EP1549140A2 - Production de peptides dans des plantes sous forme d'hybride de proteines de coque virale - Google Patents

Production de peptides dans des plantes sous forme d'hybride de proteines de coque virale

Info

Publication number
EP1549140A2
EP1549140A2 EP03808079A EP03808079A EP1549140A2 EP 1549140 A2 EP1549140 A2 EP 1549140A2 EP 03808079 A EP03808079 A EP 03808079A EP 03808079 A EP03808079 A EP 03808079A EP 1549140 A2 EP1549140 A2 EP 1549140A2
Authority
EP
European Patent Office
Prior art keywords
virus
peptide
epitope
vaccine
protein
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP03808079A
Other languages
German (de)
English (en)
Other versions
EP1549140A4 (fr
Inventor
Kenneth E. Palmer
Rachel L. Toth
Michael Jones
Sean Chapman
Lisa Smolenska
Alison Mccormick
Gregory Pogue
Long Nguyen
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Kentucky Bioprocessing LLC
Original Assignee
Large Scale Biology Corp
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from US10/457,082 external-priority patent/US20040033585A1/en
Application filed by Large Scale Biology Corp filed Critical Large Scale Biology Corp
Publication of EP1549140A2 publication Critical patent/EP1549140A2/fr
Publication of EP1549140A4 publication Critical patent/EP1549140A4/fr
Withdrawn legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/12—Viral antigens
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/12—Viral antigens
    • A61K39/21—Retroviridae, e.g. equine infectious anemia virus
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/12—Viral antigens
    • A61K39/23—Parvoviridae, e.g. feline panleukopenia virus
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N7/00—Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/525—Virus
    • A61K2039/5256—Virus expressing foreign proteins
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/525—Virus
    • A61K2039/5258—Virus-like particles
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/545—Medicinal preparations containing antigens or antibodies characterised by the dose, timing or administration schedule
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/20011—Papillomaviridae
    • C12N2710/20022—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/20011—Papillomaviridae
    • C12N2710/20034—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00—Reverse transcribing RNA viruses
    • C12N2740/00011—Details
    • C12N2740/10011—Retroviridae
    • C12N2740/16011—Human Immunodeficiency Virus, HIV
    • C12N2740/16111—Human Immunodeficiency Virus, HIV concerning HIV env
    • C12N2740/16134—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00—Reverse transcribing RNA viruses
    • C12N2740/00011—Details
    • C12N2740/10011—Retroviridae
    • C12N2740/16011—Human Immunodeficiency Virus, HIV
    • C12N2740/16311—Human Immunodeficiency Virus, HIV concerning HIV regulatory proteins
    • C12N2740/16334—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011—Details
    • C12N2750/14011—Parvoviridae
    • C12N2750/14311—Parvovirus, e.g. minute virus of mice
    • C12N2750/14334—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2760/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
    • C12N2760/00011—Details
    • C12N2760/12011—Bunyaviridae
    • C12N2760/12211—Phlebovirus, e.g. Rift Valley fever virus
    • C12N2760/12222—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Definitions

  • the present invention relates to the field of genetically engineered peptide production in plants, particularly to the use of tobamo virus vectors to express fusion proteins.
  • Peptides are a diverse class of molecules having a variety of important chemical and biological properties. Some examples include; hormones, cytokines, immunoregulators, peptide-based enzyme inhibitors, vaccine antigens, adhesions, receptor binding domains, enzyme inhibitors and the like.
  • the cost of chemical synthesis limits the potential applications of synthetic peptides for many useful purposes such as large scale therapeutic drug or vaccine synthesis.
  • TMV tobacco mosaic virus
  • TMV tobacco mosaic virus
  • TMV is the type member of the tobamovirus group.
  • TMV has straight tubular virions of approximately 300 by 18 nm with a 4 nm-diameter hollow canal, consisting of approximately 2000 units of a single capsid protein wound helically around a single RNA molecule.
  • Virion particles are 95% protein and 5% RNA by weight.
  • the genome of TMV is composed of a single- stranded RNA of 6395 nucleotides containing five large ORFs. Expression of each gene is regulated independently.
  • the virion RNA serves as the messenger RNA (mRNA) for the 5' genes, encoding the 126 kDa replicase subunit and the overlapping 183 kDa replicase subunit that is produced by read through of an amber stop codon approximately 5% of the time.
  • mRNA messenger RNA
  • Expression of the internal genes is controlled by different promoters on the minus- sense RNA that direct synthesis of 3'-coterminal subgenomic mRNAs which are produced during replication (FIG. 1)
  • Other tobamoviruses have a similar construction with genomic RNA of approximately 6.5 kb.
  • the genomic RNA is used as an mRNA and translated to produce the replicase protein.
  • viruses may produce two replicase proteins, with the larger protein being produced by translational readthrough of an amber (AUG) stop codon. Both viruses produce two smaller coterminal subgenomic RNAs.
  • the coat protein is encoded by the 3 '-most RNA, and the movement proteins by the larger sgRNA.
  • the virion RNA and sgRNAs are capped.
  • Tobamovirus RNAs are not polyadenylated, but contain a tRNA-like structure at the 3' end. Potevirus genomic and sgRNAs are polyadenylated.. A detailed description of tobamovirus gene expression and life cycle can be found, among other places, in Dawson and Lehto, Advances in Virus Research 38:307-342 (1991).
  • transient expression of foreign genes in plants using virus-based vectors has several advantages. Products of plant viruses are among the highest produced proteins in plants. Often a viral gene product is the major protein produced in plant cells during virus replication. Many viruses are able to quickly move from an initial infection site to almost all cells of the plant. Because of these reasons, plant viruses have been developed into efficient transient expression vectors for foreign genes in plants. Viruses of multicellular plants are relatively small, probably due to the size limitation in the pathways that allow viruses to move to adjacent cells in the systemic infection of entire plants. Most plant viruses have single-stranded RNA genomes of less than 10 kb. Genetically altered plant viruses provide one efficient means of transfecting plants with genes coding for peptide carrier fusions.
  • HPVs Human papillomaviruses
  • HPVs Human papillomaviruses
  • these tumors arise from keratinocytes of oral, epidermal, and anogenital sites, although some tumors (e.g. adenocarcinoma of the cervix) have a glandular morphology and origin.
  • cervical cancers not only do 95- 99% of cervical cancers originate from papillomavirus-infected cells (zur Hausen 1999), but papillomaviruses also appear to contribute significantly to the development of oral and epidermal cancers (Balaram et al, 1995). Malignant conversion of cervical epithelium appears to be restricted to a "high risk" subset of papillomaviruses, whose association with cancer correlates with the ability of their E6 and E7 proteins to efficiently inactivate the cellular p53 and pRb tumor suppressor proteins, respectively. A single "high risk" HPV type, HPV- 16 is associated with approximately 60% of cervical carcinomas.
  • Papillomavirus infection has become a significant public health issue in the United States, where at least 17.9% of women are seropositive for HPV-16 infection (Stone et al, 2002); this figure does not include rates of infection with other "high risk” HPV types, and is still significantly lower than infection rates in developing countries. There is thus a great need for development of efficacious and cost-effective vaccines mat will prevent papillomavirus infection and associated disease.
  • the viral capsid is comprised of 72 pentamers, or capsomeres, of LI . Approximately 12 molecules of the L2 protein are associated with each capsid, probably at die capsid vertices.
  • Regions of the L2 protein located towards the N-terminus are thought to be displayed on the surface of papillomavirus virions, since L2 antibodies can recognize both native virions and L1:L2 pseudovirions (Roden et al, 1994b; Liu et al, 1997; Kanawa et al, 1998a).
  • the L2 protein interacts with the viral DNA and is probably involved in virion assembly (Day et al, 1998).
  • Recombinant expression of the LI protein in eukaryotic cells e.g. in Sf9 insect cells using baculovirus expression vectors, results in the self-assembly of the LI protein within the nuclear compartment into capsid-like structures termed "virus-like particles" or VLPs.
  • Papillomavirus L1:L2 VLPs can encapsidate plasmid DNA as well as genomic DNA from other papillomaviruses, and these pseudovirions have proven useful for development of surrogate infection assays that have allowed both antibody- mediated virus neutralization studies and investigation of the mechanism of papillomavirus binding and entry into host cells (Roden et al, 1996; Giroglou et al, 2001; Kawana et al, 1998b; 2001b).
  • LI protein-based vaccines Early efforts to express LI protein-based vaccines showed that denatured protein purified from bacteria could not induce virus neutralizing antibodies in vaccinated animals. Conformational integrity of LI -based vaccines is critical because host antibodies recognized native, conformational epitopes on the virion (Ghim et al, 1991; Thompson et al, 1987). In the early to mid 1990's several groups demonstrated that LI protein expressed in eukaryotic expression systems — recombinant baculovirus-transduced insect cells and yeast — could assemble into virus-like particles (VLPs) that retain conformational epitopes essential for induction of neutralizing antibodies.
  • VLPs virus-like particles
  • Hemorrhagic fever viruses in the viral taxonomic families Filoviridae, Arenaviridae, Bunyaviridae and Flaviviridae threaten the health of humans and their livestock, particularly in developing countries. With the exception of yellow fever, there are no widely available, safe and efficacious vaccines that might prevent infection by any of the hemorrhagic fever viruses. In the wake of the attacks on the USA in September 2001, there is heightened awareness of the theoretical threat that biological terrorism, or biological warfare to human health.
  • HFVs were known to have been weaponized by the former Soviet Union, Russia, and the United States prior to 1969, development of safe, and easy-to-administer vaccines against high-priority HFVs would appear prudent from a National safety perspective (Borio et al, 2002).
  • Certain of the HFVs such as Rift Valley fever virus (RVFV) and Ebola virus (EBOV), present a threat to health of US military personnel deployed in Africa and the Middle East, as well as to travelers to those areas (Isaacson 2001).
  • a vaccine designed to protect against infection with human immunodeficiency type 1 will induce sterilizing immunity against a broad range of virus variants.
  • generation of broadly-neutralizing antibodies (Nabs) by vaccination, let alone natural infection has proven nearly impossible thus far.
  • Nabs broadly-neutralizing antibodies
  • These vaccines allow animals to control viral challenge by strong priming of virus-specific CD8 + T-cells (cytotoxic T cells, CTLs).
  • T-cell line-adapted (TCLA) strains of HIV-1 elicit Nabs that mostly target linear epitopes in the third variable cysteine loop (V3 loop) of gpl20, a region that is involved in co-receptor binding and hence vital for virus entry.
  • V3 loop variable cysteine loop
  • Subtype C isolates of HTV-l which infect more people worldwide than any other subtype, have relatively low level of sequence variation in the V3 loop (6,7).
  • neutralization of subtype C virus by V3 loop Abs is not extremely efficient in vitro, perhaps reflecting poor immunogenicity of epitopes in this region (7).
  • V3 loop may be hidden in the native gpl20 structure and not accessible to the immune system, and therefore that generation of V3-specific Nabs will be difficult with gpl20 subunit vaccines.
  • the V3 loop is vital for viral entry, and so significant levels of V3 loop-targeted Nabs should help prevent transmission of HIV-1.
  • Monoclonal antibody "bl2" recognizes a conformational epitope in the CD4 binding site of gpl20; 2G12 recognizes a discontinuous epitope in the C2-V4 region of gpl20 that includes N-glcyosylation sites, and 2F5 maps to a linear epitope (ELDKWA) in the membrane- proximal ectodomain of gp41 (9).
  • ELDKWA linear epitope
  • two broadly neutralizing monoclonal antibodies 4E10 and Z13 were shown to recognize a continuous epitope with core sequence NWFDIT, just C-terminal to the 2F5 recognition sequence (10,11). This strongly indicates that the membrane proximal region of gp41 plays a critical role in virus entry.
  • VX virus-like particles of the flexuous plant virus potato virus X
  • VLPs recombinant virus-like particles
  • This immunogen was able to induce production of human HIV-1 specific neutralizing antibodies (measured by in vitro inhibition of syncytium formation) in severe combined irnmunodeficient mice reconstituted with human periferal blood lymphocytes (hu-PBL-SCID) that had been immunized with human dendritic cells (DCs) pulsed with the PVX-2F5 VLPs.
  • hu-PBL-SCID human periferal blood lymphocytes
  • DCs dendritic cells
  • Rhesus monkeys were immunized with phage particles displaying the five epitopes that had shown potentially protective immune responses in mice, and challenged with pathogenic SHIV-89.6PD. While the immunized animals were not protected from SHIV infection, there was evidence of significant control of the challenge virus and the monkeys were protected from progression to AIDS. These results show similar levels of control to vaccines designed to generate virus-specific CTLs and infer that the antibody response was able to control viremia in the challenged animals.
  • a recent publication (22) described successful isolation of a number of human Nabs from XenoMouse immunized with gpl20 derived from a primary Subtype B isolate (SF162).
  • Non-structural HIV-1 proteins are found in the serum of infected individuals, and exert biological function, resulting in immunodeficiency and disease.
  • the Tat protein is required for HIV-1 replication and pathogenesis. It is produced early in the viral life cycle. In the nucleus of the infected cell, it interacts with host factors and the TAR region of the viral RNA to enhance transcript elongation and to increase viral gene expression (Jeang et al, 1999). Tat also is also found extracellularly, where it has distinct functions at may indirectly promote virus replication and disease, either through receptor mediated signal transduction or after intemalization and transport to the nucleus.
  • Tat suppresses mitogen-, alloantigen- and antigen-induced lymphocyte proliferation in vitro by stimulating suppressive levels of alpha interferon and by inducing apoptosis in activated lymphocytes.
  • Tat may alter immunity by upregulating IL-10 and reducing IL-12 production, or through its ability to increase chemokine receptor expression (Gallo et al, 2002; Tikhonov et al, 2003).
  • Antibody production against Tat has, in some cases, correlated with delayed progression to AIDS in HIV-1 infected people (Gallo et al, 2002).
  • Agwale et al. showed that antibodies induced in mice against a Tat protein subunit vaccine could negate the immune suppression activities of Tat in vivo.
  • Parvoviruses that are associated with enteric disease in domestic cats, dogs, mink and pigs are closely related antigenically, with different isolates diverging less than 2% in the sequence of the viral structural proteins.
  • Vaccination with killed or live-attenuated parvovirus protects animals against infection by Feline panleukopenia virus (FPV), canine parvovirus (CPV), mink enteritis virus (MEV) and porcine parvovirus (PPV).
  • FMV Feline panleukopenia virus
  • CPV canine parvovirus
  • MEV mink enteritis virus
  • PSV porcine parvovirus
  • maternal antibodies neutralize the vaccine, making it ineffective in animals that have not been weaned.
  • Subunit vaccines might overcome this limitation, and provide useful alternatives to conventional vaccines.
  • the present invention includes an immunological reagent having a plant viral protein covalently bound to an epitope peptide having die same linear sequence as an immunologically recognized epitope of a human papilloma virus, human immunodeficiency virus, ebola virus, rift valley fever virus or parvovirus.
  • the present invention also includes an immunological reagent having a plant viral protein covalently bound to an epitope peptide having the same linear sequence as an immunologically recognized epitope of a human papilloma virus, human immunodeficiency virus, ebola virus, rift valley fever virus or parvovirus, wherein die epitope peptide contains a sequence selected from the group consisting of the peptide sequences of Table 1, the peptide sequences of Table 6, the peptide sequences of Table 7, the peptide sequences of Table 8, HNTPVYKLDISEATQVE, ATQVEQHHRRTDNDSTA,
  • GKLGLITNTIAGVAGLI VQPDGGQPAVRNERAT, MSDGAVQPDGGQPAVRNERA, MSDGAVQPDGGQPAVRNERAT and KGTMDSGQTKREL.
  • the invention also includes a vaccine having an immunological reagent having a plant viral protein covalently bound to an epitope peptide having the same linear sequence as an immunologically recognized epitope of a human papilloma virus, human immunodeficiency virus, ebola virus, rift valley fever virus or parvovirus, wherein the epitope peptide contains a sequence selected from the group consisting of the peptide sequences of Table 1, the peptide sequences of Table 6, the peptide sequences of Table 7, the peptide sequences of Table 8, HNTPVYKLDISEATQVE, ATQVEQHHRRTDNDSTA, GKLGLITNTIAGVAGLI, VQPDGGQPAVRNERAT, MSDGAVQPDGGQPAVRNERA, MSDGAVQPDGGQPAVRNERAT and KGTMDSGQTKREL, and a pharmaceutically acceptable carrier or excipient.
  • a vaccine having an immunological reagent having a plant viral protein covalently bound to an epitop
  • the present invention also includes a metiiod for eliciting an immune response in an animal by administering a vaccine having an immunological reagent having a plant viral protein covalently bound to an epitope peptide having the same linear sequence as an immunologically recognized epitope of a human papilloma virus, human immunodeficiency virus, ebola virus, rift valley fever virus or parvovirus, wherein me epitope peptide contains a sequence selected from the group consisting of the peptide sequences of Table 1, the peptide sequences of Table 6, the peptide sequences of Table 7, the peptide sequences of Table 8, HNTPVYKLDISEATQVE, ATQVEQHHRRTDNDSTA,
  • GKLGLITNTIAGVAGLI VQPDGGQPAVRNERAT, MSDGAVQPDGGQPAVRNERA, MSDGAVQPDGGQPAVRNERAT and KGTMDSGQTKREL, and a pharmaceutically acceptable carrier or excipient to the animal.
  • the present invention includes a virus-like particle having a plurality of assembled protein subunits wherein each protein subunit is a plant viral coat protein covalently bound to an epitope peptide having the same linear sequence as an immunologically recognized epitope of a human papilloma virus, human immunodeficiency virus, ebola virus, rift valley fever virus or parvovirus.
  • the present invention also includes a virus-like particle having a plurality of assembled protein subunits wherein each protein subunit is a plant viral coat protein covalently bound to an epitope peptide having the same linear sequence as an immunologically recognized epitope of a human papilloma virus, human immunodeficiency virus, ebola virus, rift valley fever virus or parvovirus, wherein the sequence selected from the group consisting of the peptide sequences of Table 1, the peptide sequences of Table 6, the peptide sequences of Table 7, the peptide sequences of Table 8, HNTPVYKLDISEATQVE, ATQVEQHHRRTDNDSTA, GKLGLITNTIAGVAGLI, VQPDGGQPAVRNERAT, MSDGAVQPDGGQPAVRNERA,
  • the invention includes a vaccine having a virus-like particle having a plurality of assembled protein subunits wherein each protein subunit is a plant viral coat protein covalently bound to an epitope peptide having the same linear sequence as an immunologically recognized epitope of a human papilloma virus, human immunodeficiency virus, ebola virus, rift valley fever virus or parvovirus, and a pharmaceutically acceptable carrier or excipient.
  • the invention also includes a metiiod for eliciting an immune response in an animal including administering the vaccine having a virus-like particle having a plurality of assembled protein subunits wherein each protein subunit is a plant viral coat protein covalently bound to an epitope peptide having the same linear sequence as an immunologically recognized epitope of a human papilloma virus, human immunodeficiency virus, ebola virus, rift valley fever virus or parvovirus, and a pharmaceutically acceptable carrier or excipient to the animal.
  • the invention includes a plant virus having at least one plant viral coat protein covalently bound to an epitope peptide having the same linear sequence as an immunologically recognized epitope of a human papilloma virus, human immunodeficiency virus, ebola virus, rift valley fever virus or parvovirus.
  • the invention also includes a plant virus having at least one plant viral coat protein covalently bound to an epitope peptide having the same linear sequence as an immunologically recognized epitope of a human papilloma virus, human immunodeficiency virus, ebola virus, rift valley fever virus or parvovirus, wherein the sequence sequence is selected from the group consisting of the peptide sequences of Table 1, the peptide sequences of Table 6, the peptide sequences of Table 7, the peptide sequences of Table 8, HNTPVYKLDISEATQVE, ATQVEQHHRRTDNDSTA, GKLGLITNTIAGVAGLI, VQPDGGQPAVRNERAT, MSDGAVQPDGGQPAVRNERA,
  • the present invention also includes a vaccine having a plant virus having at least one plant viral coat protein covalently bound to an epitope peptide having the same linear sequence as an immunologically recognized epitope of a human papilloma virus, human immunodeficiency virus, ebola virus, rift valley fever virus or parvovirus, wherein the sequence sequence is selected from the group consisting of the peptide sequences of Table 1, the peptide sequences of Table 6, the peptide sequences of Table 7, the peptide sequences of Table 8, HNTPVYKLDISEATQVE, ATQVEQHHRRTDNDSTA,
  • GKLGLITNTIAGVAGLI VQPDGGQPAVRNERAT, MSDGAVQPDGGQPAVRNERA, MSDGAVQPDGGQPAVRNERAT and KGTMDSGQTKREL and a pharmaceutically acceptable carrier or excipient.
  • the invention also includes a method for eliciting an immune response in an animal including administering a vaccine having a plant virus having at least one plant viral coat protein covalently bound to an epitope peptide having the same linear sequence as an immunologically recognized epitope of a human papilloma virus, human immunodeficiency virus, ebola virus, rift valley fever virus or parvovirus, wherein the sequence sequence is selected from the group consisting of the peptide sequences of Table 1, the peptide sequences of Table 6, the peptide sequences of Table 7, the peptide sequences of Table 8, HNTPVYKLDISEATQVE, ATQVEQHHRRTDNDSTA, GKLGLITNTIAGVAGLI, VQPDGGQPAVRNERAT, MSDGAVQPDGGQPAVRNERA, MSDGAVQPDGGQPAVRNERAT and KGTMDSGQTKREL and a pharmaceutically acceptable carrier or excipient to the animal.
  • a vaccine having a plant virus having at least one
  • the present invention also includes the composition of the sixth paragraph of this section or the composition of the tenth paragraph of this section containing a plurality of different epitope peptides, each on a separate plant viral coat protein molecule.
  • the present invention also includes a method for preparing an antibody against a papilloma virus, ebola virus, HIV virus, Rift Valley Fever virus or a parvovirus including: exposing an animal to the vaccine described in the third, seventh, or eleventh paragraph of this section, recovering cells or body fluids from the animal, and preparing an antibody from said cells or body fluids.
  • the present invention includes the method of the above paragraph wherein the antibody is neutralizing.
  • the present invention includes a method for detecting a papilloma virus, ebola virus, HIV virus, Rift Valley Fever virus or a parvovirus comprising contacting an antibody produced by the method of the 14 th paragraph of this section with a sample suspecting of containing a virus, and detecting die presence or absence of antibody binding to the virus.
  • the present invention includes a method for inducing an immune response in an animal against a peptide epitope including: coupling the peptide epitope to a first carrier antigen to make a first vaccine composition, coupling the peptide epitope to a second carrier antigen, which is different from the first carrier antigen, to make a second vaccine composition, immunizing the animal with die first vaccine composition, at a later time, immunizing the animal with the second vaccine composition, wherein the immune response to the peptide epitope is boosted greater than die boosting of either carrier antigen.
  • the present invention also includes the method according to the previous paragraph further including: coupling a second peptide epitope to a third carrier antigen to make a third vaccine composition, coupling the second peptide epitope to a fourth carrier antigen, which is different from the third carrier antigen but may be the same as either the first carrier antigen or the second carrier antigen, to make a fourth vaccine composition, immunizing an individual animal with the first vaccine composition and the third composition, at a later time, immunizing the same individual animal with the second vaccine composition and the fourth composition, wherein the immune responses to the first and second peptide epitope are boosted greater than the boosting of the carrier antigens.
  • FIG 1 Tobamovirus gene map and expression products are diagrammed.
  • Figure 2 A series of flow charts showing methods used for construction of recombinant tobamoviruses with useful peptides genetically fused to the coat protein gene.
  • Figure 3 An uninfected Glurk plant leaf is shown on the left and a leaf with lesions is shown on the right, where each necrotic local lesion indicates a virus infection event.
  • Figure 4 SDS PAGE and MALDI-TOF analysis.
  • the vaccine samples were run in triplicate, with the Mark 12 protein molecular weight markers (Invitrogen) in the fourth lane in every case.
  • the molecular weight marker bands, from top to bottom are 36.5 kDa; 31 kDa; 21.5 kDa and 14.4 kDa.
  • the molecular weight of the upper viral band, as determined by MALDI-TOF is indicated in the figure.
  • FIG. 5 Western blot analysis of TMV:papillomavirus vaccines. Samples were loaded as indicated in the coomassie blue stained gel (lower right) and probed with rabbit antisera indicated above the blots.
  • Figure 6 Scatter plot indicating ELISA (IgG) response of all immunized animals to the cognate peptide antigen. Sera analyzed here were from bleed 3, post vaccine 4.
  • Figure 7 Bar graph showing responses to peptide antigens, pooled data with error bars indicating 95% confidence interval. Sera analyzed were from bleed 3, post vaccine 4.
  • Figure 8 Analysis of serum cross-reactivity between papillomavirus peptide antigens.
  • Figure 9 Comparison of IgG antibody response to vaccination with CRPV2.1 vaccines, BEI treated and non-treated (left) and to the HPV6/11 vaccine (right). Each bar represents the specific IgG level of an individual mouse.
  • Figure 10 shows the results of IgG subtype measurement in sera of animals vaccinated with the five different papillomavirus L2 vaccines. The immune response appears balanced; but, the concentration of IgGl subtype appears to be at least 3 -fold greater than that of IgG2, perhaps indicating a dominant Th2 response.
  • Figure 11 ELISA measurement of relative amounts peptide specific IgG after vaccine 3 (left) and 4 (right).
  • Figure 12 IgG subtype measurements in sera of Guinea Pigs vaccinated with TMVpapillomavirus vaccines.
  • FIG 13 Cross-reactivity of sera of guinea pigs immunized with CRPV- or HPV 6/11 TMV peptide fusions, against HPV 16 L2 peptide capture antigen (LVEETSFIDAGAP). Each bar indicates the antibody response induced in an individual animal. The dashed line indicates the probable level of non-specific cross-reactive antibodies that were induced on vaccination witii TMV virions carrying the very distantly related cottontail rabbit papillomavirus peptide 2.1.
  • Figure 14 Shared amino acid identity between the HPV- 11 L2 peptide present on recombinant TMV virion LSB2282; the CRPV 2.1 peptide present on recombinant TMV virion LSB2283, and the HPV-16 L2 peptide LVEETSFIDAGAP that was conjugated to bovine serum albumin and used as the capture antigen in the ELISA.
  • Figure 15 Solubility of example coat fusion proteins carrying Ebola epitopes.
  • an "immunologically recognized epitope peptide” generally has at least 8 amino acids unique to an antigen, or closely related antigens, and is a binding site for a specific antibody or T-cell receptor.
  • the antibody and/or cytotoxic T-lymphocyte containing the T- cell receptor are induced upon immunization or infection with an antigen containing this epitope peptide.
  • epitope peptide or a “peptide epitope” includes the specific sequences described below chemically bonded to the N-terminal, the C-terminal or an internal region of an antigen.
  • the epitope peptide may be longer than the specific sequences described below with boardering sequence(s) having the same sequence as the viral pathogen's antigens.
  • the epitope may contain slight amino acid substitutions (preferably conservative substitutions) slight deletions in the sequences recited provided that the epitope peptide contains a sufficient amount of the sequence to bind to a specific antibody and/or to elicit a specific antibody capable of binding specifically to the natural antigen.
  • Examples of a shorter epitope peptide include the 1 N-terminal amino acid in the HPV- 16 LI protein epitope and Ebola virus epitope GP-1 amino acid number 405.
  • protein is intended to also encompass derivitized molecules such as glycoproteins and lipoproteins as well as lower molecular weight polypeptides.
  • binding component may be any of a large number of different molecules, and the terms are sometimes usable interchangeably.
  • the receptor is usually an antibody and the ligand is usually the pathogenic virus such as a papilloma virus, ebola virus, HIV virus, Rift Valley Fever virus or a parvovirus.
  • binding includes any physical attachment or close association, which may be permanent or temporary. Generally, an interaction of hydrogen bonding, hydrophobic forces, van der Waals forces etc. facilitates physical attachment between the ligand molecule of interest and the receptor.
  • the "binding" interaction may be brief as in the situation where binding causes a chemical reaction to occur. Reactions resulting from contact between the binding component and the analyte are within the definition of binding for the purposes of me present invention. Binding is preferably specific. Specific binding indicates substantially no strong binding to other antigens. A comparison of the binding of different papilloma viruses as shown below emphasizes the nature of the specific binding. The binding may be reversible, particularly under different conditions.
  • bound to refers to a tight coupling of the two components mentioned.
  • the nature of the binding may be chemical coupling through a linker moiety, as a fusion protein produced by expression of a single ORF, physical binding or packaging such as in a macromolecular complex.
  • all of the components of a cell are “bound to” the cell.
  • Labels include a large number of directly or indirectly detectable substances bound to another compound and are known per se in me immunoassay and hybridization assay fields. Examples include radioactive, fluorescent, enzyme, chemiluminescent, hapten, a solid phase, spin labels, particles, etc. Labels include indirect labels, which are detectable in the presence of another added reagent, such as a receptor bound to a biotin label and added avidin or streptavidin, labeled or subsequently labeled with labeled biotin simultaneously or later.
  • an "antibody” is a typical receptor and includes fragments of antibodies, e.g., Fab, Fab2, recombinant, reassortant, single chain, phage display and other antibody variations.
  • the receptor may be directly or indirectly labeled.
  • alternative methods may be used such as agglutination or precipitation of the ligand/receptor complex, detecting molecular weight changes between complexed and uncomplexed ligands and receptors, optical changes to a surface and other changes in properties between bound and unbound ligands or receptors.
  • biological sample includes tissues, fluids, solids (preferably suspendable), extracts and fractions that contain proteins. These protein samples are from cellular or fluids originating from an organism.
  • the host is generally a mammal, most preferably a human.
  • the present invention provides recombinant plant viruses that express fusion proteins that are formed by fusions between a plan viral coat protein and protein of interest. By infecting plant cells with the recombinant plant viruses of the invention, relatively large quantities of the protein of interest may be produced in the form of a fusion protein.
  • the fusion protein encoded by the recombinant plant virus may have any of a variety of forms.
  • the protein of interest may be fused to the amino terminus of the viral coat protein or the protein of interest may be fused to the carboxyl terminus of the viral coat protein. In other embodiments of the invention, the protein of interest may be fused internally to a coat protein.
  • the viral coat fusion protein may have one or more properties of the protein of interest.
  • the recombinant coat fusion protein may be used as an antigen for antibody development or to induce a protective immune response.
  • the subject invention provides novel recombinant plant viruses that code for the expression of fusion proteins that consist of a fusion between a plant viral coat protein and a protein of interest.
  • the recombinant plant viruses of the invention provide for systemic expression of the fusion protein, by systemically infecting cells in a plant.
  • large quantities of a protein of interest may be produced.
  • the fusion proteins of the invention comprise two portions: (i) a plant viral coat protein and (ii) a protein of interest.
  • the plant viral coat protein portion may be derived from the same plant viral coat protein that serves a coat protein for the virus from which the genome of the expression vector is primarily derived, i.e., the coat protein is native with respect to the recombinant viral genome.
  • the coat protein portion of the fusion protein may be heterologous, i.e., non-native, with respect to the recombinant viral genome.
  • the 17.5 KDa coat protein of tobacco mosaic virus is used in conjunction with a tobacco mosaic virus derived vector.
  • the protein of interest portion of the fusion protein for expression may consist of a peptide of virtually any amino acid sequence, provided that the protein of interest does not significantly interfere with (1) the ability to bind to a receptor molecule, including antibodies and T cell receptors (2) the ability to bind to the active site of an enzyme (3) the ability to induce an immune response, (4) hormonal activity, (5) immunoregulatory activity, and (6) metal chelating activity.
  • the protein of interest portion of the subject fusion proteins may also possess additional chemical or biological properties that have not been enumerated. Protein of interest portions of the subject fusion proteins having the desired properties may be obtained by employing all or part of the amino acid residue sequence of a protein known to have the desired properties.
  • the amino acid sequence of hepatitis B surface antigen may be used as a protein of interest portion of a fusion protein invention so as to produce a fusion protein tiiat has antigenic properties similar to hepatitis B surface antigen.
  • Detailed structural and functional information about many proteins of interest are well known; this information may be used by the person of ordinary skill in the art so as to provide for coat fusion proteins having the desired properties of the protein of interest.
  • the protein of interest portion of the subject fusion proteins may vary in size from one amino acid residue to over several hundred amino acid residues, preferably the sequence of interest portion of the subject fusion protein is less than 100 amino acid residues in size, more preferably, the sequence of interest portion is less than 50 amino acid residues in length.
  • the protein of interest portion may need to be longer than 100 amino acid residues in order to maintain the desired properties.
  • a smaller sequence containing only the particular epitope or even a fraction of it may be used.
  • the size of the protein of interest portion of the fusion proteins of the invention is minimized (but retains the desired biological/chemical properties), when possible.
  • the protein of interest portion of fusion proteins of the invention may be derived from any of the variety of proteins, proteins for use as antigens are particularly preferred.
  • the fusion protein, or a portion thereof may be injected into a mammal, along with suitable adjutants, so as to produce an immune response directed against the protein of interest portion of the fusion protein.
  • the immune response against the protein of interest portion of the fusion protein has numerous uses, such uses include, protection against infection, and the generation of antibodies useful in immunoassays.
  • a given fusion protein may have one or two fusion joints.
  • the fusion joint may be located at the carboxyl terminus of the coat protein portion of the fusion protein (joined at the amino terminus of the protein of interest portion).
  • the fusion joint may be located at the amino terminus of the coat protein portion of the fusion protein (joined to the carboxyl terminus of the protein of interest).
  • the fusion protein may have two fusion joints.
  • the protein of interest is located internal with respect to the carboxyl and amino terminal amino acid residues of the coat protein portion of the fusion protein, i.e., an internal fusion protein.
  • Internal fusion proteins may comprise an entire plant virus coat protein amino acid residue sequence (or a portion thereof) that is "interrupted" by a protein of interest, i.e., the amino terminal segment of the coat protein portion is joined at a fusion joint to the amino terminal amino acid residue of the protein of interest and the carboxyl terminal segment of the coat protein is joined at a fusion joint to the amino terminal acid residue of the protein of interest.
  • the fusion joints may be located at a variety of sites within a coat protein. Suitable sites for the fusion joints may be determined either through routine systematic variation of the fusion joint locations so as to obtain an internal fusion protein with the desired properties. Suitable sites for the fusion jointly may also be determined by analysis of the three dimensional structure of the coat protein so as to determine sites for "insertion" of the protein of interest that do not significantly interfere with the structural and biological functions of the coat protein portion of the fusion protein. Detailed three dimensional structures of plant viral coat proteins and their orientation in the virus have been determined and are publicly available to a person of ordinary skill in the art.
  • Polynucleotide sequences encoding the subject fusion proteins may comprise a "leaky” stop codon at a fusion joint.
  • the stop codon may be present as the codon immediately adjacent to the fusion joint, or may be located close (e.g., within 9 bases) to me fusion joint.
  • a leaky stop codon may be included in polynucleotides encoding the subject coat fusion proteins so as to maintain a desired ratio of fusion protein to wild type coat protein.
  • a "leaky” stop codon does not always result in translational termination and is periodically translated. The frequency of initiation or termination at a given start stop codon is context dependent.
  • the ribosome scans from the 5'-end of a messenger RNA for the first ATG codon.
  • the ribosome will pass, some fraction of the time, to the next available start codon and initiate translation downstream of the first.
  • the first termination codon encountered during translation will not function 100% of me time if it is in a particular sequence context. Consequently, many naturally occurring proteins are known to exist as a population having heterogeneous N and or C terminal extensions.
  • the vector may be used to produce both a fusion protein and a second smaller protein, e.g., the viral coat protein.
  • a leaky stop codon may be used at, or proximal to, the fusion joints of fusion proteins in which the protein of interest portion is joined to the carboxyl terminus of the coat protein region, whereby a single recombinant viral vector may produce both coat fusion proteins and coat proteins. Additionally, a leaky start codon may be used at or proximal to the fusion joints of fusion proteins in which the protein of interest portion is joined to the amino terminus of the coat protein region, whereby a similar result is achieved. In the case of TMVCP, extensions at the N and C terminus are at the surface of viral particles and can be expected to project away from the helical axis.
  • the fusion joints on the subject coat fusion proteins are designed so as to comprise an amino acid sequence that is a substrate for protease.
  • the protein of interest may be conveniently derived from the coat protein fusion by using a suitable proteolytic enzyme.
  • the proteolytic enzyme may contact the fusion protein either in vitro or in vivo.
  • the expression of the subject coat fusion proteins may be driven by any of a variety of promoters functional in the genome of the recombinant plant viral vector.
  • the subject fusion proteins are expressed from plant viral subgenomic promoters using vectors as described in U.S. Pat. No. 5,316,931.
  • Recombinant DNA technologies have allowed the life cycle of numerous plant RNA viruses to be extended artificially through a DNA phase that facilitates manipulation of the viral genome. These techniques may be applied by the person ordinary skill in the art in order make and use recombinant plant viruses of the invention.
  • the entire cDNA of the TMV genome was cloned and functionally joined to a bacterial promoter in an E. coli plasmid (Dawson et al., 1986).
  • Infectious recombinant plant viral RNA transcripts may also be produced using other well known techniques, for example, with the commercially available RNA polymerases from T7, T3 or SP6.
  • RNA polymerase and dinucleotide cap m7GpppG.
  • This not only allows manipulation of the viral genome for reverse genetics, but it also allows manipulation of the virus into a vector to express foreign genes.
  • a method of producing plant RNA virus vectors based on manipulating RNA fragments with RNA ligase has proved to be impractical and is not widely used (Pelcher, L. E., 1982).
  • Detailed information on how to make and use recombinant RNA plant viruses can be found, among other places in U.S. Pat. No. 5,316,931 (Donson et al.), which is herein incorporated by reference.
  • the invention provides for polynucleotide encoding recombinant RNA plant vectors for the expression of the subject fusion proteins.
  • the invention also provides for polynucleotides comprising a portion or portions of the subject vectors.
  • No. 5,316,931 are particularly preferred for expressing the fusion proteins of the invention.
  • Figure 2 demonstrates one way used in the present invention for constructing the recombinant tobamovimses used in the present invention.
  • An infectious clone of TMV strain UI called pBSG801 was used as the basic vector for construction of peptide fusion constructs, as well as for building other peptide fusion-acceptor vectors.
  • an Ncol restriction site was required for peptide insertions.
  • a version of pBSG801 was created where the Ncol site in the movement protein gene was mutated, without altering the amino acid sequence of the movement protein. In this construct (pBSG801 ANco), Ncol is available as a cloning site.
  • A. shows a method that was used for construction of peptide fusion constructs using a PCR-ligation method.
  • GGAGTTTGTGTCGGTGTGTATTG and R (GGAGTTTGTGTCGGTGTGTATTG) amplify a fragment of the pBSG801 or plasmid that spans the 3' end of the viral genome to a point upstream of the native Ncol site within the movement protein open reading frame.
  • Peptides may be fused to internal positions in the coat protein open reading frame by addition of synthetic DNA encoding the a fragment of the peptide of interest to internal primers F' and R'. Primers F and R' and R and F' are then used to amplify PCR products A and B. Ligation of A and B reconstitutes the peptide of interest in the same reading frame as the coat protein.
  • the ligated product is digested with Ncol and Kpnl
  • the engineered coat protein-peptide fusion is then translated in vivo when in v/tro-generated infectious R ⁇ A is used to infect Nicotiana plants.
  • B. Shows part of the plasmid pLSB2268 which was generated from pBSG801 ⁇ Nco: an Ncol site (CCATGG) was inserted at the start of the coat protein open reading frame to facilitate cloning of ⁇ -terminal peptide fusions by PCR.
  • Synthetic D ⁇ A encoding peptides of interest was inserted in frame with the ATG in the Ncol site into a primer homologous with the 5'1 end of the coat protein gene.
  • the specific PCR primer was used in PCR reactions with primer R (GGAGTTTGTGTCGGTGTGTATTG) and resulting PCR product was digested with Ncol and Kpnl and cloned into pLSB2268.
  • An alternative strategy for insertion of synthetic D ⁇ A encoding peptides of interest in different positions of tobamovirus coat proteins is shown in C.
  • Three different vectors were created; all were derived from pBSG801 ⁇ Nco. These acceptor vectors, pLSB2268; pLSB2269 and pLSB2109 contain restriction sites suitable for accepting double stranded oligonucleotides with sticky ends compatible with Ncol (5') and NgoMIV (3').
  • Complementary single stranded oligonucleotides are synthesized that encode the peptide of interest, such that the sense (top) strand has the sequence 5'-CATG( ⁇ ) n G-3' and the antisense (bottom) strand has the sequence 5'- CCGGC(NNN) n -3' where (NNN) n denotes a sequence of DNA that encodes amino acids in the peptide of interest.
  • the complementary oligonucleotides are annealed in vitro and the resulting dsDNA oligonucleotide with overhanging CATG and CCGG ends is ligated with acceptor vector that has been digested with Ncol and NgoMIV to create various coat protein fusion constructs.
  • the invention also provides for virus particles that comprise the subject fusion proteins.
  • the coat of the virus particles of the invention may consist entirely of coat fusion protein.
  • the virus particle coat may consist of a mixture of coat fusion proteins and non-fusion coat protein, wherein the ratio of the two proteins may be varied.
  • tobamovirus coat proteins may self-assemble into virus particles, the virus particles of the invention may be assembled either in vivo or in vitro. The virus particles may also be conveniently disassembled using well known techniques so as to simplify the purification of the subject fusion proteins, or portions thereof.
  • the invention also provides for recombinant plant cells comprising the subject coat fusion proteins and/or virus particles comprising the subject coat fusion proteins.
  • These plant cells may be produced either by infecting plant cells (either in culture or in whole plants) with infectious virus particles of the invention or with polynucleotides encoding the genomes of the infectious virus particle of the invention.
  • the recombinant plant cells of the invention have many uses. Such uses include serving as a source for the fusion coat proteins of the invention.
  • the protein of interest portion of the subject fusion proteins may comprise many different amino acid residue sequences, and accordingly may have different possible biological/chemical properties however, in a preferred embodiment of the invention the protein of interest portion of the fusion protein is useful as a vaccine antigen.
  • TMV particles and other tobamoviruses contain continuous epitopes of high antigenicity and segmental mobility thereby making TMV particles especially useful in producing a desired immune response. These properties make the virus particles of the invention especially useful as carriers in the presentation of foreign epitopes to mammalian immune systems.
  • RNA viruses of the invention may be used to produce numerous coat fusion proteins for use as vaccine antigens or vaccine antigen precursors, it is of particular interest to provide vaccines against viral pathogens of humans, and domestic animals. It is of particular interest to provide vaccines against human papillomavirus (HPV) types that are implicated in the etiology of cervical cancer, and other neoplasias, including but not limited to HPV-16, HPV-18, HPV-31, HPV-33, HPV-35 and HPV-52. While not implicated in cervical cancer a vaccine against HPV-6 and HPV- 11 is also desirable as such viruses cause much disease.
  • HPV human papillomavirus
  • the proteins are typically administered in a composition comprising a pharmaceutical carrier.
  • a pharmaceutical carrier can be any compatible, non-toxic substance suitable for delivery of the desired compounds to the body. Sterile water, alcohol, fats, waxes and inert solids may be included in the carrier. Pharmaceutically accepted adjuvants (buffering agents, dispersing agent) may also be incorporated into the pharmaceutical composition.
  • formulation for administration may comprise one or immunological adjuvants in order to stimulate a desired immune response.
  • compositions for parenteral administration which comprise a solution of the fusion protein (or derivative thereof) or a cocktail thereof dissolved in an acceptable carrier, preferably an aqueous carrier.
  • aqueous carriers can be used, e.g., water, buffered water, 0.4% saline, 0.3% glycerine and the like. These solutions are sterile and generally free of particulate matter.
  • compositions may be sterilized by conventional, well known sterilization techniques.
  • the compositions may contain pharmaceutically acceptable auxiliary substances as required to approximate physiological conditions such as pH adjusting and buffering agents, toxicity adjusting agents and the like, for example sodium acetate, sodium chloride, potassium chloride, calcium chloride, sodium lactate, etc.
  • concentration of fusion protein (or portion thereof) in these formulations can vary widely depending on the specific amino acid sequence of the subject proteins and the desired biological activity, e.g., from less than about 0.5%, usually at or at least about 1% to as much as 15 or 20% by weight and will be selected primarily based on fluid volumes, viscosities, etc., in accordance with the particular mode of administration selected.
  • the vaccine compositions of the present invention are used for inducing an immune response to prevent infection by one or more of the pathogenic viruses.
  • the vaccines may be provided to help in clearing the infection or to suppress the infection.
  • vaccines are given by injection or contact with mucosal, buccal, lung, eye or similar tissues.
  • Transdermal and oral administration may be used when sufficiently adsorbed and stable, particularly when tolerization is desired.
  • One or more of the vaccines may be used cross-immunize the individual recipient against related strains or viruses.
  • a single vaccine designed against one pathogen may be used against other related ones.
  • a single parvovirus vaccine composition may be used to induce an immune response against feline, canine and porcine parvoviruses in cats, dogs and pigs respectively due to a very similar viral antigen common to each virus.
  • the peptide epitope containing compositions may also be used as positive controls for diagnostic, epidemiological and other screening purposes.
  • compositions as used for vaccines may be used to immunize an animal for the production of antibodies, antibody-secreting cells (e.g. for monoclonal antibody production), T-cell receptors and corresponding T-cells. These materials may be used for diagnostic purposes, given by injection to provide passive immunity prophalactically or to treat an active infection.
  • binding assay formats may be used to detect the pathogenic viruses or antibodies to the viruses as a measure of past infection. Both competitive and non-competitive assays may be used with direct or indirect labels to one or more binding partners. These binding assays, particularly immunoassays are well known in the art.
  • EXAMPLE 1 Papillomavirus Vaccines
  • Antigens are most effectively delivered to the immune system in a repetitive configuration, like that presented by virus-like particles.
  • a crucial factor for immunogenicity is repetitiveness and order of antigenic determinants.
  • Many viruses display a quasicrystalline surface with a regular array of epitopes which efficiently crosslink antigen-specific immunoglobulins on the surface of B cells, leading to B cell proliferation and production of secreted antibodies (Bachmann et al, 1993; Fehr et al, 1998).
  • Triggered B cells can activate helper T cells, leading to long-lived B cell memory — essential for any vaccine.
  • Antibodies against the N-terminus of L2 can be neutralizing in pseudoinfection studies, but paradoxically the neutralizing antibodies do not inhibit virion binding to the cell surface (Gaukroger et al, 1996; Roden et al, 1994). It is possible that domains of L2 that bind neutralizing antibodies are not accessible in native virions or pseudovirions, but are exposed at some point during viral entry into cells. Recently Kawana et al. (2001b) showed that amino acids 108-126 of HPV 16 L2 (a neutralizing domain) could bind a proteinaceous receptor, present at higher level on the surface of epithelial cells than non- epithelial cells.
  • L2 binds a co-receptor on the cell surface and that at least a subset of virus neutralizing antibodies can block L2-mediated virus entry.
  • Papillomavirus virions and pseudovirions bind a wide variety of cell types and the N- termini of L2 proteins of mucosottopic papillomaviruses show high homology.
  • the binding specificity between L2 and a papillomavirus cell surface coreceptor could be a determinant of papillomavirus tissue tropism.
  • Kawana and colleagues show that immunization of mice (Kawana et al,
  • (2003) had to deliver relatively large quantities of peptide - 500 ⁇ g, by the intranasal route, to induce papillomavirus L2-specific antibodies.
  • the inventors predicted that display of the peptide as a highly repetitive antigen array, such as on the surface of TMV, would enhance the immunogenicity of the peptide.
  • RNA transcripts described in Table 1 were transcribed in vitro to generate capped infectious RNA transcripts (mMESSAGE mMACHINE Kit, Ambion, Austin TX). Transcription reactions were diluted in FES buffer, and plants were inoculated by leaf abrasion.
  • the four rabbit papillomavirus constructs (pLSB2283, pLSB2288, pLSB2285 and pLSB2280) were inoculated on two leaves of each of 40 to 46 Nicotiana benthamiana plants, 24 days post-sowing, and infectious transcripts of pLSB2282 (TMV:HPV-11L2) were inoculated on two leaves of each of 40, 27 day-old, Nicotiana excelsiana plants, a Large Scale Biology Corporation-proprietary field host for TMV (Fitzmaurice WP, US Patent 6,344,597). Wild type TMV UI was prepared from infected tobacco (Nicotiana tabacc m).
  • TMV:ROPV2.2 The recombinant TMV:ROPV2.2 virus induced necrotic symptoms on infected N. benthamiana plants; the other recombinant viruses induced symptoms typically seen in Nicotiana plants infected with TMV coat protein fusions, i.e. leaf crinkling, bubbling and twisting, and a stunted plant growtii habit.
  • the number of grams of tissue and DPI for each construct is summarized in Table 2.
  • Table 2 Record of production of recombinant TMV in Nicotiana plants
  • N. benthamiana plants were used for die rabbit papillomavirus constructs.
  • Excelsiana plants were chosen for the HPV construct because if this moved forward to a product it would most likely be grown in the field and Excelsiana is a better host for the field.
  • the control virus was wild type TMV UI for which MD609 plants are the host of choice. Virus is generally allowed to accumulate for longer time periods in the larger MD plants prior to harvest.
  • Infected plant material was harvested between 8 and 14 days post-inoculation, when the virus accumulation was estimated to be the highest in infected leaf tissues. Only plant material (stem and leaves) above the inoculated leaf was harvested. The harvested tissue was weighed and chopped into small pieces. The virus was extracted by grinding the tissue in a four liter Waring Blender, for two minutes on high speed in a 1:2 ratio (tissue:buffer) of 0.86M sodium chloride, 0.04% sodium metabisulphite solution that had been chilled to 10°C. The temperature of the homogenate (“green juice”) was measured and recorded: this averaged 20.5°C. The homogenate was recovered by squeezing through four layers of cheesecloth, and the volume of homogenate measured. Two 0.5 ml samples of the green juice were collected for analysis by SDS-PAGE, and for bioburden analyses.
  • the pH of the homogenate was measured and adjusted to pH5.0 with concentrated phosphoric acid.
  • the green juice was then heated to 47°C, and held at that temperature for 15 minutes to coagulate contaminating plant proteins.
  • the homogenate was then cooled to 15°C in an ice bath.
  • the pH/heat treated homogenate was clarified by centrifugation at 6,000 x g for 5 minutes.
  • the supernatant (Sl) was decanted through two layers of Miracloth, and the volume of Sl recovered was recorded. Two 0.5 ml samples were collected for SDS-PAGE, protein assay and bioburden analyses.
  • the pellet (PI) was resuspended in distilled water, adjusted to pH 7.4 with ⁇ aOH and centrifuged at 6,000 x g for 5 minutes to clarify.
  • the volume of the second supernatant (S2) was recorded, and sampled for SDS PAGE to verify that the majority of the virus was in the Sl fraction.
  • Recombinant virus was precipitated from Sl by adding polyethylene glycol (6000 Da molecular weight) to 4% final concentration. The solution was stirred for 20 minutes, and then chilled on ice for one hour. Precipitated virus was recovered by centrifugation at 10,000 x g for 10 minutes. The supernatants were decanted and discarded.
  • the recombinant virus pellets were resuspended in a modified phosphate buffered saline containing 0.86M NaCI, and chilled on ice for 30 minutes. The virus was centrifuged at 8,000 x g for 5 minutes to clarify. The supernatants were decanted through miracloth. Two 0.5 ml samples were collected for SDS PAGE analysis. A second PEG-mediated virus precipitation was then performed, as before, and the virus pellets resuspended in phosphate- buffered saline (PBS), pH 7.4. Insoluble material was pelleted by centrifugation at 10,000 x g for 5 minutes and the supernatant was recovered with a serological pipette.
  • PBS phosphate- buffered saline
  • the final purification step involved freezing and thawing of the virus samples to precipitate any remaining plant contaminants: samples were frozen at -20°C for several hours and then thawed at room temperature. Insoluble material was eliminated by centrifugation at 10,000 x g. The additional freeze-thaw purification steps were not carried out for the TMV:CRPV2.1 and TMV:HPVHL2 samples.
  • each fusion was measured using the BCA protein assay with IgG as the standard. Based on the virus concentration determination, a portion of each virus preparation was diluted to 0.5 mg/ml (live virus) or 0.55 mg/ml for the virus inactivation step.
  • Each recombinant TMV preparation was diluted to 0.55 mg/ml in PBS, pH 7.4 to account for the slight dilution due to reagent addition.
  • Virus was chemically inactivated by treatment with binary ethylenimine (BEI), by addition of a 0.1M BEI stock solution to a final concentration of 5mM BEI. Samples were incubated for 48 hours at 37°C with constant mixing by rotating tubes end over end in a 37°C incubator. After 48 hours the BEI was neutralized by addition of a 3 molar excess of sodium thiosulphate.
  • BEI binary ethylenimine
  • RVFV is perhaps the easiest to weaponize: aerosols are particularly infectious, and have frequently caused infection in laboratory personnel (Borio et al, 2002; Isaacson, 2001).
  • Monoclonal antibody 4D4 has been shown to inhibit RVFV plaque formation in cell culture and to protect mice against lethal challenge (Keegan and Collet, 1986; London et al, 1992).
  • Example 1 The general method used in Example 1 was repeated with the linear epitope that binds mAb 4D4 (sequence: KGTMDSGQTKREL) inserted at three different positions in the TMV UI coat protein: N-terminal (between amino acids 1 and 2); in the surface-located loop structure (between amino acids 64 and 65) and at the C-terminus, between amino acids 155 and 156.
  • the genetic constructs were verified by DNA sequencing, and assigned LSBC identifiers. Table 5 summarizes the expression and MALDI-TOF characterization for these viral fusion constructs.
  • Table 5 RVFV peptide fusions to the TMV UI coat protein.
  • Example 2 The general method used in Example 1 was repeated with the three known linear epitopes from EBOV GP1 that bind monoclonal antibodies that neutralize EBOV infection in vitro and in vivo (Wilson et al. 2000).
  • the peptide VYKLDISEA is bound by Mab 6D8- 1-2; Mab 13F6-1-2 binds the amino acid sequence DEQHHRRTDND and mAb 12B5-1-1- binds amino acid sequence LITNTIAGV (Wilson et al, 2000).
  • Table 6 summarizes the expression and solubility data for these recombinant TMV virions.
  • Table 6 Solubility and confirmation of three Ebola epitopes fused to three locations on the TMV UI coat protein.
  • N N-terminus
  • Near C the insertion site is before the last four amino acid of the coat protein.
  • Figure 15 shows an SDS PAGE gel where extracts from plants infected with infectious transcripts of the various EBOV peptide:TMV fusion constructs were separated according to molecular mass. Proteins from leaf tissues of two infected plants were extracted in sodium acetate "N" buffer (pH 5), the pellet was further extracted in TRIS-Cl "T” buffer (pH 7.5). To extract total protein, another leaf sample was extracted in SDS denaturing "S" buffer (75 mM TRIS (pH 7), 2.5% sodium dodecyl sulfate (SDS), 6% glycerol, 2.5% beta-mecapthoethanol, and 0.05% bromphenol blue).
  • SDS denaturing "S” buffer 75 mM TRIS (pH 7), 2.5% sodium dodecyl sulfate (SDS), 6% glycerol, 2.5% beta-mecapthoethanol, and 0.05% bromphenol blue).
  • the protein molecular weight marker "Ml 2" is Mark 12 (In vitrogen) spiked with 1.2 meg of wild type TMV UI coat protein (CP). The arrow indicates the recombinant product (coat protein fused to an Ebola GPi epitope).
  • EXAMPLE 3 Human Immunodeficiency virus type 1 (HIV-1) vaccines
  • Example 1 The general method used in Example 1 was repeated with the linear epitopes from HIV proteins.
  • Table 7 a list of peptides that have been displayed on the surface of TMV UI and/or U5 virions is displayed.
  • Example 2 The general method used in Example 1 was repeated with the linear epitopes from parvo virus.
  • the N-terminus of FPV, CPV and PPV VP2 contains a major neutralizing determinant for the virus; this is a linear epitope, present in the first 23 amino acids of the protein.
  • Neutralizing antibodies may be induced in animals immunized with peptides derived from the first 23 amino acids of VP2 (Langeveld et al, 1995; 2001).
  • the sequence of the N-terminus of VP2 follows: MSDGAVQPDGGQPAVRNERATGS.
  • EXAMPLE 5 Determination of viral infectivity and bacterial bioburden of recombinant TMV particles carrying vaccine epitopes
  • Table 3 A list of final products with titers diluents, carrier are given in Table 3.
  • Table 3 Papillomavirus Vaccines Final Volumes and Virus Quantities
  • Process samples and final product for bacterial bioburden were monitored by aseptically plating 10 ⁇ l or 100 ⁇ l samples on bacterial nutrient agar in a laminar flow hood. Plates were inverted and incubated at room temperature for four days. The bacterial colony counts were recorded after four days. The plates were then transferred to a 33°C incubator for a further four days, and bacterial colony counts were recorded again. Bioburden assays for final fill samples were run in duplicate and the results averaged. Bioburden decreased with each sequential processing step from 420 - 3800 colony forming units (CFU) per ml in the initial homogenate, to 0 - 130 CFU/ml in the final (concentrated) virus preparations. The final dilute vaccines had no detectable bioburden in either die untreated or BEI-treated samples.
  • CFU colony forming units
  • TMV infectivity was determined using a local lesion host Nicotiana tabacum var. Xanthi, cultivar "Glurk”. This assay is accepted by the United States Department of Agriculture as a method for evaluating tobacco mosaic virus infectivity. The limit of detection for the Glurk assay is 10 pg/ ⁇ l. Glurk plants were sown into flats and transplanted into 3.5 inch pots at two weeks post sowing. The Glurks were prepared for inoculation by numbering the leaves to be inoculated with a lab marker on the upper distal portion of the leaf. A small amount of silicon carbide (400 mesh) was sprinkled on each numbered leaf.
  • TMV:HPV11L2 (1 EU/dose)
  • TMV:ROPV2.1 (2 EU/dose)
  • TMV:ROPV2.2 (2 EU/dose)
  • Membranes with TMV papillomavirus vaccine antigens were probed with rabbit antisera specific for rabbit or human papillomaviruses by Western blot analysis. The results are shown in Figure 5: there is some cross-reactivity between ROPV2.1 and CRPV2.1.
  • Preliminary immunogenicity testing of the papillomavirus:TMV epitope fusions was performed to ensure that appropriate antibody responses could be induced by immunization of animals with the vaccines, and to determine what, if any, effect BEI-inactivation of the TMV virions would have on the immunogenicity of the recombinant viruses.
  • Four to five week old, female BALB/c mice were used to assay immunogenicity of the vaccines, and to compare die immunogenicity of BEI-inactivation TMV preparations with untreated controls.
  • TMV vaccine product Four animals per group received a dose of lO ⁇ g of the TMV vaccine product, administered subcutaneously. Vaccines were administered every second week, and a total of four vaccines were given. All six BEI-inactivated vaccines were administered, and untreated (non-BEI inactivated) versions of the TMV, TMV:CRPV2.1 and TMV:HPV11L2 vaccines were given to serve as controls for the BEI-inactivated vaccines.
  • ELISA using peptide-conjugated bovine serum albumin as the capture antigen, determined antibody titers. Rabbit polyclonal sera specific for the peptide epitopes were provided by Neil Christensen, and served as positive controls, and tittering standards on ELISA plates. The rabbit sera used as positive control were: HPV1/11 NC25 C000840; CRPVL2.1 B0229; CRPVL2.2 B0225; ROPVL2.1 B0219 and ROPVL2.2 B0220.
  • a dilution of the rabbit sera was chosen, and arbitrarily set to 1.
  • the mouse antibody titers were expressed as a unit of the rabbit sera.
  • the subclasses of antibodies of the IgG isotype were measured with secondary antibodies specific for mouse IgGl or IgG2.
  • Figure 6 shows a scatter plot of antibody responses of all vaccinated animals to the peptide antigen;
  • Figure 7 shows the same data in bar graph format, with error bars indicating 95%) confidence intervals.
  • the X axis standard is normalized to the various rabbit positive control sera, where 1 unit is the OD obtained for a 1 :1000 dilution. This gives some indication of the range of responses seen in each group, relative to the positive control sera.
  • Figure 8 shows an analysis of the antigen-specificity of sera from vaccinated animals. Pooled sera were reacted with plates carrying all of the different peptide antigens. The antibodies appear very specific, in all cases, with no, or very little cross-reactivity between antigens. The effect of BEI inactivation of TMV peptide vaccines, with untreated samples was compared. The data depicted in Figure 9 show that the immune response of animals vaccinated with BEI-inactivated TMV:CRPV2.1 and untreated TMV:CRPV2.1 was qualitatively similar. Likewise, animals vaccinated with BEI-inactivated TMV:HPV6/11L2 and the untreated version reacted similarly.
  • FIG 11 shows the antibody titer obtained for each individual animal after vaccine 3 (left) and after vaccine 4 (right).
  • the anti CRPV2.2 peptide response was very low, and only marginally above background. It is possible that in this vaccine, which contained more than 50% cleavage, a new epitope comprising die part of the TMV coat protein and part of the first 10 amino acids of the CRPV2.2 peptide is recognized and is dominant over the authentic CRPV2.2 epitope.
  • the titer of the CRPV2.1 and HPV6/11 peptide antibodies was significantly higher in the Guinea pig sera in comparison with the BALB/c mouse sera. In all cases, both guinea pigs responded well to the vaccine; apparently well witiiin a Log of the rabbit titer. It is worthwhile noting that the mice received 1/10 of the vaccine dose that the guinea pigs received, and that the higher dose could have had some positive effect on the immune response observed in the guinea pigs.
  • the IgG subtype analyses presented in Figure 10 show that the guinea pigs responded similarly to the mice to the vaccines: with a balanced, but apparently Th2- dominant response.
  • Bleeds 1 and 2 and terminal bleeds from all the guinea pigs, and terminal bleeds from highest mouse responder in each group are available for CRPV and HPV6 or HPV 11 neutralization assays.
  • EXAMPLE 6 Carrier Rotation to Improve Immunological Responses to Peptide-Based Vaccines
  • VLP Virus like particle
  • Vaccine like particle (VLP) -based vaccines can carry specific antigens and to be particularly effective in inducing humoral, and sometimes, cellular immune responses. It is now well established that peptides are most efficiently presented to the mammalian immune system in a highly ordered, repetitive, quasicrystalline array as provided by a VLP structure (Bachmann et al, 1993; Savelyeva et al, 2001). By their structure, VLPs are capable of stimulating proliferation of dendritic cells and other antigen presenting cells resulting in strong immunological responses thus producing protective immunity and even breaking tolerance for self-antigens (Savelyeva et al, 2001; Fitchen et al, 1995).
  • HBcAg hepatitis B core antigen
  • papillomaviruses represent well-established metiiodologies for recombinant production of VLP-epitope display.
  • HBcAg VLPs are produced recombinantly in E. coli systems and are effective tools for VLP display (Bachman and Kopf, 2002). Purification of endotoxin-free structures is a challenge from such systems. In addition, the rate of successful expression of epitopes genetically fused to these structures is highly variable.
  • the tobamovirus family offers the tools for building a robust epitope display vaccine platform.
  • Each of the 13 tobamovirus species encodes a coat protein with similar structural folding (Stubbs, 1999).
  • Each coat protein exhibits surface exposed N and C termini (extreme end and upstream of terminal GPAT motif) and a single surface-exposed loop ("60 's loop) mat have been shown experimentally to tolerate insertion of peptide sequences ( Figure 1; see references within 1).
  • TMV strains Ul, U5, cucumber green mild mottle virus (CGMMV), and ribgrass mosaic virus (RMV) are all immunologically distinct, while TMV Ul and ToMV are immunologically similar (Jaegle and Van Regenmortel, 1985; Gibbs 1999; 1997).
  • CGMMV cucumber green mild mottle virus
  • RMV ribgrass mosaic virus
  • Extensive studies by phytopathologists determined that mammals immunized with tobamovimses produce antibodies with little cross-reactivity with other tobamovirus coat proteins. This structural conservation, coupled with immunologic distinctness, provides a unique opportunity for deriving a platform of vaccine protein scaffolds that share similar biochemical and purification properties.
  • TMV VLPs Display of peptides on TMV VLPs may be used for the induction of neutralizing responses to biodefense related pathogens was illustrated by VLP vaccine candidates generated against the filovirus pathogen Ebola. Additional biodefense related epitopes have been identified for bacterial and viral pathogens and include the Rift Valley Fever neutralization epitope KGTMDSGQTKREL bound by protective Mab 4D4 (Keegan and Collett, 1986; London et al, 1992). We have also made the TMV virions displaying peptides specifically binding neutralizing antibodies against the Ebola virus (Wilson et al, 2000). The minimal consensus sequence, underlined, represents the common sequence found on two adjacent overlapping peptides that were bound by the neutralizing MAb:
  • Fusion proteins of these minimal consensus peptides were generated at the N- terminal, 60 's loop, and near the C-terminal of the TMV Ul coat protein using the general techniques above.
  • the solubility of peptides fused to the coat proteins extracted from N. benthamiana plants inoculated with infectious transcripts is shown in Table 6 and Figure 15.
  • the virions that remain soluble in aqueous solutions differ in terms of the absolute yield of recombinant virus recovered from infected tissues, and the optimal buffer extraction conditions necessary for extraction.
  • the epitope GP 1-481 fused to ⁇ -terminal of coat protein has a slightly lower yield compared to the same epitope fused near the C- terminus of the TMV Ul coat protein.
  • the cloning vectors for fusing peptides to various tobamovirus coat proteins were constructed using unique restriction endonuclease sites, PCR-based genetic fusions and insertion cloning procedures.
  • vectors possess unique Ncol and NgoMIV restriction sites at four locations, ⁇ -terminal, C- terminal, C-terminal upstream of the GPATmotif, and within the surface exposed loop region. These linearized sites can readily accept any hybridized oligonucleotides (coding for epitopes) with the same overhangs.
  • Recombinant virus clones were transcribed and capped in-vitro, and the infectious transcripts were inoculated onto plants: N. benthamiana or N. excelsiana. Infections of plants were scored visually between 5 and 10 days post inoculation.
  • a low pH buffer 50 mM sodium acetate, 5 mM EDTA, pH 5.0 was very useful for initial extraction of virus coat protein fusions since many host proteins are insoluble at this pH and so coat protein bands are easily visible in extracts run in SDS-PAGE gels and stained with Coomassie Brilliant Blue. However, several coat fusions were not soluble under these conditions. Some of these were selectively solubilized from insoluble plant material by resuspension of the material in 50 mM Tris-HCl pH 7.5 buffer followed by centrifugation to remove insoluble materials. The virus was purified by differential centrifugation followed by precipitation of virus by treatment of supernatants with 4% polyethylene glycol in the presence of 0.7M ⁇ aCl.
  • Peptide display vaccines applied with a single carrier can induce a response primarily to the carrier protein, rather than effectively boosting immune responses to the peptide antigen.
  • a carrier rotation approach to vaccines was used.
  • the peptide immunogen such as Ebola neutralizing peptide GP 1-393 (VYKLDISEA)
  • VYKLDISEA Ebola neutralizing peptide GP 1-393
  • the immune system of the immunized individual sees only one consistent linear epitope, and that is for die peptide immunogen.
  • This enhances the level of immune response and the specificity of the immune response over that available for a vaccine using a single carrier in repeated immunizations.
  • the principle is useful for any peptide or protein antigen which is presented with a non-specific antigen.
  • the booster effect of multiple vaccinations is then directed only to the specific peptide immunogen, not to the carrier molecule or portion or the carrier molecule.
  • This concept was extended to a multi-peptide immunogen vaccine.
  • a set of peptide immunogens was employed in a vaccine to induce a wider anti-pathogen response against a single organism (e.g. Ebola: peptides GP1-393, 405, 481).
  • a set of peptide immunogens to different organisms can be applied in a single vaccine to induce an effective immune response against more than one organism simultaneously (e.g. Ebola, GP 1-393 and RVFV 4D4 peptide).
  • Each is fused to the surface of the coat protein of TMV Ul and TMGMV or RMV coat protein.
  • the initial immunization is given with the TMV Ul -peptide vaccines and the boosting immunization will be given 2-4 weeks later using the TMGMV or RMV fusions.
  • the immune system of the immunized individual sees only the two (or more) consistent linear epitopes that are for the multi- pathogen peptide immunogens.
  • This approach enhances the level of immune response and the specificity of the immune response over that available for a vaccine using a single carrier in repeated immunizations.
  • the epitope peptide may be fused to the carrier antigen or it may be mixed therewith to present or enhance the immune response.
  • Plural epitope peptides may be bound to the same or different carrier antigens simultaneously.
  • a murine model for Ebola filovirus is an example of the test systems that may be used to for such a rotating carrier approach.
  • Murine test hosts were of the Balb C or C57B1/6 mouse strains. Mice were immunized with VLP peptide vaccines (a dose range (2 and 10 meg) fused to TMV Ul (first immunization), TMGMV or RMV (second and/or third immunization). Peptides were chosen from the group (peptides GP1-393, 405, 481) and PBS buffer was used a negative control. Mice were immunized at two week intervals.
  • Targets included cognate peptide conjugated to BSA, TMV-Ebola peptide fusion, TMV- RVFV peptide fusion, and TMV. Plates are washed, blocked, and incubated with a 1:3 serial dilution of sera from immunized or control mice at a starting dilution of 1:10. Plates were tiien washed, and incubated with an anti-mouse-HRP conjugate. Following secondary incubation, plates were washed, and developed by standard procedure, and read on a Molecular Devices Gemini plate reader at 405 run. The level of bound antibodies were determined by comparing to the known amount of neutralizing MAb.
  • Ebola peptide immunogens fused to tobamovirus VLP structures can be tested for efficacy in an Ebola challenge model.
  • Ten mice per treatment will be evaluated in each of two experiments.
  • C57BL/6 mice will be vaccinated at two doses at 4 week intervals and challenged intraperitoneally with 1000 pfu of mouse-adapted Ebola Zaire virus (2; 43) one month after the final immunization. Mice will be observed daily for signs of illness for 28 days after challenge.
  • EXAMPLE 7 Carrier Rotation to Improve Immunological Responses to HIV Vaccines Ideally, a vaccine designed to protect against infection with human immunodeficiency type 1 (HIV-1) will induce sterilizing immunity against a broad range of virus variants.
  • HIV-1 human immunodeficiency type 1
  • V3 loop variable cysteine loop
  • TCLA T-cell line-adapted
  • gpl20 variable cysteine loop
  • Subtype C isolates of HIV-1 which infect more people worldwide than any other subtype, have relatively low level of sequence variation in the V3 loop (Engelbrecht et al, 2001; Bures et al, 2002).
  • neutralization of subtype C virus by V3 loop Abs is not extremely efficient in vitro, perhaps reflecting poor immunogenicity of epitopes in this region (Bures et al, 2002).
  • V3 loop may be hidden in the native gpl20 structure and not accessible to the immune system, and therefore that generation of V3 -specific Nabs will be difficult with gpl20 subunit vaccines.
  • the V3 loop is vital for viral entry, and so significant levels of V3 loop-targeted Nabs should help prevent transmission of HIV- 1.
  • Monoclonal antibody "bl2" recognizes a conformational epitope in the CD4 binding site of gpl20; 2G12 recognizes a discontinuous epitope in the C2-V4 region of gpl20 that includes N-glcyosylation sites, and 2F5 maps to a linear epitope (ELDKW A) in the membrane- proximal ectodomain of gp41 (D'Souza et al, 1997).
  • ELDKW A linear epitope
  • two broadly neutralizing monoclonal antibodies 4E10 and Z13 were shown to recognize a continuous epitope with core sequence NWFDIT, just C-terminal to the 2F5 recognition sequence (Stiegler et al, 2001; Zwick et al, 2001).
  • Rhesus monkeys were immunized with phage particles displaying the five epitopes that had shown potentially protective immune responses in mice, and challenged with pathogenic SHIV-89.6PD. While the immunized animals were not protected from SHIV infection, there was evidence of significant control of the challenge virus and the monkeys were protected from progression to AIDS. These results show similar levels of control to vaccines designed to generate virus-specific CTLs and infer that the antibody response was able to control viremia in the challenged animals.
  • a recent publication (He et al, 2002) described successful isolation of a number of human Nabs from XenoMouse immunized with g l20 derived from a primary Subtype B isolate (SF162).
  • Non-structural HIV-1 proteins are found in the serum of infected individuals, and exert biological function, resulting in immunodeficiency and disease.
  • the Tat protein is required for HIV-1 replication and pathogenesis. It is produced early in the viral life cycle. In the nucleus of the infected cell, it interacts with host factors and the TAR region of the viral RNA to enhance transcript elongation and to increase viral gene expression (Jeang et al, 1999). Tat also is also found extracellularly, where it has distinct functions that may indirectly promote virus replication and disease, either through receptor mediated signal transduction or after internalization and transport to the nucleus.
  • Tat suppresses mitogen-, alloantigen- and antigen-induced lymphocyte proliferation in vitro by stimulating suppressive levels of alpha interferon and by inducing apoptosis in activated lymphocytes.
  • Tat may alter immunity by upregulating IL-10 and reducing IL-12 production, or through its ability to increase chemokine receptor expression (Gallo et al, 2002; Tikhonov et al, 2003).
  • Antibody production against Tat has, in some cases, correlated with delayed progression to AIDS in HIV-1 infected people (Gallo et al, 2002).
  • Agwale et al. showed that antibodies induced in mice against a Tat protein subunit vaccine could negate the immune suppression activities of Tat in vivo.
  • peptide epitopes were prepared in TMV coat proteins and produced as above.
  • Table 7 a list of peptides that have been displayed on the surface of TMV Ul and/or U5 virions is displayed.
  • the expression, extraction and solubility data for these recombinant viruses is summarized in Table 8.
  • Parvoviruses that are associated with enteric disease in domestic cats, dogs, mink and pigs are closely related antigenically, with different isolates diverging less than 2% in the sequence of the viral structural proteins.
  • Vaccination with killed or live-attenuated parvovirus protects animals against infection by Feline panleukopenia virus (FPV), canine parvovirus (CPV), mink enteritis virus (MEV) and porcine parvovirus (PPV).
  • FMV Feline panleukopenia virus
  • CPV canine parvovirus
  • MEV mink enteritis virus
  • PSV porcine parvovirus
  • maternal antibodies neutralize the vaccine, making it ineffective in animals that have not been weaned.
  • Subunit vaccines might overcome this limitation, and provide useful alternatives to conventional vaccines.
  • the N-terminus of FPV, CPV and PPV VP2 contains a major neutralizing determinant for the virus; this is a linear epitope, present in the first 23 amino acids of the protein.
  • Neutralizing antibodies may be induced in animals immunized with peptides derived from the first 23 amino acids of VP2 (Casal et al, 1995; Langeveld et al, 2001).
  • the sequence of the N-terminus of VP2 follows: MSDGAVQPDGGQPAVRNERATGS We designed a synthetic DNA sequences which would encode various portions of the N-terminal VP2 sequence.
  • the synthetic DNA was synthesized in complementary oligonucleotides, and inserted into the coat protein of TMV Ul and TMV U5, as depicted in Figure 2. These sequences of the peptides were denoted Parvol; Parvo2; and Parvo3. The amino acid sequences of these peptides are as follows: Parvo 1 : MSDGAVQPDGGQPAVRNERAT (21 amino acids)
  • a Tat subunit vaccine confers protective immunity against the immune- modulating activity of the human immunodeficiency virus type-1 Tat protein in mice.
  • Alani RM, Munger K (1998) Human papillomaviruses and associated malignancies. Journal of Clinical Oncology 16:330-337.
  • LI virus-like particles as defined by monoclonal antibodies.
  • Roden RB Weissinger EM, Henderson DW, Booy F, Kirnbauer R, Mushinski JF, Lowy
  • HPV ep8 HPV eplO As for HPV ep8

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Virology (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Veterinary Medicine (AREA)
  • Immunology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Microbiology (AREA)
  • Public Health (AREA)
  • Mycology (AREA)
  • Genetics & Genomics (AREA)
  • Epidemiology (AREA)
  • Zoology (AREA)
  • Biochemistry (AREA)
  • Wood Science & Technology (AREA)
  • Engineering & Computer Science (AREA)
  • Communicable Diseases (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Hematology (AREA)
  • Oncology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biophysics (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

L'invention concerne des vaccins et une composition de diagnostic fabriqués et utilisés en vue de prévenir, traiter et détecter des antigènes provenant du papillomavirus, du virus d'Ebola, du VIH, du virus de la fièvre de la vallée du Rift ou du parvovirus. Les épitopes de ces virus sont produits comme des peptides de fusion génétiquement modifiés dans des plantes par infection au moyen de vecteurs recombinants du tobamovirus en vue d'exprimer des protéines de fusion contenant les peptides de l'épitope.
EP03808079A 2002-09-03 2003-09-03 Production de peptides dans des plantes sous forme d'hybride de proteines de coque virale Withdrawn EP1549140A4 (fr)

Applications Claiming Priority (5)

Application Number Priority Date Filing Date Title
US40779502P 2002-09-03 2002-09-03
US407795P 2002-09-03
US457082 2003-06-06
US10/457,082 US20040033585A1 (en) 2002-06-07 2003-06-06 Flexible vaccine assembly and vaccine delivery platform
PCT/US2003/027563 WO2004032622A2 (fr) 2002-09-03 2003-09-03 Production de peptides dans des plantes sous forme d'hybride de proteines de coque virale

Publications (2)

Publication Number Publication Date
EP1549140A2 true EP1549140A2 (fr) 2005-07-06
EP1549140A4 EP1549140A4 (fr) 2009-04-29

Family

ID=32096072

Family Applications (1)

Application Number Title Priority Date Filing Date
EP03808079A Withdrawn EP1549140A4 (fr) 2002-09-03 2003-09-03 Production de peptides dans des plantes sous forme d'hybride de proteines de coque virale

Country Status (4)

Country Link
EP (1) EP1549140A4 (fr)
AU (1) AU2003296902A1 (fr)
CA (1) CA2497798A1 (fr)
WO (1) WO2004032622A2 (fr)

Families Citing this family (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1926238A (zh) 2004-02-27 2007-03-07 陶氏化学公司 植物细胞中的高效肽生产
WO2005108564A2 (fr) * 2004-03-25 2005-11-17 Large Scale Biology Corporation Production de peptides dans des plantes sous forme de fusion de protéines d'enveloppe virale
CA2594276A1 (fr) 2004-12-30 2006-07-13 Schering-Plough Ltd. Vaccins favorisant la croissance a base d'epitopes neutralisants
WO2017217460A1 (fr) * 2016-06-15 2017-12-21 出光興産株式会社 Protéine de fusion contenant au moins deux protéines liées entre elles par l'intermédiaire d'un lieur peptidique
CN111351929B (zh) * 2020-01-15 2022-08-16 南京农业大学 基于单克隆抗体的黄瓜绿斑驳花叶病毒的快速检测试纸条

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1991015587A1 (fr) * 1990-04-06 1991-10-17 Commonwealth Scientific And Industrial Research Organisation Systeme d'expression auto-polymerisante a base de proteines enveloppantes de potyvirus modifiees
WO1995031476A1 (fr) * 1994-05-17 1995-11-23 The University Of Queensland Papillomavirus recombine de type l1
WO1996012028A1 (fr) * 1994-10-14 1996-04-25 Biosource Technologies, Inc. Production de peptides dans des vegetaux par fusions de proteines d'enveloppe virales
CA2355883A1 (fr) * 1998-12-23 2000-07-06 Merck & Co., Inc. Dosage neutralisant utilisant des particules veriformes du papillomavirus humain
WO2001066778A2 (fr) * 2000-03-08 2001-09-13 Large Scale Biology Corporation Production de polypeptides etrangers dans des plantes sous forme d'hybrides de proteine de coque virales

Family Cites Families (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB9108386D0 (en) 1991-04-19 1991-06-05 Agricultural Genetics Co Modified plant viruses as vectors
US5667782A (en) * 1992-07-16 1997-09-16 Oxford University Multiple particulate antigen delivery system
US5795754A (en) * 1995-07-19 1998-08-18 Merck & Co., Inc. Synthetic HPV11 virus-like particles
EP1123114B1 (fr) * 1998-10-21 2005-12-28 THE UNITED STATES GOVERNMENT as represented by THE DEPARTMENT OF HEALTH AND HUMAN SERVICES Particules assimilees a des virus pour l'induction d'auto-anticorps
US20030005410A1 (en) * 1999-06-02 2003-01-02 American Management Systems, Inc. Of Fairfax, Va. Xml parser for cobol
DK1450856T3 (da) * 2001-09-14 2010-05-31 Cytos Biotechnology Ag Pakning af immunstimulatorisk CpG i virus-lignende partilker, fremgangsmåde og anvendelse

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1991015587A1 (fr) * 1990-04-06 1991-10-17 Commonwealth Scientific And Industrial Research Organisation Systeme d'expression auto-polymerisante a base de proteines enveloppantes de potyvirus modifiees
WO1995031476A1 (fr) * 1994-05-17 1995-11-23 The University Of Queensland Papillomavirus recombine de type l1
WO1996012028A1 (fr) * 1994-10-14 1996-04-25 Biosource Technologies, Inc. Production de peptides dans des vegetaux par fusions de proteines d'enveloppe virales
CA2355883A1 (fr) * 1998-12-23 2000-07-06 Merck & Co., Inc. Dosage neutralisant utilisant des particules veriformes du papillomavirus humain
WO2001066778A2 (fr) * 2000-03-08 2001-09-13 Large Scale Biology Corporation Production de polypeptides etrangers dans des plantes sous forme d'hybrides de proteine de coque virales

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See also references of WO2004032622A2 *

Also Published As

Publication number Publication date
WO2004032622A8 (fr) 2007-11-01
CA2497798A1 (fr) 2004-04-22
EP1549140A4 (fr) 2009-04-29
WO2004032622A3 (fr) 2005-04-28
AU2003296902A1 (en) 2004-05-04
WO2004032622A2 (fr) 2004-04-22

Similar Documents

Publication Publication Date Title
WO2021254327A1 (fr) Vaccin à vecteur viral de type à remplacement d'enveloppe et procédé de construction associé
CN112538105B (zh) 稳定的冠状病毒刺突(s)蛋白抗原和相关疫苗
CN107921117B (zh) Hpv疫苗
Nemchinov et al. Development of a plant-derived subunit vaccine candidate against hepatitis C virus
Slupetzky et al. A papillomavirus-like particle (VLP) vaccine displaying HPV16 L2 epitopes induces cross-neutralizing antibodies to HPV11
Spiropoulou et al. Sin Nombre virus glycoprotein trafficking
Peng et al. Papillomavirus virus-like particles can deliver defined CTL epitopes to the MHC class I pathway
ES2301551T3 (es) Moleculas l1 de papilomavirus humano (hpv) quimericas y usos de las mismas.
Pineo et al. Immunogenic assessment of plant‐produced human papillomavirus type 16 L1/L2 chimaeras
US20040170606A1 (en) Production of peptides in plants as viral coat protein fusions
Chakrabarti et al. Expanded breadth of virus neutralization after immunization with a multiclade envelope HIV vaccine candidate
US20080213293A1 (en) Prevention and Treatment of Recurrent Respiratory Papillomatosis
CN113862284B (zh) 一种编码重组禽流感病毒ha蛋白的基因、病毒样颗粒、疫苗及制备与应用
Hunter et al. Induction of mucosal and systemic antibody responses against the HIV coreceptor CCR5 upon intramuscular immunization and aerosol delivery of a virus-like particle based vaccine
DK2020444T3 (en) DEFECTIVE NON-INTEGRATIVE LENTIVIRAL TRANSMISSION VECTORS FOR VACCINES
EP1549140A2 (fr) Production de peptides dans des plantes sous forme d'hybride de proteines de coque virale
Kuck et al. Efficiency of HPV 16 L1/E7 DNA immunization: influence of cellular localization and capsid assembly
EP1732615A2 (fr) Production de peptides dans des plantes sous forme de fusion de protéines d'enveloppe virale
WO2021235503A1 (fr) Monomère protéique conjugué supportant la protéine du coronavirus, agrégat desdits monomères, et composant vaccinal comprenant ledit agrégat comme principe actif
AU8284298A (en) Homogeneous human papilloma virus capsomere containing compositions, methods for manufacture,and the use thereof as diagnostic, prophylactic or therapy
Ximba et al. Characterization and immunogenicity of HIV envelope gp140 Zera® tagged antigens
JP2009511640A (ja) マルチクレードｈｉｖワクチン
VZOROV et al. Immunogenicity of full length and truncated SIV envelope proteins
ZA200501807B (en) Production of peptides in plants as viral coat protein fusions
Zhao et al. Development and efficacy evaluation of remodeled canine parvovirus-like particles displaying major antigenic epitopes of a giant panda derived canine distemper virus

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20050331

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LI LU MC NL PT RO SE SI SK TR

AX Request for extension of the european patent

Extension state: AL LT LV MK

RIC1 Information provided on ipc code assigned before grant

Ipc: 7A 61K 48/00 A

DAX Request for extension of the european patent (deleted)
R17D Deferred search report published (corrected)

Effective date: 20071101

RIC1 Information provided on ipc code assigned before grant

Ipc: A61K 39/00 20060101AFI20071122BHEP

RAP1 Party data changed (applicant data changed or rights of an application transferred)

Owner name: KENTUCKY BIOPROCESSING, LLC

A4 Supplementary search report drawn up and despatched

Effective date: 20090326

RIC1 Information provided on ipc code assigned before grant

Ipc: A61K 39/12 20060101AFI20090320BHEP

RIC1 Information provided on ipc code assigned before grant

Ipc: A01N 61/00 20060101ALI20090917BHEP

Ipc: A61K 38/12 20060101ALI20090917BHEP

Ipc: A61K 39/00 20060101AFI20090917BHEP

17Q First examination report despatched

Effective date: 20100622

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20111112