EP1565200A2 - NUKLEINSûURE ENTSPRECHENDES PROTEIN 24P4C12 ZUR BEHANDLUNG UND ERKENNUNG VON KREBS - Google Patents

NUKLEINSûURE ENTSPRECHENDES PROTEIN 24P4C12 ZUR BEHANDLUNG UND ERKENNUNG VON KREBS

Info

Publication number
EP1565200A2
EP1565200A2 EP02789937A EP02789937A EP1565200A2 EP 1565200 A2 EP1565200 A2 EP 1565200A2 EP 02789937 A EP02789937 A EP 02789937A EP 02789937 A EP02789937 A EP 02789937A EP 1565200 A2 EP1565200 A2 EP 1565200A2
Authority
EP
European Patent Office
Prior art keywords
protein
cancer
peptide
cell
cells
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP02789937A
Other languages
English (en)
French (fr)
Other versions
EP1565200A4 (de
Inventor
Arthur B. Raitano
Karen Jane Meyrick Morrison
Wangmao Ge
Pia M. Challita-Eid
Aya Jakobovits
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Agensys Inc
Original Assignee
Agensys Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Agensys Inc filed Critical Agensys Inc
Publication of EP1565200A2 publication Critical patent/EP1565200A2/de
Publication of EP1565200A4 publication Critical patent/EP1565200A4/de
Withdrawn legal-status Critical Current

Links

Classifications

    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/575Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • A61K38/16Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/1703Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • A61K38/1709Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P13/00Drugs for disorders of the urinary system
    • A61P13/08Drugs for disorders of the urinary system of the prostate
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P13/00Drugs for disorders of the urinary system
    • A61P13/10Drugs for disorders of the urinary system of the bladder
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents

Definitions

  • the invention described herein relates to a gene and its encoded protein, termed 24P4C12, expressed in certain cancers, and to diagnostic and therapeutic methods and compositions useful in the management of cancers that express 24P4C12.
  • Cancer is the second leading cause of human death next to coronary disease. Worldwide, millions of people die from cancer every year. In the United States alone, as reported by ttie American Cancer Society, cancer causes the death of well over a half-million people annually, with over 1.2 million new cases diagnosed per year. While deaths from heart disease have been declining significantly, those resulting from cancer generally are on the rise. In the early part of the next century, cancer is predicted to become the leading cause of death.
  • carcinomas of the lung, prostate, breast, colon, pancreas, and ovary represent the primary cause&of cancer death.
  • ca. cinomas share a common lethal feature.
  • metastatic disease from a carcinoma is fatal.
  • common experience has shown that their lives are dramatically altered.
  • Many cancer patients experience strong anxieties driven by the awareness of the potential for recurrence or treatment failure.
  • Many cancer patients experience physical debilitations following treatment.
  • many cancer patients experience a recurrence.
  • prostate cancer is the fourth most prevalent cancer in men. In North America and Northern Europe, it is by far the most common cancer in males and is the second leading cause of cancer death in men. In the United States alone, well over 30,000 men die annually of this disease - second only to lung cancer. Despite the magnitude of these figures, there is still no effective treatment for metastatic prostate cancer. Surgical prostatectomy, radiation therapy, hormone ablation therapy, surgical castration and chemotherapy continue to be the main treatment modalities. Unfortunately, these treatments are ineffective for many and are often associated with undesirable consequences.
  • PSA serum prostate specific antigen
  • the LAPC Los Angeles Prostate Cancer
  • SCID severe combined immune deficient mice
  • More recently identified prostate cancer markers include PCTA-1 (Su ef al., 1996, Proc. Natl. Acad. Sci.
  • PSM prostate-specific membrane
  • STEAP Human, ef al., Proc Natl Acad Sci U SA. 1999 Dec 7; 96(25): 14523-8
  • PSCA prostate stem cell antigen
  • Renal cell carcinoma accounts for approximately 3 percent of adult malignancies. Once adenomas reach a diameter of 2 to 3 cm, malignant potential exists. In the adult, the two principal malignant renal tumors are renal cell adenocarcinoma and transitional cell carcinoma of the renal pelvis or ureter. The incidence of renal cell adenocarcinoma is estimated at more than 29,000 cases in the United States, and more than 11,600 patients died of this disease in 1998. Transitional cell carcinoma is less frequent, with an incidence of approximately 500 cases per year in the United States.
  • bladder cancer represents approximately 5 percent in men (fifth most common neoplasm) and 3 percent in women (eighth most common neoplasm). The incidence is increasing slowly, concurrent with an increasing older population. In 1998, there was an estimated 54,500 cases, including 39,500 in men and 15,000 in women. The age-adjusted incidence in the United States is 32 per 100,000 for men and eight per 100,000 in women. The historic male/female ratio of 3:1 may be decreasing related to smoking patterns in women. There were an estimated 11 ,000 deaths from bladder cancer in 1998 (7,800 in men and 3,900 in women). Bladder cancer incidence and mortality strongly increase with age and will be an increasing problem as the population becomes more elderly.
  • bladder cancers recur in the bladder.
  • Bladder cancer is managed with a combination of transurethral resection of the bladder (TUR) and intravesical chemotherapy or immunotherapy.
  • TUR transurethral resection of the bladder
  • the multifocal and recurrent nature of bladder cancer points out the limitations of TUR.
  • Most muscle-invasive cancers are not cured by TUR alone. Radical cystectomy and urinary diversion is the most effective means to eliminate the cancer but carry an undeniable impact on urinary and sexual function. There continues to be a significant need for treatment modalities that are beneficial for bladder cancer patients.
  • Treatment options for lung and bronchial cancer are determined by the type and stage of the cancer and include surgery, radiation therapy, and chemotherapy. For many localized cancers, surgery is usually the treatment of choice. Because the disease has usually spread by the time it is discovered, radiation therapy and chemotherapy are often needed in combination with surgery. Chemotherapy alone or combined with radiation is the treatment of choice for small cell lung cancer; on this regimen, a large percentage of patients experience remission, which in some cases is long lasting. There is however, an ongoing need for effective treatment and diagnostic approaches for lung and bronchial cancers.
  • treatment of breast cancer may involve lumpectomy (local removal of the tumor) and removal of the lymph nodes under the arm; mastectomy (surgical removal of the breast) and removal of the lymph nodes under the arm; radiation therapy; chemotherapy; or hormone therapy.
  • lumpectomy local removal of the tumor
  • mastectomy surgical removal of the breast
  • radiation therapy chemotherapy
  • hormone therapy chemotherapy
  • two or more methods are used in combination.
  • Numerous studies have shown that, for early stage disease, long-term survival rates after lumpectomy plus radiotherapy are similar to survival rates after modified radical mastectomy.
  • Significant advances in reconstruction techniques provide several options for breast reconstruction after mastectomy. Recently, such reconstruction has been done at the same time as the mastectomy.
  • DCIS ductal carcinoma in situ
  • pancreatic cancer Surgery, radiation therapy, and chemotherapy are treatment options for pancreatic cancer. These treatment options can extend survival and/or relieve symptoms in many patients but are not likely to produce a cure for most. There is a significant need for additional therapeutic and diagnostic options for pancreatic cancer.
  • the present invention relates to a gene, designated 24P4C12, that has now been found to be over-expressed in the cancer(s) listed in Table I.
  • Northern blot expression analysis of 24P4C12 gene expression in normal tissues shows a restricted expression pattern in adult tissues.
  • the nucleotide ( Figure 2) and amino acid ( Figure 2, and Figure 3) sequences of 24P4C12 are provided.
  • the invention provides polynucleotides corresponding or complementary to all or part of the 24P4C12 genes, mRNAs, and/or coding sequences, preferably in isolated form, including polynucleotides encoding 24P4C12-.
  • Recombinant DNA molecules containing 24P4C12 polynucleotides, cells transformed or transduced with such molecules, and host-vector systems for the expression of 24P4C12 gene products are also provided.
  • the invention further provides antibodies that bind to 24P4C12 proteins and polypeptide fragments thereof, including polyclonal and monoclonal antibodies, murine and other mammalian antibodies, chimeric antibodies, humanized and fully human antibodies, and antibodies labeled with a detectable marker or therapeutic agent.
  • the entire nucleic acid sequence of Figure 2 is encoded and/or the entire amino acid sequence of Figure 2 is prepared, either of which are in respective human unit dose forms.
  • the invention further provides methods for detecting the presence and status of 24P4C12 polynucleotides and proteins in various biological samples, as well as methods for identifying cells that express 24P4C12.
  • a typical embodiment of this invention provides methods for monitoring 24P4C12 gene products in a tissue or hematology sample having or suspected of having some form of growth dysregulation such as cancer.
  • the invention further provides various immunogenic or therapeutic compositions and strategies for treating cancers that express 24P4C12 such as cancers of tissues listed in Table I, including therapies aimed at inhibiting the transcription, translation, processing or function of 24P4C12 as well as cancer vaccines.
  • the invention provides compositions, and methods comprising them, for treating a cancer that expresses 24P4C12 in a human subject wherein the composition comprises a carrier suitable for human use and a human unit dose of one or more than one agent that inhibits the production or function of 24P4C12.
  • the carrier is a uniquely human carrier.
  • the agent is a moiety that is immunoreactive with 24P4C12 protein.
  • Non-limiting examples of such moieties include, but are not limited to, antibodies (such as single chain, monoclonal, polyclonal, humanized, chimeric, or human antibodies), functional equivalents thereof (whether naturally occurring or synthetic), and combinations thereof.
  • the antibodies can be conjugated to a diagnostic or therapeutic moiety.
  • the agent is a small molecule as defined herein.
  • the agent comprises one or more than one peptide which comprises a cytotoxic T lymphocyte (CTL) epitope that binds an HLA class I molecule in a human to elicit a CTL response to 24P4C12 and/or one or more than one peptide which comprises a helper T lymphocyte (HTL) epitope which binds an HLA class II molecule in a human to elicit an HTL response.
  • CTL cytotoxic T lymphocyte
  • HTL helper T lymphocyte
  • the peptides of the invention may be on the same or on one or more separate polypeptide molecules.
  • the agent comprises one or more than one nucleic acid molecule that expresses one or more than one of the CTL or HTL response stimulating peptides as described above.
  • the one or more than one nucleic acid molecule may express a moiety that is immunologically reactive with 24P4C12 as described above.
  • the one or more than one nucleic acid molecule may also be, or encodes, a molecule that inhibits production of 24P4C12.
  • Non-limiting examples of such molecules include, but are not limited to, those complementary to a nucleotide sequence essential for production of 24P4C12 (e.g. antisense sequences or molecules that form a triple helix with a nucleotide double helix essential for 24P4C12 production) or a ribozyme effective to lyse 24P4C12 mRNA.
  • HLA Peptide Tables respective to its parental protein, e.g., variant 1, variant 2, etc.
  • HLA Peptide Tables respective to its parental protein, e.g., variant 1, variant 2, etc.
  • search Peptides in Table VII Generally, a unique Search Peptide is used to obtain HLA peptides of a particular for a particular variant. The position of each Search Peptide relative to its respective parent molecule is listed in Table VII.
  • a Search Peptide begins at position "X"
  • One embodiment of the invention comprises an HLA peptide, that occurs at least twice in Tables VIII-XXI and XXII to XLIX collectively, or an oligonucleotide that encodes the HLA peptide.
  • Another embodiment of the invention comprises an HLA peptide that occurs at least once in Tables VIII-XXI and at least once in tables XXII to XLIX, or an oligonucleotide that encodes the HLA peptide.
  • antibody epitopes which comprise a peptide regions, or an oligonucleotide encoding the peptide region, that has one two, three, four, or five of the following characteristics: i) a peptide region of at least 5 amino acids of a particular peptide of Figure 3, in any whole number increment up to the full length of that protein in Figure 3, that includes an amino acid position having a value equal to or greater than 0.5, 0.6, 0.7, 0.8, 0.9, or having a value equal to 1.0, in the Hydrophilicity profile of Figure 5; ii) a peptide region of at least 5 amino acids of a particular peptide of Figure 3, in any whole number increment up to the full length of that protein in Figure 3, that includes an amino acid position having a value equal to or less than 0.5, 0.4, 0.3, 0.2, 0.1, or having a value equal to 0.0, in the Hydropathi ⁇ ty profile of Figure 6; iii) a peptide region of
  • FIG. 1 The 24P4C12 SSH sequence of 160 nucleotides.
  • FIG. 2A The cDNA and amino acid sequence of 24P4C12 variant 1 (also called “24P4C12 v.1" or “24P4C12 variant 1”) is shown in Figure 2A.
  • the start methionine is underlined.
  • the open reading frame extends from nucleic acid 6-
  • 24P4C12 variant 2 (also called “24P4C12 v.2”) is shown in Figure 2B.
  • the codon for the start methionine is underlined.
  • the open reading frame extends from nucleic acid 6-2138 including the stop codon.
  • 24P4C12 variant 3 (also called “24P4C12 v.3") is shown in Figure 20
  • the codon for the start methionine is underlined.
  • the open reading frame extends from nucleic acid 6-2138 including the stop codon,
  • 24P4C12 variant 4 (also called "24P4C12 v.4") is shown in Figure 2D.
  • the codon for the start methionine is underlined.
  • the open reading frame extends from nucleic acid 6-2138 including the stop codon.
  • 24P4C12 variant 5 also called “24P4C12 v.5"
  • Figure 2E The cDNA and amino acid sequence of 24P4C12 variant 5 (also called "24P4C12 v.5") is shown in Figure 2E.
  • the codon for the start methionine is underlined.
  • the open reading frame extends from nucleic acid 6-2138 including the stop codon.
  • 24P4C12 variant 6 (also called “24P4C12 v.6”) is shown in Figure 2F.
  • the codon for the start methionine is underlined.
  • the open reading frame extends from nucleic acid 6-2138 including the stop codon.
  • 24P4C12 variant 7 (also called “24P4C12 v.7") is shown in Figure 2G.
  • the codon for the start methionine is underlined.
  • the open reading frame extends from nucleic acid 6-1802 including the stop codon.
  • 24P4C12 variant 8 (also called “24P4C12 v.8") is shown in Figure 2H.
  • the codon for the start methionine is underlined.
  • the open reading frame extends from nucleic acid 6-2174 including the stop codon.
  • 24P4C12 variant 9 (also called “24P4C12 v.9 n ) is shown in Figure 21.
  • the codon for the start methionine is underlined.
  • the open reading frame extends from nucleic acid 6-2144 including the stop codon.
  • Amino acid sequence of 24P4C12 v.1 is shown in Figure 3A; it has 710 amino acids.
  • 24P4C12 v.9 The amino acid sequence of 24P4C12 v.9 is shown in Figure 3G; it has 712 amino acids.
  • a reference to 24P4C12 includes all variants thereof, including those shown in Figures 2, 3, 10, and 11, unless the context clearly indicates otherwise.
  • FIG. 4 Alignment or 24P4C12 with human choline transporter-like protein 4 (CTL4) (gi
  • Figure 6 Hydropathicity amino acid profile of 24P4C12 determined by computer algorithm sequence analysis using the method of Kyte and Doolittle (Kyte J., Doolittle R.F., 1982. J. Mol. Biol. 157:105-132) accessed on the ProtScale website located on the World Wide Web at (.expasy.ch/cgi-bin/protscale.pl) through the ExPasy molecular biology server.
  • Figure 7 Percent accessible residues amino acid profile of 24P4C12 determined by computer algorithm sequence analysis using the method of Janin (Janin J., 1979 Nature 277:491492) accessed on the ProtScale website located on the World Wide Web at (.expasy.ch/cgi-bin/protscale.pl) through the ExPasy molecular biology server.
  • Figure 8. Average flexibility amino acid profile of 24P4C12 determined by computer algorithm sequence analysis using the method of Bhaskaran and Ponnuswamy (Bhaskaran R., and Ponnuswamy P.K., 1988 Int. J. Pept. Protein Res. 32:242-255) accessed on the ProtScale website located on the World Wide Web at (.expasy.ch/cgi-bin/protscale.pl) through the ExPasy molecular biology server.
  • Beta-turn amino acid profile of 24P4C12 determined by computer algorithm sequence analysis using the method of Deleage and Roux (Deleage, G., Roux B. 1987 Protein Engineering 1:289-294) accessed on the ProtScale website located on the World Wide Web at (.expasy.ch/cgi-bin/protscale.pl) through the ExPasy molecular biology server.
  • FIG. 10 Schematic alignment of SNP variants of 24P4C12.
  • Variants 24P4C12 v.2 through v.6 are variants with single nucleotide differences. Though these SNP variants are shown separately, they could also occur in any combinations and in any transcript variants that contains the base pairs. Numbers correspond to those of 24P4C12 v.1. Black box shows the same sequence as 24P4C12 v.1. SNPs are indicated above the box.
  • FIG 11. Schematic alignment of protein variants of 24P4C12. Protein variants correspond to nucleotide variants. Nucleotide variants 24P4C12 v.2, v.4 in Figure 10 code for the same protein as 24P4C12 v.1. Nucleotide variants 24P4C12 v.7, v.8 and v.9 are splice variants of v.1, as shown in Figure 12. Single amino acid differences were indicated above the boxes. Black boxes represent the same sequence as 24P4C12 v.1. Numbers underneath the box correspond to 24P4C12 V.1.
  • Exon compositions of transcript variants of 24P4C12. Vanant24P4C12 v.7, v.8 and v.9 are transcript variants of 24P4C12 v.1. Variant 24P4C12 v.7 does not have exons 10 and 11 of variant 24P4C12 v.1. Variant 24P4C12 v.8 extended 36 bp at the 3' end of exon 20 of variant 24P4C12 v.1. Variant 24P4C12 v.9 had a longer exon 12 and shorter exon 13 as compared to variant 24P4C12 v.1. Numbers in "( )" underneath the boxes correspond to those of 24P4C12 v.1. Lengths of introns and exons are not proportional.
  • FIG. 13 Secondary structure and transmembrane domains prediction for 24P4C12 protein variant 1 (SEQ ID NO: 112).
  • A: The secondary structure of 24P4C12 protein variant 1 was predicted using the HNN - Hierarchical Neural Network method (Guermeur, 1997, http://pbil.ibcp.fr/cgi-bin/npsa_automat.pl?page npsa_nn.html), accessed from the ExPasy molecular biology server (http://www.expasy.ch/tools/). This method predicts the presence and location of alpha helices, extended strands, and random coils from the primary protein sequence. The percent of the protein in a given secondary structure is also listed.
  • Figure 14 24P4C12 Expression by RT-PCR.
  • First strand cDNA was generated from vital pool 1 (kidney, liver and lung), vital pool 2 (colon, pancreas and stomach), a pool of prostate cancer xenografts (LAPC-4AD, LAPC-4AI, LAPC-9AD and LAPC-9AI), prostate cancer pool, bladder cancer pool, kidney cancer pool, colon cancer pool, ovary cancer pool, breast cancer pool, and cancer metastasis pool. Normalization was performed by PCR using primers to actin. Semi-quantitative PCR, using primers to 24P4C12, was performed at 26 and 30 cycles of amplification. Results show strong expression of 24P4C12 in prostate cancer pool and ovary cancer pool. Expression was also detected in prostate cancer xenografts, bladder cancer pool, kidney cancer pool, colon cancer pool, breast cancer pool, cancer metastasis pool, vital pool 1 , and vital pool 2.
  • FIG. 15 Expression of 24P4C12 in normal tissues. Two multiple tissue northern blots (Clontech) both with 2 ug of mRNA/lane were probed with the 24P4C12 sequence. Size standards in kilobases (kb) are indicated on the side. Results show expression of 24P4C12 in prostate, kidney and colon. Lower expression is detected in pancreas, lung and placenta amongst all 16 normal tissues tested.
  • RNA was extracted from a panel of cell lines and prostate cancer xenografts (PrEC, LAPC-4AD, LAPC-4AI, LAPC-9AD, LAPC-9AI, LNCaP, PC-3, DU145, TsuPr, and LAPC-4CL).
  • Northern blot with 10 ug of total RNA/lane was probed with 24P4C12 SSH sequence. Size standards in kilobases (kb) are indicated on the side.
  • the 24P4C12 transcript was detected in LAPC-4AD, LAPC-4AI, LAPC- 9AD, LAPC-9AI, LNCaP, and LAPC-4 CL.
  • RNA was extracted from a pool of prostate cancer specimens, bladder cancer specimens, colon cancer specimens, ovary cancer specimens, breast cancer specimens and cancer metastasis specimens, as well as from normal prostate (NP), normal bladder (NB), normal kidney (NK), and normal colon (NC).
  • Northern blot with 10 ⁇ g of total RNA/lane was probed with 24P4C12 SSH sequence. Size standards in kilobases (kb) are indicated on the side. Strong expression of 24P4C12 transcript was detected in the patient cancer pool specimens, and in normal prostate but not in the other normal tissues tested.
  • RNA was extracted from normal prostate (N), prostate cancer patient tumors (T) and their matched normal adjacent tissues (Nat). Northern blots with 10 ug of total RNA were probed with the 24P4C12 SSH fragment. Size standards in kilobases are on the side. Results show expression of 24P4C12 in normal prostate and all prostate patient tumors tested.
  • RNA was extracted from colon cancer cell lines (CL: Colo 205, LoVo, and SK-CO-), normal colon (N), colon'cancer patient tumors (T) and their matched normal adjacent tissues (Nat). Northern blots with 10 ug of total RNA were probed with the 24P4C12 SSH fragment. Size standards in kilobases are on the side. Results show expression of 24P4C12 in normal colon and all colon patient tumors tested. Expression was detected in the cell lines Colo 205 and SK-CO-, but not in LoVo. Figure 20. Expression of 24P4C12 in Lung Cancer Patient Specimens.
  • Northern blots with 10 ug of total RNA were probed with the 24P4C12 SSH fragment. Size standards in kilobases are on the side. Results show expression of 24P4C12 in lung patient tumors tested, but not in normal lung. Expression was also detected in CALU-1 , but not in the other cell lines A427, NCI-H82, and NCI-H146.
  • FIG. 21 Expression of 24P4C12 in breast and stomach human cancer specimens. Expression of 24P4C12 was assayed in a panel of human stomach and breast cancers (T) and their respective matched normal tissues (N) on RNA dot blots. 24P4C12 expression was seen in both stomach and breast cancers. The expression detected in normal adjacent tissues (isolated from diseased tissues) but not in normal tissues (isolated from healthy donors) may indicate that these tissues are not fully normal and that 24P4C12 may be expressed in early stage tumors.
  • Figure 22 24P4C12 Expression in a large panel of Patient Cancer Specimens.
  • First strand cDNA was prepared from a panel of ovary patient cancer specimens (A), uterus patient cancer specimens (B), prostate cancer specimens (C), bladder cancer patient specimens (D), lung cancer patient specimens (E), pancreas cancer patient specimens (F), colon cancer specimens (G), and kidney cancer specimens (H). Normalization was performed by PCR using primers to actin. Semi-quantitative PCR, using primers to 24P4C12, was performed at 26 and 30 cycles of amplification. Samples were run on an agarose gel, and PCR products were quantitated using the Alphalmager software. Expression was recorded as absent, low, medium or strong.
  • Results show expression of 24P4C12 in the majority of patient cancer specimens tested, 73.3% of ovary patient cancer specimens, 83.3% of uterus patient cancer specimens, 95.0% of prostate cancer specimens, 61.1 % of bladder cancer patient specimens, 80.6% of lung cancer patient specimens, 87.5% of pancreas cancer patient specimens, 87.5% of colon cancer specimens, 68.4% of of clear cell renal carcinoma, 100% of papillary renal cell carcinoma.
  • FIG. 24P4C12 expression in transduced cells PC3 prostate cancer cells, NIH-3T3 mouse cells and 300.19 mouse cells were transduced with 24P4C12 .pSRa retroviral vector. Cells were selected in neomycin for the generation of stable cell lines. RNA was extracted following selection in neomycin. Northern blots with 10 ug of total RNA were probed with the 24P4C12 SSH fragment. Results show strong expression of 24P4C12 in 24P4C12.pSRa transduced PC3, 3T3 and 300.19 cells, but not in the control cells transduced with the parental pSRa construct.
  • FIG. 24 Expression of 24P4C12 in 293T cells.
  • 293T cell were transiently transfected with either pCDNA3.1 Myc-His tagged expression vector, the pSRO expression vector each encoding the 24P4C12 variant 1 cDNA or a control neo vector.
  • Cells were harvested 2 days later and analyzed by Western blot with anti-24P4C12 pAb (A) or by Flow cytometry (B) on fixed and permeabilized 293T cells with either the anti-24P4C12 pAb or anti-His pAb followed by a PE-conjugated anti- rabbit IgG secondary Ab.
  • FIG. 25 Expression and detection of 24P4C12 in stably transduced PC3 cells.
  • PC3 cells were infected with retrovirus encoding the 24P4C12 variant 1 cDNA and stably transduced ceils were derived by G418 selection. Cells were then analyzed by Western blot (A) or immunohistochemistry (B) with anti-24P4C12 pAb. Shown with an arrow on the Western blot is expression of a -94 kD band representing 24P4C12 expressed in PC3-24P4C12 cells but not in control neo cells. Immunohistochemical analysis shows specific staining of 24P4C12-PC3 cells and not PC3-neo cells which is competed away competitor peptide to which the pAb was derived.
  • FIG. 26 Expression of recombinant 24P4C12 antigens in 293T cells.
  • 293T cells were transiently transfected with Tag5 His-tagged expression vectors encoding either amino acids 59-227 or 319-453 of 24P4C12 variant 1 or a control vector.
  • 2 days later supernatants were collected and cells harvested and lysed.
  • Supernatants and lysates were then subjected to Western blot analysis using an anti-His pAb. Shown is expression of the recombinant Tag559-227 protein in both the supernatant and lysate and the Tag5 319-453 protein in lhe cell lysate.
  • These proteins are purified and used as antigens for generation of 24P4C12-specific antibodies,
  • FIG. 27 Monoclonal antibodies detect 24P4C12 protein expression in 293T cells by flow cytometry.
  • 293T cells were transfected with either pCDNA 3.1 His-tagged expression vector for 24P4C12 or a control neo vector and harvested 2 days later.
  • Cells were fixed, permeabilized, and stained with a 1 :2 dilution of supernatants of the indicated hybridomas generated from mice immunized with 300.19-24P4C12 cells or with anti-His pAb. Ceils were then stained with a PE- conjugated secondary Ab and analyzed by flow cytometry. Shown is a fluorescent shift of 293T-24P4C12 cells but not control neo cells demonstrating specific recognition of 24P4C12 protein by the hybridoma supernatants.
  • FIG. 28 Shows expression of 24P4C12 Enhances Proliferation.
  • PC3 and 3T3 were grown overnight in low FBS. Cells were then incubated in low or 10% FBS as indicated. Proliferation was measured by Alamar Blue.
  • FIG. 29 Detection of 24P4C12 protein by immunohistochemistry in prostate cancer patient specimens.
  • Prostate adenocarcinoma tissue and its matched normal adjacent tissue were obtained from prostate cancer patients.
  • the results showed strong expression of 24P4C12 in the tumor cells and normal epithelium of the prostate cancer patients' tissue (panels (A) low grade prostate adenocarcinoma, (B) high grade prostate adenocarcinoma, (C) normal tissue adjacent to tumor).
  • the expression was detected mostly around the cell membrane indicating that 24P4C12 is membrane associated in prostate tissues.
  • FIG. 30 Detection of 24P4C12 protein by immunohistochemistry in various cancer patient specimens.
  • Tissue was obtained from patients with colon adenocarcinoma, breast d ⁇ cta ) carcinoma, lung adenocarcinoma, bladder transitional cell carcinoma, renal clear cell carcinoma and pancreatic adenocarcinoma.
  • the results showed expression of 24P4C12 in the tumor cells of the cancer patients' tissue (panel (A) colon adenocarcinoma, (B) lung adenocarcinoma, (C) breast ductal carcinoma, (D) bladder transitional carcinoma, (E) renal clear cell carcinoma, (F) pancreatic adenocarcinoma).
  • Figure 32 Shows 24P4C12 Enhances Tumor Growth in SCID Mice. 1 x 106 3T3-24P4C12 cells were mixed with
  • Vaccine Compositions Comprising DC Pulsed with CTL and/or HTL Peptides
  • prostate cancer and “locally advanced disease” mean prostate cancers that have extended through the prostate capsule, and are meant to include stage C disease under the American Urological Association (AUA) system, stage C1 - C2 disease under the Whitmore-Jewett system, and stage T3 - T4 and N+ disease under the TNM (tumor, node, metastasis) system.
  • AUA American Urological Association
  • stage C1 - C2 disease under the Whitmore-Jewett system
  • TNM tumor, node, metastasis
  • surgery is not recommended for patients with locally advanced disease, and these patients have substantially less favorable outcomes compared to patients having clinically localized (organ-confined) prostate cancer.
  • Locally advanced disease is clinically identified by palpable evidence of induration beyond the lateral border of the prostate, or asymmetry or induration above the prostate base.
  • Locally advanced prostate cancer is presently diagnosed pathologically following radical prostatectomy if the tumor invades or penetrates the prostatic capsule, extends into the surgical margin, or invades the seminal
  • “Altering the native glycosylation pattern” is intended for purposes herein to mean deleting one or more carbohydrate moieties found in native sequence 24P4C12 (either by removing the underlying glycosylation site or by deleting the glycosylation by chemical and/or enzymatic means), and/or adding one or more glycosylation sites that are not present in the native sequence 24P4C12.
  • the phrase includes qualitative changes in the glycosylation of the native proteins, involving a change in the nature and proportions of the various carbohydrate moieties present.
  • analog refers to a molecule which is structurally similar or shares similar or corresponding attributes with another molecule (e.g. a 24P4C12-related protein).
  • a 24P4C12-related protein e.g. an analog of a 24P4C12 protein can be specifically bound by an antibody or T cell that specifically binds to 24P4C12.
  • Antibody is used in the broadest sense. Therefore, an “antibody” can be naturally occurring or man-made such as monoclonal antibodies produced by conventional hybridoma technology.
  • Anti-24P4C12 antibodies comprise monoclonal and polyclonal antibodies as well as fragments containing the antigen-binding domain and/or one or more complementarity determining regions of these antibodies.
  • an “antibody fragment” is defined as at least a portion of the variable region of the immunoglobulin molecule that binds to its target, i.e., the antigen-binding region. In one embodiment it specifically covers single anti-24P4C12 antibodies and clones thereof (including agonist, antagonist and neutralizing antibodies) and anti-24P4C12 antibody compositions with polyepitopic specificity.
  • codon optimized sequences refers to nucleotide sequences that have been optimized for a particular host species by replacing any codons having a usage frequency of less than about 20%. Nucleotide sequences that have been optimized for expression in a given host species by elimination of spurious polyadenylation sequences, elimination of exon/intr on splicing signals, elimination of transposon-like repeats and/or optimization of GC content in addition to codon optimization are referred to herein as an "expression enhanced sequences.”
  • a “combinatorial library” is a collection of diverse chemical compounds generated by either chemical synthesis or biological synthesis by combining a number of chemical "building blocks” such as reagents.
  • a linear combinatorial chemical library such as a polypeptide (e.g., mutein) library, is formed by combining a set of chemical building blocks called amino acids in every possible way for a given compound length (i.e., the number of amino acids in a polypeptide compound).
  • Numerous chemical compounds are synthesized through such combinatorial mixing of chemical building blocks (Gallop et al., J. Med. Chem. 37(9): 1233-1251 (1994)).
  • combinatorial chemical libraries include, but are not limited to, peptide libraries (see, e.g., U.S. Patent No. 5,010,175, Furka, Pept. Prot. Res. 37:487493 (1991), Houghton et al., Nature, 354:84-88 (1991)), peptoids (PCT Publication No WO 91/19735), encoded peptides (PCT Publication WO 93/20242), random bio- oligomers (PCT Publication WO 92/00091), benzodiazepines (U.S. Pat. No.
  • oligocarbarnates Cho, et al., Science 261 :1303 (1993)
  • peptidyl phosphonates Campbell et al., J. Org. Chem. 59:658 (1994)
  • nucleic acid libraries see, e.g., Stratagene, Corp.
  • peptide nucleic acid libraries see, e.g., U.S.
  • Patent 5,539,083 antibody libraries (see, e.g., Vaughn et al., Nature Biotechnology 14(3): 309-314 (1996), and PCT/US96/10287), carbohydrate libraries (see, e.g., Liang et al., Science 274:1520-1522 (1996), and U.S. Patent No. 5,593,853), and small organic molecule libraries (see, e.g., benzodiazepines, Baum, C&EN, Jan 18, page 33 (1993); isoprenoids, U.S. Patent No. 5,569,588; thiazolidinones and metathiazanones, U.S. Patent No.
  • cytotoxic agent refers to a substance that inhibits or prevents the expression activity of cells, function of cells and/or causes destruction of cells.
  • the term is intended to include radioactive isotopes chemotherapeutic agents, and toxins such as small molecule toxins or enzymatically active toxins of bacterial, fungal, plant or animal origin, including fragments and/or variants thereof.
  • cytotoxic agents include, but are not limited to auristatins, auromycins, maytansinoids, yttrium, bismuth, ricin, ricin A-chain, combrestatin, duocarmycins, dolostatins, doxorubicin, daunorubicin, taxol, cisplatin, cc1065, ethidium bromide, mitomycin, etoposide, tenoposide, vincristine, vinblastine, colchicine, dihydroxy anthracin dione, actinomycin, diphtheria toxin, Pseudomonas exotoxin (PE) A, PE40, abrin, abrin A chain, modeccin A chain, alpha-sarcin, gelonin, mitogellin, retstrictocin, phenomycin, enomycin, curicin, crotjn, calicheamicin, Sapaonaria officinalis
  • the “gene product” is sometimes referred to herein as a protein or mRNA.
  • a “gene product of the invention” is sometimes referred to herein as a "cancer amino acid sequence", “cancer protein”, “protein of a cancer listed in Table I", a “cancer mRNA”, “mRNA of a cancer listed in Table I”, etc.
  • the cancer protein is encoded by a nucleic acid of Figure 2.
  • the cancer protein can be a fragment, or alternatively, be the full-length protein to the fragment encoded by the nucleic acids of Figure 2.
  • a cancer amino acid sequence is used to determine sequence identity or similarity.
  • the sequences are naturally occurring allelic variants of a protein encoded by a nucleic acid of Figure 2.
  • the sequences are sequence variants as further described herein.
  • high throughput s ⁇ eening systems are commercially available (see, e.g., Amersham Biosciences, Piscataway, NJ; Zymark Corp., Hopkinton, MA; Air Technical Industries, Mentor, OH; Beckman Instruments, Inc. Fullerton, CA; Precision Systems, Inc., Natick, MA; etc.). These systems typically automate entire procedures, including all sample and reagent pipetting, liquid dispensing, timed incubations, and final readings of the microplate in detector(s) appropriate for the assay. These configurable systems provide high throughput and rapid start up as well as a high degree of flexibility and customization. The manufacturers of such systems provide detailed protocols for various high throughput systems. Thus, e.g., Zymark Corp. provides technical bulletins describing screening systems for detecting the modulation of gene transcription, ligand binding, and the like.
  • homolog refers to a molecule which exhibits homology to another molecule, by for example, having sequences of chemical residues that are the same or similar at corresponding positions.
  • HLA Human Leukocyte Antigen
  • HLA Human Leukocyte Antigen
  • MHC Major Histocompatibility Complex
  • hybridize used in the context of polynucleotides, are meant to refer to conventional hybridization conditions, preferably such as hybridization in 50% formamide/6XSSC/0.1 % SDS/100 ⁇ g/ml ssDNA, in which temperatures for hybridization are above 37 degrees C and temperatures for washing in 0.1XSSC/0.1 % SDS are above 55 degrees C.
  • isolated or “biologically pure” refer to material which is substantially or essentially free from components which normally accompany the material as it is found in its native state.
  • isolated peptides in accordance with the invention preferably do not contain materials normally associated with the peptides in their in situ environment.
  • a polynucleotide is said to be “isolated” when it is substantially separated from contaminant polynucleotides that correspond or are complementary to genes other than the 24P4C12 genes or that encode polypeptides other than 24P4C12 gene product or fragments thereof.
  • a skilled artisan can readily employ nucleic acid isolation procedures to obtain an isolated 24P4C12 polynucleotide.
  • a protein is said to be "isolated,” for example, when physical, mechanical or chemical methods are employed to remove the 24P4C12 proteins from cellular constituents that are normally associated with the protein.
  • a skilled artisan can readily employ standard purification methods to obtain an isolated 24P4C12 protein.
  • an isolated protein can be prepared by chemical means.
  • mammal refers to any organism classified as a mammal, including mice, rats, rabbits, dogs, cats, cows, horses and humans. In one embodiment of the invention, the mammal is a mouse. In another embodiment of the invention, the mammal is a human.
  • metastatic prostate cancer and “metastatic disease” mean prostate cancers that have spread to .regional lymph nodes or to distant sites, and are meant to include stage D disease under the AUA system and stage TxNxM ⁇ under the TNM system.
  • surgery is generally not indicated for patients with metastatic disease, and hormonal (androgen ablation) therapy is a preferred treatment modality.
  • Patients with metastatic prostate cancer eventually develop an androgen-refractory state within 12 to 18 months of treatment initiation. Approximately half of these androgen-refractory patients die within 6 months after developing that status. The most common site for prostate cancer metastasis is bone.
  • Prostate cancer bone metastases are often osteoblastic rather than osteolytic (i.e., resulting in net bone formation). Bone metastases are found most frequently in the spine, followed by the femur, pelvis, rib cage, skull and humerus. Other common sites for metastasis include lymph nodes, lung, liver and brain. Metastatic • prostate cancer is typically diagnosed by open or laparoscopic pelvic lymphadenectomy, whole body radionuclide scans, skeletal radiography, and/or bone lesion biopsy.
  • modulator or “test compound” or “drug candidate” or grammatical equivalents as used herein describe any molecule, e.g., protein, oligopeptide, small organic molecule, polysaccharide, polynucleotide, etc., to be tested for the capacity to directly or indirectly alter the cancer phenotype or the expression of a cancer sequence, e.g., a nucleic acid or protein sequences, or effects of cancer sequences (e.g., signaling, gene expression, protein interaction, etc.)
  • a modulator will neutralize the effect of a cancer protein of the invention.
  • neutralize is meant that an activity of a protein is inhibited or blocked, along with the consequent effect on the cell.
  • a modulator will neutralize the effect of a gene, and its corresponding protein, of the invention by normalizing levels of said protein.
  • modulators alter expression profiles, or expression profile nucleic acids or proteins provided herein, or downstream effector pathways.
  • the modulator suppresses a cancer phenotype, e.g. to a normal tissue fingerprint.
  • a modulator induced a cancer phenotype.
  • a plurality of assay mixtures is run in parallel with different agent concentrations to obtain a differential response to the various concentrations. Typically, one of these concentrations serves as a negative control, i.e., at zero concentration or below the level of detection.
  • Modulators, drug candidates or test compounds encompass numerous chemical classes, though typically they are organic molecules, preferably small organic compounds having a molecular weight of more than 100 and less than about 2,500 Daltons. Preferred small molecules are less than 2000, or less than 1500 or less than 1000 or less than 500 D.
  • Candidate agents comprise functional groups necessary for structural interaction with proteins, particularly hydrogen bonding, and typically include at least an amine, carbonyl, hydroxyl or carboxyl group, preferably at least two of the functional chemical groups.
  • the candidate agents often comprise cyclical carbon or heterocyclic structures and/or aromatic or polyaromatic structures substituted with one or more of the above functional groups.
  • Modulators also comprise biomolecules such as peptides, saccharides, fatty acids, steroids, purines, pyrimidines, derivatives, structural analogs or combinations thereof. Particularly preferred are peptides.
  • One class of modulators are peptides, for example of from about five to about 35 amino acids, with from about five to about 20 amino acids being preferred, and from about 7 to about 15 being particularly preferred.
  • the cancer modulatory protein is soluble, includes a non-transmembrane region, and/or, has an N- terminal Cys to aid in solubility.
  • the C-terminus of the fragment is kept as a free acid and the N-terminus is a free amine to aid in coupling, i.e., to cysteine.
  • a cancer protein of the invention is conjugated to an i munogenic agent as discussed herein.
  • the cancer protein is conjugated to BSA.
  • the peptides of the invention e.g., of preferred lengths, can be linked to each other or to other amino acids to create a longer peptide/protein.
  • the modulatory peptides can be digests of naturally occurring proteins as is outlined above, random peptides, or "biased" random peptides.
  • peptide/protein-based modulators are antibodies, and fragments thereof, as defined herein.
  • Modulators of cancer can also be nucleic acids.
  • Nucleic acid modulating agents can be naturally occurring nucleic acids, random nucleic acids, or "biased" random nucleic acids. For example, digests of prokaryotic or eukaryotic genomes can be used in an approach analogous to that outlined above for proteins.
  • the term "monoclonal antibody” refers to an antibody obtained from a population of substantially homogeneous antibodies, i.e., the antibodies comprising the population are identical except for possible naturally occurring mutations that are present in minor amounts.
  • a "motif, as in biological motif of a 24P4C12-related protein, refers to any pattern of amino acids forming part of the primary sequence of a protein, that is associated with a particular function (e.g. protein-protein interaction, protein-DNA interaction, etc) or modification (e.g. that is phosphorylated, glycosylated or amidated), or localization (e.g. secretory sequence, nuclear localization sequence, etc.) or a sequence that is correlated with being immunogenic, either humorally or cellularly .
  • a motif can be either contiguous or capable of being aligned to certain positions that are generally correlated with a certain function or property.
  • motif refers to the pattern of residues in a peptide of defined length, usually a peptide of from about 8 to about 13 amino acids for a class I HLA motif and from about 6 to about 25 amino acids for a class II HLA motif, which is recognized by a particular HLA molecule.
  • Peptide motifs for HLA binding are typically different for each protein encoded by each human HLA allele and differ in the pattern of the primary and secondary anchor residues.
  • a “pharmaceutical excipient” comprises a material such as an adjuvant, a carrier, pH-adjusting and buffering agents, tonicity adjusting agents, wetting agents, preservative, and the like.
  • “Pharmaceutically acceptable” refers to a non-toxic, inert, and/or composition that is physiologically compatible with humans or other mammals.
  • polynucleotide means a polymeric form of nucleotides of at least 10 bases or base pairs in length, either ribonudeotides or deoxynucleotides or a modified form of either type of nucleotide, and is meant to include single and double stranded forms of DNA and/or RNA. In the art, this term if often used interchangeably with “oligonucleotide”.
  • a polynucleotide can comprise a nucleotide sequence disclosed herein wherein thymidine (T), as shown for example in Figure 2, can also be uracil (U); this definition pertains to the differences between the chemical structures of DNA and RNA, in particular the observation that one of the four major bases in RNA is uracil (U) instead of thymidine (T).
  • T thymidine
  • U uracil
  • polypeptide means a polymer of at least about 4, 5, 6, 7, or 8 amino acids. Throughout the specification, standard three letter or single letter designations for amino acids are used. In the art, this term is often used interchangeably with “peptide” or "protein”.
  • an HLA "primary anchor residue” is an amino add at a specific position along a peptide sequence which is understood to provide a contact point between the immunogenic peptide and the HLA molecule.
  • One to three, usually two, primary anchor residues within a peptide of defined length generally defines a "motif" for an immunogenic peptide. These residues are understood to fit in close contact with peptide binding groove of an HLA molecule, with their side chains buried in specific pockets of the binding groove.
  • the primary anchor residues for an HLA class I molecule are located at position 2 (from the amino terminal position) and at the carboxyl terminal position of a 8, 9, 10, 11 , or 12 residue peptide epitope in accordance with the invention.
  • the primary anchor residues of a peptide binds an HLA class II molecule are spaced relative to each other, rather than to the termini of a peptide, where the peptide is generally of at least 9 amino acids in length.
  • the primary anchor positions for each motif and supermotif are set forth in Table IV.
  • analog peptides can be created by altering the presence or absence of particular residues in the primary and/or secondary anchor positions shown in Table IV. Such analogs are used to modulate the binding affinity and/or population coverage of a peptide comprising a particular HLA motif or supermotif.
  • Radioisotopes include, but are not limited to the following (non-limiting exemplary uses are also set forth):
  • Radium-223 which is an alpha emitter used to treat metastases in the skeleton resulting from cancer (i.e., breast and prostate cancers), and cancer radioimmunotherapy
  • Radiation source for radiotherapy of cancer for food irradiators, and for sterilization of medical supplies
  • Beta/gamma emitter used in cancer radioimmunotherapy and diagnostic studies (i.e., breast and colon cancers, and lymphoma)
  • Radiation source for food irradiation and for sterilization of medical supplies
  • Radiation source for food irradiation and for sterilization of medical supplies
  • Gold-198 Implant and intr acavity therapy of ovarian, prostate, and brain cancers
  • Osteoporosis detection diagnostic imaging, tracer drugs, brain cancer treatment, radiolabeling, tumor imaging, mapping of receptors in the brain, interstitial radiation therapy, brachytherapy for treatment of prostate cancer, determination of glomemlar filtration rate (GFR), determination of plasma volume, detection of deep vein thrombosis of the legs lodine-131 (1-131) -
  • thyroid function evaluation thyroid disease detection, treatment of thyroid cancer as well as other non- malignant thyroid diseases (i.e., Graves disease, goiters, and hyperthyroidism), treatment of leukemia, lymphoma, and other forms of cancer (e.g., breast cancer) using radioimmunotherapy lridium-192
  • Brachytherapy brain and spinal cord tumor treatment, treatment of blocked arteries (i.e., arteriosderosis and re stenosis), and implants for breast and prostate tumors
  • Tc-99m Parent of Technetium-99m which is used for imaging the brain, liver, lungs, heart, and other organs.
  • Tc-99m is the most widely used radioisotope used for diagnostic imaging of various cancers and diseases involving the brain, heart, liver, lungs; also used in detection of deep vein thrombosis of the legs .
  • Polycythemia rubra vera blood cell disease
  • leukemia treatment bone cancer diagnosis/treatment
  • colon, pancreatic, and liver cancer treatment radiolabeling nucleic acids for in vitro research, diagnosis of superficial tumors, treatment of blocked arteries (i.e., arteriosclerosis and restenosis), and intracavity therapy
  • Selenium-75 Radiotracer used in brain studies, imaging of adrenal cortex by gamma-sdntigraphy, lateral locations of steroid secreting tumors, pan ⁇ eatic scanning, detection of hyperactive parathyroid glands, measure rate of bile acid loss from the endogenous pool
  • Bone cancer pain relief multiple myeloma treatment, and osteoblastic therapy
  • Rhenium-188 which is used for cancer diagnostics/treatment, bone cancer pain relief, rheumatoid arthritis treatment, and treatment of blocked arteries (i.e., arteriosclerosis and restenosis)
  • Neuroimaging of brain disorders high resolution SPECT studies, pulmonary function tests, and cerebral blood flow studies
  • Y-90 Yttrium-90
  • cancer radioimmunotherapy i.e., lymphoma, breast, colon, kidney, lung, ovarian, prostate, pan ⁇ eatic, and inoperable liver cancers
  • randomized or grammatical equivalents as herein applied to nucleic acids and proteins is meant that each nucleic acid and peptide consists of essentially random nucleotides and amino acids, respectively. These random peptides (or nucleic acids, discussed herein) can incorporate any nucleotide or amino acid at any position.
  • the synthetic process can be designed to generate randomized proteins or nucleic acids, to allow the formation of all or most of the possible combinations over the length of the sequence, thus forming a library of randomized candidate bioactive proteinaceous agents.
  • a library is "fully randomized,” with no sequence preferences or constants at any position.
  • the library is a "biased random” library. That is, some positions within the sequence either are held constant, or are selected from a limited number of possibilities.
  • the nucleotides or amino acid residues are randomized within a defined class, e.g., of hydrophobic amino acids, hydrophilic residues, sterically biased (either small or large) residues, towards the creation of nucleic acid binding domains, the creation of cysteines, for cross-linking, prolines for SH-3 domains, serines, threonines, tyrosines or histidines for phosphorylation sites, etc., or to purines, etc.
  • a "recombinant" DNA or RNA molecule is a DNA or RNA molecule that has been subjected to molecular manipulation in vitro.
  • Non-limiting examples of small molecules include compounds that bind or interact with 24P4C12, ligands including hormones, neuropeptides, chemokines, odorants, phospholipids, and functional equivalents thereof that bind and preferably inhibit 24P4C12 protein function.
  • Such non-limiting small molecules preferably have a molecular weight of less than about 10 kDa, more preferably below about 9, about 8, about 7, about 6, about 5 or about 4 kDa.
  • small molecules physically associate with, or bind, 24P4C12 protein; are not found in naturally occurring metabolic pathways; and/or are more soluble in aqueous than non-aqueous solutions
  • “Stringency” of hybridization reactions is readily determinable by one of ordinary skill in the art, and generally is an empirical calculation dependent upon probe length, washing temperature, and salt concentration. In general, longer probes require higher temperatures for proper annealing, while shorter probes need lower temperatures. Hybridization generally depends on the ability of denatured nucleic acid sequences to reanneal when complementary strands are present in an environment below their melting temperature. The higher the degree of desired homology between the probe and hybridizable sequence, the higher the relative temperature that can be used. As a result, it follows that higher relative temperatures would tend to make the reaction conditions more stringent, while lower temperatures less so. For additional details and explanation of stringency of hybridization reactions, see Ausubel et al., Current Protocols in Molecular Biology, Wiley Interscience Publishers, (1995).
  • “Stringent conditions” or “high stringency conditions”, as defined herein, are identified by, but not limited to, those that: (1) employ low ionic strength and high temperature for washing, for example 0.015 M sodium chloride/0.0015 M sodium citrate/0.1 % sodium dodecyl sulfate at 50°C; (2) employ during hybridization a denaturing agent, such as formamide, for example, 50% (v/v) formamide with 0.1% bovine serum albumin/0.1% Ficoll/0.1% polyvinylpyrrolidone/50 mM sodium phosphate buffer at pH 6.5 with 750 mM sodium chloride, 75 mM sodium citrate at 42 °C; or (3) employ 50% formamide, 5 x SSC (0.75 M NaCl, 0.075 M sodium citrate), 50 mM sodium phosphate (pH 6.8), 0.1% sodium pyrophosphate, 5 x Denhardt's solution, sonicated salmon sperm DNA (50 ⁇ g/ml), 0.1% SDS,
  • Modely stringent conditions are described by, but not limited to, those in Sambrook et al., Molecular Cloning: A Laboratory Manual, New York: Cold Spring Harbor Press, 1989, and indude the use of washing solution and hybridization conditions (e.g., temperature, ionic strength and %SDS) less stringent than those described above.
  • washing solution and hybridization conditions e.g., temperature, ionic strength and %SDS
  • moderately stringent conditions is overnight incubation at 37°C in a solution comprising: 20% formamide, 5 x SSC (150 mM NaCl, 15 mM trisodium citrate), 50 mM sodium phosphate (pH 7.6), 5 x Denhardt's solution, 10% dextran sulfate, and 20 mg/mL denatured sheared salmon sperm DNA, followed by washing the filters in 1 x SSC at about 37-50°C.
  • 5 x SSC 150 mM NaCl, 15 mM trisodium citrate
  • 50 mM sodium phosphate pH 7.6
  • 5 x Denhardt's solution 10% dextran sulfate
  • 20 mg/mL denatured sheared salmon sperm DNA followed by washing the filters in 1 x SSC at about 37-50°C.
  • the skilled artisan will recognize how to adjust the temperature, ionic strength, etc. as necessary to accommodate factors such as probe length and the like.
  • HLA-supermotif is a peptide binding specificity shared by HLA molecules encoded by two or more HLA alleles. Overall phenotypic frequencies of HLA-supertypes in different ethnic populations are set forth in Table IV (F). The non- limiting constituents of various supetypes are as follows:
  • A3 A3, A11, A31, A*3301, A*6801, A * 0301, A * 1101, A * 3101
  • B7 B7, 6*3501-03, B*51, B*5301, B*5401, B*5501, B*5502, B*5601, B * 6701, B * 7801, B*0702, B*5101, B*5602
  • B44 B*3701, B*4402, B*4403, B * 60 (B 001), B61 (B 006)
  • A24 A*24, A*30, A*2403, A*2404, A*3002, A * 3003
  • B27 B*1401-02, B 503, B*1509, B*1510, B*1518, B*3801-02, B*3901 , B*3902, B * 3903-04, B 801-02, B*7301, B*2701-08
  • B58 B 516, B 517, B*5701, B * 5702, B58
  • B62 B 601. B52. B*1501 (B62), B*1502 (B75), B*1513 (B77) Calculated population coverage afforded by different HLA-supertype combinations are set forth in Table IV (G).
  • to treat or "therapeutic” and grammatically related terms, refer to any improvement of any consequence of disease, such as prolonged survival, less morbidity, and/or a lessening of side effects which are the byproducts of an alternative therapeutic modality; full eradication of disease is not required.
  • transgenic animal e.g., a mouse or rat
  • transgene is an animal having cells that contain a transgene, which transgene was introduced into the animal or an ancestor of the animal at a prenatal, e.g., an embryonic stage.
  • transgene is a DNA that is integrated into the genome of a cell from which a transgenic animal develops.
  • an HLA or cellular immune response "vaccine” is a composition that contains or encodes one or more peptides of the invention.
  • vaccines such as a cocktail of one or more individual peptides; one or more peptides of the invention comprised by a polyepitopic peptide; or nucleic acids that encode such individual peptides or polypeptides, e.g., a minigene that encodes a polyepitopic peptide.
  • the "one or more peptides” can include any whole unit integer from 1-150 or more, e.g., at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, or 150 or more peptides of the invention.
  • the peptides or polypeptides can optionally be modified, such as by lipidation, addition of targeting or other sequences.
  • HLA class I peptides of the invention can be admixed with, or linked to, HLA class II peptides, to facilitate activation of both cytotoxic T lymphocytes and helper T lymphocytes.
  • HLA vaccines can also comprise peptide-pulsed antigen presenting cells, e.g., dendritic cells.
  • variant refers to a molecule that exhibits a variation from a described type or norm, such as a protein that has one or more different amino add residues in the corresponding position(s) of a specifically described protein (e.g. the 24P4C12 protein shown in Figure 2 or Figure 3.
  • An analog is an example of a variant protein.
  • Splice isoforms and single nudeotides polymorphisms (SNPs) are further examples of variants.
  • 24P4C12-related proteins indude those specifically identified herein, as well as allelic variants, conservative substitution variants, analogs and ho ologs that can be isolated/generated and characterized without undue experimentation following the methods ouBined herein or readily available in the art Fusion proteins that combine parts of different 24P4C12 proteins or fragments thereof, as well as fusion proteins of a 24P4C12 protein and a heterologous polypeptide are also induded.
  • Such 24P4C12 proteins are collectively referred to as the 24P4C12-related proteins, the proteins of the invention, or 24P4C12.
  • 24P4C12-related protein refers to a polypeptide fragment or a 24P4C12 protein sequence of 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or more than 25 amino adds; or, at least 30, 35, 40, 45, 50, 55, 60, 65, 70, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150, 155, 160, 165, 170, 175, 180, 185, 190, 195, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 525, 550, 575, 600, 625, 650, or 664 or more amino acids.
  • One aspect of the invention provides polynucleotides corresponding or complementary to all or part of a 24P4C12 gene, mRNA, and/or coding sequence, preferably in isolated form, including polynucleotides encoding a 24P4C12-related protein and fragments thereof, DNA, RNA, DNA/RNA hybrid, and related molecules, polynucleotides or oligonucleotides complementary to a 24P4C12 gene or mRNA sequence or a part thereof, and polynucleotides or oligonucleotides that hybridize to a 24P4C12 gene, mRNA, or to a 24P4C12 encoding polynucleotide (collectively, "24P4C12 polynucleotides").
  • T can also be U in Figure 2.
  • Embodiments of a 24P4C12 polynucleotide indude a 24P4C12 polynucleotide having the sequence shown in Figure 2, the nudeotide sequence of 24P4C12 as shown in Figure 2 wherein T is U; at least 10 contiguous nucleotides of a polynucleotide having the sequence as shown in Figure 2; or, at least 10 contiguous nucleotides of a polynucleotide having the sequence as shown in Figure 2 where T is U.
  • embodiments of 24P4C12 nucleotides comprise, without limitation:
  • V a polynucleotide comprising, consisting essentially of, or consisting of the sequence as shown in Figure 2D, from nucleotide residue number 6 through nucleotide residue number 2138, including the stop codon, wherein T can also be U;
  • VI a polynucleotide comprising, consisting essentially of, or consisting of the sequence as shown in Figure 2E, from nucleotide residue number 6 through nucleotide residue number 2138, including the stop codon, wherein T can also be U;
  • VII a polynucleotide comprising, consisting essentially of, or consisting of the sequence as shown in Figure 2F, from nucleotide residue number 6 through nucleotide residue number 2138, including the stop codon, wherein T can also be U;
  • VIII a polynucleotide comprising, consisting essentially of, or consisting of the sequence as shown in Figure 2G, from nucleotide residue number 6 through nucleotide residue number 1802, including the stop codon, wherein T can also be U;
  • (IX) a polynucleotide comprising, consisting essentially of, or consisting of the sequence as shown in Figure 2H, from nucleotide residue number 6 through nudeotide residue number 2174, including the stop codon, wherein T can also be U;
  • (X) a polynucleotide comprising, consisting essentially of, or consisting of the sequence as shown in Figure 21, from nudeotide residue number 6 through nucleotide residue number 2144, including the stop codon, wherein T can also be U;
  • XI a polynucleotide that encodes a 24P4C12-related protein that is at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100% homologous to an entire amino acid sequence shown in Figure 2A-I;
  • XII a polynucleotide that encodes a 24P4C12-related protein that is at least 90, 91 , 92, 93, 94, 95, 96, 97, 98, 99 or 100% identical to an entire amino acid sequence shown in Figure 2A-I;
  • (XIV) a polynucleotide that encodes a peptide region of at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35 amino adds of a peptide of Figure 3A-D in any whole number increment up to 710 that includes at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 amino acid position(s) having a value greater than 0.5 in the Hydrophilicity profile of Figure 5;
  • (XV) a polynucleotide that encodes a peptide region of at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 amino acids of a peptide of Figure 3A-D in any whole number increment up to 710 that includes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 amino acid position(s) having a value less than 0.5 in the Hydropathidty profile of Figure 6;
  • (XVI) a polynucleotide that encodes a peptide region of at least 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 amino adds of a peptide of Figure 3A-D in any whole number increment up to 710 that indudes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35 amino add positions) having a value greater than 0.5 in the Percent Accessible Residues profile of Figure 7;
  • (XVII) a polynudeotide that encodes a peptide region of at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 5, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35 amino adds of a peptide of Figure 3A-D in any whole number increment up to 710 that includes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 amino add position(s) having a value greater than 0.5 in the Average Flexibility profile of Figure 8;
  • (XVIII) a polynucleotide that encodes a peptide region of at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 amino acids of a peptide of Figure 3A-D in any whole number increment up to 710 that includes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 amino acid position(s) having a value greater than 0.5 in the Beta-turn profile of Figure 9;
  • (XIX) a polynucleotide that encodes a peptide region of at least 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 amino acids of a peptide of Figure 3E in any whole number increment up to 598 that includes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 3, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 amino acid position(s) having a value greater than 0.5 in the Hyd ophilicity profile of Figure 5;
  • (XX) a polynucleotide that encodes a peptide region of at least 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35 amino acids of a peptide of Figure 3E in any whole number increment up to 598 that includes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 amino add position(s) having a value less than 0.5 in the Hydropathicity profile of Figure 6;
  • (XXI) a polynucleotide that encodes a peptide region of at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 amino adds of a peptide of Figure 3E in any whole number i ⁇ ement up to 598 that includes 1, 2, 3, , 5, 6, 7, 8, , 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 amino acid position(s) having a value greater than 0.5 in the Percent Accessible Residues profile of Figure 7;
  • (XXII) a polynucleotide that encodes a peptide region of at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 amino acids of a peptide of Figure 3E in any whole number increment up to 598 that indudes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25. 26, 27. 28. 29, 30, 31 , 32, 33, 34, 35 amino acid position(s) having a value greater than 0.5 in the Average Flexibility profile of Figure 8;
  • (XXIII) a polynudeotide that encodes a peptide region of at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 amino acids of a peptide of Figure 3E in any whole number increment up to 598 that indudes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35 amino add position(s) having a value greater than 0.5 in the Beta- turn profile of Figure 9
  • (XXIV) a polynucleotide that encodes a peptide region of at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 amino acids of a peptide of Figure 3F in any whole number in ⁇ ement up to 722 that includes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 amino acid position(s) having a value greater than 0.5 in the Hydrophilicity profile of Figure 5; (XXV) a polynucleotide that encodes a peptide region of at least 5, 6, 7, 8, 9, 10, 11 , 12, 13. 14, 15.
  • (XXVI) a polynucleotide that encodes a peptide region of at least 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 amino acids of a peptide of Figure 3F in any whole number increment up to 722 that includes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 amino add position(s) having a value greater than 0.5 in the Percent Accessible Residues profile of Figure 7;
  • (XXVII) a polynucleotide that encodes a peptide region of at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 amino acids of a peptide of Figure 3F in any whole number increment up to 722 that includes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 amino acid positi ' on(s) having a value greater than 0.5 in the Average Flexibility profile of Figure 8;
  • (XXVI II) a polynucleotide that encodes a peptide region of at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35 amino acids of a peptide of Figure 3F in any whole number increment up to 722 that includes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 amino acid position(s) having a value greater than 0.5 in the Beta- turn profile of Figure 9
  • (XXIX) a polynucleotide that encodes a peptide region of at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35 amino adds of a peptide of Figure 3G in any whole number increment up to 712 that includes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35 amino acid positio ⁇ (s) having a value greater than 0.5 in the Hydrophilicity profile of Figure 5;
  • (XXX) a polynucleotide that encodes a peptide region of at least 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 amino acids of a peptide of Figure 3G in any whole number increment up to 712 that includes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35 amino acid position(s) having a value less than 0.5 in the Hydropathicity profile of Figure 6;
  • (XXXI) a polynucleotide that encodes a peptide region of at least 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 amino acids of a peptide of Figure 3G in any whole number increment up to 712 that indudes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 amino acid position(s) having a value greater than 0.5 in the Percent Accessible Residues profile of Figure 7;
  • (XXXII) a polynudeotide that encodes a peptide region of at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 amino adds of a peptide of Figure 3G in any whole number increment up to 712 that includes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 2, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 amino acid position(s) having a value greater than 0.5 in the Average Flexibility profile of Figure 8;
  • (XXXIII) a polynucleotide that encodes a peptide region of at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35 amino acids of a peptide of Figure 3G in any whole number increment up to 712 that includes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 amino acid position(s) having a value greater than 0.5 in the Beta- turn profile of Figure 9
  • (XXXIV) a polynucleotide that is fully complementary to a polynucleotide of any one of (l)-(XXXIH).
  • (XXXVI) a composition comprising a polynucleotide of any of (l)-(XXXIV) or peptide of (XXXV) together with a pharmaceutical excipient and/or in a human unit dose form.
  • (XXXVII) a method of using a polynucleotide of any (l)-( XXXIV) or peptide of (XXXV) or a composition of (XXXVI) in a method to modulate a cell expressing 24P4C12,
  • (XXXVIII) a method of using a polynucleotide of any (l)-( XXXIV) or peptide of (XXXV) or a composition of (XXXVI) in a method to diagnose, prophylax, prognose, or treat an individual who bears a cell expressing 24P4C12
  • (XXXIX) a method of using a polynudeotide of any (l)-( XXXIV) or peptide of (XXXV) or a composition of (XXXVI) in a method to diagnose, prophylax, prognose, or treat an individual who bears a cell expressing 24P4C12, said cell from a cancer of a tissue listed in Table I;
  • (XL) a method of using a polynucleotide of any (l)-(XXXIV) or peptide of (XXXV) or a composition of (XXXVI) in a method to diagnose, prophylax, prognose, or treat a a cancer;
  • (XLI) a method of using a polynucleotide of any (l)-(XXXIV) or peptide of (XXXV) or a composition of (XXXVI) in a method to diagnose, prophylax, prognose, or treat a a cancer of a tissue listed in Table I;
  • (XLI I) a method of using a polynucleotide of any (l)-(XXXI V) or peptide of (XXXV) or a composition of (XXXVI) in a method to identify or characterize a modulator of a cell expressing 24P4C12.
  • a range is understood to disdose specifically all whole unit positions thereof.
  • representative embodiments of the invention disclosed herein include: polynucleotides and their encoded peptides themselves encoding about amino acid 1 to about amino acid 10 of the 24P4C12 protein shown in Figure 2 or Figure 3, polynucleotides encoding about amino acid 10 to about amino acid 20 of the 24P4C12 protein shown in Figure 2 or Figure 3, polynucleotides encoding about amino acid 20 to about amino acid 30 of the 24P4C12 protein shown in Figure 2 or Figure 3, polynucleotides encoding about amino acid 30 to about amino acid 40 of the 24P4C12 protein shown in Figure 2 or Figure 3, polynucleotides encoding about amino acid 40 to about amino acid 50 of the 24P4C12 protein shown in Figure 2 or Figure 3, polynucleotides encoding about amino acid 50 to about amino acid 60 of the 24P4C12 protein shown in Figure 2 or Figure 3, polynucleotides encoding about amino acid 60 to about amino acid 70 of the 24P4C12 protein shown
  • polynucleotides encoding portions of the amino acid sequence (of about 10 amino acids), of amino acids, 100 through the carboxyl terminal amino acid of the 24P4C12 protein are embodiments of the invention. Wherein it is understood that each particular amino acid position discloses that position plus or minus five amino acid residues.
  • Polynucleotides encoding relatively long portions of a 24P4C12 protein are also within the scope of the invention.
  • polynudeotides encoding from about amino acid 1 (or 20 or 30 or 40 etc.) to about amino acid 20, (or 30, or 40 or 50 etc.) of the 24P4C12 protein "or variant" shown in Figure 2 or Figure 3 can be generated by a variety of techniques well known in the art.
  • These polynucleotide fragments can include any portion of the 24P4C12 sequence as shown in Figure 2.
  • Additional illustrative embodiments of the invention disclosed herein include 24P4C12 polynucleotide fragments encoding one or more of the biological motifs contained within a 24P4C12 protein "or varianf sequence, including one or more of the motif-bearing subsequences of a 24P4C12 protein "or varianf set forth in Tables VIII-XXI and XXII-XLIX.
  • typical polynucleotide fragments of the invention encode one or more of the regions of 24P4C12 protein or variant that exhibit homology to a known molecule.
  • typical polynucleotide fragments can encode one or more of the 24P4C12 protein or variant N-glycosylation sites, cAMP and cGMP-dependent protein kinase phosphorylation sites, casein kinase II phosphorylation sites or N-myristoylation site and amidation sites.
  • HLA Peptide Tables e.g., HLA Peptide Tables
  • HLA Peptide Tables e.g., HLA Peptide Tables
  • search Peptides listed in Table LVII Generally, a unique Search Peptide is used to obtain HLA peptides for a particular variant. The position of each Search Peptide relative to its respective parent molecule is listed in Table VII.
  • a Search Peptide begins at position "X"
  • 150 - 1 i.e., 149 to each HLA peptide amino acid position to calculate the position of that amino acid in the parent molecule.
  • the polynudeotides of the preceding paragraphs have a number of different specific uses.
  • the human 24P4C12 gene maps to the chromosomal location set forth in the Example entitled "Chromosomal Mapping of 24P4C12."
  • polynudeotides that encode different regions of the 24P4C12 proteins are used to characterize cytogenetic abnormalities of this chromosomal locale, such as abnormalities that are identified as being associated with various cancers.
  • cytogenetic abnormalities of this chromosomal locale such as abnormalities that are identified as being associated with various cancers.
  • a variety of chromosomal abnormalities including rearrangements have been identified as frequent cytogenetic abnormalities in a number of different cancers (see e.g. Krajinovic et al, Mutat.
  • polynucleotides encoding specific regions of the 24P4C12 proteins provide new tools that can be used to delineate, with greater precision than previously possible, cytogenetic abnormalities in the chromosomal region that encodes 24P4C12 that may contribute to the malignant phenotype.
  • these polynucleotides satisfy a need in the art for expanding the sensitivity of chromosomal screening in order to identify more subtle and less common chromosomal abnormalities (see e.g. Evans etal., Am. J. Obstet. Gynecol 171(4): 1055-1057 (1994)).
  • 24P4C12 was shown to be highly expressed in bladder and other cancers, 24P4C12 polynucleotides are used in methods assessing the status of 24P4C12 gene products in normal versus cancerous tissues. Typically, polynucleotides that encode specific regions of the 24P4C12 proteins are used to assess the presence of perturbations (such as deletions, insertions, point mutations, or alterations resulting in a loss of an antigen etc.) in specific regions of the 24P4C12 gene, such as regions containing one or more motifs.
  • perturbations such as deletions, insertions, point mutations, or alterations resulting in a loss of an antigen etc.
  • Exemplary assays include both RT-PCR assays as well as single-strand conformation polymorphism (SSCP) analysis (see, e.g., Marrogi etal., J, Cutan. Pathol. 26(8): 369-378 (1999), both of which utilize polynucleotides encoding specific regions of a protein to examine these regions within the protein.
  • SSCP single-strand conformation polymorphism
  • nudeic add related embodiments of the invention disdosed herein are genomic DNA cDNAs, ribozymes, and antisense molecules, as well as nudeic acid molecules based on an alternative backbone, or induding alternative bases, whether derived from natural sources or synthesized, and include molecules capable of inhibiting the RNA or protein expression of 24P4C12.
  • antisense molecules can be RNAs or other molecules, including peptide nucleic acids (PNAs) or non-nucleic acid molecules such as phosphorothioate derivatives that spedfically bind DNA or RNA in a base pair-dependent manner.
  • PNAs peptide nucleic acids
  • non-nucleic acid molecules such as phosphorothioate derivatives that spedfically bind DNA or RNA in a base pair-dependent manner.
  • a skilled artisan can readily obtain these classes of nudeic acid molecules using the 24P4C12 polynudeotides and polynudeotide sequences disclosed
  • Antisense technology entails the administration of exogenous oligonucleotides that bind to a target polynucleotide located within the cells.
  • the term "antisense” refers to the fact that such oligonucleotides are complementary to their intracellular targets, e.g., 24P4C12. See for example, Jack Cohen, Oligodeoxynucleotides, Antisense Inhibitors of Gene Expression, CRC Press, 1989; and Synthesis 1:1-5 (1988).
  • the 24P4C12 antisense oligonucleotides of the present invention include derivatives such as S-oligonucleotides (phosphorothioate derivatives or S-oligos, see, Jack Cohen, supra), which exhibit enhanced cancer cell growth inhibitory action.
  • S-oligos are isoelectronic analogs of an oligonucleotide (O-oligo) in which a nonbridging oxygen atom of the phosphate group is replaced by a sulfur atom.
  • the S-oligos of the present invention can be prepared by treatment of the corresponding O-oligos with 3H-1.2- benzodithiol-3-one-1,1-dioxide, which is a sulfur transfer reagent. See, e.g., Iyer, R. P. etal., J. Org. Chem. 55:46934698 (1990); and Iyer. R. P. etal., J. Am. Chem. Soc.
  • Additional 24P4C12 antisense oligonucleotides of the present invention include morpholino antisense oligonucleotides known in the art (see, e.g., Partridge et al., 1996, Antisense & Nucleic Add Drug Development 6: 169-175).
  • the 24P4C12 antisense oligonucleotides of the present invention typically can be RNA or DNA that is complementary to and stably hybridizes with the first 1005' codons or last 1003' codons of a 24P4C 12 genomic sequence or the corresponding mRNA. Absolute complementarity is not required, although high degrees of complementarity are preferred. Use of an oligonucleotide complementary to this region allows for the selective hybridization to 24P4C12 mRNA and not to mRNA spedfying other regulatory subunits of protein kinase.
  • 24P4C12 antisense oligonucleotides of the present invention are 15 to 30-mer fragments of the antisense DNA molecule that have a sequence that hybridizes to 24P4C12 mRNA.
  • 24P4C12 antisense oligonucleotide is a 30-mer oligonudeotide that is complementary to a region in the first 105' codons or last 103' codons of 24P4C12.
  • the antisense molecules are modified to employ ribozymes in the inhibition of 24P4C12 expression, see, e.g., L. A. Couture & D. T. Stinchcomb; Trends Genet 12: 510-515 (1996).
  • nucleotides of the invention include primers and primer pairs, which allow the specific amplification of polynucleotides of the invention or of any specific parts thereof, and probes that selectively or specifically hybridize to nucleic acid molecules of the invention or to any part thereof.
  • Probes can be labeled with a detectable marker, such as, for example, a radioisotope, fluorescent compound, bioluminescent compound, a chemiluminescent compound, metal chelator or enzyme.
  • a detectable marker such as, for example, a radioisotope, fluorescent compound, bioluminescent compound, a chemiluminescent compound, metal chelator or enzyme.
  • Such probes and primers are used to detect the presence of a 24P4C12 polynudeotide in a sample and as a means for detecting a cell expressing a 24P4C12 protein.
  • probes include polypeptides comprising all or part of the human 24P4C12 cDNA sequence shown in Figure 2.
  • primer pairs capable of specifically amplifying 24P4C12 mRNAs are also described in the Examples. As will be understood by the skilled artisan, a great many different primers and probes can be prepared based on the sequences provided herein and used effectively to amplify and/or detect a 24P4C12 mRNA.
  • the 24P4C12 polynucleotides of the invention are useful for a variety of purposes, including but not limited to their use as probes and primers for the amplification and/or detection of the 24P4C12 gene(s), mRNA(s), or fragments thereof; as reagents for the diagnosis and/or prognosis of prostate cancer and other cancers; as coding sequences capable of directing the expression of 24P4C12 polypeptides; as tools for modulating or inhibiting the expression of the 24P4C12 gene(s) and/or translation of the 24P4C12 transcript(s); and as therapeutic agents.
  • the present invention indudes the use of any probe as described herein to identify and isolate a 24P4C12 or 24P4C12 related nudeic add sequence from a naturally occurring source, such as humans or other mammals, as well as the isolated nudeic add sequence per se, which would comprise all or most of the sequences found in the probe used. II.A.4.) Isolation of 24P4C12-Encoding Nucleic Acid Molecules
  • the 24P4C12 cDNA sequences described herein enable the isolation of other polynudeotides encoding 24P4C12 gene product(s), as well as the isolation of polynudeotides encoding 24P4C12 gene product homologs, alternatively spliced isoforms, allelic variants, and mutant forms of a 24P4C12 gene product as well as polynudeotides that encode analogs of 24P4C12-related proteins.
  • Various molecular doning methods that can be employed to isolate lull length cDNAs encoding a 24P4C12 gene are well known (see, for example, Sambrook, J.
  • a 24P4C12 cDNA (e.g., Figure 2) or a portion thereof can be synthesized and used as a probe to retrieve overlapping and full-length cDNAs corresponding to a 24P4C12 gene.
  • a 24P4C12 gene itself can be isolated by s ⁇ eening genomic DNA libraries, bacterial artificial chromosome libraries (BACs), yeast artificial chromosome libraries (YACs), and the like, with 24P4C12 DNA probes or primers.
  • the invention also provides recombinant DNA or RNA molecules containing a 24P4C12 polynudeotide, a fragment, analog or homologue thereof, induding but not limited to phages, plasmids, phagemids, cosmids, YACs, BACs, as well as various viral and non-viral vectors well known in the art, and cells transformed or transfected with such recombinant DNA or RNA molecules. Methods for generating such molecules are well known (see, for example, Sambrook ef a/. , 1989, supra).
  • the invention further provides a host-vector system comprising a recombinant DNA molecule containing a 24P4C12 polynudeotide, fragment analog or homologue thereof within a suitable prokaryotic or eukaryotic host cell.
  • suitable eukaryote host cells include a yeast cell, a plant cell, or an animal cell, such as a mammalian cell or an insect cell (e.g., a baculovirus-infectible cell such as an Sf9 or HighFive cell).
  • suitable mammalian cells include various prostate cancer cell lines such as DU145 and TsuPrl , other transfectable or transducible prostate cancer cell lines, primary cells (PrEC), as well as a number of mammalian cells routinely used for the expression of recombinant proteins (e.g , COS, CHO, 293, 293T cells). More particularly, a polynucleotide comprising the coding sequence of 24P4C12 or a fragment, analog or homolog thereof can be used to generate 24P4C12 proteins or fragments thereof using any number of host-vector systems routinely used and widely known in the art.
  • Preferred vectors for mammalian expression include but are not limited to pcDNA 3.1 myc-His-tag (Invitrogen) and the retroviral vector pSR ⁇ tkneo (Muller ef al., 1991, MCB 11:1785).
  • 24P4C12 can be expressed in several prostate cancer and non-prostate cell lines, including for example 293, 293T, rat-1 , NIH 3T3 and TsuPrl
  • the host-vector systems of the invention are useful for the production of a 24P4C12 protein or fragment thereof. Such host-vector systems can be employed to study the functional properties of 24P4C12 and 24P4C12 mutations or analogs.
  • Recombinant human 24P4C12 protein or an analog or homolog or fragment thereof can be produced by mammalian cells transfected with a construct encoding a 24P4C12-related nucleotide.
  • 293T cells can be transfected with an expression plasmid encoding 24P4C12 or fragment, analog or homolog thereof, a 24P4C12-related protein is expressed in the 293T cells, and the recombinant 24P4C12 protein is isolated using standard purification methods (e.g., affinity purification using anti-24P4C12 antibodies).
  • a 24P4C12 coding sequence is subdoned into the retroviral vector pSR ⁇ MSVtkneo and used to infect various mammalian cell lines, such as NIH 3T3, TsuPrl , 293 and rat-1 in order to establish 24P4C12 expressing cell lines.
  • various mammalian cell lines such as NIH 3T3, TsuPrl , 293 and rat-1
  • Various other expression systems well known in the art can also be employed.
  • Expression constructs encoding a leader peptide joined in frame to a 24P4C12 coding sequence can be used for the generation of a se ⁇ eted form of recombinant 24P4C12 protein.
  • redundancy in the genetic code permits variation in 24P4C12 gene sequences.
  • specific host species often have specific codon preferences, and thus one can adapt the disclosed sequence as preferred for a desired host.
  • preferred analog codon sequences typically have rare codons (i.e., codons having a usage frequency of less than about 20% in known sequences of the desired host) replaced with higher frequency codons.
  • Codon preferences for a specific species are calculated, for example, by utilizing codon usage tables available on the INTERNET such as at URL dna.affrc.go.jp/ ⁇ nakamura/codon.html.
  • Additional sequence modifications are known to enhance protein expression in a cellular host. These include elimination of sequences encoding spurious polyadenylation signals, exon/intron splice site signals, transposon-like repeats, and/or other such well-characterized sequences that are deleterious to gene expression.
  • the GC content of the sequence is adjusted to levels average for a given cellular host, as calculated by reference to known genes expressed in the host cell. Where possible, the sequence is modified to avoid predicted hairpin secondary mRNA structures.
  • Other useful modifications include the addition of a translational initiation consensus sequence at the start of the open reading frame, as described in Kozak, Mol. Cell Biol., 9:5073-5080 (1989).
  • 24P4C12-related Proteins Another aspect of the present invention provides 24P4C12-related proteins. Spedfic embodiments of 24P4C12 proteins comprise a polypeptide having all or part of the amino acid sequence of human 24P4C12 as shown in Figure 2 or Figure 3. Alternatively, embodiments of 24P4C12 proteins comprise variant, homolog or analog polypeptides that have alterations in the amino acid sequence of 24P4C12 shown in Figure 2 or Figure 3.
  • Embodiments of a 24P4C12 polypeptide include: a 24P4C12 polypeptide having a sequence shown in Figure 2, a peptide sequence of a 24P4C12 as shown in Figure 2 wherein T is U; at least , 10 contiguous nucleotides of a polypeptide having the sequence as shown in Figure 2; or, at least 10 contiguous peptides of a polypeptide having the sequence as shown in Figure 2 where T is U.
  • embodiments of 24P4C12 peptides comprise, without limitation:
  • (V) a protein that comprises at least one peptide set forth in Tables VIII-XXI, collectively, which peptide is also set forth in Tables XXII to XLIX, collectively, optionally with a proviso that it is not an entire protein of Figure 2;
  • VII a protein that comprises at least two peptides selected from the peptides set forth in Tables VIII to XLIX collectively, with a proviso that the protein is not a contiguous sequence from an amino add sequence of Figure 2;
  • (VIII) a protein that comprises at least one peptide selected from the peptides set forth in Tables VIII-XXI; and at least one peptide selected from the peptides set forth in Tables XXII to XLIX, with a proviso that the protein is not a contiguous sequence from an amino add sequence of Figure 2;
  • (X) a polypeptide comprising at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 amino acids of a protein of Figure 3A, 3B, 3C, 3D, 3E, 3F, or 3G in any whole number increment up to 710, 710, 710, 710, 598, 722, or 712 respectively, that indudes at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31.32, 33, 34, 35 amino acid position(s) having a value less than 0.5 in the Hydropathicity profile of Figure 6; (XI) a polypeptide comprising at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35 amino acids of a protein of Figure 3A, 3B, 3C, 3D, 3E, 3F, or 3G in any whole
  • (XII) a polypeptide comprising at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35 amino acids of a protein of Figure 3A, 3B, 3C, 3D, 3E, 3F, or 3G in any whole number increment up to 710, 710, 710, 710, 598, 722, or 712 respectively, that includes at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 amino acid position(s) having a value greater than 0.5 in the Average Flexibility profile of Figure 8;
  • XXI a peptide that occurs at least twice in Tables VIII-XXI, and at least twice in tables XXII to XLIX;
  • (XXII) a peptide which comprises one two, three, four, or five of the following characteristics, or an oligonucleotide encoding such peptide: i) a region of at least 5 amino acids of a particular peptide of Figure 3, in any whole number increment up to the full length of that protein in Figure 3, that includes an amino add position having a value equal to or greater than 0.5, 0.6, 0.7, 0.8, 0.9, or having a value equal to 1.0, in the Hydrophilicity profile of Figure 5; ii) a region of at least 5 amino acids of a particular peptide of Figure 3, in any whole number increment up to the full length of that protein in Figure 3, that includes an amino add position having a value equal to or less than 0.5, 0.4, 0.3, 0.2, 0.1 , or having a value equal to 0.0, in the Hydropathicity profile of Figure 6; iii) a region of at least 5 amino acids of a particular peptide of Figure 3, in any whole number increment up
  • (XXIII) a composition comprising a peptide of (l)-(XXH) or an antibody or binding region thereof together with a pharmaceutical excipient and/or in a human unit dose form
  • (XXIV) a method of using a peptide of (l)-(XXII), or an antibody or binding region thereof or a composition of (XXIII) in a method to modulate a cell expressing 24P4C12,
  • (XXV) a method of using a peptide of (l)-(XXII) or an antibody or binding region thereof or a composition of (XXIII) in a method to diagnose, prophylax, prognose, or treat an individual who bears a cell expressing 24P4C12
  • (XXVI) a method of using a peptide of (l)-(XXH) or an antibody or binding region thereof or a composition (XXIII) in a method to diagnose, prophylax prognose, or treat an individual who bears a cell expressing 24P4C12 said cell from a cancer of a tissue listed in Table I,
  • (XXVII) a method of using a peptide of (l)-(XXII) or an antibody or binding region thereof or a composition of (XXIII) in a method to diagnose, prophylax, prognose, or treat a a cancer
  • (XXVIII) a method of using a peptide of (l)-(XXII) or an antibody or binding region thereof or a composition of (XXIII) in a method to diagnose, prophylax, prognose, or treat a a cancer of a tissue listed in Table I, and
  • (XXIX) a method of using a a peptide of (l)-(XXII) or an antibody or binding region thereof or a composition (XXIII) in a method to identify or characte ⁇ ze a modulator of a cell expressing 24P4C12
  • Typical embodiments of the invention disclosed herein include 24P4C12 polynucleotides that encode specific portions of 24P4C12 mRNA sequences (and those which are complementary to such sequences) such as those that encode the proteins and/or fragments thereof, for example
  • the maximal lengths relevant for other variants are vanant 3, 710 ammo acids, variant 5, 710 ammo acids, variant 6, 710, variant 7, 598 ammo acids, variant 8, 722 ammo acids, and vanant 9, 712 ammo acids
  • allelic va ⁇ ants of human 24P4C12 share a high degree of structural identity and homology (e g , 90% or more homdogy)
  • allelic va ⁇ ants of a 24P4C12 protein contain conservative am o a ⁇ d substitutions within the 24P4C12 sequences descnbed herein or contain a substitution of an ammo actd from a corresponding position in a homologue of 24P4C12
  • One premises of 24P4C12 allelic va ⁇ ants are proteins that share a high degree of homology with at least a small region of a particular 24P4C12 ammo a ⁇ d sequence, but further contain a radical departure from the sequence, such as a non-conservative substitution, truncation, insertion or frame shift
  • simila ⁇ ty, identity, and homology each have a distind meaning as appre ⁇ ated in the field of genetics
  • orthology and paralogy can be important concepts des
  • Embodiments of the invention disclosed herein include a wide variety of art-accepted variants or analogs of 24P4C12 proteins such as polypeptides having ammo acid insertions, deletions and substitutions 24P4C12 variants can be made using methods known in the art such as site-directed mutagenesis, alanine scanning, and PCR mutagenesis Site- directed mutagenesis (Carter ef al , Nucl Acids Res , 134331 (1986), Zoller ef al , Nucl Acids Res, 106487 (1987)), cassette mutagenesis (Wells ef al , Gene 34315 (1985)), rest ⁇ ction selection mutagenesis (Wells et al , Philos Trans R Soc London SerA, 317415 (1986)) or other known techniques can be performed on the cloned DNA to produce the 24P4C12 variant DNA
  • Scanning ammo acid analysis can also be employed to identify one or more am o acids along a contiguous sequence that is involved in a specific biological activity such as a protein-protein interaction
  • preferred scanning ammo acids are relatively small, neutral ammo acids
  • ammo acids include alanine, glycine, senne, and cysteine Alanine is typically a preferred scanning amino acid among this group because it eliminates the side-chain beyond the beta- carbon and is less likely to alter the mam-chain conformation of the variant Alanine is also typically preferred because it is the most common amino acid Further, it is frequently found in both buried and exposed positions (Creighton, The Proteins, (W H Freeman & Co , N Y ), Chothia J Mol Biol , 150 1 (1976)) If alanine substitution does not yield adequate amounts of vanant, an isoste ⁇ c ammo a ⁇ d can be used
  • 24P4C12 variants, analogs or homologs have the distinguishing attribute of having at least one epitope that is "cross reactive" with a 24P4C12 protein having an am o acid sequence of Figure 3
  • ⁇ oss reactive means that an antibody or T cell that specifically binds to a 24P4C12 vanant also specifically binds to a 24P4C12 protein having an ammo acid sequence set forth in Figure 3
  • a polypeptide ceases to be a vanant of a protein shown in Figure 3, when it no longer contains any epitope capable of being recognized by an antibody or T cell that specifically binds to the starting 24P4C12 protein
  • antibodies that recognize proteins bind to epitopes of varying size, and a grouping of the order of about four or five ammo acids, contiguous or not, is regarded as a typical number of am o a ⁇ ds in a minimal epitope See, e g , Nair
  • 24P4C12-related protein va ⁇ ants share 70%, 75%, 80%, 85% or 90% or more similarity with an am o acid sequence of Figure 3, or a fragment thereof
  • Another specific class of 24P4C12 protein vanants or analogs compnses one or more of the 24P4C12 biological motifs descnbed herein or presently known in the art
  • analogs of 24P4C12 fragments that have altered functional (e g immunogenic) properties relative to the starting fragment. It is to be appredated that motifs now or which become part of the art are to be applied to the nucleic or amino acid sequences of Figure 2 or Figure 3.
  • embodiments of the claimed invention include polypeptides containing less than the full amino acid sequence of a 24P4C12 protein shown in Figure 2 or Figure 3.
  • representative embodiments of the invention comprise peptides/proteins having any 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15 or more contiguous amino acids of a 24P4C12 protein shown in Figure 2 or Figure 3.
  • representative embodiments of the invention disclosed herein include polypeptides consisting of about amino acid 1 to about amino acid 10 of a 24P4C12 protein shown in Figure 2 or Figure 3, polypeptides consisting of about amino acid 10 to about amino acid 20 of a 24P4C12 protein shown in Figure 2 or Figure 3, polypeptides consisting of about amino acid 20 to about amino acid 30 of a 24P4C12 protein shown in Figure 2 or Figure 3, polypeptides consisting of about amino acid 30 to about amino acid 40 of a 24P4C12 protein shown in Figure 2 or Figure 3, polypeptides consisting of about amino acid 40 to about amino acid 50 of a 24P4C12 protein shown in Figure 2 or Figure 3, polypeptides consisting of about amino acid 50 to about amino acid 60 of a 24P4C12 protein shown in Figure 2 or Figure 3, polypeptides consisting of about amino add 60 to about amino acid 70 of a 24P4C12 protein shown in Figure 2 or Figure 3, polypeptides consisting of about amino acid 70 to about amino acid 80 of
  • polypeptides consisting of about amino acid 1 (or 20 or 30 or 40 etc.) to about amino acid 20, (or 130, or 140 or 150 etc.) of a 24P4C12 protein shown in Figure 2 or Figure 3 are embodiments of the invention. It is to be appreciated that the starting and stopping positions in this paragraph refer to the specified position as well as that position plus or minus 5 residues.
  • 24P4C12-related proteins are generated using standard peptide synthesis technology or using chemical deavage methods well known in the art. Altematively, recombinant methods can be used to generate nudeic add molecules that encode a 24P4C12-related protein. In one embodiment, nudeic add molecules provide a means to generate defined fragments of a 24P4C12 protein (or variants, homologs or analogs thereof).
  • Additional illustrative embodiments of the invention disclosed herein include 24P4C12 polypeptides comprising the amino acid residues of one or more of the biological motifs contained within a 24P4C12 polypeptide sequence set forth in Figure 2 or Figure 3.
  • motifs are known in the art, and a protein can be evaluated for the presence of such motifs by a number of publicly available Internet sites (see, e.g., URL addresses: pfam.wustl.edu/; searchlauncher.bcm.tmc.edu/seq- search/struc-predicthtml; psort.ims.u-tokyo.ac.jp/; cbs.dtu.dk/; ebi.ac.uk/interpro/scan.html; expasy.ch/tools/scnpsitl.html; EpimatrixTMand EpimerTM, Brown University, brown.edu/Research/TB-HIVJ-ab/epimatri
  • Motif bearing subsequences of all 24P4C12 variant proteins are set forth and identified in Tables VIII-XXI and XXII- XLIX.
  • Table V sets forth several frequently occurring motifs based on pfam searches (see URL address pfam.wustl.edu/). The columns of Table V list (1) motif name abbreviation, (2) percent identity found amongst the different member of the motif family, (3) motif name or description and (4) most common function; location information is included if the motif is relevant for location.
  • Polypeptides comprising one or more of the 24P4C12 motifs discussed above are useful in elucidating the specific characteristics of a malignant phenotype in view of the observation that the 24P4C12 motifs discussed above are associated with growth dysregulation and because 24P4C12 is overexpressed in certain cancers (See, e.g., Table I).
  • Casein kinase II, cAMP and camp-dependent protein kinase, and Protein Kinase C are enzymes known to be associated with the development of the malignant phenotype (see e.g.
  • Amidation is another protein modification also associated with cancer and cancer progression (see e.g. Treston et al., J. Natl. Cancer Inst. Monogr. (13): 169-175 (1992)).
  • proteins of the invention comprise one or more of the immunoreactive epitopes identified in accordance with art-accepted methods, such as the peptides set forth in Tables VIII-XXI and XXII-XLIX.
  • CTL epitopes can be determined using specific algorithms to identify peptides within a 24P4C12 protein that are capable of optimally binding to spedfied HLA alleles (e.g., Table IV; EpimatrixTM and EpimerTM, Brown University, URL brown.edu/Research/TB- HIV_Lab/epimatrix/epimatrix.htrnl; and BIMAS, URL bimas.dcrtnih.gov/.)
  • processes for identifying peptides that have sufficient binding affinity for HLA molecules and which are correlated with being immunogenic epitopes are well known in the art, and are carried out without undue experimentation.
  • epitopes in order to modulate immunogenicity. For example, one begins with an epitope that bears a CTL or HTL motif (see, e.g., the HLA Class I and HLA Class II motifs/ supermotifs of Table IV).
  • the epitope is analoged by substituting out an amino acid at one of the specified positions, and replacing it with another amino acid specified for that position.
  • residues defined in Table IV one can substitute out a deleterious residue in favor of any other residue, such as a prefened residue; substitute a less- preferred residue with a preferred residue; or substitute an originally-occurring preferred residue with another preferred residue. Substitutions can occur at primary anchor positions or at other positions in a peptide; see, e.g., Table IV.
  • Related embodiments of the invention indude polypeptides comprising combinations of the different motifs set forth in Table VI, and/or, one or more of the predicted CTL epitopes of Tables VIII-XXI and XXII-XLIX, and/or, one or more of the predicted HTL epitopes of Tables XLVI-XLIX, and/or, one or more of the T cell binding motifs known in the art Preferred embodiments contain no insertions, deletions or substitutions either within the motifs or within the intervening sequences of the polypeptides.
  • embodiments which include a number of either N-terminal and/or C-terminal amino acid residues on either side of these motifs may be desirable (to, for example, include a greater portion of the polypeptide architecture in which the motif is located).
  • the number of N-terminal and/or C-terminal amino add residues on either side of a motif is between about 1 to about 100 amino acid residues, preferably 5 to about 50 amino add residues.
  • 24P4C12-related proteins are embodied in many forms, preferably in isolated form.
  • a purified 24P4C12 protein molecule will be substantially free of other proteins or molecules that impair the binding of 24P4C12 to antibody, T cell or other ligand. The nature and degree of isolation and purification will depend on the intended use.
  • Embodiments of a 24P4C12- related proteins include purified 24P4C12-related proteins and functional, soluble 24P4C12-related proteins.
  • a functional, soluble 24P4C12 protein or fragment thereof retains the ability to be bound by antibody, T cell or other ligand.
  • the invention also provides 24P4C12 proteins comprising biologically active fragments of a 24P4C12 amino acid sequence shown in Figure 2 or Figure 3.
  • Such proteins exhibit properties of the starting 24P4C12 protein, such as the ability to elicit the generation of antibodies that specifically bind an epitope assodated with the starting 24P4C12 protein; to be bound by such antibodies; to elicit the activation of HTL or CTL; and/or, to be recognized by HTL or CTL that also specifically bind to the starting protein.
  • 24P4C12-related polypeptides that contain particularly interesting structures can be predided and/or identified using various analytical techniques well known in the art, induding, for example, the methods of Chou-Fasman, Gamier-Robson, Kyte- Doolittle, Eisenberg, Karplus-Schultz or Jameson-Wolf analysis, or based on immunogenicity. Fragments that contain such structures are particularly useful in generating subunit-spedfic anti-24P4C12 antibodies ⁇ T cells or in identifying cellular factors that bind to 24P4C12. For example, hydrophilicity profiles can be generated, and immunogenic peptide fragments identified, using the method of Hopp, T.P. and Woods, K.R., 1981 , Proc.
  • Hydropathicity profiles can be generated, and immunogenic peptide fragments identified, using the method of Kyte, J. and Doolittle, R.F., 1982, J. Mol. Biol. 157:105-132. Percent (%) Accessible Residues profiles can be generated, and immunogenic peptide fragments identified, using the method of Janin J., 1979, Nature 277:491492. Average Flexibility profiles can be generated, and immunogenic peptide fragments identified, using the method of Bhaskaran R., Ponnuswamy P.K., 1988, Int. J. Pept. Protein Res. 32:242-255. Beta-turn profiles can be generated, and immunogenic peptide fragments identified, using the method of Deleage, G. , Roux B thread 1987, Protein Engineering 1 :289-294.
  • CTL epitopes can be determined using specific algorithms to identify peptides within a 24P4C12 protein that are capable of optimally binding to specified HLA alleles (e.g., by using the SYFPEITHI site at World Wide Web URL syfpeithi.bmi- heidelberg.com/; the listings in Table IV(A)-(E); EpimatrixTM and EpimerTM, Brown University, URL (brown.edu/Research/TB- HIV_Lab.epima1rix/epimatrix.html); and BIMAS, URL bimas.dcrt.nih.gov/).
  • peptide epitopes from 24P4C12 that are presented in the context of human MHC Class I molecules, e.g., HLA-A1, A2, A3, A11, A24, B7 and B35 were predicted (see, e.g., Tables VIII-XXI, XXII-XLIX).
  • the complete amino acid sequence of the 24P4C12 protein and relevant portions of other variants i.e., for HLA Class I predictions 9 flanking residues on either side of a point mutation or exon juction, and for HLA Class II predictions 14 flanking residues on either side of a point mutation or exon junction corresponding to that variant, were entered into the HLA Peptide Motif Search algorithm found in the Bioinformatics and Molecular Analysis Section (BIMAS) web site listed above; in addition to the site SYFPEITHI, at URL syfpeithi.bmi- heidelberg.com/.
  • BIMAS Bioinformatics and Molecular Analysis Section
  • HLA peptide motif search algorithm was developed by Dr. Ken Parker based on binding of specific peptide sequences in the groove of HLA Class I molecules, in particular HLA-A2 (see, e.g., Falk ef al., Nature 351: 290-6 (1991); Hunt ⁇ f al., Science 255:1261-3 (1992); Parker et al., J. Immunol. 149:3580-7 (1992); Parker ef a/., J. Immunol. 152:163-75 (1994)).
  • This algorithm allows location and ranking of 8-mer, 9-mer, and 10-mer peptides from a complete protein sequence for predicted binding to HLA-A2 as well as numerous other HLA Class I molecules.
  • HLAsie I binding peptides are 8-, 9-, 10 or 11-mers.
  • the epitopes preferably contain a leudne (L) or methionine (M) at position 2 and a valine (V) or leucine (L) at the C-terminus (see, e.g., Parker et al., J. Immunol. 149:3580-7 (1992)).
  • Selected results of 24P4C12 predicted binding peptides are shown in Tables VIII-XXI and XXII-XLIX herein.
  • Tables VIII- XXI and XXII-XLVII selected candidates, 9-mers and 10-mers, for each family member are shown along with their location, the amino add sequence of each spe fic peptide, and an estimated binding score.
  • Tables XLVI-XLIX selected candidates, 15-mers, for each family member are shown along with their location, the ammo acid sequence of each specific peptide and an estimated binding score The binding score corresponds to the estimated half time of dissociation of complexes containing the peptide at 37°C at pH 65 Peptides with the highest binding score are predicted to be the most tightly bound to HLA Class I on the cell surface for the greatest period of time and thus represent the best immunogenic targets for T-cell recognition
  • 24P4C12 can be conveniently expressed in cells (such as 293T cells) transfected with a commercially available expression vector such as a CMV-d ⁇ ven expression vector encoding 24P4C12 with a C-terminal 6XH ⁇ s and MYC tag (pcDNA3 1/mycHIS, Invitrogen or Tag5, GenHunter Corporation, Nashville TN)
  • the Tag5 vector provides an IgGK secretion signal that can be used to facilitate the production of a secreted 24P4C12 protein in transfected cells
  • the secreted HIS-tagged 24P4C12 in the culture media can be purified, e g , using a nickel column using standard techniques
  • 24P4C12-related proteins such as covalent modifications are included within the scope of this invention
  • One type of covalent modification includes reacting targeted ammo acid residues of a 24P4C12 polypeptide with an organic de ⁇ vatizing agent that is capable of reacting with selected side chains or the N- or C- terminal residues of a 24P4C12 protein
  • Another type of covalent modification of a 24P4C12 polypeptide included within the scope of this invention comprises alte ⁇ ng the native glycosylation pattern of a protein of the invention
  • Another type of covalent modification of 24P4C12 comprises linking a 24P4C12 polypeptide to one of a variety of nonproteinaceous polymers, e g , polyethylene glycol (PEG), polypropylene glycol, or polyoxyalkylenes, in the manner set forth in U S Patent Nos 4,640,835 4,496,689, 4,301,144, 4,670,417, 4,791,192 or 4,179337
  • the 24P4C12-related proteins of the present invention can also be modified to form a chimenc molecule compnsing 24P4C12 fused to another, heterologous polypeptide or am o a ⁇ d sequence
  • a chimenc molecule can be synthesized chemically or r ecombinantJy
  • a chimenc molecule can have a protein of the invention fused to another tumor- asso ⁇ ated antigen or fragment thereof
  • a protein in accordance with the invention can comp ⁇ se a fusion of fragments of a 24P4C12 sequence (ammo or nucleic a ⁇ d) such that a molecule is ⁇ eated that is not, through its length, directly homologous to the ammo or nucleic acid sequences shown in Figure 2 or Figure 3
  • Such a chimenc molecule can comprise multiples of the same subsequence of 24P4C12
  • a chimenc molecule can comprise a fusion of a 24P4C
  • the epitope tag is generally placed at the amino- or carboxyl- terminus of a 24P4C12 protein.
  • the chimeric molecule can comprise a fusion of a 24P4C12-related protein with an immunoglobulin or a particular region of an immunoglobulin.
  • an immunoglobulin also referred to as an "immunoadhesin”
  • a fusion could be to the Fc region of an IgG molecule.
  • the Ig fusions preferably include the substitution of a soluble (transmembrane domain deleted or inactivated) form of a 24P4C12 polypeptide in place of at least one variable region within an Ig molecule.
  • the immunoglobulin fusion includes the hinge, CH2 and CH3, or the hinge, CH I, CH2 and CH3 regions of an IgGI molecule.
  • immunoglobulin fusions see, e.g., U.S. Patent No. 5,428,130 issued June 27, 1995.
  • the proteins of the invention have a number of different specific uses.
  • 24P4C12 is highly expressed in prostate and other cancers
  • 24P4C12-related proteins are used in methods that assess the status of 24P4C12 gene products in normal versus cancerous tissues, thereby elucidating the malignant phenotype.
  • polypeptides from specific regions of a 24P4C12 protein are used to assess the presence of perturbations (such as deletions, insertions, point mutations etc.) in those regions (such as regions containing one or more motifs).
  • Exemplary assays utilize antibodies or T cells targeting 24P4C12-related proteins comprising the amino acid residues of one or more of the biological motifs contained within a 24P4C12 polypeptide sequence in order to evaluate the characteristics of this region in normal versus cancerous tissues or to elicit an immune response to the epitope.
  • 24P4C12-related proteins that contain the amino acid residues of one or more of the biological motifs in a 24P4C12 protein are used to screen for factors that interact with that region of 24P4C12.
  • 24P4C12 protein fragments/subsequences are particularly useful in generating and characterizing domain-specific antibodies (e.g., antibodies recognizing an exfracellular or intracellular epitope of a 24P4C12 protein), for identifying agents or cellular fadors that bind to 24P4C12 or a particular structural domain thereof, and in various therapeutic and diagnostic contexts, induding but not limited to diagnostic assays, cancer vacdnes and methods of preparing such vaccines.
  • domain-specific antibodies e.g., antibodies recognizing an exfracellular or intracellular epitope of a 24P4C12 protein
  • Proteins encoded by the 24P4C12 genes have a variety of uses, including but not limited to generating antibodies and in methods for identifying ligands and other agents and cellular constituents that bind to a 24P4C12 gene product
  • Antibodies raised against a 24P4C12 protein or fragment thereof are useful in diagnostic and prognostic assays, and imaging methodologies in the management of human cancers characterized by expression of 24P4C12 protein, such as those listed in Table I.
  • Such antibodies can be expressed intracellularly and used in methods of treating patients with such cancers.
  • 24P4C12-related nudeic acids or proteins are also used in generating HTL or CTL responses.
  • Various immunological assays useful for the detection of 24P4C12 proteins are used, induding but not limited to various types of radioimmunoassays, enzyme-linked immunosorbent assays (ELISA), enzyme-linked immunofluorescent assays (EL1FA), immunocytochemical methods, and the like.
  • Antibodies can be labeled and used as immunological imaging reagents capable of detecting 24P4C12-expressing cells (e.g., in radiosdntigraphic imaging melhods).
  • 24P4C12 proteins are also particularly useful in generating cancer vacdnes, as further described herein.
  • Another aspect of the invention provides antibodies that bind to 24P4C12-related proteins.
  • Preferred antibodies spedfically bind to a 24P4C12-related protein and do not bind (or bind weakly) to peptides or proteins that are not 24P4C12- related proteins.
  • antibodies that bind 24P4C12 can bind 24P4C12-related proteins such as Ihe homologs or analogs thereof.
  • 24P4C12 antibodies of the invention are particularly useful in cancer (see, e.g., Table I) diagnostic and prognostic assays, and imaging methodologies.
  • antibodies are useful in the treatment, diagnosis, and/or prognosis of other cancers, to the extent 24P4C12 is also expressed or overexpressed in these other cancers.
  • intracellularly expressed antibodies e.g., single chain antibodies
  • the invention also provides various immunological assays useful for the detection and quantification of 24P4C12 and mutant 24P4C12-related proteins.
  • Such assays can comprise one or more 24P4C12 antibodies capable of recognizing and binding a 24P4C12-related protein, as appropriate.
  • These assays are performed within various immunological assay formats well known in the art, induding but not limited to various types of radioimmunoassays, enzyme-linked immunosorbent assays (ELISA), enzyme-linked immunofiuor escent assays (ELIFA), and the like.
  • Immunological non-antibody assays of the invention also comprise T cell immunogenicity assays (inhibitory or stimulatory) as well as major histocompatibility complex (MHC) binding assays.
  • T cell immunogenicity assays inhibitory or stimulatory
  • MHC major histocompatibility complex
  • immunological imaging methods capable of detecting prostate cancer and other cancers expressing 24P4C12 are also provided by the invention, induding but not limited to radiosdntigraphic imaging methods using labeled 24P4C12 antibodies. Such assays are dinically useful in the detection, monitoring, and prognosis of 24P4C12 expressing cancers such as prostate cancer.
  • 24P4C12 antibodies are also used in methods for purifying a 24P4C12-related protein and for isolating 24P4C12 homologues and related molecules.
  • a method of purifying a 24P4C12-related protein comprises incubating a 24P4C12 antibody, which has been coupled to a solid matrix, with a lysate or other solution containing a 24P4C12-related protein under conditions that permit the 24P4C12 antibody to bind to the 24P4C12-related protein; washing the solid matrix to eliminate impurities; and eluting the 24P4C12-related protein from the coupled antibody.
  • Other uses of 24P4C12 antibodies in accordance with the invention include generating anti-idiotypic antibodies that mimic a 24P4C12 protein.
  • antibodies can be prepared by immunizing a suitable mammalian host using a 24P4C12-related protein, peptide, or fragment, in isolated or immunoconjugated form (Antibodies: A Laboratory Manual, CSH Press, Eds., Harlow, and Lane (1988); Harlow, Antibodies, Cold Spring Harbor Press, NY (1989)).
  • fusion proteins of 24P4C12 can also be used, such as a 24P4C12 GST-fusion protein .
  • a GST fusion protein comprising all or most of the amino add sequence of Figure 2 or Figure 3 is produced, then used as an immunogen to generate appropriate antibodies.
  • a 24P4C12-related protein is synthesized and used as an immunogen.
  • naked DNA immunization techniques known in the art are used (with OT without purified 24P4C12-related protein or 24P4C12 expressing cells) to generate an immune response to the encoded immunogen (for review, see Donnelly ef al., 1997, Ann. Rev. Immunol. 15: 617-648).
  • the amino acid sequence of a 24P4C12 protein as shown in Figure 2 or Figure 3 can be analyzed to select specific regions of the 24P4C12 protein for generating antibodies.
  • hydrophobidty and hydrophilidty analyses of a 24P4C12 amino add sequence are used to identify hydrophilic regions in the 24P4C12 structure. Regions of a 24P4C12 protein that show immunogenic structure, as well as other regions and domains, can readily be identified using various other methods known in the art, such as Chou-Fasman, Gamier-Robson, Kyte-Doolittle, Eisenberg, Ka ⁇ lus-Schultz or Jameson-Wolf analysis. Hydrophilidty profiles can be generated using the method of Hopp, T.P.
  • Hydropathicity profiles can be generated using the method of Kyte, J. and Doolittle, R.F., 1982, J. Mol. Biol. 157:105- 132. Percent (%) Accessible Residues profiles can be generated using the method of Janin J., 1979, Nature 277:491 92. Average Flexibility profiles can be generated using the method of Bhaskaran R exert Ponnuswamy P.K., 1988, Int. J. Pept. Protein Res.32:242-255.
  • Beta-turn profiles can be generated using the method of Deleage, G., Roux B., 1987, Protein Engineering 1 :289-294. Thus, each region identified by any of these programs or methods is within the scope of the present invention. Methods for the generation of 24P4C12 antibodies are further illustrated by way of the examples provided herein. Methods for preparing a protein or polypeptide for use as an immunogen are well known in the art. Also well known in the art are methods for preparing immunogenic conjugates of a protein with a carrier, such as BSA, KLH or other carrier protein.
  • 24P4C12 monodonal antibodies can be produced by various means well known in the art.
  • immortalized cell lines that se ⁇ ete a desired monodonal antibody are prepared using the standard hybridoma technology of Kohler and Milstein or modifications that immortalize antibody-producing B cells, as is generally known.
  • Immortalized cell lines that se ⁇ ete the desired antibodies are s ⁇ eened by immunoassay in which the antigen is a 24P4C12-related protein.
  • the appropriate immortalized cell culture is identified, the cells can be expanded and antibodies produced either from in vitro cultures or from asdtes fluid.
  • the antibodies or fragments of the invention can also be produced, by recombinant means. Regions that bind spedfically to the desired regions of a 24P4C12 protein can also be produced in the context of chimeric or complementarity- determining region (CDR) grafted antibodies of multiple species origin. Humanized or human 24P4C12 antibodies can also be produced, and are preferred for use in therapeutic contexts.
  • CDR complementarity- determining region
  • Fully human 24P4C12 monodonal antibodies can be generated using doning technologies employing large human Ig gene combinatorial libraries (i.e., phage display) (Griffiths and Hoogenboom, Building an in vitro immune system: human antibodies from phage display libraries. In: Protein Engineering of Antibody Molecules for Prophylactic and Therapeutic Applications in Man, Clark, M. (Ed.), Nottingham Academic, pp 45-64 (1993); Burton and Barbas, Human Antibodies from combinatorial libraries. Jd., pp 65-82).
  • Fully human 24P4C12 monoclonal antibodies can also be produced using transgenic mice engineered to contain human immunoglobulin gene lo as described in PCT Patent Application W098/24893, Kucherlapati and Jakobovits etal., published December 3, 1997 (see also, Jakobovits, 1998, Exp. Opin. Invest Drugs 7(4): 607-614; U.S. patents 6,162,963 issued 19 December 2000; 6,150,584 issued 12 November 2000; and, 6,114598 issued 5 September 2000). This method avoids the in vitro manipulation required with phage display technology and efficiently produces high affinity authentic human antibodies.
  • Reactivity of 24P4C12 antibodies with a 24P4C12-related protein can be established by a number of well known means, including Western blot, immunoprecipitation, ELISA, and FACS analyses using, as appropriate, 24P4C12-related proteins, 24P4C12-expressing cells or extracts thereof.
  • a 24P4C12 antibody or fragment thereof can be labeled with a detectable marker or conjugated to a second molecule. Suitable detectable markers include, but are not limited to, a radioisotope, a fluorescent compound, a biolu inescent compound, chemiluminescent compound, a metal chelator or an enzyme.
  • bi-specific antibodies specific for two or more 24P4C12 epitopes are generated using methods generally known in the art.
  • Homodimeric antibodies can also be generated by cross-linking techniques known in the art (e.g., Wolff ef al., Cancer Res. 53: 2560-2565).
  • compositions of the invention induce a therapeutic or prophylactic immune responses in very broad segments of the worldwide population.
  • immunology-related technology For an understanding of the value and efficacy of compositions of the invention that induce cellular immune responses, a brief review of immunology-related technology is provided.
  • a complex of an HLA molecule and a peptidic antigen acts as the ligand recognized by HLA-restricted T cells (Buus, S. ef al., Cell 47:1071, 1986; Babbitt, B. P. ef al., Nature 317:359, 1985; Townsend, A. and Bodmer, H repeatedly Annu. Rev. Immunol. 7:601, 1989; Germain, R. N., Annu. Rev. Immunol. 11:403, 1993).
  • class I and amongstuene-specific HLA binding motifs, or class I or class II supermofjfs allows identification of regions within a protein that are correlated with binding to particular HLA antigen(s).
  • candidates for epitope-based vaccines have been identified; such candidates can be further evaluated by HLA-peptide binding assays to determine binding affinity and/or the time period of association of the epitope and its corresponding HLA molecule. Additional confirmatory work can be performed to select, amongst these vaccine candidates, epitopes with preferred characteristics in terms of population coverage, and/or immunogenicity.
  • HLA transgenic mice see, e.g., Wentworth, P. A. ef a/., J. Immunol. 26:97, 1996; Wentworth, P. A. etal., Int. Immunol. 8:651, 1996; Alexander, J. ef al., J. Immunol. 159:4753, 1997).
  • peptides in incomplete Freund's adjuvant are administered subcutaneously to HLA transgenic mice.
  • splenocytes are removed and cultured in vitro in the presence of test peptide for approximately one week.
  • Peptide-specific T cells are detected using, e.g., a ⁇ Cr-release assay involving peptide sensitized target cells and target cells expressing endogenously generated antigen.
  • recall responses are detected by culturing PBL from subjects that have been exposed to the antigen due to disease and thus have generated an immune response "naturally", or from patients who were vaccinated against the antigen.
  • PBL from subjects are cultured in vitro for 1-2 weeks in the presence of test peptide plus antigen presenting cells (APC) to allow activation of "memory" T cells, as compared to "naive" T cells.
  • APC antigen presenting cells
  • T cell activity is detected using assays including ⁇ Cr release involving peptide-se ⁇ sitized targets, T cell proliferation, or lymphokine release.
  • Nucleic acids that encode a 24P4C12-related protein can also be used to generate either transgenic animals or "knock out" animals that, in turn, are useful in the development and screening of therapeutically useful reagents.
  • cDNA encoding 24P4C12 can be used to clone genomic DNA that encodes 24P4C12. The cloned genomic sequences can then be used to generate transgenic animals containing cells that express DNA that encode 24P4C12. Methods for generating transgenic animals, particularly animals such as mice or rats, have become conventional in the art and are described, for example, in U.S. Patent Nos.4,736,866 issued 12 April 1988, and 4,870,009 issued 26 September 1989. Typically, particular cells would be targeted for 24P4C12 transgene incorporation with tissue-specific enhancers.
  • Transgenic animals that include a copy of a transgene encoding 24P4C12 can be used to examine the effect of increased expression of DNA that encodes 24P4C12. Such animals can be used as tester animals for reagents thought to confer protection from, for example, pathological conditions associated with its overexpression.
  • an animal is treated with a reagent and a reduced incidence of a pathological condition, compared to untreated animals that bear the transgene, would indicate a potential therapeutic intervention for the pathological condition.
  • non-human homologues of 24P4C12 can be used to construct a 24P4C12 "knock out" animal that has a defective or altered gene encoding 24P4C12 as a result of homologous recombination between the endogenous gene encoding 24P4C12 and altered genomic DNA encoding 24P4C12 introduced into an embryonic cell of the animal.
  • cDNA that encodes 24P4C12 can be used to clone genomic DNA encoding 24P4C12 in accordance with established techniques. A portion of the genomic DNA encoding 24P4C12 can be deleted or replaced with another gene, such as a gene encoding a selectable marker that can be used to monitor integration.
  • flanking DNA typically, several kilobases of unaltered flanking DNA (both at the 5' and 3' ends) are included in the vector (see, e.g., Thomas and Capecchi, CeH, 51:503 (1987) for a description of homologous recombination vectors).
  • the vector is introduced into an embryonic stem cell line (e.g., by electroporation) and cells in which the introduced DNA has homologously recombined with the endogenous DNA are selected (see, e.g., Li et al, CeH, 69:915 (1992)).
  • the selected cells are then injected into a blastocyst of an animal (e.g., a mouse or rat) to form aggregation chimeras (see, e.g., Bradley, in Teratocarcinomas and Embryonic Stem Cells: A Practical Approach, E. J. Robertson, ed. (IRL, Oxford, 1987), pp. 113-152).
  • a chimeric embryo can then be implanted into a suitable pseudopregnant female foster animal, and the embryo brought to term to ⁇ eate a "knock out" animal.
  • Progeny harboring the homologously recombined DNA in their germ cells can be identified by standard techniques and used to breed animals in which all cells of the animal contain the homologously recombined DNA. Knock out animals can be characterized, for example, for their ability to defend against certain pathological conditions or for their development of pathological conditions due to absence of a 24P4C12 polypeptide.
  • Another asped of the present invention relates to methods for detecting 24P4C12 polynudeotides and 24P4C12- related proteins, as well as methods for identifying a cell that expresses 24P4C12.
  • the expression profile of 24P4C12 makes it a diagnostic marker for metastasized disease. Accordingly, the status of 24P4C12 gene products provides information useful for predicting a variety of factors induding susceptibility to advanced stage disease, rate of progression, and/or tumor aggressiveness.
  • the status of 24P4C12 gene products in patient samples can be analyzed by a variety protocols that are well known in the art including immunohistochemical analysis, the variety of Northern blotting techniques induding in situ hybridization, RT-PCR analysis (for example on laser capture i ⁇ o-disseded samples), Western blot analysis and tissue array analysis.
  • the invention provides assays for the detection of 24P4C12 polynudeotides in a biological sample, such as serum, bone, prostate, and other tissues, urine, semen, cell preparations, and the like.
  • Detectable 24P4C12 polynucleotides indude, for example, a 24P4C12 gene or fragment thereof, 24P4C12 mRNA, alternative splice variant 24P4C12 mRNAs, and recombinant DNA or RNA molecules that contain a 24P4C12 polynucleotide.
  • a number of methods for amplifying and/or detecting the presence of 24P4C12 polynudeotides are well known in the art and can be employed in the practice of this aspect of the invention.
  • a method for detecting a 24P4C12 mRNA in a biological sample comprises producing cDNA from the sample by reverse transcription using at least one primer; amplifying the cDNA so produced using a 24P4C12 polynucleotides as sense and antisense primers to amplify 24P4C12 cDNAs therein; and detecting the presence of the amplified 24P4C12 cDNA.
  • the sequence of the amplified 24P4C12 cDNA can be determined.
  • a method of detecting a 24P4C12 gene in a biological sample comprises first isolating genomic DNA from the sample; amplifying the isolated genomic DNA using 24P4C12 polynudeotides as sense and antisense primers; and detecting the presence of the amplified 24P4C12 gene.
  • Any number of appropriate sense and antisense probe combinations can be designed from a 24P4C12 nucleotide sequence (see, e.g., Figure 2) and used for this purpose.
  • the invention also provides assays for detecting the presence of a 24P4C12 protein in a tissue or other biological sample such as serum, semen, bone, prostate, urine, cell preparations, and the like.
  • Methods for detecting a 24P4C12-related protein are also well known and indude, for example, immunopredpitation, immunohistochemical analysis, Western blot analysis, molecular binding assays, ELISA, ELIFA and the like.
  • a method of detecting the presence of a 24P4C12-related protein in a biological sample comprises first contacting the sample with a 24P4C12 antibody, a 24P4C12-reactive fragment thereof, or a recombinant protein containing an antigen-binding region of a 24P4C12 antibody; and then detecting the binding of 24P4C12-related protein in the sample.
  • an assay for identifying a cell that expresses a 24P4C12 gene comprises detecting the presence of 24P4C12 mRNA in the cell.
  • an assay for identifying a cell that expresses a 24P4C12 gene comprises detecting the presence of 24P4C12-related protein in the cell or se ⁇ eted by the cell.
  • Various methods for the detection of proteins are well known in the art and are employed for the detection of 24P4C12-related proteins and cells that express 24P4C12-related proteins.
  • 24P4C12 expression analysis is also useful as a tool for identifying and evaluating agents that modulate 24P4C12 gene expression.
  • 24P4C12 expression is significantly upregulated in prostate cancer, and is expressed in cancers of the tissues listed in Table I.
  • Identification of a molecule or biological agent that inhibits 24P4C12 expression or over- expression in cancer cells is of therapeutic value.
  • such an agent can be identified by using a screen that quantifies 24P4C12 expression by RT-PCR, nucleic acid hybridization or antibody binding.
  • Oncogenesis is known to be a multistep process where cellular growth becomes progressively dysregulated and cells progress from a normal physiological state to precancerous and then cancerous states (see, e.g., Alers ef al., Lab Invest.77(5): 437-438 (1997) and Isaacs ef al, Cancer Surv. 23: 19-32 (1995)).
  • examining a biological sample for evidence of dysregulated cell growth allows for early detection of such aberrant physiology, before a pathologic state such as cancer has progressed to a stage that therapeutic options are more limited and or the prognosis is worse.
  • the status of 24P4C12 in a biological sample of interest can be compared, for example, to the status of 24P4C12 in a corresponding normal sample (e.g. a sample from that individual or alternatively another individual that is not affected by a pathology).
  • a corresponding normal sample e.g. a sample from that individual or alternatively another individual that is not affected by a pathology.
  • An alteration in the status of 24P4C12 in the biological sample provides evidence of dysregulated cellular growth.
  • a predetermined normative value such as a predetermined normal level of mRNA expression (see, e.g., Grever et al., J. Comp. Neurol. 1996 Dec 9; 376(2): 306-14 and U.S. Patent No.5,837,501) to compare 24P4C12 status in a sample.
  • status in this context is used according to its art accepted meaning and refers to the condition or state of a gene and its produds.
  • skilled artisans use a number of parameters to evaluate the condition or state of a gene and its products. These indude, but are not limited to the location of expressed gene products (induding the location of 24P4C12 expressing cells) as well as the level, and biological activity of expressed gene products (such as 24P4C12 mRNA, polynucleotides and polypeptides).
  • an alteration in the status of 24P4C12 comprises a change in the location of 24P4C12 and/or 24P4C12 expressing cells and/or an increase in 24P4C12 mRNA and/or protein expression.
  • 24P4C12 status in a sample can be analyzed by a number of means well known in the art, induding without limitation, immunohistochemical analysis, in situ hybridization, RT-PCR analysis on laser capture mi ⁇ c-dissected samples, Western blot analysis, and tissue array analysis.
  • Typical protocols for evaluating the status of a 24P4C12 gene and gene products are found, for example in Ausubel ef al eds., 1995, Current Protocols In Molecular Biology, Units 2 (Northern Blotting), 4 (Southern Blotting), 15 (Immunoblotting) and 18 (PCR Analysis).
  • the status of 24P4C12 in a biological sample is evaluated by various methods utilized by skilled artisans including, but not limited to genomic Southern analysis (to examine, for example perturbations in a 24P4C12 gene), Northern analysis and/or PCR analysis of 24P4C12 mRNA (to examine, for example alterations in the polynucleotide sequences or expression levels of 24P4C12 mRNAs), and, Western and/or immunohistochemical analysis (to examine, for example alterations in polypeptide sequences, alterations in polypeptide localization within a sample, alterations in expression levels of 24P4C12 proteins and/or associations of 24P4C12 proteins with polypeptide binding partners).
  • genomic Southern analysis to examine, for example perturbations in a 24P4C12 gene
  • Northern analysis and/or PCR analysis of 24P4C12 mRNA to examine, for example alterations in the polynucleotide sequences or expression levels of 24P4C12 mRNAs
  • Western and/or immunohistochemical analysis to examine, for
  • Detedable 24P4C12 polynucleotides indude, for example, a 24P4C12 gene or fragment thereof, 24P4C12 mRNA, alternative splice variants, 24P4C12 mRNAs, and recombinant DNA or RNA molecules containing a 24P4C12 polynudeotide.
  • the expression profile of 24P4C12 makes it a diagnostic marker for local and/or metastasized disease, and provides information on the growth or oncogenic potential of a biological sample.
  • the status of 24P4C12 provides information useful for predicting susceptibility to particular disease stages, progression, and/or tumor aggressiveness.
  • the invention provides methods and assays for determining 24P4C12 status and diagnosing cancers that express 24P4C12, such as cancers of the tissues listed in Table I.
  • 24P4C12 mRNA is so highly expressed in prostate and other cancers relative to normal prostate tissue
  • assays that evaluate the levels of 24P4C12 mRNA transcripts or proteins in a biological sample can be used to diagnose a disease assodated with 24P4C12 dysregulation, and can provide prognostic information useful in defining appropriate therapeutic options.
  • the expression status of 24P4C12 provides information induding the presence, stage and location of dysplastic, precancerous and cancerous cells, predicting susceptibility to various stages of disease, and/or for gauging tumor aggressiveness. Moreover, the expression profile makes it useful as an imaging reagent for metastasized disease. Consequently, an aspect of the invention is directed to the various molecular prognostic and diagnostic methods for examining the status of 24P4C12 in biological samples such as those from individuals suffering from, or suspected of suffering from a pathology characterized by dysregulated cellular growth, such as cancer.
  • the status of 24P4C12 in a biological sample can be examined by a number of well-known procedures in the art.
  • the status of 24P4C12 in a biological sample taken from a specific location in the body can be examined by evaluating the sample for the presence or absence of 24P4C12 expressing cells (e.g. those that express 24P4C12 mRNAs or proteins).
  • This examination can provide evidence of dysregulated cellular growth, for example, when 24P4C12-expressing cells are found in a biological sample that does not normally contain such cells (such as a lymph node), because such alterations in the status of 24P4C12 in a biological sample are often associated with dysregulated cellular growth.
  • one indicator of dysregulated cellular growth is the metastases of cancer cells from an organ of origin (such as the prostate) to a different area of the body (such as a lymph node).
  • evidence of dysregulated cellular growth is important for example because occult lymph node metastases can be detected in a substantial proportion of patients with prostate cancer, and such metastases are associated with known predictors of disease progression (see, e.g., Murphy ef al, Prostate 42(4): 315-317 (2000);Su ef al, Semin. Surg. Oncol. 18(1): 17-28 (2000) and Freeman ef al., J Urol 1995 Aug 154(2 Pt 1):474-8).
  • the invention provides methods for monitoring 24P4C12 gene products by determining the status of 24P4C12 gene products expressed by cells from an individual suspected of having a disease assodated with dysregulated cell growth (such as hyperplasia or cancer) and then comparing the status so determined to the status of 24P4C12 gene products in a corresponding normal sample.
  • the presence of aberrant 24P4C12 gene products in the test sample relative to the normal sample provides an indication of the presence of dysregulated cell growth within the cells of the individual.
  • the invention provides assays useful in determining the presence of cancer in an individual, comprising detecting a significant increase in 24P4C12 mRNA or protein expression in a test cell or tissue sample relative to expression levels in the corresponding normal cell or tissue.
  • the presence of 24P4C12 mRNA can, for example, be evaluated in tissues including but not limited to those listed in Table I.
  • the presence of significant 24P4C12 expression in any of these tissues is useful to indicate the emergence, presence and/or severity of a cancer, since the corresponding normal tissues do not express 24P4C12 mRNA or express it at lower levels.
  • 24P4C12 status is determined at the protein level rather than at the nudeic acid level.
  • a method comprises determining the level of 24P4C12 protein expressed by cells in a test tissue sample and comparing the level so determined to the level of 24P4C12 expressed in a corresponding normal sample.
  • the presence of 24P4C12 protein is evaluated, for example, using immunohistochemical methods.
  • 24P4C12 antibodies or binding partners capable of detecting 24P4C12 protein expression are used in a variety of assay formats well known in the art for this purpose.
  • perturbations can indude insertions, deletions, substitutions and the like.
  • Such evaluations are useful because perturbations in the nucleotide and amino add sequences are observed in a large number of proteins associated with a growth dysregulated phenotype (see, e.g. , Marrogi ef al , 1999, J. Cutan. Pathol. 26(8):369-378).
  • a mutation in the sequence of 24P4C12 may be indicative of the presence or promotion of a tumor.
  • Such assays therefore have diagnostic and predictive value where a mutation in 24P4C12 indicates a potential loss of function or increase in tumor growth.
  • nudeotide and amino acid sequences A wide variety of assays for observing perturbations in nudeotide and amino acid sequences are well known in the art. For example, the size and structure of nudeic add or amino add sequences of 24P4C12 gene products are observed by the Northern, Southern, Western, PCR and DNA sequen ng protocols discussed herein. In addition, other methods for observing perturbations in nucleotide and amino acid sequences such as single strand conformation polymorphism analysis are well known in the art (see, e.g., U.S. Patent Nos.5,382,510 issued 7 September 1999, and 5,952,170 issued 17 January 1995).
  • methylation status of a 24P4C12 gene in a biological sample. Aberrant demethylation and/or hypermethylation of CpG islands in gene 5' regulatory regions frequently occurs in immortalized and transformed cells, and can result in altered expression of various genes. For example, promoter hypermethylation of the pi-class glutathione S-tr ansferase (a protein expressed in normal prostate but not expressed in >90% of prostate carcinomas) appears to permanently silence transcription of this gene and is the most frequently detected genomic alteration in prostate carcinomas (De Marzo et al, Am. J. Pathol. 155(6): 1985-1992 (1999)).
  • MSP methylation spedfic PCR
  • MSP methylation spedfic PCR
  • This procedure involves initial modification of DNA by sodium bisulfite (which will convert all unmettiylated cytosines to uracil) followed by amplification using primers specific for methylated versus unmettiylated DNA. Protocols involving methylation interference can also be found for example in Cunent Protocols In Molecular Biology, Unit 12, Frederick M. Ausubel etal. eds., 1995.
  • Gene amplification is an additional method for assessing the status of 24P4C12.
  • Gene amplification is measured in a sample directly, for example, by conventional Southern blotting or Northern blotting to quantitate the transcription of mRNA (Thomas, 1980, Proc. Natl. Acad. Sci. USA, 77:5201-5205), dot blotting (DNA analysis), or in situ hybridization, using an appropriately labeled probe, based on the sequences provided herein.
  • antibodies are employed that recognize specific duplexes, including DNA duplexes, RNA duplexes, and DNA-RNA hybrid duplexes or DNA-protein duplexes. The antibodies in turn are labeled and the assay carried out where the duplex is bound to a surface, so that upon the formation of duplex on the surface, the presence of antibody bound to the duplex can be detected.
  • Biopsied tissue or peripheral blood can be conveniently assayed for the presence of cancer cells using for example, Northern, dot blot or RT-PCR analysis to deted 24P4C12 expression.
  • the presence of RT-PCR amplifiable 24P4C12 mRNA provides an indication of the presence of cancer.
  • RT-PCR assays are well known in the art RT-PCR detection assays for tumor cells in peripheral blood are currently being evaluated for use in the diagnosis and management of a number of human solid tumors. In the prostate cancer field, these indude RT-PCR assays for the detection of cells expressing PSA and PSM (Verkaik ef al, 1997, Urol. Res.25:373-384; Ghossein etal, 1995, J. Clin. Oncol. 13:1195-2000; Heston etal, 1995, Clin. Chem.41:1687- 1688).
  • a further aspect of the invention is an assessment of the susceptibility that an individual has for developing cancer.
  • a method for predicting susceptibility to cancer comprises deteding 24P4C12 mRNA or 24P4C12 protein in a tissue sample, its presence indicating susceptibility to cancer, wherein the degree of 24P4C12 mRNA expression correlates to the degree of susceptibility.
  • the presence of 24P4C12 in prostate or other tissue is examined, with the presence of 24P4C12 in the sample providing an indication of prostate cancer susceptibility (or the emergence or existence of a prostate tumor).
  • 24P4C12 nudeotide and amino add sequences in a biological sample in order to identify perturbations in the structure of these molecules such as insertions, deletions, substitutions and the like.
  • the presence of one or more perturbations in 24P4C12 gene products in the sample is an indication of cancer susceptibility (or the emergence or existence of a tumor).
  • the invention also comprises methods for gauging tumor aggressiveness.
  • a method for gauging aggressiveness of a tumor comprises determining the level of 24P4C12 mRNA or 24P4C12 protein expressed by tumor cells, comparing the level so determined to the level of 24P4C12 mRNA or 24P4C12 protein expressed in a corresponding normal tissue taken from the same individual or a normal tissue reference sample, wherein the degree of 24P4C12 mRNA or 24P4C12 protein expression in the tumor sample relative to the normal sample indicates the degree of aggressiveness.
  • aggressiveness of a tumor is evaluated by determining the extent to which 24P4C12 is expressed in the tumor cells, with higher expression levels indicating more aggressive tumors.
  • Another embodiment is the evaluation of the integrity of 24P4C12 nucleotide and amino add sequences in a biological sample, in order to identify perturbations in the structure of these molecules such as insertions, deletions, substitutions and the like. The presence of one or more perturbations indicates more aggressive tumors.
  • methods for observing the progression of a malignancy in an individual over time comprise determining the level of 24P4C12 mRNA or 24P4C12 protein expressed by cells in a sample of the tumor, comparing the level so determined to the level of 24P4C12 mRNA or 24P4C12 protein expressed in an equivalent tissue sample taken from the same individual at a different time, wherein the degree of 24P4C12 mRNA or 24P4C12 protein expression in the tumor sample over time provides information on the progression of the cancer.
  • the progression of a cancer is evaluated by determining 24P4C12 expression in the tumor cells over time, where in ⁇ eased expression overtime indicates a progression of the cancer. Also, one can evaluate the integrity 24P4C12 nudeotide and amino add sequences in a biological sample in order to identify perturbations in the structure of these molecules such as insertions, deletions, substitutions and the like, where the presence of one or more perturbations indicates a progression of the cancer.
  • Another embodiment of the invention is directed to methods for observing a coinddence between the expression of 24P4C12 gene and 24P4C12 gene products (or perturbations in 24P4C12 gene and 24P4C12 gene products) and a factor that is assodated with malignancy, as a means for diagnosing and prognosticating the status of a tissue sample.
  • factors assodated with malignancy can be utilized, such as the expression of genes assodated with malignancy (e.g.
  • Methods for observing a coinddence between the expression of 24P4C12 gene and 24P4C12 gene products (or perturbations in 24P4C12 gene and 24P4C12 gene products) and another factor that is assodated with malignancy are useful, for example, because the presence of a set of specific factors that coindde with disease provides information crudal for diagnosing and prognosticating the status of a tissue sample.
  • methods for observing a coinddence between the expression of 24P4C12 gene and 24P4C12 gene products (or perturbations in 24P4C12 gene and 24P4C12 gene products) and another factor assodated with malignancy entails detecting the overexpression of 24P4C12 mRNA or protein in a tissue sample, detecting the overexpression of PSA mRNA or protein in a tissue sample (or PSCA or PSM expression), and observing a coinddence of 24P4C12 mRNA or protein and PSA mRNA or protein overexpression ( ⁇ PSCA or PSM expression).
  • the expression of 24P4C12 and PSA mRNA in prostate tissue is examined, where the coinddence of 24P4C12 and PSA mRNA overexpression in the sample indicates the existence of prostate cancer, prostate cancer susceptibility or the emergence or status of a prostate tumor.
  • semi- quantitative RT-PCR is used to detect and quantify 24P4C12 mRNA expression.
  • primers capable of amplifying 24P4C12 can be used for this purpose, including but not limited to the various primer sets spedfically described herein.
  • polydonal or monodonal antibodies spedfically reactive with the wild-type 24P4C12 protein can be used in an immunohistochemical assay of biopsied tissue.
  • the 24P4C12 protein and nucleic add sequences disclosed herein allow a skilled artisan to identify proteins, small molecules and other agents that interact with 24P4C12, as well as pathways activated by 24P4C12 via any one of a variety of art accepted protocols.
  • one can utilize one of the so-called interaction trap systems also referred to as the "two-hybrid assay".
  • molecules interact and reconstitute a transcription factor which directs expression of a reporter gene, whereupon the expression of the reporter gene is assayed.
  • Other systems identify protein-protein interactions in vivo through reconstitution of a eukaryotic transcriptional activator, see, e.g., U.S.
  • Algorithms are also available in the art for genome-based predictions of protein function (see, e.g., Marcotte, ef al, Nature 402: 4 November 1999, 83-86).
  • peptide libraries can be screen peptide libraries to identify molecules that interact with 24P4C12 protein sequences.
  • peptides that bind to 24P4C12 are identified by s ⁇ eening libraries that encode a random or controlled collection of amino adds.
  • Peptides encoded by the libraries are expressed as fusion proteins of bacteriophage coat proteins, the bacteriophage particles are then screened against the 24P4C12 protein(s).
  • peptides having a wide variety of uses are thus identified without any prior information on the structure of the expected ligand or receptor molecule.
  • Typical peptide libraries and screening methods that can be used to identify molecules that interact with 24P4C12 protein sequences are disclosed for example in U.S. Patent Nos. 5,723,286 issued 3 March 1998 and 5,733,731 issued 31 March 1998.
  • 24P4C12 is used to identify protein-protein interactions mediated by 24P4C12. Such interactions can be examined using immunoprecipitation techniques (see, e.g., Hamilton B.J., et al. Biochem. Biophys. Res. Commun. 1999, 261:646-51).
  • 24P4C12 protein can be immunoprecipitated from 24P4C12- expressing cell lines using anti-24P4C12 antibodies.
  • antibodies against His-tag can be used in a cell line engineered to express fusions of 24P4C12 and a His-tag (vectors mentioned above).
  • the immunopredpitated complex can be examined for protein association by procedures such as Western blotting, ⁇ S-methionine labeling of proteins, protein microsequencing, silver staining and two-dimensional gel electrophoresis.
  • Small molecules and ligands that interact with 24P4C12 can be identified through related embodiments of such screening assays. For example, small molecules can be identified that interfere with protein function, including molecules that interfere with 24P4C12's ability to mediate phosphorylation and de-phosphorylation, interaction with DNA or RNA molecules as an indication of regulation of cell cycles, second messenger signaling or tumorigenesis.
  • small molecules that modulate 24P4C12-related ion channel, protein pump, or cell communication functions are identified and used to treat patients that have a cancer that expresses 24P4C12 (see, e.g., Hille, B., Ionic Channels of Excitable Membranes 2 nd Ed., Sinauer Assoc, Sunderiand, MA, 1992).
  • ligands that regulate 24P4C12 function can be identified based on their ability to bind 24P4C12 and activate a reporter construct. Typical methods are discussed for example in U.S. Patent No. 5,928,868 issued 27 July 1999, and include methods for forming hybrid ligands in which at least one ligand is a small molecule.
  • cells engineered to express a fusion protein of 24P4C12 and a DNA-binding protein are used to co-express a fusion protein of a hybrid ligand/small molecule and a cDNA library transcriptional activator protein.
  • the cells further contain a reporter gene, the expression of which is conditioned on the proximity of the first and second fusion proteins to each other, an event that occurs only if the hybrid ligand binds to target sites on both hybrid proteins.
  • Those cells that express the reporter gene are selected and the unknown small molecule or the unknown ligand is identified. This method provides a means of identifying modulators, which activate or inhibit 24P4C12.
  • An embodiment of this invention comprises a method of s ⁇ eening for a molecule that interacts with a 24P4C12 amino add sequence shown in Figure 2 or Figure 3, comprising the steps of contacting a population of molecules with a 24P4C12 amino acid sequence, allowing the population of molecules and the 24P4C12 amino acid sequence to interact under conditions that facilitate an interaction, determining the presence of a molecule that interacts with the 24P4C12 amino add sequence, and then separating molecules that do not interact with the 24P4C12 amino acid sequence from molecules that do.
  • the method further comprises purifying, characterizing and identifying a molecule that interacts with the 24P4C12 amino acid sequence. The identified molecule can be used to modulate a function performed by 24P4C12.
  • the 24P4C12 amino acid sequence is contacted with a library of peptides.
  • 24P4C12 functions as a transcription factor involved in activating tumor-promoting genes or repressing genes that block tumorigenesis.
  • therapeutic approaches that inhibit the activity of a 24P4C12 protein are useful for patients suffering from a cancer that expresses 24P4C12. These therapeutic approaches generally fall into two stones.
  • One class comprises various methods for inhibiting the binding or association of a 24P4C12 protein with its binding partner or with other proteins.
  • Another class comprises a variety of methods for inhibiting the transcription of a 24P4C12 gene or translation of 24P4C12 mRNA.
  • the invention provides cancer vacdnes comprising a 24P4C12-related protein or 24P4C12-related nucleic add.
  • cancer vacdnes prevent and/or treat 24P4C12-expressing cancers with minimal or no effects on non-target tissues.
  • the use of a tumor antigen in a vacdne that generates humoral and/or cell-mediated immune responses as anti-cancer therapy is well known in the art and has been employed in prostate cancer using human PSMA and rodent PAP immunogens (Hodge ef al, 1995, Int. J. Cancer 63:231-237; Fong ef a/., 1997, J. Immunol. 159:3113-3117).
  • Such methods can be readily practiced by employing a 24P4C12-related protein, or a 24P4C12-encoding nucleic acid molecule and recombinant vectors capable of expressing and presenting the 24P4C12 immunogen (which typically comprises a number of antibody or T cell epitopes)
  • Skilled artisans understand that a wide variety of vac ne systems for delivery of immunoreactive epitopes are known in the art (see, e.g., Heryln et a/., Ann Med 1999 Feb 31(1):66-78; Maruyama ef al, Cancer Immunol Immunother 2000 Jun 49(3):123-32) Briefly, such methods of generating an immune response (e.g.
  • a mammal's immune system comprises the steps of: exposing the mammal's immune system to an immunoreactive epitope (e.g. an epitope present in a 24P4C12 protein shown in Figure 3 or analog or homolog thereof) so that the mammal generates an immune response that is specific for that epitope (e.g. generates antibodies that specifically recognize that epitope).
  • an immunoreactive epitope e.g. an epitope present in a 24P4C12 protein shown in Figure 3 or analog or homolog thereof
  • an immunoreactive epitope e.g. an epitope present in a 24P4C12 protein shown in Figure 3 or analog or homolog thereof
  • an immunoreactive epitope e.g. an epitope present in a 24P4C12 protein shown in Figure 3 or analog or homolog thereof
  • an immune response that is specific for that epitope (e.g. generates antibodies that specifically recognize that epitope).
  • a 24P4C12 immunogen contains a
  • Such vaccine compositions can include, for example, lipopeptides (e.g. , itiello, A. ef al, J. Clin. Invest. 95:341, 1995), peptide compositions encapsulated in poly(DL-lactide-co-glycolide) ("PLG”) microspheres (see, e.g., Eldridge, ef al, Molec. Immunol.
  • lipopeptides e.g. , itiello, A. ef al, J. Clin. Invest. 95:341, 1995
  • PLG poly(DL-lactide-co-glycolide)
  • Toxin-targeted delivery technologies also known as receptor mediated targeting, such as those of Avant Immunotherapeutics, Inc. (Needham, Massachusetts) may also be used.
  • the vaccine compositions of the invention can also be used in conjunction with other treatments used for cancer, e.g., surgery, chemotherapy, drug therapies, radiation therapies, efc. including use in combination with immune adjuvants such as IL-2, IL-12, GM-CSF, and the like.
  • CTL epitopes can be determined using specific algorithms to identify peptides within 24P4C12 protein that bind corresponding HLA alleles (see e.g., Table IV; EpimerTM and EpimatrixTM, Brown University (URL brown.edu/Research/TB- HIV_Lab/epimatrix/epimatrix.html); and, BIMAS, (URL bimas.dcrtnih.gov/; SYFPEITHI at URL syfj-eithi.bmi-heidelberg.com.).
  • a 24P4C12 immunogen contains one or more amino acid sequences identified using techniques well known in the art, such as the sequences shown in Tables VIII-XXI and XXII-XLIX or a peptide of 8, 9, 10 or 11 amino acids specified by an HLA Class I moti f/supermotif (e.g., Table IV (A), Table IV (D), or Table IV (E)) and/or a peptide of at least 9 amino acids that comprises an HLA Class II motif/supermotif (e.g., Table IV (B) or Table IV (C)).
  • HLA Class I moti f/supermotif e.g., Table IV (A), Table IV (D), or Table IV (E)
  • HLA Class II motif/supermotif e.g., Table IV (B) or Table IV (C)
  • the HLA Class I binding groove is essentially closed ended so that peptides of only a particular size range can fit into the groove and be bound, generally HLA Class I epitopes are 8, 9, 10, or 11 amino acids long.
  • the HLA Class II binding groove is essentially open ended; therefore a peptide of about 9 or more amino acids can be bound by an HLA Class II molecule. Due to the binding groove differences between HLA Class I and II, HLA Class I motifs are length specific, i.e., position two of a Class I motif is the second amino acid in an amino to carboxyl direction of the peptide.
  • HLA Class II epitopes are often 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 amino acids long, or longer than 25 amino acids.
  • Methods of generating an immune response in a mammal comprise exposing the mammal's immune system to an immunogenic epitope on a protein (e.g. a 24P4C12 protein) so that an immune response is generated.
  • a protein e.g. a 24P4C12 protein
  • a typical embodiment consists of a method for generating an immune response to 24P4C12 in a host, by contacting the host with a sufficient amount of at least one 24P4C12 B cell or cytotoxic T-cell epitope or analog thereof; and at least one periodic interval thereafter re-contacting the host with the 24P4C12 B cell or cytotoxic T-cell epitope or analog thereof.
  • a specific embodiment consists of a method of generating an immune response against a 24P4C12- related protein or a man-made multiepitopic peptide comprising: administering 24P4C12 immunogen (e.g. a 24P4C12 protein or a peptide fragment thereof, a 24P4C12 fusion protein or analog etc.) in a vaccine preparation to a human or another mammal.
  • 24P4C12 immunogen e.g. a 24P4C12 protein or a peptide fragment thereof, a 24P4C12 fusion protein or analog etc.
  • a suitable adjuvant see, e.g., U.S. Patent No. 6,146,635
  • a universal helper epitope such as a PADRETM peptide (Epimmune Inc., San Diego, CA; see, e.g., Alexander ef al, J.
  • An alternative method comprises generating an immune response in an individual against a 24P4C12 immunogen by: administering in vivo to muscle or skin of the individual's body a DNA molecule that comprises a DNA sequence that encodes a 24P4C12 immunogen, the DNA sequence operatively linked to regulatory sequences which control the expression of the DNA sequence; wherein the DNA molecule is taken up by cells, the DNA sequence is expressed in the cells and an immune response is generated against the immunogen (see, e.g., U.S. Patent No. 5,962,428).
  • a genetic vaccine facilitator such as anionic lipids; saponins; lectins; estrogenic compounds; hydroxylated lower alkyls; dimethyl sulfoxide; and urea is also administered.
  • an antiidiotypic antibody can be administered that mimics 24P4C12, in order to generate a response to the target antigen.
  • Vaccine compositions of the invention include nucleic add-mediated modalities.
  • DNA or RNA that encode protein(s) of the invention can be administered to a patient.
  • Genetic immunization methods can be employed to generate prophylactic or therapeutic humoral and cellular immune responses directed against cancer cells expressing 24P4C12.
  • Constructs comprising DNA encoding a 24P4C12-related protein/immunogen and appropriate regulatory sequences can be injected directly into muscle or skin of an individual, such that the cells of the muscle or skin take-up the construd and express the encoded 24P4C12 protein/immunogen.
  • a vaccine comprises a 24P4C12-related protein.
  • 24P4C12-related protein immunogen results in the generation of prophylactic or therapeutic humoral and cellular immunity against cells that bear a 24P4C12 protein.
  • Various prophylactic and therapeutic genetic immunization techniques known in the art can be used (for review, see information and references published at Internet address genweb.com). Nudeic acid-based delivery is described, for instance, in Wolff ef. al, Science 247:1465 (1990) as well as U.S. Patent Nos.5,580,859; 5,589,466; 5,804,566; 5,739,118; 5,736,524; 5,679,647; WO 98/04720.
  • DNA-based delivery technologies indude "naked DNA”, facilitated (bupivicaine, polymers, peptide-mediated) delivery, cationic lipid complexes, and particle-mediated (“gene gun") or pressure-mediated delivery (see, e.g., U.S. Patent No. 5,922,687).
  • proteins of the invention can be expressed via viral or bacterial vectors.
  • Non-viral delivery systems can also be employed by introducing naked DNA encoding a 24P4C12-related protein into the patient (e.g., intramuscularly or intradermally) to induce an anti-tumor response.
  • Vaccinia virus is used, for example, as a vector to express nucleotide sequences that encode the peptides of the invention. Upon introduction into a host, the recombinant vaccinia virus expresses the protein immunogenic peptide, and thereby elicits a host immune response.
  • Vaccinia vectors and methods useful in immunization protocols are described in, e.g., U.S. Patent No. 4,722,848.
  • Another vector is BCG (Bacille Calmette Guerin). BCG vectors are described in Stover ef al, Nature 351:456460 (1991).
  • BCG vectors are described in Stover ef al, Nature 351:456460 (1991).
  • a wide variety of other vectors useful for therapeutic administration or immunization of the peptides of the invention e.g. adeno and adeno-associated virus vectors, retroviral vectors, Salmonella typhi vectors, detoxified anthrax to
  • gene delivery systems are used to deliver a 24P4C12-related nudeic add molecule.
  • the full- length human 24P4C12 cDNA is employed.
  • 24P4C12 nudeic acid molecules encoding spedfic cytotoxic T lymphocyte (CTL) and/or antibody epitopes are employed.
  • APCs antigen presenting cells
  • DC dendritic cells
  • DRCs antigen presenting cells
  • DRCs dendritic cells
  • MHC MHC
  • B7 co-stimulator B7 co-stimulator
  • IL-12 IL-12
  • PSMA prostate-specific membrane antigen
  • dendritic cells can be used to present 24P4C12 peptides to T cells in the context of MHC class I or II molecules.
  • autologous dendritic cells are pulsed with 24P4C12 peptides capable of binding to MHC class I and/or class II molecules.
  • dendritic cells are pulsed with the complete 24P4C12 protein.
  • Yet another embodiment involves engineering the overexpression of a 24P4C12 gene in dendritic cells using various implementing vectors known in the art, such as adenovirus (Arthur etal, 1997, Cancer Gene Ther.4:17-25), retrovirus (Henderson ef al, 1996, Cancer Res.
  • Cells that express 24P4C12 can also be engineered to express immune modulators, such as GM- CSF, and used as immunizing agents.
  • 24P4C12 is an attractive target for antibody-based therapeutic strategies.
  • a number of antibody strategies are known in the art for targeting both extracellular and intracellular molecules (see, e.g., complement and ADCC mediated killing as well as the use of intrabodies).
  • 24P4C12 is expressed by cancer cells of various lineages relative to corresponding normal cells, systemic administration of 24P4C12-immunoreactive compositions are prepared that exhibit excellent sensitivity without toxic, non-specific and/or non-target effects caused by binding of the immunoreactive composition to non-target organs and tissues.
  • Antibodies spedfically reactive with domains of 24P4C12 are useful to treat 24P4C12-expressing cancers systemically, either as conjugates with a toxin or therapeutic agent, or as naked antibodies capable of inhibiting cell proliferation or function.
  • 24P4C12 antibodies can be introduced into a patient such that the antibody binds to 24P4C12 and modulates a function, such as an interaction with a binding partner, and consequently mediates destruction of the tumor cells and/or inhibits the growth of the tumor cells.
  • Mechanisms by which such antibodies exert a therapeutic effect can include complement-mediated cytolysis, antibody-dependent cellular cytotoxicity, modulation of the physiological function of 24P4C12, inhibition of ligand binding or signal transduction pathways, modulation of tumor cell differentiation, alteration of tumor angiogenesis factor profiles, and/or apoptosis.
  • antibodies can be used to specifically target and bind immunogenic molecules such as an immunogenic region of a 24P4C12 sequence shown in Figure 2 or Figure 3.
  • cytotoxic agents see, e.g., Slevers ef al. Blood 93:11 3678- 3684 (June 1 , 1999)
  • the cytotoxic agent will exert its known biological effect (i.e. cytotoxicity) on those cells.
  • compositions and methods for using antibody-cytotoxic agent conjugates to kill cells are known in the art.
  • typical methods entail administering to an animal having a tumor a biologically effective amount of a conjugate comprising a selected cytotoxic and/or therapeutic agent linked to a targeting agent (e.g. an anti- 24P4C12 antibody) that binds to a marker (e.g. 24P4C12) expressed, accessible to binding or localized on the cell surfaces.
  • a targeting agent e.g. an anti- 24P4C12 antibody
  • a marker e.g. 24P4C12
  • a typical embodiment is a method of delivering a cytotoxic and/or therapeutic agent to a cell expressing 24P4C12, comprising conjugating the cytotoxic agent to an antibody that immunospecifically binds to a 24P4C12 epitope, and, exposing the cell to the antibody-agent conjugate.
  • Another illustrative embodiment is a method of treating an individual suspected of suffering from metastasized cancer, comprising a step of administering parenterally to said individual a pharmaceutical composition comprising a therapeutically effective amount of an antibody conjugated to a cytotoxic and/or therapeutic agent.
  • Cancer immunotherapy using anti-24P4C12 antibodies can be done in accordance with various approaches that have been successfully employed in the treatment of other types of cancer, including but not limited to colon cancer (Arlen et al, 1998, Crit. Rev. Immunol. 18:133-138), multiple myeloma (Ozaki etal, 1997, Blood 90:3179-3186, Tsunenari etal, 1997, Blood 90:2437-2444), gastric cancer (Kasprzyk etal, 1992, Cancer Res. 52:2771-2776), B-cell lymphoma (Funakoshi etal, 1996, J. Immunother. Emphasis Tumor Immunol.
  • leukemia Zhong etal, 1996, Leuk. Res. 20:581-589
  • colorectal cancer Moun etal, 1994, Cancer Res. 54:6160-6166; Velders et al, 1995, Cancer Res. 55:43984403)
  • breast cancer Shepard etal, 1991, J. Clin. Immunol. 11:117-127.
  • Some therapeutic approaches involve conjugation of naked antibody to a toxin or radioisotope, such as the conjugation of Y 91 or I 131 to anti-CD20 antibodies (e.g., ZevalinTM, IDEC Pharmaceuticals Corp.
  • antibodies and other therapeutic agents such as HerceptinTM (trastuzumab) with paclitaxel (Genentech, Inc.).
  • the antibodies can be conjugated to a therapeutic agent.
  • 24P4C12 antibodies can be administered in conjunction with radiation, chemotherapy or hormone ablation.
  • antibodies can be conjugated to a toxin such as calicheamicin (e.g., MyiotargTM, Wyeth-Ayerst, Madison, NJ, a recombinant humanized IgG.
  • a kappa antibody conjugated to a ⁇ titumor antibiotic calicheamicin or a maytansinoid (e.g., taxane-based Tumor-Activated Prodrug, TAP, platform, ImmunoGen, Cambridge, MA, also see e.g., US Patent 5,416,064).
  • antibody therapy can be particularly appropriate in advanced or metastatic cancers.
  • Treatment with the antibody therapy of the invention is indicated for patients who have received one or more rounds of chemotherapy.
  • antibody therapy of the invention is combined with a chemotherapeutic or radiation regimen for patients who have not received chemotherapeutic treatment.
  • antibody therapy can enable the use of reduced dosages of concomitant chemotherapy, particularly for patients who do not tolerate the toxidty of the chemotherapeutic agent very well.
  • Fan et al. (Cancer Res. 53:46374642, 1993), Prewett et al. (International J. of Onco. 9:217-224, 1996), and Hancock et al. (Cancer Res. 51:45754580, 1991) describe the use of various antibodies together with chemotherapeutic agents.
  • antibody therapy can be particularly appropriate in advanced or metastatic cancers.
  • Treatment with the antibody therapy of the invention is indicated for patients who have received one or more rounds of chemotherapy.
  • antibody therapy of the invention is combined with a chemotherapeutic or radiation regimen for patients who have not received chemotherapeutic treatment.
  • antibody therapy can enable the use of reduced dosages of concomitant chemotherapy, particularly for patients who do not tolerate the toxidty of the chemotherapeutic agent very well.
  • Cancer patients can be evaluated for the presence and level of 24P4C12 expression, preferably using immunohistochemical assessments of tumor tissue, quantitative 24P4C12 imaging, or other techniques that reliably indicate the presence and degree of 24P4C12 expression. Immunohistochemical analysis of tumor biopsies or surgical specimens is preferred for this purpose. Methods for immunohistochemical analysis of tumor tissues are well known in the art.
  • Anti-24P4C12 monoclonal antibodies that treat prostate and other cancers include those that initiate a potent immune response against the tumor or those that are directly cytotoxic.
  • anti-24P4C12 monoclonal antibodies can elicit tumor cell lysis by either complement-mediated or antibody-dependent cell cytotoxicity (ADCC) mechanisms, both of which require an intact Fc portion of the immunoglobulin molecule for interaction with effector cell Fc receptor sites on complement proteins.
  • ADCC antibody-dependent cell cytotoxicity
  • anti-24P4C12 mAbs that exert a direct biological effect on tumor growth are useful to treat cancers that express 24P4C12.
  • Mechanisms by which directly cytotoxic mAbs act include: inhibition of cell growth, modulation of cellular differentiation, modulation of tumor angiogenesis factor profiles, and the induction of apoptosis.
  • the mechanism(s) by which a particular anti-24P4C12 mAb exerts an anti-tumor effect is evaluated using any number of in vitro assays that evaluate cell death such as ADCC, ADMMC, complement-mediated cell lysis, and so forth, as is generally known in the art.
  • preferred monoclonal antibodies used in the therapeutic methods of the invention are those that are either fully human or humanized and that bind specifically to the target 24P4C12 antigen with high affinity but exhibit low or no antigenicity in the patient.
  • Therapeutic methods of the invention contemplate the administration of single anti-24P4C12 mAbs as well as combinations, or cocktails, of different mAbs.
  • Such mAb cocktails can have certain advantages inasmuch as they contain mAbs that target different epitopes, exploit different effector mechanisms or combine directly cytotoxic mAbs with mAbs that rely on immune effector functionality. Such mAbs in combination can exhibit synergistic therapeutic effects.
  • anti- 24P4C12 mAbs can be administered concomitantly with other therapeutic modalities, including but not limited to various chemotherapeutic agents, androgen-blockers, immune modulators (e.g., IL-2, GM-CSF), surgery or radiation.
  • the anti- 24P4C12 mAbs are administered in their "naked" or unconjugated form, or can have a therapeutic agent(s) conjugated to them.
  • Anti-24P4C12 antibody formulations are administered via any route capable of delivering the antibodies to a tumor cell.
  • Routes of administration include, but are not limited to, intravenous, intr aperitoneal, intramuscular, intratumor, intradermal, and the like.
  • Treatment generally involves repeated administration of the anti-24P4C12 antibody preparation, via an acceptable route of administration such as intravenous injection (IV), typically at a dose in the range of about 0.1 , .2, .3, .4, .5, .6, .7, .8, .9., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, or 25 mg/kg body weight.
  • IV intravenous injection
  • doses in the range of 10-1000 mg mAb per week are effective and well tolerated.
  • an initial loading dose of approximately 4 mg/kg patient body weight IV, followed by weekly doses of about 2 mg/kg IV of the anti- 24P4C12 mAb preparation represents an acceptable dosing regimen.
  • the initial loading dose is administered as a 90-minute or longer infusion.
  • the periodic maintenance dose is administered as a 30 minute or longer infusion, provided the initial dose was well tolerated.
  • various factors can influence the ideal dose regimen in a particular case.
  • Such factors include, for example, the binding affinity and half life of the Ab or mAbs used, the degree of 24P4C12 expression in the patient, the extent of circulating shed 24P4C12 antigen, the desired steady-state antibody concentration level, frequency of treatment, and the influence of chemotherapeutic or other agents used in combination with the treatment method of the invention, as well as the health status of a particular patient.
  • patients should be evaluated for the levels of 24P4C12 in a given sample (e.g. the levels of circulating 24P4C12 antigen and/or 24P4C 12 expressing cells) in order to assist in the determination of the most effective dosing regimen, etc.
  • levels of 24P4C12 in a given sample e.g. the levels of circulating 24P4C12 antigen and/or 24P4C 12 expressing cells
  • Such evaluations are also used for monitoring purposes throughout therapy, and are useful to gauge therapeutic success in combination with the evaluation of other parameters (for example, urine cytology and/or ImmunoCyt levels in bladder cancer therapy, or by analogy, serum PSA levels in prostate cancer therapy).
  • Anti-idiotypic anti-24P4C12 antibodies can also be used in anti-cancer therapy as a vaccine for indudng an immune response to cells expressing a 24P4C12-related protein.
  • the generation of anti-idiotypic antibodies is well known in the art; this methodology can readily be adapted to generate anti-idiotypic anti-24P4C12 antibodies that mimic an epitope on a 24P4C12-related protein (see, for example, Wagner etal., 1997, Hybridoma 16: 3340; Foon ef a/., 1995, J. Clin. Invest.96:334-342; Herlyn ef a/., 1996, Cancer Immunol. I munother.43:65-76).
  • Such an anti-idiotypic antibody can be used in cancer vaccine strategies.
  • Vaccines and methods of preparing vaccines that contain an immunogenically effective amount of one or more HLA-binding peptides as described herein are further embodiments of the invention.
  • vaccines in accordance with the invention encompass compositions of one or more of the claimed peptides.
  • a peptide can be present in a vaccine individually.
  • the peptide can exist as a homopolymer comprising multiple copies of the same peptide, or as a heteropolymer of various peptides.
  • Polymers have the advantage of increased immunological reaction and, where different peptide epitopes are used to make up the polymer, the additional ability to induce antibodies and/or CTLs that react with different antigenic determinants of the pathogenic organism or tumor-related peptide targeted for an immune response.
  • the composition can be a naturally occurring region of an antigen or can be prepared, e.g., recombinantly or by chemical synthesis.
  • Carriers that can be used with vaccines of the invention are well known in the art, and include, e.g., thyroglobulin, albumins such as human serum albumin, tetanus toxoid, polyamino adds such as poly L-lysine, poly L-glutamic add, influenza, hepatitis B virus core protein, and the like.
  • the vacdnes can contain a physiologically tolerable (i.e., acceptable) diluent such as water, or saline, preferably phosphate buffered saline.
  • the vaccines also typically include an adjuvant.
  • Adjuvants such as incomplete Freund's adjuvant, aluminum phosphate, aluminum hydroxide, or alum are examples of materials well known in the art. Additionally, as disdosed herein, CTL responses can be primed by conjugating peptides of the invention to lipids, such as tripalmitoyl-S-glycerylcysteinlyseryl- serine (P3CSS). Moreover, an adjuvant such as a synthetic cytosine-phosphorothiolated-guanine-containing (CpG) oligonudeotides has been found to in ⁇ ease CTL responses 10- to 100-fold, (see, e.g, Davila and Celis, J. Immunol.
  • CpG cytosine-phosphorothiolated-guanine-containing
  • the immune system of the host responds to the vaccine by producing large amounts of CTLs and/or HTLs spedfic for the desired antigen. Consequently, the host becomes at least partially immune to later development of cells that express or overexpress 24P4C12 antigen, or derives at least some therapeutic benefit when the antigen was tumor-associated.
  • class I peptide components may be desirable to combine with components that induce or facilitate neutralizing antibody and or helper T cell responses directed to the target antigen.
  • a preferred embodiment of such a composition comprises class I and class II epitopes in accordance with the invention.
  • An alternative embodiment of such a composition comprises a class I and/or class II epitope in accordance with the invention, along with a cross reactive HTL epitope such as PADRETM (Epimmune, San Diego, CA) molecule (described e.g., in U.S. Patent Number 5,736,142).
  • a vaccine of the invention can also include antigen-presenting cells (APC), such as dendritic cells (DC), as a vehicle to present peptides of the invention.
  • APC antigen-presenting cells
  • DC dendritic cells
  • Vaccine compositions can be created in vitro, following dendritic cell mobilization and harvesting, whereby loading of dendritic cells occurs in vitro.
  • dendritic cells are transfected, e.g., with a minigene in accordance with the invention, or are pulsed with peptides.
  • the dendritic cell can then be administered to a patient to elicit immune responses in vivo.
  • Vaccine compositions either DNA- or peptide-based, can also be administered in vivo in combination with dendritic cell mobilization whereby loading of dendritic cells occurs in vivo.
  • the following principles are utilized when selecting an array of epitopes for inclusion in a polyepitopic composition for use in a vaccine, or for selecting dis ⁇ ete epitopes to be included in a vaccine and/or to be encoded by nudeic acids such as a minigene. It is preferred that each of the following principles be balanced in order to make the selection.
  • the multiple epitopes to be incorporated in a given vaccine composition may be, but need not be, contiguous in sequence in the native antigen from which the epitopes are derived.
  • Epitopes are selected which, upon administration, mimic immune responses that have been observed to be correlated with tumor clearance. For HLA Class I this includes 34 epitopes that come from at least one tumor associated antigen (TAA), For HLA Class II a similar rationale is employed; again 3-4 epitopes are selected from at least one TAA (see, e.g., Rosenberg et al., Science 278:1447-1450). Epitopes from one TAA may be used in combination with epitopes from one or more additional TAAs to produce a vaccine that targets tumors with varying expression patterns of frequently-expressed TAAs.
  • TAA tumor associated antigen
  • Epitopes are selected that have the requisite binding affinity established to be correlated with immunogenicity: for HLA Class I an ICso of 500 nM or less, often 200 nM or less; and for Class II an ICso of 1000 nM or less.
  • Sufficient supermotif bearing-peptides, or a sufficient array of allele-spedfic motif-bearing peptides, are selected to give broad population coverage. For example, it is preferable to have at least 80% population coverage.
  • a Monte Carlo analysis a statistical evaluation known in the art, can be employed to assess the breadth, or redundancy of, population coverage.
  • nested epitopes are epitopes referred to as "nested epitopes.” Nested epitopes occur where at least two epitopes overlap in a given peptide sequence.
  • a nested peptide sequence can comprise B cell, HLA class I and/or HLA class II epitopes.
  • a general objective is to provide the greatest number of epitopes per sequence.
  • an aspect is to avoid providing a peptide that is any longer than the amino terminus of the amino terminal epitope and the carboxyl terminus of the carboxyl terminal epitope in the peptide.
  • a multi-epitopic sequence such as a sequence comprising nested epitopes, it is generally important to screen the sequence in order to insure that it does not have pathological or other deleterious biological properties.
  • a polyepitopic protein is created, or when creating a minigene, an objective is to generate the smallest peptide that encompasses the epitopes of interest. This principle is similar, if not the same as that employed when selecting a peptide comprising nested epitopes. However, with an artificial polyepitopic peptide, the size minimization objective is balanced against the need to integrate any spacer sequences between epitopes in the polyepitopic protein.
  • Spacer amino add residues can, for example, be introduced to avoid junctional epitopes (an epitope recognized by the immune system, not present in the target antigen, and only created by the man-made juxtaposition of epitopes), or to facilitate cleavage between epitopes and thereby enhance epitope presentation.
  • Junctional epitopes are generally to be avoided because the recipient may generate an immune response to that non-native epitope. Of particular concern is a junctional epitope that is a "dominant epitope.” A dominant epitope may lead to such a zealous response that immune responses to other epitopes are diminished or suppressed,
  • potential peptide epitopes can also be selected on the basis of their conservancy.
  • a criterion for conservancy may define that the entire sequence of an HLA class I binding peptide or the entire 9-mer core of a class II binding peptide be conserved in a designated percentage of the sequences evaluated for a specific protein antigen.
  • Nucleic acids encoding the peptides of the invention are a particularly useful embodiment of the invention.
  • Epitopes for inclusion in a minigene are preferably selected according to the guidelines set forth in the previous section,
  • a preferred means of administering nucleic acids encoding the peptides of the invention uses minigene constructs encoding a peptide comprising one or multiple epitopes of the invention.
  • a multi-epitope DNA plasmid encoding supermotif- and/or motif-bearing epitopes derived 24P4C12, the PADRE® universal helper T cell epitope or multiple HTL epitopes from 24P4C12 (see e.g., Tables VIII-XXI and XXII to XLIX), and an endoplasmic reticulum-translocating signal sequence can be engineered.
  • a vaccine may also comprise epitopes that are derived from other TAAs.
  • the immunogenicity of a multi-epitopic minigene can be confirmed in transgenic mice to evaluate the magnitude of CTL induction responses against the epitopes tested. Further, the immunogenicity of DNA-encoded epitopes in vivo can be correlated with the in vitro responses of specific CTL lines against target cells transfected with the DNA plasmid. Thus, these experiments can show that the minigene serves to both: 1.) generate a CTL response and 2.) that the induced CTLs recognized cells expressing the encoded epitopes.
  • the amino acid sequences of the epitopes may be reverse translated.
  • a human codon usage table can be used to guide the codon choice for each amino acid.
  • Examples of amino acid sequences that can be reverse translated and included in the minigene sequence indude HLA class I epitopes, HLA class II epitopes, antibody epitopes, a ubiquitination signal sequence, and/or an endoplasmic reticulum targeting signal.
  • HLA presentation of CTL and HTL epitopes may be improved by induding synthetic (e.g. poly-alanine) or naturally-occurring flanking sequences adjacent to the CTL or HTL epitopes; these larger peptides comprising the epitope(s) are within the scope of the invention.
  • the minigene sequence may be converted to DNA by assembling oligonucleotides that encode the plus and minus strands of the minigene.
  • Overlapping oligonucleotides (30-100 bases long) may be synthesized, phosphorylated, purified and annealed under appropriate conditions using well known techniques. The ends of the oligonucleotides can be joined, for example, using T4 DNA ligase. This synthetic minigene, encoding the epitope polypeptide, can then be cloned into a desired expression vector.
  • Standard regulatory sequences well known to those of skill in the art are preferably included in the vector to ensure expression in the target cells.
  • a promoter with a down-stream cloning site for minigene insertion a polyadenylation signal for efficient transcription termination; an £ coli origin of replication; and an £ coli selectable marker (e.g. ampicillin or kanamycin resistance).
  • Numerous promoters can be used for this purpose, e.g., the human cytomegalovirus (hCMV) promoter. See, e.g., U.S. Patent Nos. 5,580,859 and 5,589,466 for other suitable promoter sequences.
  • introns are required for efficient gene expression, and one or more synthetic or naturally-occurring introns could be incorporated into the transcribed region of the minigene.
  • mRNA stabilization sequences and sequences for replication in mammalian cells may also be considered for increasing minigene expression.
  • the minigene is cloned into the polylinker region downstream of the promoter.
  • This plasmid is transformed into an appropriate £ coli strain, and DNA is prepared using standard techniques. The orientation and DNA sequence of the minigene, as well as all other elements induded in the vector, are confirmed using restriction mapping and DNA sequence analysis. Bacterial cells harboring the correct plasmid can be stored as a master cell bank and a working cell bank.
  • immunostimulatory sequences appear to play a role in the immunogenicity of DNA vaccines. These sequences may be included in the vector, outside the minigene coding sequence, if desired to enhance immunogenicity.
  • a bi-cistronic expression vector which allows production of both the minigene-encoded epitopes and a second protein (included to enhance or decrease immunogenicity) can be used.
  • proteins or polypeptides that could beneficially enhance the immune response if co-expressed indude cytokines (e.g., IL-2, IL-12, GM- CSF), cytokine-inducing molecules (e.g., LelF), costimulatory molecules, or for HTL responses, pan-DR binding proteins (PADRETM, Epimmune, San Diego, CA).
  • Helper (HTL) epitopes can be joined to intracellular targeting signals and expressed separately from expressed CTL epitopes; this allows direction of the HTL epitopes to a cell compartment different than that of the CTL epitopes. If required, this could facilitate more efficient entry of HTL epitopes into the HLA class II pathway, thereby improving HTL induction.
  • immunosuppressive molecules e.g. TGF- ⁇
  • TGF- ⁇ immunosuppressive molecules
  • Therapeutic quantities of plasmid DNA can be produced for example, by fermentation in £ coli, followed by purification. Aliquots from the working cell bank are used to inoculate growth medium, and grown to saturation in shaker flasks or a bioreactor according to well-known techniques. Plasmid DNA can be purified using standard biosepar ation technologies such as solid phase anion-exchange resins supplied by QIAGEN, Inc. (Valencia, California). If required, supercoiled DNA can be isolated from the open circular and linear forms using gel electrophoresis or other methods.
  • Purified plasmid DNA can be prepared for injection using a variety of formulations. The simplest of these is reconstitution of lyophilized DNA in sterile phosphate-buffer saline (PBS). This approach, known as "naked DNA,” is currently being used for intramuscular (IM) administration in clinical trials. To maximize the immunotherapeutic effects of minigene DNA vaccines, an alternative method for formulating purified plasmid DNA may be desirable. A variety of methods have been described, and new techniques may become available.
  • Cationic lipids, glycolipids, and fusogenic liposomes can also be used in the formulation (see, e.g., as described by WO 93/24640; Mannino & Gould-Fogerite, BioTechniques 6(7): 682 (1988); U.S. Pat No. 5,279,833; WO 91/06309; and Feigner, ef al, Proc. Nat'l Acad. Sci. USA 84:7413 (1987).
  • peptides and compounds referred to collectively as protective, interactive, non-condensing compounds could also be complexed to purified plasmid DNA to influence variables such as stability, intramuscular dispersion, or trafficking to specific organs or cell types.
  • Target cell sensitization can be used as a functional assay for expression and HLA class I presentation of minigene-encoded CTL epitopes.
  • the plasmid DNA is introduced into a mammalian cell line that is suitable as a target for standard CTL chromium release assays.
  • the transfection method used will be dependent on the final formulation. Electroporation can be used for "naked" DNA, whereas cationic lipids allow direct in vitro transfection.
  • a plasmid expressing green fluorescent protein (GFP) can be co-transfected to allow enrichment of transfected cells using fluorescence activated cell sorting (FACS).
  • FACS fluorescence activated cell sorting
  • HTL epitopes are then chrom ⁇ um-51 ( 51 Cr) labeled and used as target cells for epitope-spedfic CTL lines; cytolysis, detected by 51 Cr release, indicates both production of, and HLA presentation of, minigene-encoded CTL epitopes. Expression of HTL epitopes may be evaluated in an analogous manner using assays to assess HTL activity.
  • In vivo immunogenicity is a second approach for functional testing of minigene DNA formulations.
  • Transgenic mice expressing appropriate human HLA proteins are immunized with the DNA product.
  • the dose and route of administration are formulation dependent (e.g., IM for DNA in PBS, intraperitoneal (i.p.) for lipid-complexed DNA).
  • Twenty-one days after immunization splenocytes are harvested and restimulated for one week in the presence of peptides encoding each epitope being tested. Thereafter, for CTL effector cells, assays are conducted for cytolysis of peptide-loaded, 51 Cr-labeled target cells using standard techniques.
  • Lysis of target cells that were sensitized by HLA loaded with peptide epitopes, corresponding to minigene-encoded epitopes, demonstrates DNA vaccine function for in vivo induction of CTLs. Immunogenicity of HTL epitopes is confirmed in transgenic mice in an analogous manner.
  • nucleic acids can be administered using ballistic delivery as described, for instance, in U.S. Patent No. 5,204,253.
  • particles comprised solely of DNA are administered.
  • DNA can be adhered to particles, such as gold particles.
  • Minigenes can also be delivered using other bacterial or viral delivery systems well known in the art, e.g., an expression construct encoding epitopes of the invention can be incorporated into a viral vector such as vaccinia. X.C.2. Combinations of CTL Peptides with Helper Peptides
  • Vaccine compositions comprising CTL peptides of the invention can be modified, e.g., analoged, to provide desired attributes, such as improved serum half life, broadened population coverage or enhanced immunogenicity.
  • the ability of a peptide to induce CTL activity can be enhanced by linking the peptide to a sequence which contains at least one epitope that is capable of inducing a T helper cell response.
  • a CTL peptide can be directly linked to a T helper peptide, often CTL epitope/HTL epitope conjugates are linked by a spacer molecule.
  • the spacer is typically comprised of relatively small, neutral molecules, such as amino acids or amino acid imetics, which are substantially uncharged under physiological conditions.
  • the spacers are typically selected from, e.g., Ala, Gly, or other neutral spacers of nonpolar amino acids or neutral polar amino acids.
  • the optionally present spacer need not be comprised of the same residues and thus may be a hetero- or homo-oligomer. When present, the spacer will usually be at least one or two residues, more usually three to six residues and sometimes 10 or more residues.
  • the CTL peptide epitope can be linked to the T helper peptide epitope either directly or via a spacer either at the amino or carboxy terminus of the CTL peptide.
  • the amino terminus of either the immunogenic peptide or the T helper peptide may be acylated.
  • the T helper peptide is one that is recognized by T helper cells present in a majority of a genetically diverse population This can be accomplished by selecting peptides that bind to many, most, or all of the HLA class II molecules.
  • Examples of such amino acid bind many HLA Class II molecules include sequences from antigens such as fefanus toxoid at positions 830-843 (QYIKANSKFIGITE; SEQ ID NO: 29), Plasmodium falciparum circumsporozoite (CS) protein at positions 378-398 (DIEKKIAKMEKASSVFNWNS; SEQ ID NO: 30), and Streptococcus 18kD protein at positions 116-131 (GAVDSILGGVATYGAA; SEQ ID NO: 31).
  • Other examples include peptides bearing a DR 14-7 supermotif, or either of the DR3 motifs.
  • An alternative of a pan-DR binding epitope comprises all "L” natural amino acids and can be provided in the form of nucleic acids that encode the epitope.
  • HTL peptide epitopes can also be modified to alter their biological properties. For example, they can be modified to include r>amino acids to increase their resistance to proteases and thus extend their serum half life, or they can be conjugated to other molecules such as lipids, proteins, carbohydrates, and the like to increase their biological activity.
  • a T helper peptide can be conjugated to one or more palmitic acid chains at either the amino or carboxyl termini.
  • compositions of the invention at least one component which primes B lymphocytes or T lymphocytes.
  • Lipids have been identified as agents capable of priming CTL in vivo.
  • palmitic acid residues can be attached to the ⁇ -and ⁇ - amino groups of a lysine residue and then linked, e.g., via one or more linking residues such as Gly, Gly-Gly-, Ser, Ser-Ser, or the like, to an immunogenic peptide.
  • the lipidated peptide can then be administered either directly in a micelle or particle, incorporated into a liposcme, or emulsified in an adjuvant, e.g., incomplete Freund's adjuvant.
  • a particularly effective immunogenic composition comprises palmitic acid attached to ⁇ - and ⁇ - amino groups of Lys, which is attached via linkage, e.g., Ser-Ser, to the amino terminus of the immunogenic peptide.
  • £ coli lipoproteins such as tripalmitoyl-S- glycerylcysteinlyseryl- serine (P3CSS) can be used to prime virus specific CTL when covalently attached to an appropriate peptide (see, e.g., Deres, etal, Nature 342:561, 1989).
  • Peptides of the invention can be coupled to P3CSS, for example, and the lipopeptide administered to an individual to prime specifically an immune response to the target antigen.
  • two such compositions can be combined to more effectively elicit both humoral and cell-mediated responses.
  • Vaccine Compositions Comprising DC Pulsed with CTL and/or HTL Peptides
  • An embodiment of a vaccine composition in accordance with the invention comprises ex vivo administration of a cocktail of epitope-bearing peptides to PBMC, or isolated DC therefrom, from the patient's blood.
  • a pharmaceutical to facilitate harvesting of DC can be used, such as ProgenipoietinTM (Pharmacia-Monsanto, St. Louis, MO) or GM-CSF/IL4.
  • ProgenipoietinTM Pulsing the DC with peptides and prior to reinfusion into patients, the DC are washed to remove unbound peptides.
  • a vac ⁇ ' ne comprises peptide-pulsed DCs which present the pulsed peptide epitopes complexed with HLA molecules on their surfaces.
  • the DC can be pulsed ex vivo with a cocktail of peptides, some of which stimulate CTL responses to 24P4C12.
  • a helper T cell (HTL) peptide such as a natural or artificial loosely restricted HLA Class II peptide, can be included to facilitate the CTL response.
  • HTL helper T cell
  • a vaccine in accordance with the invention is used to treat a cancer which expresses or overexpresses 24P4C12.
  • Antigenic 24P4C12-related peptides are used to elicit a CTL and/or HTL response ex vivo, as well.
  • the resulting CTL or HTL cells can be used to treat tumors in patients that do not respond to other conventional forms of therapy, or will not respond to a therapeutic vaccine peptide or nucleic acid in accordance with the invention.
  • Ex vivo CTL or HTL responses to a particular antigen are induced by incubating in tissue culture the patient's, or genetically compatible, CTL or HTL precursor cells together with a source of antigen-presenting cells (APC), such as dendritic cells, and the appropriate immunogenic peptide.
  • APC antigen-presenting cells
  • the cells After an appropriate incubation time (typically about 7-28 days), in which the precursor cells are activated and expanded into effector cells, the cells are infused back into the patient, where they will destroy (CTL) or facilitate destruction (HTL) of their spedfic target cell (e.g., a tumor cell).
  • CTL destroy
  • HTL facilitate destruction
  • Transfected dendritic cells may also be used as antigen presenting cells.
  • compositions of the invention are typically used to treat and/or prevent a cancer that expresses or overexpresses 24P4C12.
  • peptide and/or nucleic acid compositions are administered to a patient in an amount sufficient to elidt an effective B cell, CTL and/or HTL response to the antigen and to cure or at least partially arrest or slow symptoms and/or complications.
  • An amount adequate to accomplish this is defined as "therapeutically effective dose.” Amounts effective for this use will depend on, e.g., the particular composition administered, the manner of administration, the stage and severity of the disease being treated, the weight and general state of health of the patient, and the judgment of the prescribing physician.
  • the immunogenic peptides of the invention are generally administered to an individual already bearing a tumor that expresses 24P4C12.
  • the peptides or DNA encoding them can be administered individually or as fusions of one or more peptide sequences.
  • Patients can be treated with the immunogenic peptides separately or in conjunction with other treatments, such as surgery, as appropriate.
  • administration should generally begin at the first diagnosis of 24P4C12-associated cancer. This is followed by boosting doses until at least symptoms are substantially abated and for a period thereafter.
  • the embodiment of the vaccine composition i.e., including, but not limited to embodiments such as peptide cocktails, polyepitopic polypeptides, minigenes, or TAA-specific CTLs or pulsed dendritic cells
  • delivered to the patient may vary according to the stage of the disease or the patient's health status. For example, in a patient with a tumor that expresses 24P4C12, a vacdne comprising 24P4C12-specific CTL may be more efficacious in killing tumor cells in patient with advanced disease than alternative embodiments.
  • compositions which stimulate helper T cell responses can also be given in accordance with this embodiment of the invention.
  • the dosage for an initial therapeutic immunization generally occurs in a unit dosage range where the lower value is about 1 , 5, 50, 500, or 1 ,000 ⁇ g and the higher value is about 10,000; 20,000; 30,000; or 50,000 ⁇ g.
  • Dosage values for a human typically range from about 500 ⁇ g to about 50,000 ⁇ g per 70 kilogram patient.
  • Boosting dosages of between about 1.0 ⁇ g to about 50,000 ⁇ g of peptide pursuant to a boosting regimen over weeks to months may be administered depending upon the patient's response and condition as determined by measuring the specific activity of CTL and HTL obtained from the patient's blood. Administration should continue until at least clinical symptoms or laboratory tests indicate that the neoplasia, has been eliminated or reduced and for a period thereafter.
  • the dosages, routes of administration, and dose schedules are adjusted in accordance with methodologies known in the art.
  • the peptides and compositions of the present invention are employed in serious disease states, that is, life-threatening or potentially life threatening situations.
  • life-threatening or potentially life threatening situations in certain embodiments, it is possible and may be felt desirable by the treating physician to administer substantial excesses of these peptide compositions relative to these stated dosage amounts.
  • the vaccine compositions of the invention can also be used purely as prophylactic agents.
  • the dosage for an initial prophylactic immunization generally occurs in a unit dosage range where the lower value is about 1 , 5, 50, 500, or 1000 ⁇ g and the higher value is about 10,000; 20,000; 30,000; or 50,000 ⁇ g.
  • Dosage values for a human typically range from about 500 ⁇ g to about 50,000 ⁇ g per 70 kilogram patient. This is followed by boosting dosages of between about 1.0 ⁇ g to about 50,000 ⁇ g of peptide administered at defined intervals from about four weeks to six months after the initial administration of vaccine.
  • the immunogenicity of the vaccine can be assessed by measuring the specific activity of CTL and HTL obtained from a sample of the patient's blood.
  • compositions for therapeutic treatment are intended for parenteral, topical, oral, nasal, intrathecal, or local (e.g. as a cream or topical ointment) administration.
  • the pharmaceutical compositions are administered parentally, e.g., intravenously, subcutaneously, intradermally, or intramuscularly.
  • compositions for parenteral administration which comprise a solution of the immunogenic peptides dissolved or suspended in an acceptable carrier, preferably an aqueous carrier.
  • aqueous carriers may be used, e.g., water, buffered water, 0.8% saline, 0.3% glycine, hyaluronic add and the like. These compositions may be sterilized by conventional, well-known sterilization techniques, or may be sterile filtered. The resulting aqueous solutions may be packaged for use as is, or lyophilized, the lyophilized preparation being combined with a sterile solution prior to administration.
  • compositions may contain pharmaceutically acceptable auxiliary substances as required to approximate physiological conditions, such as pH-adjusting and buffering agents, tonicity adjusting agents, wetting agents, preservatives, and the like, for example, sodium acetate, sodium lactate, sodium chloride, potassium chloride, caldum chloride, sorbitan monolaurate, triethanolamine oleate, efc.
  • auxiliary substances such as pH-adjusting and buffering agents, tonicity adjusting agents, wetting agents, preservatives, and the like, for example, sodium acetate, sodium lactate, sodium chloride, potassium chloride, caldum chloride, sorbitan monolaurate, triethanolamine oleate, efc.
  • concentration of peptides of the invention in the pharmaceutical formulations can vary widely, i.e., from less than about 0.1%, usually at or at least about 2% to as much as 20% to 50% or more by weight, and will be selected primarily by fluid volumes, viscosities, efc, in accordance with the particular mode of administration selected.
  • a human unit dose form of a composition is typically included in a pharmaceutical composition that comprises a human unit dose of an acceptable carrier, in one embodiment an aqueous carrier, and is administered in a volume/quantity that is known by those of skill in the art to be used for administration of such compositions to humans (see, e.g., Remington's Pharmaceutical Sciences, 17* Edition, A. Gennaro, Editor, Mack Publishing Co., Easton, Pennsylvania, 1985).
  • a peptide dose for initial immunization can be from about 1 to about 50,000 ⁇ g, generally 100-5,000 ⁇ g, for a 70 kg patient.
  • an initial immunization may be performed using an expression vector in the form of naked nucleic acid administered IM (or SC or ID) in the amounts of 0.5-5 mg at multiple sites.
  • the nudeic acid (0.1 to 1000 ⁇ g) can also be administered using a gene gun.
  • a booster dose is then administered.
  • the booster can be recombinant fowlpox virus administered at a dose of 5-10 7 to 5x10 9 pfu.
  • a treatment generally involves repeated administration of the anti-24P4C12 antibody preparation, via an acceptable route of administration such as intravenous injection (IV), typically at a dose in the range of about 0.1 to about 10 mg/kg body weight.
  • IV intravenous injection
  • doses in the range of 10-500 mg mAb per week are effective and well tolerated.
  • an initial loading dose of approximately 4 mg/kg patient body weight IV, followed by weekly doses of about 2 mg/kg IV of the anti- 24P4C12 mAb preparation represents an acceptable dosing regimen.
  • various factors can influence the ideal dose in a particular case.
  • Such factors include, for example, half life of a composition, the binding affinity of an Ab, the immunogenicity of a substance, the degree of 24P4C12 expression in the patient, the extent of circulating shed 24P4C12 antigen, the desired steady-state concentration level, frequency of treatment, and the influence of chemotherapeutic or other agents used in combination with the treatment method of the invention, as well as the health status of a particular patient.
  • Non-limiting preferred human unit doses are, for example, 500 ⁇ g - 1mg, 1mg - 50mg, 50mg - 100mg, 100mg - 200mg, 200mg - 300mg, 400mg - 500mg, 500mg - 600mg, 600mg - 700mg, 700mg - 800mg, 800mg - 900mg, 900mg - 1g, or 1mg - 700mg.
  • the dose is in a range of 2-5 mg/kg body weight, e.g., with follow on weekly doses of 1-3 mg/kg; 0.5mg, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10mg/kg body weight followed, e.g., in two, three or four weeks by weekly doses; 0.5 - 1 Omg/kg body weight, e.g., followed in two, three or four weeks by weekly doses; 225, 250, 275, 300, 325, 350, 375, 400mg m 2 of body area weekly; 1-600mg m 2 of body area weekly; 225400mg m 2 of body area weekly; these does can be followed by weekly doses for 2, 3, 4, 5, 6, 7, 8, 9, 19, 11 , 12 or more weeks.
  • human unit dose forms of polynucleotides comprise a suitable dosage range or effective amount that provides any therapeutic effect.
  • a therapeutic effect depends on a number of factors, including the sequence of the polynucleotide, molecular weight of the polynucleotide and route of administration. Dosages are generally selected by the physidan or other health care professional in accordance with a variety of parameters known in the art, such as severity of symptoms, history of the patient and the like.
  • a dosage range may be selected from, for example, an independently selected lower limit such as about 0.1 , 0,25, 0.5, 1 , 2, 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400 or 500 mg/kg up to an independently selected upper limit, greater than the lower limit of about 60, 80, 100, 200, 300, 400, 500, 750, 1000, 1500, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000 or 10,000 mg/kg.
  • an independently selected lower limit such as about 0.1 , 0,25, 0.5, 1 , 2, 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400 or 500 mg/kg up to an independently selected upper limit, greater than the lower limit of about 60, 80, 100, 200, 300, 400, 500, 750, 1000, 1500, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000 or 10,000 mg/kg.
  • a dose may be about any of the following: 0.1 to 100 mg/kg, 0.1 to 50 mg kg, 0.1 to 25 mg/kg, 0.1 to 10 mg/kg, 1 to 500 mg kg, 100 to 400 mg/kg, 200 to 300 mg/kg, 1 to 100 mg/kg, 100 to 200 mg/kg, 300 to 400 mg/kg, 400 to 500 mg/kg, 500 to 1000 mg/kg, 500 to 5000 mg/kg, or 500 to 10,000 mg/kg.
  • parenteral routes of administration may require higher doses of polynudeotide compared to more direct application to the nucleotide to diseased tissue, as do polynucleotides of increasing length.
  • human unit dose forms of T-cells comprise a suitable dosage range or effective amount that ( provides any therapeutic effect.
  • a therapeutic effect depends on a number of factors. Dosages are generally selected by the physician or other health care professional in accordance with a variety of parameters known in the art, such as severity of symptoms, history of the patient and the like.
  • a dose may be about 10 4 cells to about 10 6 cells, about 10 ⁇ cells to about 10 8 cells, about 10 8 to about 10 11 cells, or about 10 8 to about 5 x 10 10 cells.
  • a dose may also about 10 6 cells/m 2 to about 10 10 cells/m 2 , or about 10 6 cells/m 2 to about 10 8 cells/m 2 .
  • Proteins(s) of the invention, and/or nucleic acids encoding the protein(s), can also be administered via liposomes, which may also serve to: 1) target the proteins(s) to a particular tissue, such as lymphoid tissue; 2) to target selectively to diseases cells; or, 3) to increase the half-life of the peptide composition.
  • liposomes indude emulsions, foams, micelles, insoluble monolayers, liquid crystals, phospholipid dispersions, lamellar layers and the like.
  • the peptide to be delivered is incorporated as part of a liposome, alone or in conjunction with a molecule which binds to a receptor prevalent among lymphoid ceils, such as monodonal antibodies which bind to the CD45 antigen, or with other therapeutic or immunogenic compositions.
  • liposomes either filled or decorated with a desired peptide of the invention can be directed to the site of lymphoid cells, where the liposomes then deliver the peptide compositions.
  • Liposomes for use in accordance with the invention are formed from standard vesicle-forming lipids, which generally include neutral and negatively charged phospholipids and a sterol, such as cholesterol.
  • lipids are generally guided by consideration of, e.g., liposome size, acid lability and stability of the liposomes in the blood stream.
  • a variety of methods are available for preparing liposomes, as described in, e.g., Szoka, ef al, Ann. Rev. Biophys. Bioeng. 9:467 (1980), and U.S. Patent Nos. 4,235,871, 4,501,728, 4,837,028, and 5,019,369.
  • a ligand to be incorporated into the liposome can include, e.g., antibodies or fragments thereof specific for cell surface determinants of the desired immune system cells.
  • a liposome suspension containing a peptide may be administered intravenously, locally, topically, efc. in a dose which varies according to, inter alia, the manner of administration, the peptide being delivered, and the stage of the disease being treated.
  • nontoxic solid carriers include, for example, pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharin, talcum, cellulose, glucose, sucrose, magnesium carbonate, and the like.
  • a pharmaceutically acceptable nontoxic composition is formed by incorporating any of the normally employed excipients, such as those carriers previously listed, and generally 10- 95% of active ingredient, that is, one or more peptides of the invention, and more preferably at a concentration of 25%-75%.
  • immunogenic peptides are preferably supplied in finely divided form along with a surfactant and propellant. Typical percentages of peptides are about 0.01 %-20% by weight, preferably about 1 %-10%.
  • the surfadant must, of course, be nontoxic, and preferably soluble in the propellant.
  • Representative of such agents are the esters or partial esters of fatty acids containing from about 6 to 22 carbon atoms, such as caproic, octanoic, lauric, palmitic, stearic, linoleic, linolenic, olesteric and oleic acids with an aliphatic polyhydric alcohol or its cyclic anhydride.
  • Mixed esters such as mixed or natural glycerides may be employed.
  • the surfactant may constitute about 0.1 %-20% by weight of the composition, preferably about 0.25-5%.
  • the balance of the composition is ordinarily propellant.
  • a carrier can also be induded, as desired, as with, e.g., lecithin for intranasal delivery.
  • 24P4C12 polynucleotides, polypeptides, reactive cytotoxic T cells (CTL), reactive helper T cells (HTL) and anti-polypeptide antibodies are used in well known diagnostic, prognostic and therapeutic assays that examine conditions associated with dysregulated cell growth such as cancer, in particular the cancers listed in Table I (see, e.g., both its specific pattern of tissue expression as well as its overexpression in certain cancers as described for example in the Example entitled "Expression analysis of 24P4C12 in normal tissues, and patient specimens").
  • 24P4C12 can be analogized to a prostate associated antigen PSA, the archetypal marker that has been used by medical practitioners for years to identify and monitor the presence of prostate cancer (see, e.g., Merrill ef al, J. Urol. 163(2): 503-5120 (2000); Polascik ef al, J, Urol. Aug; 162(2):293-306 (1999) and Fortieref al, J. Nat. Cancer Inst.91(19): 1635- 1640(1999)).
  • PSA prostate associated antigen PSA
  • a variety of other diagnostic markers are also used in similar contexts including p53 and K-ras (see, e.g., Tulchinsky ef al, Int J Mol Med 1999 Jul 4(1):99-102 and Minimoto ef al, Cancer Detect Prev 2000;24(1):1-12). Therefore, this disclosure of 24P4C12 polynucleotides and polypeptides (as well as 24P4C12 polynucleotide probes and anti-24P4C12 antibodies used to identify the presence of these molecules) and their properties allows skilled artisans to utilize these molecules in methods that are analogous to those used, for example, in a variety of diagnostic assays directed to examining conditions associated with cancer.
  • Typical embodiments of diagnostic methods which utilize the 24P4C12 polynudeotides, polypeptides, reactive T cells and antibodies are analogous to those methods from well-established diagnostic assays, which employ, e.g., PSA polynudeotides, polypeptides, reactive T cells and antibodies.
  • PSA polynudeotides are used as probes (for example in Northern analysis, see, e.g., Sharief et al, Biochem. Mol. Biol. Int. 33(3):567-74(1994)) and primers (for example in PCR analysis, see, e.g., Okegawa et al. . Urol.
  • the 24P4C12 polynucleotides described herein can be utilized in the same way to detect 24P4C12 overexpression or the metastasis of prostate and other cancers expressing this gene.
  • PSA polypeptides are used to generate antibodies spedfic for PSA which can then be used to observe the presence and/or the level of PSA proteins in methods to monitor PSA protein overexpression (see, e.g., Stephan ef a/., Urology 55(4):560-3 (2000)) or the metastasis of prostate cells (see, e.g., Alanen etal, Pathol. Res. Pract 192(3):233-7 (1996)), the 24P4C12 polypeptides described herein can be utilized to generate antibodies for use in detecting 24P4C12 overexpression or the metastasis of prostate cells and cells of other cancers expressing this gene.
  • metastases involves the movement of cancer cells from an organ of origin (such as the lung or prostate gland etc.) to a different area of the body (such as a lymph node)
  • assays which examine a biological sample for the presence of cells expressing 24P4C12 polynucleotides and/or polypeptides can be used to provide evidence of metastasis.
  • tissue that does not normally contain 24P4C12-expressing cells lymph node
  • xenografts isolated from lymph node and bone metastasis is indicative of metastasis.
  • 24P4C12 polynucleotides and/or polypeptides can be used to provide evidence of cancer, for example, when cells in a biological sample that do not normally express 24P4C12 or express 24P4C12 at a different level are found to express 24P4C12 or have an increased expression of 24P4C12 (see, e.g., the 24P4C12 expression in the cancers listed in Table I and in patient samples etc. shown in the accompanying Figures).
  • artisans may further wish to generate supplementary evidence of metastasis by testing the biological sample for the presence of a second tissue restricted marker (in addition to 24P4C12) such as PSA, PSCA etc. (see, e.g., Alanen etal, Pathol. Res. Pract. 192(3): 233- 237 (1996)).
  • PSA polynucleotide fragments and polynucleotide variants are employed by skilled artisans for use in methods of monitoring PSA
  • 24P4C12 polynucleotide fragments and polynucleotide variants are used in an analogous manner.
  • typical PSA polynucleotides used in methods of monitoring PSA are probes or primers which consist of fragments of the PSA cDNA sequence.
  • primers used to PCR amplify a PSA polynucleotide must include less than the whole PSA sequence to function in the polymerase chain reaction.
  • PCR reactions In the context of such PCR reactions, skilled artisans generally create a variety of different polynucleotide fragments that can be used as primers in order to amplify different portions of a polynucleotide of interest or to optimize amplification reactions (see, e.g., Caetano-Anolles, G. Biotechniques 25(3): 472-476, 478480 (1998); Robertson etal, Methods Mol, Biol.98:121-154 (1998)).
  • variant polynucleotide sequences are typically used as primers and probes for the corresponding mRNAs in PCR and Northern analyses (see, e.g., Sawai ef al, Fetal Diagn. Ther. 1996 Nov-Dec 11(6):407-13 and Current Protocols In Molecular Biology, Volume 2, Unit 2, Frederick M. Ausubel ef al. eds., 1995)).
  • Polynucleotide fragments and variants are useful in this context where they are capable of binding to a target polynucleotide sequence (e.g., a 24P4C12 polynucleotide shown in Figure 2 or variant thereof) under conditions of high stringency.
  • a target polynucleotide sequence e.g., a 24P4C12 polynucleotide shown in Figure 2 or variant thereof
  • PSA polypeptides which contain an epitope that can be recognized by an antibody or T cell that specifically binds to that epitope are used in methods of monitoring PSA.
  • 24P4C12 polypeptide fragments and polypeptide analogs or variants can also be used in an analogous manner. This practice of using polypeptide fragments or polypeptide variants to generate antibodies (such as anti-PSA antibodies or T cells) is typical in the art with a wide variety of systems such as fusion proteins being used by practitioners (see, e.g., Current Protocols In Molecular Biology, Volume 2, Unit 16, Frederick M. Ausubel ef a/, eds., 1995). In this context, each epitope(s) functions to provide the architecture with which an antibody or T cell is reactive.
  • polypeptide fragments that can be used in order to generate immune responses specific for different portions of a polypeptide of interest (see, e.g., U.S. Patent No. 5,840,501 and U.S. Patent No. 5,939,533).
  • a polypeptide comprising one of the 24P4C12 biological motifs discussed herein or a motif-bearing subsequence which is readily identified by one of skill in the art based on motifs available in the art.
  • Polypeptide fragments, variants or analogs are typically useful in this context as long as they comprise an epitope capable of generating an antibody or T cell specific for a target polypeptide sequence (e.g. a 24P4C12 polypeptide shown in Figure 3).
  • the 24P4C12 polynucleotides and polypeptides exhibit spedfic properties that make them useful in diagnosing cancers such as those listed in Table I.
  • Diagnostic assays that measure the presence of 24P4C12 gene products in order to evaluate the presence or onset of a disease condition described herein, such as prostate cancer, are used to identify patients for preventive measures or further monitoring, as has been done so successfully with PSA.
  • these materials satisfy a need in the art for molecules having similar or complementary characteristics to PSA in situations where, for example, a definite diagnosis of metastasis of prostatic origin cannot be made on the basis of a test for PSA alone (see, e.g., Alanen et al, Pathol. Res. Pract. 192(3): 233-237 (1996)), and consequently, materials such as 24P4C12 polynucleotides and polypeptides (as well as the 24P4C12 polynucleotide probes and anti- 24P4C12 antibodies used to identify the presence of these molecules) need to be employed to confirm a metastases of prostatic origin.
  • the 24P4C12 polynucleotides disclosed herein have a number of other utilities such as their use in the identification of oncogenetic associated chromosomal abnormalities in the chromosomal region to which the 24P4C12 gene maps (see the Example entitled "Chromosomal Mapping of 24P4C12" below).
  • the 24P4C12-related proteins and polynucleotides disclosed herein have other utilities such as their use in the forensic analysis of tissues of unknown origin (see, e.g., Takahama K Forensic Sci I ⁇ t 1996 Jun 28;80(1-2): 63-9).
  • 24P4C12-related proteins or polynucleotides of the invention can be used to treat a pathologic condition characterized by the over-expression of 24P4C12.
  • the amino acid or nucleic acid sequence of Figure 2 or Figure 3, or fragments of either can be used to generate an immune response to a 24P4C12 antigen.
  • Antibodies or other molecules that react with 24P4C12 can be used to modulate the function of this molecule, and thereby provide a therapeutic benefit.
  • the invention includes various methods and compositions for inhibiting the binding of 24P4C12 to its binding partner or its association with other protein(s) as well as methods for inhibiting 24P4C12 function.
  • a recombinant vector that encodes single chain antibodies that spedfically bind to 24P4C12 are introduced into 24P4C12 expressing cells via gene transfer technologies. Accordingly, the encoded single chain anti- 24P4C12 antibody is expressed intracellularly, binds to 24P4C12 protein, and thereby inhibits its function. Methods for engineering such intracellular single chain antibodies are well known.
  • intracellular antibodies also known as “intrabodies” are specifically targeted to a particular compartment within the cell, providing control over where the inhibitory activity of the treatment is focused
  • This technology has been successfully applied in the art (for review, see Richardson and Marasco, 1995, TIBTECH vol 13) Infrabodies have been shown to virtually eliminate the expression of otherwise abundant cell surface receptors (see, e g Richardson et al, 1995, Proc Natl Acad Sci USA 92 3137-3141, Beerli ef al, 1994, J Biol Chem 289 23931-23936, Deshane ef al , 1994, Gene Ther 1 332-337)
  • Single chain antibodies comprise the vanable domains of the heavy and light chain joined by a flexible linker polypeptide, and are expressed as a single polypeptide
  • single chain antibodies are expressed as a single chain variable region fragment joined to the light chain constant region
  • Weil-known intracellular trafficking signals are engineered into recombinant polynucleotide vectors encoding such single chain antibodies in order to target precisely the intrabody to the desired intracellular compartment
  • infrabodies targeted to the endoplasmic reticulum (ER) are engineered to incorporate a leader peptide and, optionally, a C-terminal ER retention signal, such as the KDEL am o acid motif
  • Infrabodies intended to exert activity in the nudeus are engineered to indude a nuclear localization signal
  • Lipid moieties are joined to infrabodies in order to tether the intrabody to the cytosolic side of the plasma membrane
  • Infrabodies can also be targeted to exert function in the cytosol
  • infrabodies are used to capture 24P4C12 in the nucleus, thereby preventing its activity within the nudeus Nuclear targeting signals are engineered into such 24P4C12 infrabodies in order to achieve the desired targeting
  • Such 24P4C12 infrabodies are designed to bind specifically to a particular 24P4C12 domain
  • cytosolic infrabodies that specifically bind to a 24P4C12 protein are used to prevent 24P4C12 from gaining access to the nucleus, thereby preventing it from exerting any biological activity within the nucleus (e g , preventing 24P4C12 from forming transcription complexes with other factors)
  • the transcription of the intrabody is placed under the regulatory control of an appropnate tumor-specific promoter and/or enhancer
  • an appropnate tumor-specific promoter and/or enhancer In order to target intrabody expression spe ⁇ fically to prostate, for example the PSA promoter and/or promoter/enhancer can be utilized (See, for example, U S Patent No 5,919,652 issued 6 July 1999)
  • recombinant molecules bind to 24P4C12 and thereby inhibit 24P4C12 function
  • these recombinant molecules prevent or inhibit 24P4C12 from accessing/binding to its binding partner(s) or associating with other prote ⁇ n(s)
  • Such recombinant mdecules can, for example, contain the reactive part(s) of a 24P4C12 specific antibody molecule
  • the 24P4C12 binding domain of a 24P4C12 binding partner is engineered into a dime ⁇ c fusion protein, whereby the fusion protein compnses two 24P4C12 ligand binding domains linked to the Fc portion of a human IgG, such as human lgG1
  • Such IgG portion can contain, for example, the CH2 and CH3 domains and the hinge region, but not the CH1 domain
  • dimenc fusion proteins are administered in soluble form to patients suffering from a cancer associated with the expression of 24P4C12 whereby the dimenc
  • the present invention also compnses va ⁇ ous methods and compositions for inhibiting the transcription of the 24P4C12 gene Similarly, the invention also provides methods and compositions for inhibiting the translation of 24P4C12 mRNA into protein
  • a method of inhibiting the transcription of the 24P4C12 gene comprises contacting the 24P4C12 gene with a 24P4C12 antisense polynudeotide.
  • a method of inhibiting 24P4C12 mRNA translation comprises contacting a 24P4C12 mRNA with an antisense polynucleotide.
  • a 24P4C12 specific ribozyme is used to cleave a 24P4C12 message, thereby inhibiting translation.
  • antisense and ribozyme based methods can also be directed to the regulatory regions of the 24P4C12 gene, such as 24P4C12 promoter and/or enhancer elements.
  • proteins capable of inhibiting a 24P4C12 gene trans ⁇ iption factor are used to inhibit 24P4C12 mRNA transcription.
  • the various polynucleotides and compositions useful in the aforementioned methods have been described above.
  • the use of antisense and ribozyme molecules to inhibit transcription and translation is well known in the art.
  • Gene fransfer and gene therapy technologies can be used to deliver therapeutic polynudeotide molecules to tumor cells synthesizing 24P4C12 (i.e., antisense, ribozyme, polynudeotides encoding infrabodies and other 24P4C12 inhibitory molecules).
  • 24P4C12 i.e., antisense, ribozyme, polynudeotides encoding infrabodies and other 24P4C12 inhibitory molecules.
  • a number of gene therapy approaches are known in the art.
  • Recombinant vectors encoding 24P4C12 antisense polynudeotides, ribozymes, factors capable of interfering with 24P4C12 transcription, and so forth, can be delivered to target tumor cells using such gene therapy approaches.
  • the above therapeutic approaches can be combined with any one of a wide variety of surgical, chemotherapy or radiation therapy regimens.
  • the therapeutic approaches of the invention can enable the use of reduced dosages of chemotherapy (or other therapies) and/or less frequent administration, an advantage for all patients and particularly for those that do not tolerate the toxidty of the chemotherapeutic agent well.
  • the anti-tumor activity of a particular composition can be evaluated using various in vitro and in vivo assay systems.
  • In vitro assays that evaluate therapeutic activity indude cell growth assays, soft agar assays and other assays indicative of tumor promoting activity, binding assays capable of determining the extent to which a therapeutic composition will inhibit the binding of 24P4C12 to a binding partner, etc.
  • a 24P4C12 therapeutic composition can be evaluated in a suitable animal model.
  • xenogenic prostate cancer models can be used, wherein human prostate cancer explants or passaged xenograft tissues are introduced into immune compromised animals, such as nude or SCID mice (Klein et a/., 1997, Nature Medicine 3: 402408).
  • PCT Patent Application W098/16628 and U.S. Patent 6,107,540 describe various xenograft models of human prostate cancer capable of recapitulating the development of primary tumors, micrometastasis, and the formation of osteoblastic metastases characteristic of late stage disease. Efficacy can be predicted using assays that measure inhibition of tumor formation, tumor regression or metastasis, and the like.
  • xenografts from tumor bearing mice treated with the therapeutic composition can be examined for the presence of apoptotic foci and compared to untreated control xenograft-bearing mice. The extent to which apoptotic foci are found in the tumors of the treated mice provides an indication of the therapeutic efficacy of the composition.
  • compositions used in the practice of the foregoing methods can be formulated into pharmaceutical compositions comprising a carrier suitable for the desired delivery method.
  • Suitable carriers include any material that when combined with the therapeutic composition retains the anti-tumor function of the therapeutic composition and is generally non-reactive with the patient's immune system. Examples indude, but are not limited to, any of a number of standard pharmaceutical carriers such as sterile phosphate buffered saline solutions, bacteriostatic water, and the like (see, generally, Remington's Pharmaceutical Sciences 16 th Edition, A. Osal., Ed., 1980).
  • Therapeutic formulations can be solubilized and administered via any route capable of delivering the therapeutic composition to the tumor site.
  • Potentially effective routes of administration include, but are not limited to, intravenous, parenteral, intraperitoneal, intramuscular, intr atumor, intrader al, intraorgan, orthotopic, and the like.
  • a preferred formulation for intravenous injection comprises the therapeutic composition in a solution of preserved bacteriostatic water, sterile unpreserved water, and/or diluted in polyvinylchloride or polyethylene bags containing 0.9% sterile Sodium Chloride for Injection, USP.
  • Therapeutic protein preparations can be lyophilized and stored as sterile powders, preferably under vacuum, and then reconstituted in bacteriostatic water (containing for example, benzyl alcohol preservative) or in sterile water prior to injection.
  • Dosages and administration protocols for the treatment of cancers using the foregoing mettiods will vary with the method and the target cancer, and will generally depend on a number of other factors appredated in the art.
  • screening is performed to identify modulators that induce or suppress a particular expression profile, suppress or induce spedfic pathways, preferably generating the associated phenotype thereby.
  • having identified differentially expressed genes important in a particular state screens are performed to identify modulators that alter expression of individual genes, either increase or decrease.
  • screening is performed to identify modulators that alter a biological function of the expression product of a differentially expressed gene. Again, having identified the importance of a gene in a particular state, s ⁇ eens are performed to identify agents that bind and/or modulate the biological activity of the gene product.
  • screens are done for genes that are induced in response to a candidate agent.
  • a modulator one that suppresses a cancer expression pattern leading to a normal expression pattern, or a modulator of a cancer gene that leads to expression of the gene as in normal tissue
  • a s ⁇ een is performed to identify genes that are specifically modulated in response to the agent. Comparing expression profiles between normal tissue and agent-treated cancer tissue reveals genes that are not expressed in normal tissue or cancer tissue, but are expressed in agent treated tissue, and vice versa.
  • agent-specific sequences are identified and used by methods described herein for cancer genes or proteins. In particular these sequences and the proteins they encode are used in marking or identifying agent- treated cells.
  • antibodies are raised against the agent-induced proteins and used to target novel therapeutics to the treated cancer tissue sample.
  • Proteins, nudeic acids, and antibodies of the invention are used in screening assays.
  • the cancer-associated proteins, antibodies, nudeic acids, modified proteins and cells containing these sequences are used in screening assays, such as evaluating ttie effect of drug candidates on a "gene expression profile," expression profile of polypeptides or alteration of biological function.
  • the expression profiles are used, preferably in conjunction with high throughput s ⁇ eening techniques to allow monitoring for expression profile genes after treatment with a candidate agent (e.g., Davis, GF, etal, J Biol Screen 7:69 (2002); Zlokarnik, etal., Science 279:84-8 (1998); Heid, Genome Res 6:986- 94,1996).
  • a candidate agent e.g., Davis, GF, etal, J Biol Screen 7:69 (2002); Zlokarnik, etal., Science 279:84-8 (1998); Heid, Genome Res 6:986- 94,
  • the cancer proteins, antibodies, nucleic adds, modified proteins and cells containing the native or modified cancer proteins or genes are used in screening assays. That is, the present invention comprises methods for screening for compositions which modulate the cancer phenotype or a physiological function of a cancer protein of the invention. This is done on a gene itself or by evaluating the effect of drug candidates on a "gene expression profile" or biological function. In one embodiment, expression profiles are used, preferably in conjunction with high throughput screening techniques to allow monitoring after treatment with a candidate agent, see Zlokamik, supra.
  • a variety of assays are executed directed to the genes and proteins of the invention. Assays are run on an individual nucleic acid or protein level. That is, having identified a particular gene as up regulated in cancer, test compounds are screened for the ability to modulate gene expression or for binding to the cancer protein of the invention. "Modulation" in this context includes an increase or a decrease in gene expression. The preferred amount of modulation will depend on the original change of the gene expression in normal versus tissue undergoing cancer, with changes of at least 10%, preferably 50%, more preferably 100-300%, and in some embodiments 300-1000% or greater.
  • a gene exhibits a 4-fold increase in cancer tissue compared to normal tissue, a decrease of about four-fold is often desired; similarly, a 10-fold de ⁇ ease in cancer tissue compared to normal tissue a target value of a 10-fold increase in expression by the test compound is often desired.
  • Modulators that exacerbate the type of gene expression seen in cancer are also useful, e.g., as an upregulated target in further analyses.
  • the amount of gene expression is monitored using nucleic acid probes and the quantification of gene expression levels, or, alternatively, a gene product itself is monitored, e.g., through the use of antibodies to the cancer protein and standard immunoassays. Proteomics and separation techniques also allow for quantification of expression.
  • gene expression monitoring i.e., an expression profile
  • Such profiles will typically involve one or more of the genes of Figure 2.
  • cancer nucleic acid probes are attached to biochips to detect and quantify cancer sequences in a particular cell.
  • PCR can be used.
  • a series e.g., wells of a mi ⁇ otiter plate, can be used with dispensed primers in desired wells. A PCR reaction can then be performed and analyzed for each well.
  • Expression monitoring is performed to identify compounds that modify the expression of one or more cancer- asso ated sequences, e.g., a polynucleotide sequence set out in Figure 2.
  • a test modulator is added to the cells prior to analysis.
  • screens are also provided to identify agents that modulate cancer, modulate cancer proteins of the invention, bind to a cancer protein of the invention, or interfere with the binding of a cancer protein of the invention and an antibody or other binding partner.
  • high throughput screening methods involve providing a library containing a large number of potential therapeutic compounds (candidate compounds). Such "combinatorial chemical libraries" are then screened in one or more assays to identify those library members (particular chemical species or subclasses) that display a desired characteristic activity. The compounds thus identified can serve as conventional "lead compounds,” as compounds for screening, or as therapeutics.
  • combinatorial libraries of potential modulators are screened for an ability to bind to a cancer polypeptide or to modulate activity.
  • new chemical entities with useful properties are generated by identifying a chemical compound (called a "lead compound") with some desirable property or activity, e.g., inhibiting activity, creating variants of the lead compound, and evaluating the property and activity of those variant compounds.
  • HTS high throughput screening
  • gene expression monitoring is conveniently used to test candidate modulators (e g , protein, nudeic acid or small molecule) After the candidate agent has been added and the cells allowed to incubate for a period, the sample containing a target sequence to be analyzed is, e g , added to a biochip
  • the target sequence is prepared using known techniques For example, a sample is treated to lyse the cells, using known lysis buffers, electroporation, etc , with purification and/or amplification such as PCR performed as appropnate For example, an in vitro transcription with labels covalently attached to the nucleotides is performed Generally, the nucleic acids are labeled with biot -FITC or PE, or with cy3 or cy5
  • the target sequence can be labeled with, e g , a fluorescent, a chemiluminescent, a chemical, or a radioactive signal, to provide a means of detecting the target sequence's specific binding to a probe
  • the label also can be an enzyme, such as alkaline phosphatase or horseradish peroxidase, which when provided with an appropriate substrate produces a product that is detected
  • the label is a labeled compound or small molecule, such as an enzyme inhibitor, that binds but is not catalyzed or altered by the enzyme
  • the label also can be a moiety or compound, such as, an epitope tag or biotin which specifically binds to sfreptavidin
  • the sfreptavidin is labeled as described above, thereby, providing a detectable signal for the bound target sequence Unbound labeled sfreptavidin is typically removed prior to analysis
  • these assays can be direct hybridization assays or can comprise "sandwich assays", which include the use of multiple probes, as is generally outlined in U S Patent Nos 5, 681,702, 5,597,909, 5,545,730, 5594,117, 5,591,584 5,571,670, 5,580,731, 5,571,670, 5,591,584, 5,624,802, 5,635,352, 5,594,118, 5,359,100, 5,124, 246, and 5,681,697
  • the target nucleic acid is prepared as outlined above, and then added to the biochip comp ⁇ sing a plurality of nucleic a ⁇ d probes, under conditions that allow the formation of a hybridization complex
  • a va ⁇ ety of hybridization conditions are used in the present invention, including high, moderate and low stnngency conditions as outlined above
  • the assays are generally run under stnngency conditions which allow formation of the label probe hybridization complex only in the presence of target Stringency can be controlled by altering a step parameter that is a thermodynamic vanable, including, but not limited to, temperature, formamide concentration, salt concentration, chaofropic salt concentration pH, organic solvent concentration, etc These parameters may also be used to control non-specific binding, as is generally outlined in U S Patent No 5,681,697 Thus, it can be desirable to perform certain steps at higher stnngency conditions to reduce non-specific binding
  • reaction may include a vanety of other reagents These include salts, buffers, neutral proteins, e g albumin, detergents, etc which can be used to facilitate optimal hybridization and detection, and/or reduce nonspe ⁇ fic or background interactions Reagents that otherwise improve the efficiency of the assay, such as protease inhibitors, nuclease inhibitors, anti-microbial agents, etc , may also be used as appropnate, depending on the sample preparation methods and purity of the target The assay data are analyzed to determine the expression levels of individual genes, and changes in expression levels as between states, forming a gene expression profile
  • the invention provides methods identify or s ⁇ een for a compound that modulates the activity of a cancer-related gene or protein of the invention
  • the methods compnse adding a test compound, as defined above, to a cell comp ⁇ sing a cancer protein of the invention
  • the cells contain a recombinant nudeic a ⁇ d that encodes a cancer protein of the invention
  • a library of candidate agents is tested on a plurality of cells
  • the assays are evaluated in the presence or absence or previous or subsequent exposure of physiological signals, e.g.
  • pharmacological agents including chemotherapeutics, radiation, carcinogenics, or other cells (i.e., cell-cell contacts).
  • the determinations are made at different stages of the cell cycle process. In this way, compounds that modulate genes or proteins of the invention are identified. Compounds with pharmacological activity are able to enhance or interfere with the activity of the cancer protein of the invention. Once identified, similar structures are evaluated to identify critical structural features of the compound.
  • a method of modulating (e.g., inhibiting) cancer cell division comprises administration of a cancer modulator.
  • a method of modulating (e.g., inhibiting) cancer is provided; the method comprises administration of a cancer modulator.
  • methods of treating cells or individuals with cancer are provided; the method comprises administration of a cancer modulator.
  • a method for modulating the status of a cell that expresses a gene of the invention comprises such art-accepted parameters such as growth, proliferation, survival, function, apoptosis, senescence, location, enzymatic activity, signal transduction, etc. of a cell.
  • a cancer inhibitor is an antibody as discussed above.
  • the cancer inhibitor is an antisense molecule.
  • a variety of cell growth, proliferation, and metastasis assays are known to those of skill in the art, as described herein.
  • the assays to identify suitable modulators are amenable to high throughput screening. Preferred assays thus detect enhancement or inhibition of cancer gene transcription, inhibition or enhancement of polypeptide expression, and inhibition or enhancement of polypeptide activity.
  • modulators evaluated in high throughput screening methods are proteins, often naturally occurring proteins or fragments of naturally occurring proteins.
  • proteins e.g., cellular extracts containing proteins, or random or directed digests of proteinaceous cellular extracts, are used.
  • libraries of proteins are made for screening in the methods of the invention.
  • Particularly preferred in this embodiment are libraries of bacterial, fungal, viral, and mammalian proteins, with the latter being preferred, and human proteins being especially preferred.
  • Particularly useful test compound will be directed to the ensemble of proteins to which the target belongs, e.g., substrates for enzymes, or ligands and receptors.
  • Normal cells require a solid substrate to attach and grow. When cells are transformed, they lose this phenotype and grow detached from the substrate. For example, transformed cells can grow in stirred suspension culture or suspended in semi-solid media, such as semi-solid or soft agar. The transformed cells, when transfected with tumor suppressor genes, can regenerate normal phenotype and once again require a solid subsfrate to attach to and grow. Soft agar growth or colony formation in assays are used to identify modulators of cancer sequences, which when expressed in host cells, inhibit abnormal cellular proliferation and transformation. A modulator reduces or eliminates the host cells' ability to grow suspended in solid or semisolid media, such as agar.
  • Normal cells typically grow in a flat and organized pattern in cell culture until they touch other cells. When the cells touch one another, they are contact inhibited and stop growing. Transformed cells, however, are not contact inhibited and continue to grow to high densities in disorganized foci. Thus, transformed cells grow to a higher saturation density than corresponding normal cells. This is detected morphologically by the formation of a disoriented monolayer of cells or cells in foci. Alternatively, labeling index with ( 3 H)-thymidine at saturation density is used to measure density limitation of growth, similarly an MTT or Alamar blue assay will reveal proliferation capacity of cells and the the ability of modulators to affect same. See Freshney (1994), supra. Transformed cells, when transfected with tumor suppressor genes, can regenerate a normal phenotype and become contact inhibited and would grow to a lower density.
  • labeling index with 3 H)-thymidine at saturation density is a preferred method of measuring density limitation of growth.
  • Transformed host cells are transfected with a cancer-associated sequence and are grown for 24 hours at saturation density in non-limiting medium conditions.
  • the percentage of cells labeling with ( 3 H)-thymidine is determined by incorporated cpm.
  • a modulator reduces or eliminates contact independent growth, and returns the cells to a normal phenotype.
  • Transformed cells have lower serum dependence than their normal counterparts (see, e.g., Temin, J. Natl. Cancer Inst, 37:167-175 (1966); Eagle et al., J. Exp. Med 131:836-879 (1970)); Freshney, supra. This is in part due to release of - various growth factors by the transformed cells.
  • the degree of growth factor or serum dependence of fransformed host cells can be compared with that of control. For example, growth factor or serum dependence of a cell is monitored in methods to identify and characterize compounds that modulate cancer-associated sequences of the invention.
  • Tumor cells release an increased amount of certain factors (hereinafter "tumor specific markers") than their normal counterparts.
  • plas inogen activator PA
  • Tumor Angiogenesis Factor TAF
  • TAF Tumor Angiogenesis Factor
  • the degree of invasiveness into Matrigel or an extracellular matrix constituent can be used as an assay to identify and characterize compounds that modulate cancer associated sequences.
  • Tumor cells exhibit a positive correlation between malignancy and invasiveness of cells into Matrigel or some other extracellular matrix constituent.
  • tumorigenic cells are typically used as host cells. Expression of a tumor suppressor gene in these host cells would decrease invasiveness of the host cells. Techniques described in Cancer Res. 1999; 59:6010; Freshney (1994), supra, can be used. Briefly, the level of invasion of host cells is measured by using filters coated with Matrigel or some other extracellular matrix constituent.
  • Penetration into the gel, or through to the distal side of the filter, is rated as invasiveness, and rated histologically by number of cells and distance moved, or by prelabeling the cells with 125 1 and counting the radioactivity on the distal side of the filter or bottom of the dish. See, e.g., Freshney (1984), supra.
  • Transgenic organisms are prepared in a variety of art-accepted ways. For example, knock-out transgenic organisms, e.g., mammals such as mice, are made, in which a cancer gene is disrupted or in which a cancer gene is inserted. Knock-out transgenic mice are made by insertion of a marker gene or other heterologous gene into the endogenous cancer gene site in the mouse genome via homologous recombination. Such mice can also be made by substituting the endogenous cancer gene with a mutated version of the cancer gene, or by mutating the endogenous cancer gene, e.g., by exposure to carcinogens.
  • transgenic chimeric animals e.g., mice
  • a DNA construct is introduced into the nuclei of embryonic stem cells.
  • Cells containing the newly engineered genetic lesion are injected into a host mouse embryo, which is re- implanted into a recipient female. Some of these embryos develop into chimeric mice that possess germ cells some of which are derived from the mutant cell line. Therefore, by breeding the chimeric mice it is possible to obtain a new line of mice containing the infroduced genetic lesion (see, e.g., Capecchi etal., Science 244:1288 (1989)).
  • Chimeric mice can be derived according to US Patent 6,365,797, issued 2 April 2002; US Patent 6,107,540 issued 22 August 2000; Hogan et al., Manipulating the Mouse Embryo: A laboratory Manual, Cold Spring Harbor Laboratory (1988) and Teratocarcinomas and Embryonic Stem Cells: A Practical Approach, Robertson, ed., IRL Press, Washington, D.C., (1987).
  • various immune-suppressed or immune-deficient host animals can be used.
  • a genetically athymic "nude” mouse see, e.g., Giovanella et al., J. Natl. Cancer Inst. 52:921 (1974)
  • SCID mouse see, e.g., Giovanella et al., J. Natl. Cancer Inst. 52:921 (1974)
  • SCID mouse e.g., a thymectornized mouse
  • an irradiated mouse see, e.g., Bradley et al., Br. J. Cancer 38:263 (1978); Selby et al., Br. J. Cancer 41:52 (1980)
  • Transplantable tumor cells typically about 10 s cells
  • isogenic hosts produce invasive tumors in a high proportion of cases, while normal cells of similar origin will not.
  • cells expressing cancer-associated sequences are injected subcutaneously or orthotopically. Mice are then separated into groups, including confrol groups and treated experimental groups) e.g. treated with a modulator).
  • tumor growth is measured (e.g., by volume or by its two largest dimensions, or weight) and compared to the control. Tumors that have statistically significant reduction (using, e.g., Student's T test) are said to have inhibited growth.
  • Assays to identify compounds with modulating activity can be performed in vitro.
  • a cancer polypeptide is first contacted with a potential modulator and incubated for a suitable amount of time, e.g., from 0.5 to 48 hours.
  • the cancer polypeptide levels are determined in vitro by measuring the level of protein or mRNA.
  • the level of protein is measured using immunoassays such as Western blotting, ELISA and the like with an antibody that selectively binds to the cancer polypeptide or a fragment thereof.
  • amplification e.g., using PCR, LCR, or hybridization assays, e. g., Northern hybridization, RNAse protection, dot blotting, are preferred.
  • the level of protein or mRNA is detected using directly or indirectly labeled detection agents, e.g., fluorescentJy or radioactively labeled nucleic acids, radioactively or enzymatically labeled antibodies, and the like, as described herein.
  • directly or indirectly labeled detection agents e.g., fluorescentJy or radioactively labeled nucleic acids, radioactively or enzymatically labeled antibodies, and the like, as described herein.
  • a reporter gene system can be devised using a cancer protein promoter operably linked to a reporter gene such as luciferase, green fluorescent protein, CAT, or P-gal.
  • the reporter construct is typically transfected into a cell. After treatment with a potential modulator, the amount of reporter gene trans ⁇ iption, translation, or activity is measured according to standard techniques known to those of skill in the art (Davis GF, supra; Gonzalez, J. & Negulescu, P. Curr. Opin. Biotechnol. 1998: 9:624).
  • in vitro screens are done on individual genes and gene products. That is, having identified a particular differentially expressed gene as important in a particular state, screening of modulators of the expression of the gene or the gene product itself is performed.
  • screening for modulators of expression of specific gene(s) is performed. Typically, the expression of only one or a few genes is evaluated. In another embodiment, screens are designed to first find compounds that bind to differentially expressed proteins. These compounds are then evaluated for the ability to modulate differentially expressed activity. Moreover, once initial candidate compounds are identified, variants can be further screened to better evaluate structure activity relationships.
  • a purified or isolated gene product of the invention is generally used.
  • antibodies are generated to a protein of the invention, and immunoassays are run to determine the amount and/or location of protein.
  • cells comprising the cancer proteins are used in the assays.
  • the methods comprise combining a cancer protein of the invention and a candidate compound such as a ligand, and determining the binding of the compound to the cancer protein of the invention.
  • a cancer protein of the invention utilizes the human cancer protein; animal models of human disease of can also be developed and used.
  • other analogous mammalian proteins also can be used as appreciated by those of skill in the art.
  • variant or derivative cancer proteins are used.
  • the cancer protein of the invention, or the ligand is non-diffusibly bound to an insoluble support.
  • the support can, e.g., be one having isolated sample receiving areas (a mi ⁇ otiter plate, an array, etc.).
  • the insoluble supports can be made of any composition to which the compositions can be bound, is readily separated from soluble material, and is otherwise compatible with the overall method of screening.
  • the surface of such supports can be solid or porous and of any convenient shape.
  • suitable insoluble supports include microtiter plates, arrays, membranes and beads. These are typically made of glass, plastic (e.g., polystyrene), polysaccharide, nylon, nitrocellulose, or TeflonTM, etc. Microtiter plates and arrays are especially convenient because a large number of assays can be carried out simultaneously, using small amounts of reagents and samples. The particular manner of binding of the composition to the support is not crucial so long as it is compatible with the reagents and overall methods of the invention, maintains the activity of the composition and is nondiffusable.
  • Preferred methods of binding include the use of antibodies which do not sterically block either the ligand binding site or activation sequence when attaching the protein to the support, direct binding to "sticky" or ionic supports, chemical crosslinking, the synthesis of the protein or agent on the surface, etc. Following binding of the protein or ligand/binding agent to the support, excess unbound material is removed by washing. The sample receiving areas may then be blocked through incubation with bovine serum albumin (BSA), casein or other innocuous protein or other moiety.
  • BSA bovine serum albumin
  • Binding agents include specific antibodies, non-natural binding agents identified in screens of chemical libraries, peptide analogs, etc.
  • assays to identify agents that have a low toxidty for human cells.
  • a wide variety of assays can be used for this purpose, including proliferation assays, cAMP assays, labeled in vitro protein-protein binding assays, elect, ophoretic mobility shift assays, immunoassays for protein binding, functional assays (phosphorylation assays, etc.) and the like.
  • a determination of binding of the test compound (ligand, binding agent, modulator, etc.) to a cancer protein of the invention can be done in a number of ways.
  • the test compound can be labeled, and binding determined directly, e.g., by attaching all or a portion of the cancer protein of the invention to a solid support, adding a labeled candidate compound (e.g., a fluorescent label), washing off excess reagent, and determining whether the label is present on the solid support.
  • a labeled candidate compound e.g., a fluorescent label
  • washing off excess reagent e.g., a fluorescent label
  • determining whether the label is present on the solid support.
  • Various blocking and washing steps can be utilized as appropriate.
  • only one of the components is labeled, e.g., a protein of the invention or ligands labeled.
  • more than one component is labeled with different labels, e.g., I 125 , for the proteins and a fiuorophor for the compound.
  • Proximity reagents e.g., quenching or energy transfer reagents are also useful.
  • the binding of the "test compound” is determined by competitive binding assay with a "competitor.”
  • the competitor is a binding moiety that binds to the target molecule (e.g., a cancer protein of the invention). Competitors include compounds such as antibodies, peptides, binding partners, ligands, etc. Under certain circumstances, the competitive binding between the test compound and the competitor displaces the test compound.
  • the test compound is labeled. Either the test compound, the competitor, or both, is added to the protein for a time sufficient to allow binding. Incubations are performed at a temperature that fadlitates optimal activity, typically between four and 40°C.
  • Incubation periods are typically optimized, e.g., to fadlitate rapid high throughput screening; typically between zero and one hour will be sufficient. Excess reagent is generally removed or washed away. The second component is then added, and the presence or absence of the labeled component is followed, to indicate binding.
  • the competitor is added first, followed by the test compound.
  • Displacement of the competitor is an indication that the test compound is binding to the cancer protein and thus is capable of binding to, and potentially modulating, the activity of the cancer protein.
  • either component can be labeled.
  • the presence of label in the post-test compound wash solution indicates displacement by the test compound.
  • the presence of the label on the support indicates displacement.
  • the test compound is added first, with incubation and washing, followed by the competitor.
  • the absence of binding by the competitor indicates that the test compound binds to the cancer protein with higher affinity than the competitor.
  • the presence of the label on the support, coupled with a lack of competitor binding indicates that the test compound binds to and thus potentially modulates the cancer protein of the invention.
  • the competitive binding methods comprise differential screening to identity agents that are capable of modulating the activity of the cancer proteins of the invention.
  • the methods comprise combining a cancer protein and a competitor in a first sample.
  • a second sample comprises a test compound, the cancer protein, and a competitor.
  • the binding of the competitor is determined for both samples, and a change, or difference in binding between the two samples indicates the presence of an agent capable of binding to the cancer protein and potentially modulating its activity. That is, if the binding of the competitor is different in the second sample relative to the first sample, the agent is capable of binding to the cancer protein.
  • differential screening is used to identify drug candidates that bind to the native cancer protein, but cannot bind to modified cancer proteins.
  • the structure of the cancer protein is modeled and used in rational drug design to synthesize agents that interact with that site, agents which generally do not bind to site-modified proteins.
  • drug candidates that affect the activity of a native cancer protein are also identified by screening drugs for the ability to either enhance or reduce the activity of such proteins.
  • Positive controls and negative controls can be used in the assays
  • confrol and test samples are performed in at least triplicate to obtain statistically significant results
  • Incubation of all samples occurs for a time sufficient to allow for the binding of the agent to the protein
  • samples are washed free of non-spe ⁇ fically bound material and the amount of bound, generally labeled agent determined
  • the samples can be counted in a scintillation counter to determine the amount of bound compound
  • va ⁇ ety of other reagents can be included m the screening assays These include reagents like salts, neutral proteins, e g albumin, detergents, etc which are used to facilitate optimal protein-protein binding and/or reduce non-specific or background interactions Also reagents that otherwise improve the efficiency of the assay such as protease inhibitors nuclease inhibitors, anti-microbial agents, etc can be used The mixture of components is added in an order that provides for the requisite binding
  • Polynudeotide modulators of cancer can be introduced into a cell containing the target nucleotide sequence by formation of a conjugate with a ligand-bindmg molecule, as described in WO 91/04753
  • Suitable gand-binding molecules include, but are not limited to, cell surface receptors, growth factors, other cytokines, or other ligands that bind to cell surface receptors
  • conjugation of the ligand binding molecule does not substantially interfere with the ability of the ligand binding molecule to bind to its corresponding molecule or receptor, or block entry of the sense or antisense oligonucleotide or its conjugated version into the cell
  • a polynucleotide modulator of cancer can be introduced into a cell containing the target nucleic acid sequence e g , by formation of a polyn u cleotide-lipid complex, as described in WO 90/10448 It is understood that the use of antisense molecules or knock out and knock in models may also
  • the activity of a cancer-associated protein is down-regulated, or entirely inhibited, by the use of antisense polynucleotide or inhibitory small nudear RNA (snRNA), i e , a nucleic acid complementary to, and which can preferably hybridize specifically to, a coding mRNA nucleic acid sequence, e g , a cancer protein of the invention, mRNA, or a subsequence thereof Binding of the antisense polynucleotide to the mRNA reduces the translation and/or stability of the mRNA
  • snRNA inhibitory small nudear RNA
  • antisense polynudeotides can comprise naturally occumng nudeotides, or synthetic species formed from naturally occurring subunits or their close homologs
  • Antisense polynucleotides may also have altered sugar moieties or inter-sugar linkages Exemplary among these are the phosphorothioate and other sulfur containing species which are known for use in the art Analogs are comprised by this invention so long as they function effectively to hybndize with nucleotides of the invention See, e g , Isis Pharmaceuticals, Carlsbad, CA, Sequitor, Inc , Natick, MA
  • antisense polynucleotides can readily be synthesized using recombinant means, or can be synthesized in vitro Equipment for such synthesis is sold by several vendors, including Applied Biosystems The preparation of other oligonucleotides such as phosphor othioates and alkylated derivatives is also well known to those of skill in the art
  • Antisense molecules as used herein include antisense or sense ohgonudeotides
  • Sense oligonucleotides can, e g , be employed to block transaction by binding to the anti-sense strand
  • the antisense and sense oligonucleotide comprise a single stranded nucleic acid sequence (either RNA or DNA) capable of binding to target mRNA (sense) or DNA (antisense) sequences for cancer molecules
  • Antisense or sense oligonucleotides, according to the present invention comp ⁇ se a fragment generally at least about 12 nucleotides, preferably from about 12 to 30 nucleotides
  • Stein &Cohen Cancer Res. 48:2659 (1988 and van der Krol et al. (BioTechniques 6:958 (1988)).
  • ribozymes can be used to target and inhibit transcription of cancer- associated nucleotide sequences.
  • a ribozyme is an RNA molecule that catalytically cleaves other RNA molecules.
  • Different kinds of ribozymes have been described, including group I ribozymes, hammerhead ribozymes, hairpin ribozymes, RNase P, and axhead ribozymes (see, e.g., Castanotto et al., Adv. in Pharmacology 25: 289-317 (1994) for a general review of the properties of different ribozymes).
  • hairpin ribozymes are described, e.g., in Hampel et al., Nucl. Acids Res. 18:299-304 (1990); European Patent Publication No. 0360257; U.S. Patent No. 5,254,678.
  • Methods of preparing are well known to those of skill in the art (see, e.g., WO 94/26877; Ojwang et al., Proc. Natl. Acad. Sci. USA 90:6340-6344 (1993); Yamada et al., Human Gene Therapy 1 :3945 (1994); Leavitt et al., Proc. Natl. Acad Sci. USA 92:699- 703 (1995); Leavitt et al., Human Gene Therapy 5: 1151-120 (1994); and Yamada et al., Virology 205: 121-126 (1994)).
  • a test compound is administered to a population of cancer cells, which have an associated cancer expression profile.
  • administration or “contacting” herein is meant that the modulator is added to the cells in such a manner as to allow the modulator to act upon the cell, whether by uptake and intracellular action, or by action at the cell surface.
  • a nucleic acid encoding a proteinaceous agent i.e., a peptide
  • a viral construct such as an adenoviral or retroviral construct
  • expression of the peptide agent is accomplished, e.g., PCT US97/01019.
  • Regulatable gene therapy systems can also be used.
  • the cells are washed if desired and are allowed to incubate under preferably physiological conditions for some period.
  • the cells are then harvested and a new gene expression profile is generated.
  • cancer tissue is screened for agents that modulate, e.g., induce or suppress, the cancer phenotype.
  • a change in at least one gene, preferably many, of the expression profile indicates that the agent has an effect on cancer activity.
  • altering a biological function or a signaling pathway is indicative of modulator activity.
  • screens are done to assess genes or gene products. That is, having identified a particular differentially expressed gene as important in a particular state, s ⁇ eening of modulators of either the expression of the gene or the gene product itself is performed.
  • Measurements of cancer polypeptide activity, or of the cancer phenotype are performed using a variety of assays. For example, the effeds of modulators upon the function of a cancer polypeptide(s) are measured by examining parameters described above. A physiological change that affects activity is used to assess the influence of a test compound on the polypeptides of this invention.
  • the invention provides methods for identifying cells containing variant cancer genes, e.g., determining the presence of, all or part, the sequence of at least one endogenous cancer gene in a cell. This is accomplished using any number of sequencing techniques.
  • the invention comprises methods of identifying the cancer genotype of an individual, e.g., determining all or part of the sequence of at least one gene of the invention in the individual. This is generally done in at least one tissue of the individual, e.g., a tissue set forth in Table I, and may include the evaluation of a number of tissues or different samples of the same tissue.
  • the method may indude comparing the sequence of the sequenced gene to a known cancer gene, i.e., a wild-type gene to determine the presence of family members, homologies, mutations or variants.
  • the sequence of all or part of the gene can then be compared to the sequence of a known cancer gene to determine if any differences exist, This is done using any number of known homology programs, such as BLAST, Bestfit, etc.
  • the presence of a difference in the sequence between the cancer gene of the patient and the known cancer gene correlates with a disease state or a propensity for a disease state, as outlined herein.
  • the cancer genes are used as probes to determine the number of copies of the cancer gene in the genome.
  • the cancer genes are used as probes to determine the chromosomal localization of the cancer genes.
  • Information such as chromosomal localization finds use in providing a diagnosis or prognosis in particular when chromosomal abnormalities such as translocations, and the like are identified in the cancer gene locus.
  • kits are also within the scope of the invention.
  • Such kits can comprise a carrier, package or container that is compartmentalized to receive one or more containers such as vials, tubes, and the like, each of the container(s) comprising one of the separate elements to be used in the method.
  • the container (s) can comprise a probe that is or can be detectably labeled.
  • probe can be an antibody or polynucleotide specific for a Figure 2-related protein or a Figure 2 gene or message, respectively.
  • the kit can also have containers containing nucleotide(s) for amplification of the target nucleic acid sequence and/or a container comprising a reporter-means, such as a biotin-binding protein, such as avidin or sfreptavidin, bound to a reporter molecule, such as an enzymatic, florescent, or radioisotope label.
  • a reporter-means such as a biotin-binding protein, such as avidin or sfreptavidin
  • the kit can include all or part of the amino acid sequences in Figure 2 or Figure 3 or analogs thereof, or a nucleic acid molecules that encodes such amino acid sequences.
  • the kit of the invention will typically comprise the container described above and one or more other containers comprising materials desirable from a commercial and user standpoint, induding buffers, diluents, filters, needles, syringes; carrier, package, container, vial and/or tube labels listing contents and/or instructions for use, and package inserts with instructions for use.
  • a label can be present on the container to indicate that the composition is used for a specific therapy or non-therapeutic application, such as a diagnostic or laboratory application, and can also indicate directions for either in vivo or in vitro use, such as those described herein. Directions and or other information can also be induded on an insert(s) or label(s) which is induded with or on the kit.
  • an article(s) of manufacture containing compositions such as amino add sequence(s), small molecule(s), nucleic add sequence(s), and/or antibody(s), e.g., materials useful for the diagnosis, prognosis, prophylaxis and/or treatment of neoplasias of tissues such as those set forth in Table I is provided.
  • the article of manufacture typically comprises at least one container and at least one label. Suitable containers include, for example, bottles, vials, syringes, and test tubes. The containers can be formed from a variety of materials such as glass or plastic.
  • the container can hold amino acid sequence(s), small molecule(s), nucleic acid sequence(s), and/or antibody(s), in one embodiment the container holds a polynucleotide for use in examining the mRNA expression profile of a cell,, together with reagents used for this purpose.
  • the container can alternatively hold a composition which is effective for freating, diagnosis, prognosing or prophylaxing a condition and can have a sterile access port (for example the container can be an intravenous solution bag or a vial having a stopper pierceable by a hypodermic injection needle).
  • the active agents in the composition can be an antibody capable of specifically binding 24P4C12 and modulating the function of 24P4C12.
  • the label can be on or associated with the container.
  • a label a can be on a container when letters, numbers or other characters forming the label are molded or etched into the container itself; a label can be associated with a container when it is present within a receptacle or carrier that also holds the container, e.g., as a package insert.
  • the label can indicate that the composition is used for diagnosing, treating, prophylaxing or prognosing a condition, such as a neoplasia of a tissue set forth in Table I.
  • the article of manufacture can further comprise a second container comprising a pharmaceutically-acceptable buffer, such as phosphate-buffered saline, Ringer's solution and/ordextrose solution. It can further include other materials desirable from a commercial and user standpoint, including other buffers, diluents, filters, stirrers, needles, syringes, and/or package inserts with indications and/or instructions for use.
  • Example 1 SSH-Generated Isolation of cDNA Fragment of the 24P4C12 Gene
  • SSH Suppression Subtractive Hybridization
  • the 24P4C12 SSH cDNA of 160 bp is listed in Figure 1.
  • the full length 24P4C12 cDNAs and ORFs are described in Figure 2 with the protein sequences listed in Figure 3.
  • the patient cancer and normal tissues were purchased from different sources such as the NDRI (Philadelphia, PA).
  • mRNA for some normal tissues were purchased from Clontech, Palo Alto, CA.
  • Tissues were homogenized in Trizol reagent (Life Technologies, Gibco BRL) using 10 ml/ g tissue isolate total RNA. Poly A RNA was purified from total RNA using Qiagen's Oligotex mRNA Mini and Midi kits. Total and mRNA were quantified by spectr ophotometric analysis (O.D. 260/280 nm) and analyzed by gel electrophoresis.
  • DPNCDN (cDNA synthesis primer): 5'TTTTGATCAAGCTT3o3' (SEQ ID NO: 33)
  • Adaptor 1 5'TTTTGATCAAGCTT3o3' (SEQ ID NO: 33)
  • Nested primer (NP)1 was
  • Nested primer (NP)2 5 ⁇ GCGTGGTCGCGGCCGAGGA3' (SEQ ID NO: 40)
  • SSH Suppression Subtractive Hybridization
  • the gene 24P4C12 sequence was derived from LAPC4AD prostate cancer xenograft minus begnin prostatic hyperplasia cDNA subtraction.
  • the SSH DNA sequence ( Figure 1) was identified.
  • the cDNA derived from a pool of normal tissues and benign prostatic hyperplasia was used as the source of the "driver” cDNA, while the cDNA from LAPC4AD xenograft was used as the source of the "tester” cDNA.
  • Double stranded cDNAs corresponding to tester and driver cDNAs were synthesized from 2 ⁇ g of poly(A) + RNA isolated from the relevant xenograft tissue, as described above, using CLONTECH's PCR-Select cDNA Subtraction Kit and 1 ng of oligonucleotide DPNCDN as primer. First- and second-strand synthesis were carried out as described in the Kit's user manual protocol (CLONTECH Protocol No. PT1117-1, Catalog No. K1804-1). The resulting cDNA was digested with Dpn II for 3 hrs at 37°C Digested cDNA was extracted with phenol/chloroform (1:1) and ethanol precipitated.
  • Driver cDNA was generated by combining in a 1:1 ratio Dpn II digested cDNA from the relevant tissue source (see above) with a mix of digested cDNAs derived from the nine normal tissues: stomach, skeletal muscle, lung, brain, liver, kidney, pancreas, small intestine, and heart.
  • Tester cDNA was generated by diluting 1 ⁇ l of Dpn II digested cDNA from the relevant tissue source (see above) (400 ng) in 5 ⁇ J of water. The diluted cDNA (2 ⁇ l, 160 ng) was then ligated to 2 ⁇ l of Adaptor 1 and Adaptor 2 (10 ⁇ M), in separate ligation reactions, in a total volume of 10 ⁇ l at 16°C overnight, using 400 u of T4 DNA ligase (CLONTECH). Ligation was terminated with 1 ⁇ l of 0.2 M EDTA and heating at 72°C for 5 min.
  • the first hybridization was performed by adding 1.5 ⁇ l (600 ng) of driver cDNA to each of two tubes containing 1.5 ⁇ l (20 ng) Adaptor 1- and Adaptor 2- ligated tester cDNA.
  • the samples were overiaid with mineral oil, denatured in an M J Research thermal cyder at 98°C for 1.5 minutes, and then were allowed to hybridize for 8 hrs at 68°C.
  • the two hybridizations were then mixed together with an additional 1 ⁇ l of fresh denatured driver cDNA and were allowed to hybridize overnight at 68°C.
  • the second hybridization was then diluted in 200 ⁇ l of 20 mM Hepes, pH 8.3, 50 mM NaCl, 0.2 mM EDTA, heated at 70°C for 7 min. and stored at -20°C.
  • PCR 1 was conducted using the following conditions: 75°C for 5 min., 94°C for 25 sec, then 27 cycles of 94°C for 10 sec, 66°C for 30 sec, 72°C for 1.5 min. Five separate primary PCR reactions were performed for each experiment.
  • PCR 2 was performed using 10-12 cycles of 94°C for 10 sec, 68°C for 30 sec, and 72°C for 1.5 minutes. The PCR products were analyzed using 2% agarose gel electrophoresis.
  • PCR products were inserted into pCR2.1 using the T/A vector cloning kit (Invitrogen). Transformed E coli were subjected to blue/white and ampicillin selection. White colonies were picked and arrayed into 96 well plates and were grown in liquid culture overnight. To identify inserts, PCR amplification was performed on 1 ul of bacterial culture using the conditions of PCR1 and NP1 and NP2 as primers. PCR products were analyzed using 2% agarose gel electrophoresis.
  • Bacterial clones were stored in 20% glycerol in a 96 well format. Plasmid DNA was prepared, sequenced, and subjected to nudeic acid homology searches of the GenBank, dBest, and NCI-CGAP databases.
  • First strand cDNAs can be generated from 1 ⁇ g of mRNA with oligo (dT)12-18 priming using the Gibco-BRL Superscript Prea plification system. The manufacturer's protocol was used which included an incubation for 50 min at 42°C with reverse transcriptase followed by RNAse H treatment at 37°C for 20 min. After completing the reaction, the volume can be increased to 200 ui with water prior to normalization. First strand cDNAs from 16 different normal human tissues can be obtained from Clontech.
  • Normalization of the first strand cDNAs from multiple tissues was performed by using the primers 5'atatcgccgcgctcgtcgtcgacaa3' (SEQ ID NO. 41) and 5'agccacacgcagctcattgtagaagg 3' (SEQ ID NO: 42) to amplify ⁇ -actin.
  • First strand cDNA (5 ⁇ l) were amplified in a total volume of 50 ⁇ l containing 0.4 ⁇ M primers, 0.2 ⁇ M each dNTPs, 1XPCR buffer (Clontech, 10 mM Tris-HCL, 1.5 mM MgCfc, 50 mM KCl, pH8.3) and 1X Klentaq DNA polymerase (Clontech). Five ⁇ l of the PCR reaction can be removed at 18, 20, and 22 cycles and used for agarose gel electrophoresis.
  • PCR was performed using an MJ Research thermal cyder under the following conditions: Initial denaturation can be at 94»C for 15 sec, followed by a 18, 20, and 22 cycles of 94°C for 15, 65°C for 2 min, 72°C for 5 sec. A final extension at 72°C was carried out for 2 min. After agarose gel electrophoresis, the band intensities of the 283 b.p. ⁇ -actin bands from multiple tissues were compared by visual inspection. Dilution factors for the first strand cDNAs were calculated to result in equal ⁇ -actin band intensities in all tissues after 22 cydes of PCR. Three rounds of normalization can be required to achieve equal band intensities in all tissues after 22 cydes of PCR.
  • the 24P4C12 SSH cDNA sequence was derived from a substraction consisting of LAPC4AD xenograft minus benign prostatic hyperplasia.
  • the SSH cDNA sequence ( Figure 1) was designated 24P4C12.
  • the isolated gene fragment of 160 bp encodes a putative open reading frame (ORF) of 53 amino acids and exhibits significant homology to an EST derived from a colon tumor library.
  • ORF putative open reading frame
  • Two larger cDNA clones were obtained by gene trapper experiments, GTE9 and GTF8.
  • the ORF revealed a significant homology to the mouse gene NG22 and the C.elegans gene CEESB82F.
  • NG22 was recently identified as one of many ORFs within a genomic BAC clone that encompasses the MHC class III in the mouse genome. Both NG22 and CEESB82F appear to be genes that contain 12 transmembrane domains.
  • 24P4C12 contains 12 transmembrane domains and is the human homologue of mouse NG22 and C. elegans CEESB82F. Functional studies in Ce. elegans may reveal the biological role of these homologs. If 24P4C12 is a cell surface marker, then it may have an application as a potential imaging reagent and/or therapeutic target in prostate cancer.
  • the 24P4C12 v.1 of 2587 bp codes for a protein of 710 amino acids ( Figure 2 and Figure 3).
  • Other variants of 24P4C12 were also identified and these are listed in Figures 2 and 3.24P4C12 v.1, v.3, v,5 and v.6 proteins are 710 amino acids in length and differ from each other by one amino acid as shown in Figure 11.
  • 24P4C12 v.2 and v.4 code for the same protein as 24P4C12 v.1.
  • 24P4C12 v.7, v.8 and v.9 are alternative splice variants and code for proteins of 598, 722 and 712 amino adds in length, respectively.
  • Chromosomal localization can implicate genes in disease pathogenesis.
  • FISH fluorescent in situ hybridization
  • RH human/hamster radiation hybrid
  • human-rodent somatic cell hybrid panels such as is available from the Coriell Institute (Camden, New Jersey)
  • NCBI National National Cancer Institute
  • First strand cDNA was generated from vital pool 1 (kidney, liver and lung), vital pool 2 (colon, pancreas and stomach), a pool of prostate cancer xenografts (LAPC4AD, LAPC4AI, LAPC-9AD and LAPC-9AI), prostate cancer pool, bladder cancer pool, kidney cancer pool, colon cancer pool, ovary cancer pool, breast cancer pool, and cancer metastasis pool. Normalization was performed by PCR using primers to actin. Semi-quantitative PCR, using primers to 24P4C12, was performed at 26 and 30 cydes of amplification.
  • Results show strong expression of 24P4C12 in prostate cancer pool and ovary cancer pool. Expression was also detected in prostate cancer xenografts, bladder cancer pool, kidney cancer pool, colon cancer pool, breast cancer pool, cancer metastasis pool, vital pool 1 , and vital pool 2.
  • LAPC4AD LAPC4AI
  • LAPC-9AD LAPC-9AI
  • LNCaP PC-3, DU145, TsuPr, and LAPC- 4CL
  • Northern blot with 10 ⁇ g of total RNA/lane was probed with 24P4C12 SSH sequence. Size standards in kilobases (kb) are indicated on the side.
  • the 24P4C12 transcript was detected in LAPC4AD, LAPC4AI, LAPC-9AD, LAPC-9AI, LNCaP, and LAPC-4 CL
  • RNA was extracted from a pool of prostate cancer specimens, bladder cancer specimens, colon cancer specimens, ovary cancer specimens, breast cancer spedmens and cancer metastasis specimens, as well as from normal prostate (NP), normal bladder (NB), normal kidney (NK), and nomial colon (NC).
  • Northern blot with 10 ⁇ g of total RNA/lane was probed with 24P4C12 SSH sequence. Size standards in kilobases (kb) are indicated on the side. Strong expression of 24P4C12 transcript was detected in the patient cancer pool specimens, and in normal prostate but not in the other normal tissues tested.
  • Figure 20 displays expression results of 24P4C12 in lung cancer patient specimens.
  • Ma was extracted from lung cancer cell lines (CL: CALU-1, A427, NCI-H82, NCI-H146), normal lung (N), lung cancer patient tumors (T) and their matched normal adjacent tissues (Nat).
  • Northern blots with 10 ⁇ g of total RNA were probed with the 24P4C12 SSH fragment Size standards in kilobases are on the side. Results show expression of 24P4C12 in lung patient tumors tested, but not in normal lung. Expression was also detected in CALU-1 , but not in the other cell lines A427, NCI-H82, and NCI- HI 46.
  • 24P4C12 was assayed in a panel of human stomach and breast cancers (T) and their respective matched normal tissues (N) on RNA dot blots. 24P4C12 expression was seen in both stomach and breast cancers. The expression detected in normal adjacent tissues (isolated from diseased tissues) but not in normal tissues (isolated from healthy donors) may indicate that these tissues are not fully normal and that 24P4C12 may be expressed in early stage tumors.
  • First strand cDNA was prepared from a panel of ovary patient cancer specimens (A), uterus patient cancer specimens (B), prostate cancer specimens (C), bladder cancer patient specimens (D), lung cancer patient specimens (E), pancreas cancer patient spedmens (F), colon cancer specimens (G), and kidney cancer specimens (H). Normalization was performed by PCR using primers to actin. Semi-quantitative PCR, using primers to 24P4C12, was performed at 26 and 30 cycles of amplification. Samples were run on an agarose gel, and PCR products were quantitated using the Alphalmager software.
  • Results show expression of 24P4C12 in the majority of patient cancer specimens tested, 73.3% of ovary patient cancer spedmens, 83.3% of uterus patient cancer specimens, 95.0% of prostate cancer specimens, 61.1 % of bladder cancer patient specimens, 80.6% of lung cancer patient specimens, 87.5% of pancreas cancer patient spedmens, 87.5% of colon cancer spedmens, 68.4% of clear cell renal carcinoma, 100% of papillary renal cell carcinoma.
  • 24P4C12 is a potential therapeutic target and a diagnostic marker for human cancers.
  • Transcript variants are variants of mature mRNA from the same gene which arise by alternative transcription or alternative splicing.
  • Alternative transcripts are transcripts from the same gene but start transcription at different points.
  • Splice variants are mRNA variants spliced differently from the same transcript In eukaryotes, when a multi-exon gene is transcribed from genomic DNA, the initial RNA is spliced to produce functional mRNA, which has only exons and is used for translation into an amino acid sequence. Accordingly, a given gene can have zero to many alternative transcripts and each transcript can have zero to many splice variants.
  • Each transcript variant has a unique exon makeup, and can have different coding and/or non-coding (5' or 3' end) portions, from the original trans ⁇ ipt Transcript variants can code for similar or different proteins with the same or a similar function or can encode proteins with different functions, and can be expressed in the same tissue at the same time, or in different tissues at the same time, or in the same tissue at different times, or in different tissues at different times. Proteins encoded by transcript variants can have similar or different cellular or extracellular localizations, e.g., secreted versus intracellular.
  • Trans ⁇ ipt variants are identified by a variety of art-accepted methods. For example, alternative transcripts and splice variants are identified by full-length cloning experiment, or by use of full-length transcript and EST sequences. First, all human ESTs were grouped into clusters which show direct or indirect identity with each other. Second, ESTs in the same cluster were further grouped into sub-clusters and assembled into a consensus sequence. The original gene sequence is compared to the consensus sequence(s) or other full-length sequences. Each consensus sequence is a potential splice variant for that gene. Even when a variant is identified that is not a full-length clone, that portion of the variant is very useful for antigen generation and for further cloning of the full-length splice variant, using techniques known in the art.
  • Genomic-based transcript variant identification programs indude FgenesH (A. Salamov and V. Solovyev, "Ab initio gene finding in Drosophila genomic DNA,” Genome Research. 2000 April; 10(4):516-22); Grail (URL at compbio.oml.gov/Grail-bin/EmptyGrailForm) and GenScan (URL at genes.mit.edu/GENSCAN.html).
  • FgenesH A. Salamov and V. Solovyev, "Ab initio gene finding in Drosophila genomic DNA,” Genome Research. 2000 April; 10(4):516-22
  • Grail URL at compbio.oml.gov/Grail-bin/EmptyGrailForm
  • GenScan URL at genes.mit.edu/GENSCAN.html.
  • splice variant identification protocols see., e.g., Southan, C, A genomic perspective on human proteases, FEBS Lett.
  • PCR-based Validation Wellmann S, ef al, Specific reverse transcription-PCR quantification of vascular endothelial growth factor (VEGF) splice variants by LightCycler technology, Clin Chem. 2001 Apr;47(4):654-60; Jia, H.P., ef a/., Discovery of new human beta- defensins using a genomics-based approach, Gene. 2001 Jan 24; 263(1 -2):211-8.
  • VEGF vascular endothelial growth factor
  • genomic regions are modulated in cancers.
  • the alternative transcripts or splice variants of the gene are modulated as well.
  • 24P4C12 has a particular expression profile related to cancer Alternative frans ⁇ ipts and splice variants of 24P4C12 may also be involved in cancers in the same or different tissues, thus serving as tumor-asso ⁇ ated markers/antigens
  • exon composition of the o ⁇ ginal transcript designated as 24P4C12 v 1
  • Table LI The exon composition of the o ⁇ ginal transcript, designated as 24P4C12 v 1
  • transcnpt variant 24P4C12 v 7 has spliced out exons 10 and 11 from vanant 24P4C12 v 1 , as shown in Figure 12
  • Variant 24P4C12 v 8 inserted 36 bp in between 1931 and 1932 of vanant 24P4C12 v 1 and variant 24P4C12 v 9 replaced with 36 bp the segment 1136-1163 of variant 24P4C12 v 1
  • Figure 12 shows the schematic alignment of exons of the four transcript va ⁇ ants
  • Tables Lll through LXIII are set forth on a vanant by variant basis Tables LH, LVI, and LX show nucleotide sequences of the transcnpt variant Tables Lltl, LVII, and LXI show the alignment of the transcnpt variant with the nucleic acid sequence of 24P4C12 v 1 Tables LIV, LVIII, and LXII lay out the ammo acid translation of the transcript variant for the identified reading frame orientation Tables LV, LIX, and LXIII display alignments of the am o acid sequence encoded by the splice variant with that of 24P4C12 v 1
  • a Single Nucleotide Polymorphism is a single base pair va ⁇ ation in a nucleotide sequence at a specific location
  • A/T, C/G, G/C and T/A Genotype refers to the specific base pair sequence of one or more locations in the genome of an individual
  • Haplotype refers to the base pair sequence of more than one location on the same DNA molecule (or the same chromosome in higher organisms), often in the context of one gene or in the context of several tightly linked genes
  • SNPs that occur on a cDNA are called cSNPs These cSNPs may change ammo acids of the protein encoded by the gene and thus change the functions of the protein
  • Some SNPs cause inherited diseases, others contribute to quantitative variations in phenotype and reactions to environmental factors including diet and drugs among individuals Therefore, SNPs and/or combinations of alleles (called haplotypes) have many applications, including diagnosis of inherited diseases, determination of drug reactions and
  • SNPs are identified by a va ⁇ ety of art-accepted methods (P Bean, "The promising voyage of SNP target discovery,” Am Clin Lab 2001 Oct-Nov, 20(9) 18-20, K M Weiss, “In search of human variation,” Genome Res 1998 Jul, 8(7) 691-697, M M She, “Enabling large-scale pharmacogenetic studies by high-throughput mutation detection and genotyping technologies," Clin Chem 2001 Feb, 47(2) 164-172)
  • SNPs are identified by sequencing DNA fragments that show polymorphism by gel-based methods such as restriction fragment length polymorphism (RFLP) and denatu ⁇ ng gradient gel electrophoresis (DGGE) They can also be discovered by direct sequen ⁇ ng of DNA samples pooled from different individuals or by comparing sequences from different DNA samples With the rapid accumulation of sequence data in public and p ⁇ vate databases, one can discover SNPs by compa ⁇ ng sequences using computer programs (Z Gu, L Hillier and P Y Kwok, "Single nucle
  • SNPs were identified in the original transcript, 24P4C12 v.1, at positions 542 (G/A), 564 (G/A), 818 (C/T), 981(A/G) and 1312 (NC).
  • the trans ⁇ ipts or proteins with alternative alleles were designated as variants 24P4C12 v.2, v.3, v.4, v.5 and v.6, respectively.
  • Figure 10 shows the schematic alignment of the SNP variants.
  • Figure 11 shows the schematic alignment of protein variants, corresponding to nucleotide variants. Nucleotide variants that code for the same amino acid sequence as variant 1 are not shown in Figure 11.
  • These alleles of the SNPs though shown separately here, can occur in different combinations (haplotypes) and in any one of the transcript variants (such as 24P4C12 v.7) that contains the sequence context of the SNPs.
  • the full or partial length 24P4C12 and 24P4C12 variant cDNA sequences are cloned into any one of a variety of expression vectors known in the art.
  • the full length cDNA, or any 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30 or more contiguous amino acids from 24P4C12, variants, or analogs thereof are used.
  • pCRII In vitro transcription and translation constructs: pCRII: To generate 24P4C12 sense and anti-sense RNA probes for RNA in situ investigations, pCRII constructs (Invitrogen, Carlsbad CA) are generated encoding either all or fragments of the 24P4C12 cDNA. The pCRII vector has Sp6 and T7 promoters flanking the insert to drive the transcription of 24P4C12 RNA for use as probes in RNA in situ hybridization experiments. These probes are used to analyze the cell and tissue expression of 24P4C12 at the RNA level.
  • Transcribed 24P4C12 RNA representing the cDNA amino acid coding region of the 24P4C12 gene is used in in vitro translation systems such as the TnTTM Coupled Reticulolysate System (Promega, Corp., Madison, WI) to synthesize 24P4C12 protein.
  • TnTTM Coupled Reticulolysate System Promega, Corp., Madison, WI
  • pGEX Constructs To generate recombinant 24P4C12 proteins in bacteria that are fused to the Glutathione S- transferase (GST) protein, all or parts of the 24P4C12 cDNA or variants are cloned into the GST- fusion vector of the pGEX family (Amersham Pharmacia Biotech, Piscataway, NJ). These constructs allow controlled expression of recombinant 24P4C12 protein sequences with GST fused at the amino-terminus and a six histidine epitope (6X His) at the carboxyl- terminus.
  • GST Glutathione S- transferase
  • the GST and 6X His tags permit purification of the recombinant fusion protein from induced bacteria with the appropriate affinity matrix and allow recognition of the fusion protein with anti-GST and anti-His antibodies.
  • the 6X His tag is generated by adding 6 histidine codons to the cloning primer at the 3' end, e.g., of the open reading frame (ORF).
  • a proteolyfic cleavage site such as the PreScissionTM recognition site in pGEX-6P-1, may be employed such that it permits deavage of the GST tag from 24P4C12-related protein.
  • the ampicillin resistance gene and pBR322 origin permits selection and maintenance of the pGEX plasmids in £ coli.
  • pMAL Constructs To generate, in bacteria, recombinant 24P4C12 proteins that are fused to maltose-binding protein (MBP), all or parts of the 24P4C12 cDNA protein coding sequence are fused to the MBP gene by cloning into the pMAL-c2X and pMAL-p2X vectors (New England Biolabs, Beverly, MA). These constructs allow controlled expression of recombinant 24P4C12 protein sequences with MBP fused at the amino-terminus and a 6X His epitope tag at the carboxyl ⁇ terminus.
  • MBP maltose-binding protein
  • the MBP and 6X His tags permit purification of the recombinant protein from induced bacteria with the appropriate affinity matrix and allow recognition of the fusion protein with anti-MBP and anti-His antibodies.
  • the 6X His epitope tag is generated by adding 6 histidine codons to the 3' cloning primer.
  • a Factor Xa recognition site permits cleavage of the pMAL tag from 24P4C12.
  • the pMAL-c2X and pMAL-p2X vectors are optimized to express the recombinant protein in the cytoplasm or periplasm respectively. Periplasm expression enhances folding of proteins with disulfide bonds.
  • pET Constructs To express 24P4C12 in bacterial cells, all or parts of the 24P4C12 cDNA protein coding sequence are cloned into the pET family of vectors (Novagen, Madison, WI). These vectors allow tightly controlled expression of recombinant 24P4C12 protein in bacteria with and without fusion to proteins that enhance solubility, such as NusA and thioredoxin (Trx), and epitope tags, such as 6X His and S-TagTM that aid purification and detection of the recombinant protein. For example, constructs are made utilizing pET NusA fusion system 43.1 such that regions of the 24P4C12 protein are expressed as amino-terminal fusions to NusA.
  • pESC Constructs To express 24P4C12 in the yeast species Saccharamyces cerevisiae for generation of recombinant protein and functional studies, all or parts of the 24P4C12 cDNA protein coding sequence are cloned into the pESC family of vectors each of which contain 1 of 4 selectable markers, HIS3, TRP1 , LEU2, and URA3 (Stratagene, La Jolla, CA). These vectors allow controlled expression from the same plasmid of up to 2 different genes or doned sequences containing either FlagTM or Myc epitope tags in the same yeast cell. This system is useful to confirm protein-protein interactions of 24P4C12.
  • pESP Constructs To express 24P4C12 in the yeast species Saccharomyces pombe, all or parts of the 24P4C12 cDNA protein coding sequence are cloned into the pESP family of vectors. These vectors allow controlled high level of expression of a 24P4C12 protein sequence that is fused at either the amino terminus or at the carboxyl terminus to GST which aids purification of the recombinant protein.
  • a FlagTM epitope tag allows detection of the recombinant protein with anti- FlagTM antibody.
  • 24P4C12 cDNA sequences can be cloned into any one of a variety of expression vectors known in the art.
  • One or more of the following regions of 24P4C12 are expressed in these constructs, amino acids 1 to 710, or any 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more contiguous amino acids from 24P4C12 v.1 through v.6; amino acids 1 to 598, or any 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more contiguous amino acids from 24P4C12 v.7; amino acids 1 to 722, or any 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more contiguous amino acids from 24P4C12 v.8, amino acids 1 to 712, or any 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more contiguous amino acids from 24P4C12
  • the constructs can be transfected into any one of a wide variety of mammalian cells such as 293T cells.
  • Transfected 293T cell lysates can be probed with the anti-24P4C12 polydonal serum, described herein.
  • pcDNA3.1/MvcHis Constructs To express 24P4C12 in mammalian cells, a 24P4C12 ORF, or portions thereof, of 24P4C12 with a consensus Kozak translation initiation site was doned into pcDNA3.1/MycHis Version A (Invitrogen, Carlsbad, CA). Protein expression is driven from the cytomegalovirus (CMV) promoter.
  • CMV cytomegalovirus
  • the recombinant proteins have the myc epitope and 6X His epitope fused to the carboxyl-terminus.
  • the pcDNA3.1/MycHis vector also contains the bovine growth hormone (BGH) polyadenylation signal and transcription termination sequence to enhance mRNA stability, along with the SV40 origin for episomal replication and simple vector rescue in cell lines expressing the large T antigen.
  • BGH bovine growth hormone
  • the Neomydn resistance gene can be used, as it allows for selection of mammalian cells expressing the protein and the ampicillin resistance gene and ColE1 origin permits selection and maintenance of the plasmid in £ coli.
  • Figure 24 demonstrates expression of 24P4C12 from the pcDNA3.1/MycHis construct in transiently transfected 293T cells.
  • pcDNA4/HisMax Constructs To express 24P4C12 in mammalian cells, a 24P4C12 ORF, or portions thereof, of 24P4C12 are cloned into pcDNA4/HisMax Version A (Invitrogen, Carlsbad, CA). Protein expression is driven from the cytomegalovirus (CMV) promoter and the SP16 translational enhancer. The recombinant protein has XpressTM and six histidine (6X His) epitopes fused to the amino-terminus.
  • CMV cytomegalovirus
  • 6X His six histidine
  • the pcDNA4/HisMax vector also contains the bovine growth hormone (BGH) polyadenylation signal and transcription termination sequence to enhance mRNA stability along with the SV40 origin for episomal replication and simple vector rescue in cell lines expressing the large T antigen.
  • BGH bovine growth hormone
  • the Zeocin resistance gene allows for selection of mammalian cells expressing the protein and the ampicillin resistance gene and ColE1 origin permits selection and maintenance of the plasmid in £ coli.
  • PCDNA3.1/CT-GFP-TOP0 Construct To express 24P4C12 in mammalian cells and to allow detection of the recombinant proteins using fluorescence, a 24P4C12 ORF, or portions thereof, with a consensus Kozak translation initiation site are cloned into pcDNA3.1/CT-GFP-TOPO (Invitrogen, CA). Protein expression is driven from the cytomegalovirus (CMV) promoter. The recombinant proteins have the Green Fluorescent Protein (GFP) fused to the carboxyl-terminus facilitating non-invasive, in vivo detection and cell biology studies.
  • CMV cytomegalovirus
  • the pcDNA3.1CT-GFP-TOPO vector also contains the bovine growth hormone (BGH) polyadenylation signal and transcription termination sequence to enhance mRNA stability along with the SV40 origin for episomal replication and simple vector rescue in cell lines expressing the large T antigen.
  • BGH bovine growth hormone
  • the Neomycin resistance gene allows for selection of mammalian cells that express the protein and the ampicillin resistance gene and ColE1 origin permits selection and maintenance of the plasmid in £ coli.
  • Additional constructs with an amino- terminal GFP fusion are made in pcDNA3,1/NT-GFP-TOPO spanning the entire length of a 24P4C12 protein.
  • pTag ⁇ A 24P4C12 ORF, or portions thereof, were cloned into pTag-5.
  • This vector is similar to pAPtag but without the alkaline phosphatase fusion.
  • This construct generates 24P4C12 protein with an amino-terminal lgG ⁇ signal sequence and myc and 6X His epitope tags at the carboxyl-terminus that facilitate detection and affinity purification.
  • the resulting recombinant 24P4C12 protein were optimized for secretion into the media of transfected mammalian cells, and is used as immunogen or ligand to identify proteins such as ligands or receptors that interact with the 24P4C12 proteins. Protein expression is driven from the CMV promoter.
  • the Zeocin resistance gene present in the vector allows for selection of mammalian cells expressing the protein, and the ampicillin resistance gene permits selection of the plasmid in £ coli.
  • Figure 26 shows expression of 24P4C12 from two different pTag ⁇ constructs.
  • PAPtag A 24P4C12 ORF, or portions thereof, is cloned into pAPtag-5 (GenHunter Corp. Nashville, TN). This construct generates an alkaline phosphatase fusion at the carboxyl-terminus of a 24P4C12 protein while fusing the lgG ⁇ signal sequence to the amino-terminus. Constructs are also generated in which alkaline phosphatase with an amino- terminal lgG ⁇ signal sequence is fused to the amino-terminus of a 24P4C12 protein.
  • the resulting recombinant 24P4C12 proteins are optimized for secretion into the media of transfected mammalian cells and can be used to identify proteins such as ligands or receptors that interact with 24P4C12 proteins.
  • Protein expression is driven from the CMV promoter and the recombinant proteins also contain myc and 6X His epitopes fused at the carboxyl-terminus that facilitates detection and purification.
  • the Zeocin resistance gene present in the vector allows for selection of mammalian cells expressing the recombinant protein and the ampicillin resistance gene permits selection of the plasmid in E coli.
  • PsecFc A 24P4C12 ORF, or portions thereof, is also cloned into psecFc.
  • the psecFc vector was assembled by doning the human immunoglobulin G1 (IgG) Fc (hinge, CH2, CH3 regions) into pSecTag2 (Invitrogen, California). This construct generates an lgG1 Fc fusion at the carboxyl-terminus of the 24P4C12 proteins, while fusing the IgGK signal sequence to N-terminus.
  • IgG human immunoglobulin G1
  • 24P4C12 fusions utilizing the murine lgG1 Fc region are also used.
  • the resulting recombinant 24P4C12 proteins are optimized for secretion into the media of transfected mammalian cells, and can be used as immunogens or to identify proteins such as ligands or receptors that interact with 24P4C12 protein. Protein expression is driven from the CMV promoter.
  • the hygromycin resistance gene present in the vector allows for selection of mammalian cells that express the recombinant protein, and the ampicillin resistance gene permits selection of the plasmid in E coli.
  • pSR ⁇ Constructs To generate mammalian cell lines that express 24P4C12 constitutively, 24P4C12 ORF, or portions thereof, of 24P4C12 were cloned into pSR ⁇ constructs.
  • Amphotropic and ecofropic retroviruses were generated by transfection of pSR ⁇ constructs into the 293T-10A1 packaging line or co-transfection of pSR ⁇ and a helper plasmid (containing deleted packaging sequences) into the 293 cells, respectively.
  • Theretrovirus is used to infect a variety of mammalian cell lines, resulting in the integration of the cloned gene, 24P4C12, into the host cell-lines. Protein expression is driven from a long terminal repeat (LTR).
  • LTR long terminal repeat
  • the Neomycin resistance gene present in the vector allows for selection of mammalian cells that express the protein, and the ampicillin resistance gene and ColE1 origin permit selection and maintenance of the plasmid in £ coli.
  • the retroviral vectors can thereafter be used for infection and generation of various cell lines using, for example, PC3, NIH 3T3, TsuPrl, 293 or rat-1 cells.
  • Figure 23 shows RNA expression of 24P4C12 driven from the 24P4C12.pSRa construct in stably transduced PC3, 3T3 and 300.19 cells.
  • Figure 25 shows 24P4C12 protein expression in PC3 cells stably transduced with 24P4C12.pSRa construct.
  • Additional pSR ⁇ constructs are made that fuse an epitope tag such as the FLAGTM tag to the carboxyl-terminus of 24P4C12 sequences to allow detection using anti-Flag antibodies.
  • the FLAGTM sequence 5' gat tac aag gat gac gac gat aag 3' (SEQ ID NO: 45) is added to cloning primer at the 3' end of the ORF.
  • Additional pSR ⁇ constructs are made to produce both amino-terminal and carboxyl-terminal GFP and myc/6X His fusion proteins of the full-length 24P4C12 proteins.
  • Additional Viral Vectors Additional constructs are made for viral-mediated delivery and expression of 24P4C12. High virus titer leading to high level expression of 24P4C12 is achieved in viral delivery systems such as adenoviral vectors and herpes amplicon vectors.
  • a 24P4C12 coding sequences or fragments thereof are amplified by PCR and subdoned into the AdEasy shuttle vector (Stratagene). Recombination and virus packaging are performed according to the manufacturer's instructions to generate adenoviral vectors.
  • 24P4C12 coding sequences or fragments thereof are cloned into the HSV-1 vector (Imgenex) to generate he ⁇ es viral vectors.
  • the viral vectors are thereafter used for infection of various cell lines such as PC3, NIH 3T3, 293 or rat-1 cells.
  • Regulated Expression Systems To control expression of 24P4C12 in mammalian cells, coding sequences of 24P4C12, or portions thereof, are cloned into regulated mammalian expression systems such as the T-Rex System (Invitrogen), the GeneSwitch System (Invitrogen) and the tightly-regulated Ecdysone System (Sratagene). These systems allow the study of the temporal and concentration dependent effects of recombinant 24P4C12. These vectors are thereafter used to control expression of 24P4C12 in various cell lines such as PC3, NIH 3T3, 293 or rat-1 cells.
  • T-Rex System Invitrogen
  • GeneSwitch System Invitrogen
  • Sratagene Ecdysone System
  • 24P4C12 ORF To generate recombinant 24P4C12 proteins in a baculovirus expression system, 24P4C12 ORF, or portions thereof, are cloned into the baculovirus transfer vector pBlueBac 4.5 (Invitrogen), which provides a His-tag at the N-terminus.
  • pBlueBac-24P4C12 is co-transfected with helper plasmid pBac-N-Blue (Invitrogen) into SF9 (Spodoptera frugiperda) insect cells to generate recombinant baculovirus (see Invitrogen instruction manual for details). Baculovirus is then collected from cell supernatant and purified by plaque assay.
  • Recombinant 24P4C12 protein is then generated by infection of HighFive insect cells (Invitrogen) with purified baculovirus.
  • Recombinant 24P4C12 protein can be detected using anti-24P4C12 or anti-His-tag antibody.
  • 24P4C12 protein can be purified and used in various cell-based assays or as immunogen to generate polyclonal and monoclonal antibodies specific for 24P4C12.
  • Example 9 Antigenicity Profiles and Secondary Structure
  • Figures 5-9 depict graphically five amino acid profiles of the 24P4C12 variant 1, assessment available by accessing the ProtScale website located on the World Wide Web at (.expasy.ch/cgi-bin/protscale.pl) on the ExPasy molecular biology server.
  • Hydrophilidty ( Figure 5), Hydropathicity ( Figure 6) and Percentage Accessible Residues ( Figure 7) profiles were used to determine stretches of hydrophilic amino acids (i.e., values greater than 0.5 on the Hydrophilidty and Percentage Accessible Residues profile, and values less than 0.5 on the Hydropathicity profile). Such regions are likely to be exposed to the aqueous environment, be present on the surface of the protein, and thus available for immune recognition, such as by antibodies.
  • Average Flexibility ( Figure 8) and Beta-turn ( Figure 9) profiles determine stretches of amino adds (i.e., values greater than 0.5 on the Beta-turn profile and the Average Flexibility profile) that are not constrained in secondary structures such as beta sheets and alpha helices. Such regions are also more likely to be exposed on the protein and thus accessible to immune recognition, such as by antibodies.
  • Antigenic sequences of the 24P4C12 protein and of the variant proteins indicated, e.g., by the profiles set forth in Figure 5, Figure 6, Figure 7, Figure 8, and/or Figure 9 are used to prepare immunogens, either peptides or nucleic acids that encode them, to generate therapeutic and diagnostic anti-24P4C12 antibodies.
  • the immunogen can be any 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50 or more than 50 contiguous amino acids, or the corresponding nucleic acids that encode them, from the 24P4C12 protein variants listed in Figures 2 and 3.
  • peptide immunogens of the invention can comprise, a peptide region of at least 5 amino acids of Figures 2 and 3 in any whole number increment that includes an amino acid position having a value greater than 0.5 in the Hydrophilidty profile of Figure 5; a peptide region of at least 5 amino acids of Figures 2 and 3 in any whole number increment that includes an amino acid position having a value less than 0.5 in the Hydropathicity profile of Figure 6 ; a peptide region of at least 5 amino acids of Figures 2 and 3 in any whole number increment that includes an amino add position having a value greater than 0.5 in the Percent Accessible Residues profile of Figure 7 ; a peptide region of at least 5 amino acids of Figures 2 and 3 in any whole number increment that includes an amino acid position having a value greater than 0.5 in the Average Flexibility profile on Figure 8 ; and, a peptide region of at least 5 amino acids of Figures 2 and 3 in any whole number increment that includes an amino acid position having a value greater than 0.5 in the Average Flex
  • All immunogens of the invention, peptide or nudeic acid can be embodied in human unit dose form, or comprised by a composition that includes a pharmaceutical excipient compatible with human physiology.
  • the analysis indicates that 24P4C12 variant 1 is composed of 53.94% alpha helix, 9.44% extended strand, and 36.62% random coil (Figure 13a).
  • Polyclonal antibodies can be raised in a mammal, for example, by one or more injections of an immunizing agent and, if desired, an adjuvant.
  • the immunizing agent and/or adjuvant will be injected in the mammal by multiple subcutaneous or intraperitoneal injections.
  • computer algorithms are employed in design of immunogens that, based on amino acid sequence analysis contain characteristics of being antigenic and available for recognition by the immune system of the immunized host (see the Example entitled "Antigenicity Profiles").
  • Such regions would be predicted to be hydrophilic, flexible, in beta-turn conformations, and be exposed on the surface of the protein (see, e.g., Figure 5, Figure 6, Figure 7, Figure 8, or Figure 9 for amino acid profiles that indicate such regions of 24P4C12 and variants).
  • 24P4C12 recombinant bactenal fusion proteins or peptides containing hydrophilic, flexible, beta-turn regions of 24P4C12 variant proteins are used as antigens to generate polyclonal antibodies in New Zealand White rabbits.
  • such regions include, but are not limited to, amino acids 1 -34, amino acids 118-135, amino acids 194-224, amino acids 280-290, and amino acids 690-710, of 24P4C12 variants 1. It is useful to conjugate the immunizing agent to a protein known to be immunogenic in the mammal being immunized.
  • immunogenic proteins include, but are not limited to, keyhole limpet hemocyanin (KLH), serum albumin, bovine thyroglobulin, and soybean trypsin inhibitor.
  • KLH keyhole limpet hemocyanin
  • serum albumin serum albumin
  • bovine thyroglobulin bovine thyroglobulin
  • soybean trypsin inhibitor a peptide encoding amino acids 1-14 of 24P4C12 variant 1 was conjugated to KLH and used to immunize a rabbit. This antiserum exhibited a high liter to the peptide (>10,000) and recognized 24P4C12 in transfected 293T cells by Western blot and flow cytometry (Figure 24) and in stable recombinant PC3 cells by Western blot and immunohistochemistry (Figure 25).
  • the immunizing agent may include all or portions of the 24P4C12 variant proteins, analogs or fusion proteins thereof.
  • the 24P4C12 variant 1 amino acid sequence can be fused using recombinant DNA techniques to any one of a variety of fusion protein partners that are well known in the art, such as glutathione-S-transferase (GST) and HIS tagged fusion proteins.
  • GST glutathione-S-transferase
  • HIS HIS tagged fusion proteins
  • a GST-fusion protein encoding amino acids 379453, encompassing the third predicted extracellular loop of variant 1 is produced, purified, and used as immunogen.
  • Other recombinant bacterial fusion proteins that may be employed include maltose binding protein, LacZ, thioredoxin, NusA, or an immunoglobulin constant region (see the section entitled "Production of 24P4C12 in Prokaryotic Systems” and Current Protocols In Molecular Biology, Volume 2, Unit 16, Frederick M. Ausubul et al. eds., 1995; Linsley, P.S., Brady, W., Urnes, M., Grosmaire, L, Damle, N., and Ledbetter, L(1991) J.Exp. Med. 174, 561-566).
  • mammalian expressed protein antigens are also used. These antigens are expressed from mammalian expression vectors such as the Tag5 and Fc-fusion vectors (see the Example entitled "Production of Recombinant 24P4C12 in Eukaryotic Systems"), and retains post-translational modifications such as glycosylations found in native protein.
  • mammalian expression vectors such as the Tag5 and Fc-fusion vectors (see the Example entitled "Production of Recombinant 24P4C12 in Eukaryotic Systems"), and retains post-translational modifications such as glycosylations found in native protein.
  • the predicted 1 st and third extracellular loops of variant 1 , amino acids 59-227 and 379453 respectively were each doned into the Tag5 mammalian se ⁇ etion vector and expressed in 293T cells ( Figure 26).
  • Each recombinant protein is then purified by metal chelate chromatography from tissue culture supernatants and/or lysates of 293T cells stably expressing the recombinant vector.
  • the purified Tag524P4C12 protein is then used as immunogen.
  • adjuvants include, but are not limited to, complete Freund's adjuvant (CFA) and MPL-TDM adjuvant (monophosphoryl Lipid A, synthetic trehalose dicorynomycolate).
  • CFA complete Freund's adjuvant
  • MPL-TDM adjuvant monophosphoryl Lipid A, synthetic trehalose dicorynomycolate
  • rabbits are initially immunized subcutaneously with up to 200 ⁇ g, typically 100-200 ⁇ g, of fusion protein or peptide conjugated to KLH mixed in complete Freund's adjuvant (CFA). Rabbits are then injected subcutaneously every two weeks with up to 200 ⁇ g, typically 100-200 ⁇ g, of the immunogen in incomplete Freund's adjuvant (IFA). Test bleeds are taken approximately 7-10 days following each immunization and used to monitor the tiler of the a ⁇ tiserum by ELISA.
  • CFA complete Freund's adjuvant
  • the full-length 24P4C12 variant 1 cDNA is cloned into pCDNA 3.1 myc-his or retroviral expression vectors (Invitrogen, see the Example entitled "Production of Recombinant 24P4C12 in Eukaryotic Systems").
  • cell lysates are probed with the ant ⁇ -24P4C12 serum and with anti-His antibody (Santa Cruz Biotechnologies, Santa Cruz, CA) to determine specific reactivity to denatured 24P4C12 protein using the Western blot technique.
  • antiseru specifically recognizes 24P4C12 protein in 293T and PC3 cells.
  • the immune serum is tested by fluorescence microscopy, flow cytometry, and immunohistochemistry ( Figure 25) and immunoprecipitation against 293T and other recombinant 24P4C12-expressing cells to determine specific recognition of native protein.
  • Western blot, immunoprecipitation, fluorescent microscopy, immunohistochemistry and flow cytometric techniques using cells that endogenously express 24P4C12 are also carried out to test reactivity and specificity.
  • Anti-serum from rabbits immunized with 24P4C12 variant fusion proteins are purified by depletion of antibodies reactive to the fusion partner sequence by passage over an affinity column containing the fusion partner either alone or in the context of an irrelevant fusion protein.
  • 24P4C12 variant fusion proteins such as GST and MBP fusion proteins
  • antiserum derived from a GST- 24P4C12 fusion protein encoding amino acids 379453 of variant 1 is first purified by passage over a column of GST protein covalently coupled to AffiGel matrix (BioRad, Hercules, Calif.).
  • the antiserum is then affinity purified by passage over a column composed of a MBP-fusion protein also encoding amino acids 379-453 covalently coupled to Affigel matrix.
  • the serum is then further purified by protein G affinity chromatography to isolate the IgG fraction.
  • Sera from other His-tagged antigens and peptide immunized rabbits as well as fusion partner depleted sera are affinity purified by passage over a column matrix composed of the original protein immunogen or free peptide.
  • therapeutic mAbs to 24P4C12 variants comprise those that react with epitopes specific for each variant protein or specific to sequences in common between the variants that would disrupt or modulate the biological function of the 24P4C12 variants, for example those that would disrupt the interaction with ligands and substrates or disrupt its biological activity.
  • Immunogens for generation of such mAbs include those designed to encode or contain the entire 24P4C12 protein variant sequence, regions of the 24P4C 12 protein variants predicted to be antigenic from computer analysis of the amino acid sequence (see, e.g., Figure 5, Figure 6, Figure 7, Figure 8, or Figure 9, and the Example entitled "Antigenicity Profiles").
  • Immunogens include peptides, recombinant bacterial proteins, and mammalian expressed Tag 5 proteins and human and murine IgG FC fusion proteins.
  • cells engineered to express high levels of a respective 24P4C 12 variant such as 293T-24P4C12 variant 1 or 300.19-24P4C12 variant 1 murine Pre-B cells, are used to immunize mice.
  • a respective 24P4C 12 variant such as 293T-24P4C12 variant 1 or 300.19-24P4C12 variant 1 murine Pre-B cells.
  • To generate mAbs to a 24P4C12 variant mice are first immunized intraperitoneally (IP) with, typically, 10-50 ⁇ g of protein immunogen or 10 7 24P4C12-expressing cells mixed in complete Freund's adjuvant.
  • IP intraperitoneally
  • mice are then subsequently immunized IP every 24 weeks with, typically, 10-50 ⁇ g of protein immunogen or 10 7 cells mixed in incomplete Freund's adjuvant Alternatively, MPL-TDM adjuvant is used in immunizations.
  • mice were immunized as above with 300.19-24P4C12 cells in complete and then incomplete Freund's adjuvant, and subsequently sacrificed and the spleens harvested and used for fusion and hybridoma generation.
  • 2 hybridomas were generated whose antibodies specifically recognize 24P4C12 protein expressed in 293T cells by flow cytometry.
  • a DNA-based immunization protocol is employed in which a mammalian expression vector encoding a 24P4C12 variant sequence is used to immunize mice by direct injection of the plasmid DNA.
  • a Tag5 mammalian secretion vector encoding amino acids 59-227 of the variant 1 sequence ( Figure 26) was used to immunize mice. Subsequent booster immunizations are then carried out with the purified protein.
  • the same amino acids are cloned into an Fc-fusion secretion vector in which the 24P4C12 variant 1 sequence is fused at the amino-terminus to an IgK leader sequence and at the carboxyl-terminus to the coding sequence of the human or murine IgG Fc region.
  • This recombinant vector is then used as immunogen.
  • the plasmid immunization protocols are used in combination with purified proteins as above and with cells expressing the respective 24P4C12 variant.
  • test bleeds are taken 7-10 days following an injection to monitor titer and spedfidty of the immune response. Once appropriate reactivity and specificity is obtained as determined by ELISA, Western blotting, immunoprecipitation, fluorescence microscopy, immunohistochemistry, and flow cytometric analyses, fusion and hybridoma generation is then carried out with established procedures well known in the art (see, e.g., Harlow and Lane, 1988).
  • a peptide encoding amino acids 643-654 (RNPITPTGHVFQ) (SEQ ID NO: 46) of 24P4C12 variants is synthesized, coupled to KLH and used as immunogen.
  • Balb C mice are initially immunized intraperitoneally with 25 ⁇ g of the KLH-24P4C12 variant 8 peptide mixed in complete Freund's adjuvant.
  • Mice are subsequently immunized every two weeks with 25 ⁇ g of the antigen mixed in incomplete Freund's adjuvant for a total of three immunizations.
  • ELISA using the free peptide determines the reactivity of serum from immunized mice.
  • Reactivity and specificity of serum to full length 24P4C12 variant 8 protein is monitored by Western blotting, immunoprecipitation and flow cytometry using 293T cells transfected with an expression vector encoding the 24P4C12 variant 8 cDNA compared to cells transfected with the other 24P4C12 variants (see e.g., the Example entitled "Production of Recombinant 24P4C12 in Eukaryotic Systems").
  • Other recombinant 24P4C12 variant 8-expressing cells or cells endogenously expressing 24P4C12 variant 8 are also used. Mice showing the strongest specific reactivity to 24P4C12 variant 8 are rested and given a final injection of antigen in PBS and then sacrificed four days later.
  • mice The spleens of the sacrificed mice are harvested and fused to SPO/2 myeloma cells using standard procedures (Harlow and Lane, 1988). Supernatants from HAT selected growth wells are s ⁇ eened by ELISA, Western blot, immunoprecipitation, fluorescent microscopy, and flow cytometry to identify 24P4C12 variant 8-specif ⁇ c antibody-producing clones. A similar strategy is also used to derive 24P4C12 variant 9-specific antibodies using a peptide encompassing amino acids 379-388 (PLPTQPATLG) (SEQ ID NO: 47).
  • PPTQPATLG peptide encompassing amino acids 379-388
  • the binding affinity of a 24P4C12 monoclonal antibody is determined using standard technologies. Affinity measurements quantify the strength of antibody to epitope binding and are used to help define which 24P4C12 monoclonal antibodies, preferred for diagnostic or therapeutic use, as appreciated by one of skill in the art.
  • the BIAcore system (Uppsala, Sweden) is a preferred method for determining binding affinity.
  • the BIAcore system uses surface plasmon resonance (SPR, Welford K. 1991, Opt. Quant. Elect. 23:1; Morton and Myszka, 1998, Methods in Enzymology 295: 268) to monitor bimolecular interactions in real time. BIAcore analysis conveniently generates association rate constants, dissodation rate constants, equilibrium dissociation constants, and affinity constants.
  • HLA class I and class II binding assays using purified HLA molecules are performed in accordance with disclosed protocols (e.g., PCT publications WO 94/20127 and WO 94/03205; Sidney ef al, Current Protocols in Immunology 18.3.1 (1998); Sidney, ef al, J. Immunol 154:247 (1995); Sette, ef al., Mol Immunol. 31:813 (1994)). Briefly, purified MHC molecules (5 to 500 nM) are incubated with various unlabeled peptide inhibitors and 1-10 nM 125 l-radiolabeled probe peptides as described.
  • MHC-peptide complexes are separated from free peptide by gel filtration and the fraction of peptide bound is determined.
  • each MHC preparation is titered in the presence of fixed amounts of radiolabeled peptides to determine the concentration of HLA molecules necessary to bind 10- 20% of the total radioactivity. All subsequent inhibition and direct binding assays are performed using these HLA concentrations.
  • Binding assays as outlined above may be used to analyze HLA supermotif and/or HLA motif-bearing peptides (see Table IV).
  • HLA vaccine compositions of the invention can include multiple epitopes.
  • the multiple epitopes can comprise ⁇ multiple HLA supermotifs or motifs to achieve broad population coverage. This example illustrates the identification and confirmation of supermotif- and motif-bearing epitopes for the inclusion in such a vaccine composition. Calculation of population coverage is performed using the strategy described below.
  • Identified A2-, A3-, and DR-supermotif sequences are scored using polynomial algorithms to predict their capacity to bind to spedfic HLA-Class I or Class II molecules. These polynomial algorithms account for the impact of different amino acids at different positions, and are essentially based on the premise that the overall affinity (or ⁇ G) of peptide-HLA molecule interactions can be approximated as a linear polynomial function of the type: where a/ is a coefficient which represents the effect of the presence of a given amino add (/) at a given position (/) along the sequence of a peptide of n amino acids.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Urology & Nephrology (AREA)
  • Immunology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Molecular Biology (AREA)
  • Hematology (AREA)
  • Biomedical Technology (AREA)
  • Epidemiology (AREA)
  • Biochemistry (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biotechnology (AREA)
  • Cell Biology (AREA)
  • Zoology (AREA)
  • Microbiology (AREA)
  • Marine Sciences & Fisheries (AREA)
  • Food Science & Technology (AREA)
  • Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Peptides Or Proteins (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
EP02789937A 2002-11-27 2002-11-27 NUKLEINSûURE ENTSPRECHENDES PROTEIN 24P4C12 ZUR BEHANDLUNG UND ERKENNUNG VON KREBS Withdrawn EP1565200A4 (de)

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
PCT/US2002/038264 WO2004050828A2 (en) 2002-11-27 2002-11-27 Nucleic acid corresponding protein entitled 24p4c12 useful in treatment and detection of cancer

Publications (2)

Publication Number Publication Date
EP1565200A2 true EP1565200A2 (de) 2005-08-24
EP1565200A4 EP1565200A4 (de) 2009-06-24

Family

ID=32467113

Family Applications (1)

Application Number Title Priority Date Filing Date
EP02789937A Withdrawn EP1565200A4 (de) 2002-11-27 2002-11-27 NUKLEINSûURE ENTSPRECHENDES PROTEIN 24P4C12 ZUR BEHANDLUNG UND ERKENNUNG VON KREBS

Country Status (6)

Country Link
EP (1) EP1565200A4 (de)
JP (1) JP2006508163A (de)
AU (3) AU2002352976B2 (de)
CA (1) CA2503346C (de)
IL (1) IL167892A (de)
WO (1) WO2004050828A2 (de)

Families Citing this family (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
PT2185574E (pt) * 2007-09-07 2013-08-26 Agensys Inc Anticorpos e moléculas relacionadas que se ligam a proteínas 24p4c12
CN102448486A (zh) * 2009-03-06 2012-05-09 艾更斯司股份有限公司 结合于24p4c12蛋白的抗体药物偶联物(adc)
JP2013049646A (ja) * 2011-08-30 2013-03-14 Tokyo Medical Univ 癌治療剤
JP2018537411A (ja) * 2015-10-02 2018-12-20 ユニバーシティ オブ コペンハーゲン ヒストン読み取りドメイン遮断低分子
US11513127B2 (en) 2016-01-25 2022-11-29 Genentech, Inc. Methods for assaying T-cell dependent bispecific antibodies
US20200188510A1 (en) * 2017-04-28 2020-06-18 Hoyu Co., Ltd. Allergy antigen and epitope thereof

Family Cites Families (34)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4179337A (en) 1973-07-20 1979-12-18 Davis Frank F Non-immunogenic polypeptides
US4235871A (en) 1978-02-24 1980-11-25 Papahadjopoulos Demetrios P Method of encapsulating biologically active materials in lipid vesicles
JPS6023084B2 (ja) 1979-07-11 1985-06-05 味の素株式会社 代用血液
US4640835A (en) 1981-10-30 1987-02-03 Nippon Chemiphar Company, Ltd. Plasminogen activator derivatives
US4722848A (en) 1982-12-08 1988-02-02 Health Research, Incorporated Method for immunizing animals with synthetically modified vaccinia virus
US4501728A (en) 1983-01-06 1985-02-26 Technology Unlimited, Inc. Masking of liposomes from RES recognition
US4496689A (en) 1983-12-27 1985-01-29 Miles Laboratories, Inc. Covalently attached complex of alpha-1-proteinase inhibitor with a water soluble polymer
US5019369A (en) 1984-10-22 1991-05-28 Vestar, Inc. Method of targeting tumors in humans
EP0206448B1 (de) 1985-06-19 1990-11-14 Ajinomoto Co., Inc. Hämoglobin, das an ein Poly(alkenylenoxid) gebunden ist
US4791192A (en) 1986-06-26 1988-12-13 Takeda Chemical Industries, Ltd. Chemically modified protein with polyethyleneglycol
US4837028A (en) 1986-12-24 1989-06-06 Liposome Technology, Inc. Liposomes with enhanced circulation time
US5225538A (en) 1989-02-23 1993-07-06 Genentech, Inc. Lymphocyte homing receptor/immunoglobulin fusion proteins
US5703055A (en) 1989-03-21 1997-12-30 Wisconsin Alumni Research Foundation Generation of antibodies through lipid mediated DNA delivery
DE69031305T2 (de) 1989-11-03 1998-03-26 Univ Vanderbilt Verfahren zur in vivo-verabreichung von funktionsfähigen fremden genen
US5279833A (en) 1990-04-04 1994-01-18 Yale University Liposomal transfection of nucleic acids into animal cells
US5204253A (en) 1990-05-29 1993-04-20 E. I. Du Pont De Nemours And Company Method and apparatus for introducing biological substances into living cells
SE9002480D0 (sv) 1990-07-23 1990-07-23 Hans Lilja Assay of free and complexed prostate-specific antigen
WO1993025673A1 (en) 1992-06-04 1993-12-23 The Regents Of The University Of California In vivo gene therapy with intron-free sequence of interest
US5679647A (en) 1993-08-26 1997-10-21 The Regents Of The University Of California Methods and devices for immunizing a host against tumor-associated antigens through administration of naked polynucleotides which encode tumor-associated antigenic peptides
US5804566A (en) 1993-08-26 1998-09-08 The Regents Of The University Of California Methods and devices for immunizing a host through administration of naked polynucleotides with encode allergenic peptides
EP0735893B1 (de) 1993-09-14 2008-11-26 Pharmexa Inc. Pan dr-bindeproteinen zur erhöhung der immunantwort
US5739118A (en) 1994-04-01 1998-04-14 Apollon, Inc. Compositions and methods for delivery of genetic material
US5919652A (en) 1994-11-09 1999-07-06 The Regents Of The University Of California Nucleic acid molecules comprising the prostate specific antigen (PSA) promoter and uses thereof
US5736524A (en) 1994-11-14 1998-04-07 Merck & Co.,. Inc. Polynucleotide tuberculosis vaccine
US5962428A (en) 1995-03-30 1999-10-05 Apollon, Inc. Compositions and methods for delivery of genetic material
US5922687A (en) 1995-05-04 1999-07-13 Board Of Trustees Of The Leland Stanford Junior University Intracellular delivery of nucleic acids using pressure
CU22559A1 (es) 1996-01-17 1999-05-03 Ct Ingenieria Genetica Biotech Sistema de expresión de antígenos heterologos en e. coli como proteínas de fusión
CA2248657A1 (en) 1996-03-11 1997-09-18 Epimmune Inc. Peptides with increased binding affinity for hla molecules
EP0960204A4 (de) 1996-07-26 2002-01-23 Sloan Kettering Inst Cancer Methoden und reagenzien zur genetischen immunisierung
US5840501A (en) 1996-10-25 1998-11-24 Bayer Corporation Determination of cPSA
AU8555198A (en) * 1997-08-01 1999-02-22 Genset 5' ests for secreted proteins expressed in prostate
US6943235B1 (en) * 1999-04-12 2005-09-13 Agensys, Inc. Transmembrane protein expressed in prostate cancer
AU780061B2 (en) * 1999-04-12 2005-02-24 Agensys, Inc. Transmembrane protein expressed in prostate and other cancers
WO2001046258A2 (en) * 1999-12-23 2001-06-28 Incyte Genomics, Inc. Transporters and ion channels

Also Published As

Publication number Publication date
CA2503346A1 (en) 2004-06-17
AU2002352976A1 (en) 2004-06-23
EP1565200A4 (de) 2009-06-24
WO2004050828A3 (en) 2004-12-09
AU2009208065B2 (en) 2012-05-24
CA2503346C (en) 2014-03-18
IL167892A (en) 2012-06-28
AU2008200628B2 (en) 2009-05-07
AU2008200628A1 (en) 2008-03-06
WO2004050828A2 (en) 2004-06-17
AU2002352976B2 (en) 2007-11-08
AU2009208065A1 (en) 2009-08-27
JP2006508163A (ja) 2006-03-09

Similar Documents

Publication Publication Date Title
US8426571B2 (en) Nucleic acids and corresponding proteins entitled 202P5A5 useful in treatment and detection of cancer
US8298776B2 (en) Antibodies to tumor associated proteins
US7968090B2 (en) Nucleic acids and corresponding proteins entitled 191P4D12(b) useful in treatment and detection of cancer
AU2002361610A1 (en) Nucleic acid and corresponding protein entitled 161P2F10B useful in treatment and detection of cancer
EP1537140A2 (de) Zur behandlung und zum nachweis von krebs geeignete nukleinsäure und zugehöriges protein mit der bezeichnung 161p2f10b
EP2302041A1 (de) Nukleinsäure und korrespondierendes Protein 161P2F10B nützlich für Behandlung und Nachweis von Krebs
AU2009208065B2 (en) Nucleic acid and corresponding protein entitled 24P4C12 useful in treatment and detection of cancer
HK1152714B (en) Nucleic acid and corresponding protein entitled steap-1 useful in treatment and detection of cancer
HK1152714A1 (en) Nucleic acid and corresponding protein entitled steap-1 useful in treatment and detection of cancer

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20050421

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR IE IT LI LU MC NL PT SE SK TR

AX Request for extension of the european patent

Extension state: AL LT LV MK RO SI

DAX Request for extension of the european patent (deleted)
A4 Supplementary search report drawn up and despatched

Effective date: 20090525

17Q First examination report despatched

Effective date: 20090923

RAP1 Party data changed (applicant data changed or rights of an application transferred)

Owner name: AGENSYS, INC.

GRAP Despatch of communication of intention to grant a patent

Free format text: ORIGINAL CODE: EPIDOSNIGR1

INTG Intention to grant announced

Effective date: 20150304

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20150715