts with primary structures of this hTERT mRNA in two target sequence regions from 2176 to 2250 and 2296 to 2393 according to the gene database entry AF 015950. The numbers represent - also in the following sections - the corresponding nucleotide positions within the hTERT mRNA (total length 4015 nucleotides). The invention thus relates to the surprising teaching that against tumor-associated abnormal hTERT-mRJ-IA expression onsmusτ-.er suw-.e telomerase activity levels by a possible hTER inhibition with the polynucleotides according to the invention. These polynucleotides are directed against defined hTERT mRNA sequence motifs in the range from 2000 to 2500. They can be biological and / or chemical structures that are able to interact with the target sequence area in such a way that a specific recognition / binding and interaction can be determined. Examples of polynucleotides can in particular be nucleic acid constructs and their derivatives. Of course, it is also possible to use other recognition molecules instead of or in combination with the polynucleotides, such as, for. B. antibodies, lectins, affilines, aptamers, chelators and others.

In a particularly preferred embodiment, the polynucleotide specifically interacts with two target sequence regions 2176 to 2250 and 2296 to 2393. Advantageously, particularly efficient hTERT inhibition is possible in these sequence regions. Also preferred are shorter areas with changes within these target sequences or with changed edge areas or different derivatizations / modifications / fusions / complexations, which can also be combined and / or coupled with other recognition molecules such as polynucleotides.

These preferred target sequence regions make it possible for the person skilled in the art to provide, in particular, very small and / or compact polynucleotides that essentially do not interact with other structures, in particular immunological defense structures, within the cell tissue or the organism or are attacked by them, but rather can specifically interact with the target sequence region of the hTERT mRNA.

In a further preferred embodiment of the invention it is provided that the sequence region or the recognition molecule, in particular the polynucleotide, is modified by addition, amplification, inversion, missense mutation, nonsense mutation, point mutation, deletion and / or substitution. These modifications can, for example, result in the polynucleotide binding to the mRNA of the hTERT catalytic subunit with a higher avidity or specificity. However, it can of course also be provided that the polynucleotide binds with less specificity or avidity. For the purposes of the invention, the mutations in the hTERT sequence region can be, for example, inheritable or non-inheritable changes. The modifications can be such that they can be detected directly at the RNA level or at the DNA level. The mutations can also include, for example, mutations in connection with a cytologically visible genome and / or chromosome mutations which are associated with changes in hTERT. Such mutations can arise from the fact that parts of the chromosome are lost, doubled, have the opposite orientation or are transferred to other chromosomes. Of course, it is also possible that the mutation is only one or a few neighboring base pairs, as is the case with point mutation, for example. If, for example, a base pair is lost in the form of a deletion or if a base pair is additionally inserted, as in the insertion, the reading frame of the gene concerned shifts to a reading frame mutation. In the case of the substitution mutation in the sense of the invention, for example, one base is exchanged for another, the consequences resulting therefrom being different:

(a) For example, a codon can be converted into a synonymous codon,

(b) or the mutation changes the codon specificity and thus leads to the incorporation of other amino acids or

(c) the mutation ends the translation at a specific point, and the hTERT fragments formed can be inactive or active.

In a further preferred embodiment, the polynucleotide is a nucleic acid construct. Nucleic acid constructs in the sense of the invention can be all structures which are essentially based on nucleic acids or whose active center is essentially based on nucleic acids. The polynucleotide can be part of complexes or formulations consisting of lipids, carbohydrates or proteins or peptides, for example in the form of a nanocapsule. This complex or formulation comprises an area which contains nucleic acids which can interact with hTERT. The specialist Various ways are known to provide such constructs.

In a preferred embodiment of the invention, the nucleic acid construct is an antisense (AS) oligonucleotide (ON), a DNAzyme, a ribozyme, an siRNA and / or a peptide nucleic acid (PNA).

AS constructs are synthetically produced molecules that enable selective inhibition of the biosynthesis of selected proteins. For example, ON, PNAs, ribozymes, DNAzymes are used. The AS effect is based on the sequence-specific hybridization of the ^' constructs by Watson-Crick base pairing with the target mRNA coding for the protein to be repressed, which leads to the prevention of protein synthesis via various mechanisms (Table 1).

Tab. 1 AS effects and their mechanisms of action ss - "Single stranded" (single strand)

The development of AS-ON as therapeutic substances represents, in addition to various other application fields, a new promising therapy concept for oncological diseases [Tamm et al. ]. While conventional chemotherapy leads to non-specific inhibition of cell proliferation, AS therapy specifically inactivates those mRNAs that represent the molecular basis or an essential component of the degenerate, deregulated growth and tumor progression, and for the inhibition of the body's immune defense can be responsible.

AS-ON differ from other therapeutic agents, such as antibodies, toxins or immunotoxins, in that they are relatively small molecules with a molecular weight of usually about 5 kDa. The small size of the AS-ON enables good tissue penetration. Besides, is is known that tumor blood vessels, in contrast to blood vessels of normal tissue, are permeable to substances in a size range between 4-10 kDa. This means that therapeutic AS-ON can specifically penetrate tumor blood vessels. Another advantage of these substances, for example compared to antibodies that are almost exclusively active against extracellular proteins, is that, in principle, all proteins, both cytoplasmic and nucleus-localized as well as membrane-bound proteins, can be attacked via the respective target mRNA.

The phosporthioat-AS-ON, which is relatively resistant to a nuclease attack, is currently being evaluated in a number of clinical studies (phase I-III) with regard to its potential as anti-cancer therapeutics. Target mRNA molecules that are overexpressed in tumors are attacked.

When using phosphothioate-ON (PS-ON) a number of unexpected, so-called "non-AS" effects were observed, which can also lead to non-specific inhibition of cell growth. These effects are strongly dependent on the ON sequence or on certain sequence motifs and occur due to the strong polyanionic charge of the PS-ON, which can result in the PS-ON being bound to vital proteins. The negative effects mentioned can be overcome in particular by using partially phosphothioate-modified AS-ON or by further modifications, for example incorporation of ribonucleotides instead of deoxyribonucleotides. A partial terminal modification of ON constructs (preferably 2nd up to 5 bonds from the 3'- and 5 '-nucleic acid terminus are modified) offers increased stability in the extra- and intracellular milieu of the target cells (protection against degradation by exonucleases), especially when applied in vivo. A positive side effect that has been observed when using PS-ON is its immunostimulatory effect, which can support possible therapeutic success in some tumor applications.

Further chemical modifications can be used to increase the stability and specificity of AS-ON and to reduce the "non-AS ^w effects", for example incorporation of 2'-O-methylribonucleotides, methylphosphonate segments, "locked nucleic acids" (methylene bridge between 2'-oxygen and 4'-carbon of the ribose), exchange of the cytosine with 5'-methylcytosine and / or a 2'-5'-tetraadenylate modification.

It can be either partially modified or completely changed via this chemical modification

Act ON- onstructs.

As catalytically active RNA molecules, ribozymes are able to recognize cellular RNA structures as substrates and cleave them sequence-specifically at a phosphorus diester bond. The detection takes place via AS arms, which enable hybridization with the target mRNA due to complementary sequences. Compared to AS-ON, ribozymes have the fundamental advantage that a ribozyme molecule as a real catalyst has a large number of identical ones

Can implement substrate molecules. Therefore, Ribozymes are already there effective in much lower concentration than ON and also lead to irreversible RNA degradation due to substrate cleavage [Sun et al. ].

Among the previously known ribozyme types, the hammerhead ribozyme (review: Birikh et al., 1997; Tanner, 1999) is particularly interesting for such applications because it can already be catalytically active as a comparatively small molecule (approx. 30-50 nucleotides). A very effective trans-cleaving hammerhead ribozyme consists, for example, of only 14 conserved nucleotides in the catalytic domain and two variable stem sequences (advantageously each of 6-8 nucleotides), which by Watson-Crick base pairing (analogous to AS-ON) Realize sequence-specific recognition of the substrate to be cleaved and then inactivate it by cleaving a phosphorus diester bond. In this form, a specific cleaving hammerhead ribozyme can be constructed against practically any RNA molecule that has a potential cleavage site with the minimal sequence requirement -NUX- and thus, for example, inhibit cellular mRNA or viral RNA. Other catalytic nucleic acids from DNA-yp (e.g. DNAzyme) can be used analogously.

RNAi ("RNA interference") is a new method that enables specific gene inhibition of target molecules at the mRNA level. For this, double-stranded RNA molecules ("small interference RNA", siRNA) with their two nucleotide long 3 'overhangs, consisting preferably of thymidine nucleotides, must be transfected into cells. First, the ^' siRNA constructs are associated with specific cellular proteins, followed by the recognition of the target mRNA sequence due to the complementarity of the AS-si RNA strand. The intrinsic endonuclease activity of the ribonucleoprotein complex enables a specific degradation of the mRNA to be inhibited.

In a special embodiment of the invention, the AS-ON is a PS-ON or a nucleic acid construct modified with further chemical changes.

In a further preferred embodiment of the invention, the sequence region of the hTERT mRNA to which the polynucleotide is complementary is selected from the group comprising 2183-2205, 2206-2225, 2315-2334, 2317-2336, 2324-2346, 2331-2350 and / or 2333-2352.

With these sequence regions it is advantageously possible to inhibit hTERT expression. Through the

Inhibition can be suppressed, among other diseases, such as tumors associated with the expression of this gene.

In a further preferred embodiment of the invention, the polynucleotide is immobilized. For the purposes of the invention, immobilization is understood to mean various methods and techniques for fixing the polynucleotides on specific supports. The immobilization can be used, for example, to stabilize the polynucleotides, as a result of which they are used in particular during storage or with a single batch approach are not reduced by ^■ biological, chemical or physical agents in their activity or adversely modified. The immobilization of the polynucleotides enables repeated use under routine technical or clinical conditions; furthermore, the sample can be continuously reacted with the polynucleotides. This can be achieved in particular by various immobilization techniques, the binding of the polynucleotides to other polynucleotides or molecules or to a support taking place in such a way that the three-dimensional structure at the active center of the corresponding molecules, in particular the polynucleotides, is not changed. The specificity for hTERT is advantageously lost and the specificity of the actual binding reaction is not lost due to the immobilization. For the purposes of the invention, three basic methods of immobilization can be used:

(i) Cross-linking: In cross-linking, the

Polynucleotides are fixed together without their activity being adversely affected. As a result of the crosslinking, they are advantageously no longer soluble.

(ii) Binding to a carrier: Binding to a carrier takes place, for example, by adsorption, ion binding or covalent binding. This can also take place within microbial cells or liposomes or other membrane-containing closed or open structures. The polynucleotide is by fixation advantageously not influenced in its activity. It can advantageously be used multiple times or continuously, for example in the clinic, for diagnosis or therapy in a vehicle-bound manner.

(iii) Inclusion: The inclusion takes place in the sense of the invention in particular in a semipermeable membrane in the form of gels, fibrils or fibers. Encapsulated polynucleotides are separated by a semipermeable membrane from the surrounding sample solution in such a way that they can advantageously still interact with the catalytic subunit of human telomerase or with fragments thereof.

Various methods are available for immobilization, such as. for example, adsorption on an inert or electrically charged inorganic or organic carrier. Such carriers can be, for example, porous gels, aluminum oxide, concrete, agarose, starch, nylon or polyacrylamide. The immobilization takes place here through physical binding forces, often with the participation of hydrophobic interactions and ionic bonds. Such methods are advantageously easy to use and they influence the conformation of the polynucleotides only to a small extent. The binding can advantageously be improved by electrostatic binding forces between the charged groups of the polynucleotides and the carrier, for example by using ion exchangers such as Sephadex. Another method is covalent binding to carrier materials. The carriers can be reactive Have groups that form homopolar bonds with amino acid side chains. Suitable groups in polynucleotides are carboxy, hydroxyl and sulfide groups and in particular the terminal amino groups of lysines. Aromatic groups offer the possibility of diazo couplings. The surface of microscopic porous glass particles can be activated by treatment with silanes and then populated with polynucleotides. Hydroxy groups of natural polymers can be activated with bromocyan, for example, and then coupled with polynucleotides. Numerous polynucleotides can advantageously form direct covalent bonds with polyacrylamide resins. When enclosed in three-dimensional networks, the polynucleotides are enclosed in ionotrophic gels or other structures known to the person skilled in the art. The pores of the matrix are in particular such that the polynucleotides are retained and an interaction with the target molecules is possible. In cross-linking, the polynucleotides are cross-linked with bifunctional ones

Agents converted into polymeric aggregates. Structures of this type are gelatinous and easily deformable and are particularly suitable for use in various reactors. The mechanical and enzymatic properties can advantageously be improved by adding other inactive components, such as, for example, gelatin, during the crosslinking. In microencapsulation, the reaction space of the polynucleotides is limited using membranes. The microencapsulation can be carried out, for example, as an interfacial polymerization. By immobilization at Microencapsulation makes the polynucleotides insoluble and therefore reusable. For the purposes of the invention, immobilized recognition molecules, in particular polynucleotides, are all recognition molecules or polynucleotides which are in a state which permits their reuse. The restriction of the mobility and the solubility of the polynucleotides by chemical, biological or physical means advantageously leads to low process costs.

The invention also relates to a pharmaceutical composition comprising the polynucleotides according to the invention, optionally in a combination with a pharmaceutically acceptable carrier. This pharmaceutical carrier can in particular comprise additional substances and substances, such as medical and / or pharmaceutical-technical auxiliaries. Medical auxiliaries are, for example, those substances which are used for production as ingredients of pharmaceutical compositions. Pharmaceutical-technical auxiliaries are used for the suitable formulation of the pharmaceutical composition or the medicament and can even - if they are only required during the production process - be subsequently removed or can be part of the pharmaceutical composition as pharmaceutically acceptable carrier substances. The pharmaceutical composition is optionally in combination with a pharmaceutically acceptable diluent. This can be, for example, phosphate-buffered saline,

Water, emulsions such as oil / water Emulsions, various types of detergents, sterile solutions and the like act. The pharmaceutical composition can be administered, for example, in connection with gene therapy.

For the purposes of the invention, gene therapy is a form of treatment using natural or recombinantly modified nucleic acid constructs, individual gene sequences or entire gene or chromosome sections or coded transcript areas, their derivatives / modifications with the aim of biologically-based and selective inhibition or Reverting the disease symptoms and / or their causal causes, which in the special case means the inhibition of a target molecule overexpressed in the course of a disease at the nucleic acid level, in particular at the transcript level.

Gene therapy can also be carried out, for example, using suitable vectors, such as, for example, viral vectors and / or complexing with lipids or dendrimers. In particular, gene therapy can also take place via packaging in protein casings. Furthermore, it is possible for the polynucleotide to be fused or complexed with another molecule which supports the directional transport to the target site, the uptake into and / or the distribution within the target cell. The type of dosage and route of administration can be determined by the attending physician according to the clinical requirements. It is known to the person skilled in the art that the type of dosage depends on various factors, such as, for example

Height, body surface area, age, gender or the general and disease-specific state of health of the patient, but also the specific agent which is administered, the duration and type of administration and other medicaments which may be administered in parallel, in particular in combination therapy.

The invention also relates to a kit comprising the polynucleotide and / or the pharmaceutical composition. Furthermore, the invention also relates to an array comprising the polynucleotide and / or the pharmaceutical composition. The kit and array can be used to diagnose and / or treat diseases associated with the function of the catalytic subunit of human telomerase. The invention also relates to the use of the polynucleotide, the kit, the array for diagnosis, prophylaxis, reduction, therapy, follow-up and / or post-treatment of diseases related to cell growth, differentiation and / or division.

In a preferred embodiment, the disease associated with cell growth, differentiation and / or division is a tumor. The tumor is particularly preferably a solid tumor and / or a

Blood or lymph gland cancer s.

In particular, the tumors, which may be of epithelial or mesodermal origin, can be benign or malignant types of cancer of the organs of the invention

Lungs, the prostate, the bladder, the kidney, the Esophagus, stomach, pancreas, brain, ovary, skeletal system, especially breast, prostate, lung and intestinal adenocarcinoma, bone marrow cancer, melanoma, hepatoma, head and neck Tumors are explicitly preferred as representatives of malignant (so-called malignant) tumors. The group of blood and Lymphdrüsenkrebsarten of the invention are within the meaning all ^forms' of leukemias (for example, in connection with B cell leukemia, mixed-cell leukemia, null cell leukemia, T-cell leukemia, chronic T-cell leukemia , HTLV-II-associated leukemia, acute lymphoblastic leukemia, chronic lymphoblastic leukemia, mast cell leukemia and myeloid leukemia) and lymphomas. Examples of mesenchymal malignant tumors (so-called bone and soft tissue sarcomas) are: fibrosarcoma; the malignant histiocytoma; liposarcoma; hemangiosarcoma; chondrosarcoma and osteosarcoma; Ewing's sarcoma; leio and rhabdomyosarcoma, synovial sarcoma; Carcinosarcoma. As further types of tumors, which are also summarized in the sense of the invention under the term “neoplasms”, preferred are: bone neoplasms, breast neoplasms, neoplasms of the digestive system, colorectal neoplasms, liver neoplasms, pancreatic neoplasms, brain appendage neoplasms, testes -Neoplasms, orbital neoplasms, neoplasms of the head and neck, central nervous system, neoplasms of the ear organ, pelvis, respiratory tract and urogenital tract).

In a further preferred embodiment, the cancer or the tumor that is treated or prevented is selected from the group: tumors of Ear, nose and throat area including tumors of the inner nose, paranasal sinuses, nasopharynx, lips, oral cavity, oropharynx, larynx, hypopharynx, ear, salivary glands and paragangliomas, lung tumors including non-small cell bronchial carcinomas , small cell bronchial carcinomas, tumors of the mediastinum, tumors of the gastrointestinal tract including tumors of the esophagus, stomach, pancreas, liver, gallbladder and biliary tract, small intestine, colon and rectal carcinomas and anal cancers, urogenital kidney tumors, including tumors of the ureter, kidney tumors, including tumors the bladder, prostate, urethra, penis and testes, gynecological tumors including tumors of the cervix, vagina, vulva, carcinoma of the body, malignant trophoblast disease, ovarian cancer, tumors of the fallopian tube (tuba faloppii), tumors of the abdominal cavity, breast cancer endocrine organs including tumors of the thyroid, parathyroid, N pelvic cortex, endocrine pancreatic tumors, carcinoid tumors and carcinoid syndrome, multiple endocrine neoplasias, bone and soft tissue sarcomas, mesotheliomas, skin tumors, melanomas including cutaneous and intraocular melanomas, tumors of the central nervous system, childhood tumors including ternary tumors, neuroma tumors, neuro-tumors, Wilomat's tumors Tumor family, rhabdomyosarcoma, lymphomas including non-Hodgkin's lymphomas, cutaneous T-line lymphomas, primary lymphomas of the central nervous system, Hodgkin's disease, leukemias including acute leukemias, chronic myeloid and lymphatic leukemias, plasma cell neoplasms, myelodromic syndromes, myelodrome Metastases without known primary tumor (CUP syndrome), peritoneal carcinoma, immunosuppression-related malignancy including AIDS-related malignancies such as Kaposi's sarcoma, AIDS-associated lymphomas, AIDS-associated lymphomas of the central nervous system, AIDS-associated Hodgkin's disease and AIDS-associated anogenital tumors, Transplant-related malignancies, metastatic tumors including brain metastases, lung metastases, liver metastases, bone metastases, pleural and pericardial metastases and malignant ascites.

In a particular embodiment of the invention, the solid tumor is a tumor of the urogenital tract and / or the gastrointestinal tract.

Another particularly preferred embodiment of the invention provides that the tumor is a colon carcinoma, a gastric carcinoma, a pancreatic carcinoma, a colon cancer, a small bowel cancer, an ovarian carcinoma, a cervical carcinoma, a lung cancer, a renal cell carcinoma, a brain tumor, a head and neck tumor Liver carcinoma and / or a metastasis of these tumors / carcinomas.

In a further particularly preferred embodiment, the solid tumor is a breast, bronchial, colorectal and / or prostate carcinoma.

In a very particularly preferred embodiment, the tumor of the urogenital tract is a bladder carcinoma (BCa). The BCa is the fourth most common form of cancer and the seventh most common cancer death in the Federal Republic of Germany. Cause in men. TUR-B as a general primary therapy for BCa allows organ-preserving removal of superficial tumors. Despite this histopathologically defined complete removal of the tumor, a relatively high proportion of 50-70% of patients are affected by a relapse within two years [Stein et al. ]. A synchronous or metachronous multifocal occurrence of tumor foci represents a diagnosis and therapy problem, which may result in the occurrence of recurrences remote from the resected primary tumor location [Sidransky et al. ]. In the event of recurrence or tumors primarily classified as superficial, long-term prophylaxis with an immune (Bacillus Calmette-Guerin - BCG) or chemotherapeutic agent is usually carried out after TUR-B

(e.g. Mitomycin-C, Taxol, Gemcitabin / Cisplatin). Patients with muscle-invasive BCa and with undifferentiated, superficial tumors who relapse despite this therapy are usually radically cystectomized or treated while maintaining the bladder using mono / polychemotherapy, immunotherapy or radiation therapy or a combination of these methods. Due to their relatively unspecific mechanisms of action, chemotherapy, immune or radiation treatments are accompanied by high therapy-induced toxicity.

Due to the health-related importance of the BCa

(especially in western industrialized countries), the

In the absence of tumor-specific markers and the known tumor biological and cellular heterogeneity of the tumor, there is an intensive search on the clinical BCa research area, which is aimed in particular at identifying new and / or additional therapy options.

In a special embodiment of the invention, the polynucleotide, the pharmaceutical composition, the kit and / or the array are used for a follow-up control, which essentially represents monitoring the effectiveness of an antitumor treatment. It is further preferred that the polynucleotide is used in a combination therapy, in particular for the treatment of tumors. It is particularly preferred here that the combination therapy comprises chemotherapy, cytostatic treatment and / or radiation therapy. In a particularly preferred embodiment of the invention, the combination therapy is an adjuvant, biologically specified form of therapy. It is very particularly preferred that this form of therapy is an immunotherapy. Furthermore, it is particularly preferred that the combination therapy is a gene therapy and / or a

Therapy with a polynucleotide against the same or a different target molecule. Various combination therapies, in particular for the treatment of tumors, are known to the person skilled in the art. It can be provided, for example, that cytostatic treatment takes place within a combination therapy or, for example, radiation of a specific tumor area, this treatment being combined with gene therapy, the polynucleotide according to the invention being used as an anti-cancer agent. However, the polynucleotide according to the invention can also be used in combination with other polynucleotides can be used against the same or a different target molecule. Accordingly, it can be particularly preferred that the polynucleotide is used to increase the sensitivity of tumor cells to ^'cytostatic and / or radiation. It is further preferred that the polynucleotide is used to inhibit the vitality, the proliferation rate of cells and / or to induce apoptosis and cell cycle arrest.

The invention is to be explained in more detail below with the aid of examples, without being restricted to these examples.

example 1

The easily transfectable human urinary bladder carcinoma line EJ28 showed, after transfection, in particular when using five specific anti-hTERT-AS constructs (cf. Table 2), an immediate and continuous reduction in their viability by more than 65% compared to that

Nonsense (NS) control (Fig. 2). It was particularly noticeable that four of the most effective constructs were directed against a single mRNA sequence motif.

Already after four out of five treatments with the construct AStel2331-50 "almost no living cells were detectable in the culture vessel. The treatment of telomerase negative human fibroblasts, however, did not lead to any significant differences between AS and NS-ON-treated cells, which is a specificity of the AS -ON effect on the BCa cell line EJ28 indirectly proven (data not shown). The AS-specific efficacy was then examined in detail: in accordance with the viability test, an inhibitory effect of these five AS-ONs on the proliferation and cell colony formation behavior (Fig. 3) was demonstrated. In addition, the AS-specific reduction of the cell portion in the DNA synthesis phase (up to approx. 30%) towards a Gl lock could be demonstrated (data not shown). Proof of the AS-specific effect of the AS-ON directed against the target motifs was provided in the form of a significant and time-dependent reduction in the amount of hTERT transcript (Fig. 4). In accordance with this, hTERT protein expression was also repressed. As a result, the telomerase activity of the EJ28 cells was inhibited by more than 60% (data not shown).

The AS-ODN-specific effects with regard to growth and proliferation inhibition have also been demonstrated for other human BCa cell lines (Kraemer et al.).

Example 2

Experiments on the effects of various chemotherapeutic agents (mitomycin-C, cisplatin, gemcitabine) on the growth behavior of different BCa cell lines unexpectedly became a significant one

Reinforcement effect, due to the addition of individual

Polynucleotides in the sense of the invention are observed

(Data not shown). Using the example of the easily transfectable

BCa cell line 5637 was able to significantly increase the viability-inhibiting effect of the chemotherapeutic agent with the AS-ON constructs AStel2206 and AStel2331 Detect cisplatin in two different doses (Fig. 5).

Tab. 2 hTERT-AS and NS-ON: nucleotide and target sequences

Designation SS motif sequence ^J (5 '->3')

AS-ON ASteΪ2206-2225 2191-2224 tgtcctgggggatggtgtcg

AStel2315-2334 ttgaaggccttgcggacgtg AStel2317-2336 tcttgaaggccttgcggäcg ^"

2318-2346 ÄSteΪ2 ^" 331- ^" 235Ö ggtagagacgtggctcttga AStel2333-2352 I äaggtägagacgtggctctt

NS-ON NS-K2 ^™ cagtctcagtactgaagctg

NS-K3 cagcttcagtactgagactg

¹ The name contains the sequence area of the hTERT mRNA (Acc. No.: AF015950), to which the respective AS-ON is complementary; ² The motifs depicted each contain 10 nt double-stranded RNA at the 5 'and 3'term;

³ The nucleotides in bold represent the area in AS-ON. which is complementary to the actual SS region of the target motif. bibliography

Agrawal S, Zhao Q: Antisense therapeutics. Curr Opin Chem Biol (1998) 2: 519-28.

Beattie TL, Zhou ^■ W, Robinson MO, Harrington L:

Reconstitution of human telomerase activity in vitro. curr

Biol (1998) 8: 177-80.

Boiziau C, Elector R, Cazenave C, Roig V, Thuong NT,

Toul e JJ: Inhibition of translation initiation by antisense oligonucleotides via an RNase-H independent echanism. Nucleic Acids Res (1991) 19: 1113-9.

Crooke ST: Molecular mechanisms of action of antisense drugs. Biochim Biophys Acta (1999) 1489: 31-44.

Greider CW, Blackburn EH: Identification of a specific telomere terminal transferase activity in Tetrahymena extracts. Cell (1985) 43: 405-13.

Harley. CB: Telomere loss: mitotic clock or genetic time bomb? Mutat Res (1991) 256: 271-82.

Ito H, Kyo S, Kanaya T, Takakura M,. Inoue M, Na iki M: Expression of human telomerase subunits and correlation with telomerase activity in urothelial cancer. Clin Cancer Res (1998) 4: 1603-8.

Kim NW, Piatyszek MA, Prowse KR, Harley CB, West MD, Ho PL, Coviello GM, Wright WE, Weinrich SL, Shay JW: Specific association of human telomerase activity with immortal cells and cancer. Science (1994) 266: 2011-5. De Kok JB, Schalken JA, Aalders TW, Ruers TJ ,. Willems HL,

Swinkels DW: Quantitative measurement of telomerase reverse transcriptase (hTERT) mRNA in urothelial cell carcinomas.

Int J Cancer (2000) 87: 217-20.

Kole R, Sazani P: Antisense effects in the cell nucleus: modification of splicing. Curr Opin Mol Ther (2001) 3: 229-

34th

Kraemer K, Fuessel S, Schmidt U, Kotzsch M, Schwenzer B, Wirth MP, Meye A: Antisense-mediated hTERT Inhibition Specifically Reduces the Growth of Human Bladder Cancer Cells. Clin Cancer Res (2003) 9: 3794-800.

Levy MZ, Allsopp RC, Futcher AB, Greider CW, Harley CB: Telomere end-replication problem and cell aging. J Mol Biol (1992) 225: 951-60.

Moser HE, Dervan PB: Sequence-specific cleavage of double helical DNA by triple helix formation. Science (1987) 238: 645-50.

Stein JP, Grossfeld GD, Ginsberg DA, Esrig D, Freeman JA, Figueroa AJ, Skinner DG, Cote RJ: Prognostic markers in bladder cancer: a contemporary review of the literature. J Urol (1998) 160: 645-59.

Sun LQ, Cairns MJ, Saravolac EG, Baker A, Gerlach WL: Catalytic nucleic acids: from lab to applications. Pharmacol Rev (2000) 52: 325-47. Tamm I, Dorken B, Hartmann G: Antisense therapy in oncology: new hope for an old idea? Lancet (2001) 358: 489-97.

Claims

claims

1. Polynucleotide directed against a gene of a catalytic subunit of human telomerase, characterized in that the polynucleotide specifically interacts with the mRNA of the catalytic subunit of human telomerase in at least two target sequence areas 2176 to 2250 and 2296 to 2393 according to the accession number AF015950.

2. Polynucleotide according to claim 1, characterized in that the polynucleotide with the target sequence regions selected from the group comprising 2183-2205, 2206-2225, 2315-2334, 2317-2336, 2324-2346, 2331-2350 and / or 2333-2352 interacts.

3. Polynucleotide according to one of claims 1 and 2, characterized in that the sequence region and / or the polynucleotide by addition,

Amplification, inversion, missense mutation, nonsense mutation, point mutation, deletion and / or substitution is modified.

4. Polynucleotide according to one of claims 1 to 3, characterized in that the polynucleotide is immobilized.

5. Polynucleotide according to one of claims 1 to 4, characterized in that the polynucleotide

Nucleic acid construct or its derivative.

6. Polynucleotide according to claim 5, characterized in that it is fused or complexed with another molecule which supports the directed transport to the target site, the uptake in and / or the distribution within the target cell.

7. Polynucleotide according to claim 5 or 6, characterized in that the nucleic acid construct is an antisense oligonucleotide, a DNAzyme, a peptide nucleic acid, a ribozyme and / or an siRNA.

8. Polynucleotide according to claim 7, characterized in that the antisense oligonucleotide is changed by phosphothioate bonds and / or other chemical modifications.

9. Polynucleotide according to one of claims 1 to 8, characterized in that the sequence region of the hTERT mRNA, to which the polynucleotide is complementary, from the group comprising 2183-2205, 2206-2225, 2315-2344, 2317-2336, 2324 -2346, 2331-2350 and / or 2333-2352 is selected.

10. A pharmaceutical composition comprising a polynucleotide according to any one of claims 1 to 9 alone or in combination with a pharmaceutically acceptable carrier.

11. Kit comprising a polynucleotide according to one of claims 1 to 9 and / or a pharmaceutical composition according to claim 10.

12. Array comprising a polynucleotide according to one of claims 1 to 9 and / or a pharmaceutical composition according to claim 10.

13. Use of a polynucleotide according to one of claims 1 to 9, a pharmaceutical

A composition according to claim 10, a kit according to claim 11 and / or an array according to claim 12 for the diagnosis, prophylaxis, therapy, follow-up and / or post-treatment of diseases associated with cell growth, differentiation and / or division.

14. Use according to the preceding claim, characterized in that the disease is a tumor.

15. Use according to the preceding claim, characterized in that the tumor is a solid tumor or leukemia.

16. Use according to the preceding claim, characterized in that the solid tumor is a tumor of the urogenital tract and / or the gastrointestinal tract.

17. Use according to claim 14, characterized in that the tumor is a colon carcinoma, a gastric carcinoma, a pancreatic carcinoma, a small bowel cancer, an ovarian carcinoma, a cervical carcinoma, a lung cancer, a renal cell carcinoma, a brain tumor, a head and neck tumor, a liver carcinoma and / or a metastasis of this tumor ,

18. Use according to claim 15, characterized in that the solid tumor is a breast, bronchial, colorectal and / or prostate cancer and / or a metastasis of these tumors.

19. Use according to claim 16, characterized in that the tumor of the urogenital tract is a bladder carcinoma and / or a metastasis of these tumors.

20. Use according to claim 13, characterized in that the course control a

Monitoring the effectiveness of an anti-tumor treatment is.

21. Use according to any one of claims 13 to 20, characterized in that the polynucleotide is used in a combination therapy.

22. Use according to the preceding claim, characterized in that the combination therapy comprises chemotherapy, a cytostatic treatment and / or a radiation therapy.

23. Use according to the preceding claim, characterized in that the combination therapy comprises an adjuvant, biologically specified therapy form.

24. Use according to the preceding claim, characterized in that the form of therapy is an immunotherapy.

25. Use according to any one of claims 21 to 24, characterized in that the combination therapy is a gene therapy and / or a therapy with a

Polynucleotide against the same or a different target molecule.

26. Use according to any one of claims 13 to 25 to increase the sensitivity of tumor cells to cytostatics and / or radiation.

27. Use of a polynucleotide according to one of claims 1 to 9 and / or according to one of claims 13 to 26 for inhibiting the vitality, the proliferation rate of cells, for inducing apoptosis and / or a cell cycle arrest.