EP1527191A1 - Verfahren zur biotransformation von carotinoiden mittels cytochrom p450 monooxygnase - Google Patents

Verfahren zur biotransformation von carotinoiden mittels cytochrom p450 monooxygnase

Info

Publication number
EP1527191A1
EP1527191A1 EP03766294A EP03766294A EP1527191A1 EP 1527191 A1 EP1527191 A1 EP 1527191A1 EP 03766294 A EP03766294 A EP 03766294A EP 03766294 A EP03766294 A EP 03766294A EP 1527191 A1 EP1527191 A1 EP 1527191A1
Authority
EP
European Patent Office
Prior art keywords
monooxygenase
cytochrome
sequence
amino acid
microorganism
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP03766294A
Other languages
English (en)
French (fr)
Inventor
Markus Matuschek
Bernhard Hauer
Rolf Schmid
Isabelle Melanie Kauffmann
Francesca Blasco
Claudia Schmidt-Dannert
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
BASF SE
Original Assignee
BASF SE
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by BASF SE filed Critical BASF SE
Publication of EP1527191A1 publication Critical patent/EP1527191A1/de
Withdrawn legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004Oxidoreductases (1.)
    • C12N9/0071Oxidoreductases (1.) acting on paired donors with incorporation of molecular oxygen (1.14)
    • C12N9/0077Oxidoreductases (1.) acting on paired donors with incorporation of molecular oxygen (1.14) with a reduced iron-sulfur protein as one donor (1.14.15)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P23/00Preparation of compounds containing a cyclohexene ring having an unsaturated side chain containing at least ten carbon atoms bound by conjugated double bonds, e.g. carotenes

Definitions

  • the invention relates to a method for the biotransformation of carotenoids using enzymes with cytochrome P450 monooxygenase activity; in particular monooxygenases from thermophilic bacteria, in particular of the genus Thermus sp. as well as the microorganisms and expression constructs which can be used for such processes.
  • Xanthophylls such as zeaxanthin and cryptoxanthin, are oxygen-containing carotenoids and, as pigmenting substances or precursors for vitamin A derivatives, are important additives for human or animal nutrition. Xanthophylls are also said to have a health-promoting effect. They strengthen the immune response and have anti-cancer effects due to their anti-oxidative properties, which makes them interesting as nutraceuticals.
  • Cytochrome P450 monooxygenases have the ability to catalyze technically interesting oxygenation reactions and have therefore been intensively investigated for some time.
  • the cytochrome P450 monooxygenase BM-3 from Bacillus megaterium has been isolated and characterized and is now accessible by a recombinant route (see e.g. DE-A-199 35 115).
  • This cytochrome P450 monooxygenase usually catalyzes the sub-terminal hydroxylation of long-chain, saturated acids and the corresponding amides and alcohols thereof or the epoxidation of unsaturated long-chain fatty acids or saturated medium-chain fatty acids.
  • the optimal chain length of saturated fatty acids is 14 to 16 carbon atoms.
  • the structure of the H m domain of P450 BM-3 was determined by X-ray structure analysis.
  • the substrate binding site is in the form of a long tunnel-like opening, which extends from the molecular surface to the heme molecule and is almost exclusively delimited by hydrophobic amino acid residues.
  • the only charged residues on the surface of the heme domain are Arg47 and Tyr51. It is believed that these are involved in binding the carboxylate group of the substrate by forming a hydrogen bond. Through the targeted introduction of point mutations, it is in the meantime managed to expand the substrate spectrum of this enzyme.
  • WO-A-02/33057 discloses cytochrome P450 monooxygenases from thermophilic bacteria which are suitable for the biotransformation of various organic substrates.
  • Carotenoids e.g. ⁇ -carotene is not mentioned as a potential substrate for the cytochrome P450 monooxygenases.
  • DE-A-199 16 140 describes a carotene hydroxylase from the green algae Haematococcus pluvialis which, among other things, catalyzes the conversion of ⁇ -carotene to zeaxanthin and cryptoxanthine. There is no indication of the possible usefulness of cytochrome P450 monooxygenases in the biotransformation of ⁇ -carotene.
  • the object of the present invention was therefore to provide new areas of application for cytochrome P450 monooxygenases.
  • the above object was achieved by providing a process for the oxidation of carotenoids, which is characterized in that a carotenoid is reacted in the presence of an enzyme with cytochrome P450 monooxygenase activity, which is also capable of carotenoid oxidation, and the oxidation product is isolated
  • an enzyme with cytochrome P450 monooxygenase activity which is also capable of carotenoid oxidation, has the effect that a hydroxyl group is introduced on the carbon in position 3 of a ⁇ -ionone ring or on the carbon in position 3 of a 4-keto- ⁇ -ionone ring.
  • carotenoids examples include ß.ß-carotene (hereinafter referred to as ß-carotene), ß.e-carotene or canthaxanthin.
  • Carotene oxidation in the sense of the invention comprises the single or multiple hydroxylation of the carotene.
  • Oxidation products obtained according to the invention preferably comprise zeaxanthin, cryptotoxin, adonirubin, astaxanthin, lutein or mixtures thereof.
  • FIG. 2 shows the result of a comparative test to determine the thermal stability of P450 BM3 and P450 from Thermus sp.
  • the thermal stability was determined spectrometrically in the wavelength range between 400 and 500 nm via the heme group content.
  • FIG. 3 shows a reaction scheme for the biotransformation of ⁇ -carotene to cryptoxanthin and zeaxanthin according to the invention.
  • FIG. 4 shows the HPLC elution profile of standard samples containing ⁇ -carotene, zeaxanthin or cryptoxanthin.
  • FIG. 5 illustrates the results of biotransformation experiments with recombinant E. coli strains which, in addition to the carotenoid genes crtE, crtB, crtl and crtY (FIG. 5A), have been transformed with a construct according to the invention pKK_CYP (FIG. 5B); In the presence of pKK_CYP, significant production of zeaxanthin and cryptoxanthin is observed.
  • a first subject of the invention relates in particular to a process for the oxidation of carotenoids, e.g. of ⁇ -carotene, wherein a1) a recombinant microorganism which produces an enzyme with cytochrome P450 monooxygenase activity is cultured in a culture medium in the presence of exogenous or intermediate carotenoid; or a2) incubating a carotenoid-containing reaction medium with an enzyme with cytochrome P450 monooxygenase activity; and b) the oxidation product formed or a secondary product thereof is isolated from the medium.
  • a1 a recombinant microorganism which produces an enzyme with cytochrome P450 monooxygenase activity is cultured in a culture medium in the presence of exogenous or intermediate carotenoid; or a2) incubating a carotenoid-containing reaction medium with an enzyme with cytochrome P450 monooxygenase activity; and b) the oxidation product formed or
  • the process according to the invention is carried out under conditions which preferably promote the oxidation of carotenoids, such as ⁇ -carotene, but at least do not hinder or even inhibit them.
  • the oxidation is preferably carried out by culturing the recombinant microorganism in the presence of oxygen at a cultivation temperature of at least about 20 ° C, e.g. 20 to 40 ° C, and a pH of about 6 to 9.
  • microorganisms which, by heterologous complementation for carotenoid production, such as for ß-carotene production, are capable and also express an enzyme with cytochrome P450 monooxygenase activity.
  • heterologous complementation for carotenoid production such as for ß-carotene production
  • an enzyme with cytochrome P450 monooxygenase activity is preferred.
  • Heterologically complemented E. coli strains and other microorganisms in which a P450 monooxygenase activity according to the invention (with carotenoid oxidizing activity) can be incorporated in an analogous manner are, for example, in the above-mentioned DE-A-199 16 140, which is hereby expressly incorporated by reference.
  • carotenoid e.g. ⁇ -carotene
  • the substrate-containing medium also being related may contain an approximately 10 to 100-fold molar excess of reduction equivalents on the substrate.
  • the above processes can preferably be carried out in bioreactors.
  • the invention therefore relates to such bioreactors comprising at least one monooxygenase according to the invention or at least one recombinant microorganism according to the invention, optionally in each case in immobilized form.
  • the cultivation of the microorganisms is preferably first carried out in the presence of oxygen and in a complex medium, such as, for example, TB or LB medium at a cultivation temperature of about 20 ° C. or more, and a pH from about 6 to 9 until sufficient cell density is reached.
  • a complex medium such as, for example, TB or LB medium
  • a cultivation temperature such as, for example, TB or LB medium
  • a pH from about 6 to 9
  • the use of an inducible promoter is preferred.
  • the cultivation is continued after induction of monooxygenase production in the presence of oxygen, for example from 12 hours to 3 days.
  • the enzyme according to the invention is dissolved or solubilized in a medium containing exogenous substrate (about 0.01 to 10 mM, or 0.05 to 5 mM) and the reaction is carried out, preferably in In the presence of oxygen, at a temperature of about 10 ° C or more, and a pH of about 6 to 9 (such as adjusted with 100 to 200 mM phosphate or Tris buffer), as well as in the presence of a reducing agent, whereby the substrate-containing medium also contains an approximately 10 to 100-fold molar excess of reduction equivalents (electron donor), based on the substrate to be oxidized.
  • the preferred reducing agent is NADPH.
  • oxygen contained or added in the reaction medium is reductively enzymatically cleaved.
  • the required reduction equivalents are provided by the added reducing agent (electron donor).
  • the oxidation product formed can then be processed in a conventional manner, e.g. by extraction and / or chromatography, separated from the medium and cleaned. Suitable methods are known to the person skilled in the art and therefore do not require any special explanation.
  • cytochrome P450 monooxygenase used has an amino acid sequence which comprises a partial sequence from amino acid residue Pro328 to Glu345 according to SEQ ID NO: 2 are particularly preferred; and optionally also includes a partial sequence from amino acid residue Val216 to Ala227 according to SEQ ID NO: 2.
  • Methods using a monooxygenase which has an amino acid sequence which comprises at least one further partial sequence which is selected from partial sequences of at least 10 consecutive amino acids are particularly preferred the sequence regions given by the amino acid residues Met1 to Phe327 and Gly346 to Ala389 according to SEQ ID NO: 2; and in particular methods using a monooxygenase having an amino acid sequence that substantially corresponds to SEQ ID NO: 2.
  • a recombinant microorganism is cultivated which carries an expression construct which, under the control of regulatory nucleotide sequences, comprises the coding sequence for a cytochrome P450 monooxygenase as defined above.
  • Another object of the invention relates to the use of a cytochrome P450 monooxygenase as defined above or a nucleotide sequence coding therefor for the microbiological oxidation of carotenoids, such as e.g. beta-carotene.
  • the invention also relates to recombinant microorganisms which, by heterologous complementation to carotenoid production, e.g. for ß-carotene production, are capable and also express an enzyme with cytochrome P450 monooxygenase activity.
  • Such microorganisms are preferably associated with carotenoid genes, e.g. crtE, crtB, crtl and crtY, heterologously complemented. They are derived in particular from bacteria of the genus Escherichia sp, such as E. coli, in particular E. coli JM 109.
  • Microorganisms according to the invention are in particular transformed with an expression vector which, under the genetic control of regulatory nucleotide sequences, comprises the coding sequence for a cytochrome P450 monooxygenase as defined above.
  • a preferred expression vector comprising the coding sequence for a cytochrome P450 monooxygenase as defined above contains the strong tac promoter upstream thereof and the strong rrnB ribosomal terminator operatively linked downstream.
  • microorganisms and their preparation for carrying out the method according to the invention are known, for example, from DE-A-199 16 140, to which reference is hereby made.
  • the invention also relates to the use of the P450 enzymes according to the invention with carotenoid, in particular ⁇ -carotene, oxidizing activity or a nucleic acid sequence coding therefor for the production of genetically modified organisms, in particular for carrying out the method according to the invention.
  • the invention further relates to genetically modified organisms, the genetic modification increasing the gene expression of the carotenoid according to the invention, in particular ⁇ -carotene oxidizing activity compared to a wild type in the event that the starting organism contains the gene used according to the invention or in the event that the Starting organism does not contain the gene used according to the invention.
  • a genetically modified organism is understood to mean an organism in which the P450 genes or nucleic acid constructs according to the invention have been inserted, preferably by one of the methods described herein.
  • the genetically modified organism contains at least one carotenoid, in particular ⁇ -carotene oxidizing gene according to the invention or at least one nucleic acid construct according to the invention.
  • the nucleic acid can be chromosomal or extrachromosomal.
  • the genetically modified organisms preferably have an altered carotenoid metabolism compared to the wild type.
  • Starting organisms which can naturally synthesize xanthophylls are preferred. But starting organisms that are able to synthesize xanthophylls due to the introduction of genes of carotenoid biosynthesis are also suitable.
  • Starting organisms are understood to mean prokaryotic or eukaryotic organisms such as, for example, microorganisms or plants.
  • Preferred microorganisms are bacteria, yeast, algae or fungi.
  • Both bacteria can be used as bacteria that are able to introduce carotenoid biosynthesis genes into a carotenoid-producing organism.
  • xanthophylls such as bacteria of the genus ash- richia, which contain, for example, crt genes from Erwinia, as well as bacteria which are capable of synthesizing xanthophylls, such as, for example, bacteria of the genus Erwinia, Agrobacterium, Flavobacterium, Alcaligenes or cyanobacteria of the genus Synechocystis.
  • Preferred bacteria are Escherichia coli, Erwinia herbicola, Erwinia uredo-vora, Agrobacterium aurantiacum, Alcaligenes sp. PC-1, Flavobacterium sp. strain R1534, the Cyanobacterium Synechocystis sp. PCC6803, Paracoccus marcusu, or Paracoccus carotinifaciens.
  • Preferred yeasts are Candida, Saccharomyces, Hansenula or Pichia.
  • Preferred fungi are Aspergillus, Trichoderma, Ashbya, Neurospora, Blakeslea, Phycomyces, Fusarium or others in Indian Chem. Engr. Section B. Vol. 37, No. 1, 2 (1995) on page 15, table 6 described mushrooms.
  • Preferred algae are green algae, such as algae of the genus Haematococcus, Phaedactylum tricornatum, Volvox or Dunaliella. Particularly preferred algae are Haematococcus pluvialis or Dunaliella bardawil.
  • plants are used as starting organisms and, accordingly, as genetically modified organisms.
  • Preferred plants are, for example, tagetes, sunflower, arabidopsis, tobacco, red pepper, soy, tomato, eggplant, paprika, carrot, carrot, potato, corn, salads and cabbages, oats, rye, wheat, triticale, millet, rice, alfalfa, flax , Brassicacaen, such as, for example, rape or canola, sugar beet, sugar cane, or woody plants, such as, for example, aspen or yew.
  • Arabidopsis thaliana Tagetes erecta, rapeseed, canola, potatoes and oilseeds and typical carotenoid producers such as soya, sunflower, paprika, carrot, pepper or corn are particularly preferred.
  • Cytochrome P450 monooxygenases which can be used according to the invention can be isolated in particular from thermophilic bacteria, preferably of the genus Thermus sp., Such as, for example, the species Thermus thermophilus, strain HB27 (deposited with the DSM under the number DSM7039).
  • thermophilic bacteria preferably meet the temperature tolerance criteria according to HG Schlegel, Bushe Mikrobiologie, Thieme Verlag Stuttgart, 5th edition, page 173, for thermophilic and extremely thermophilic organisms (ie optimum growth at over 40 ° C).
  • the monooxygenases preferably used according to the invention are preferably characterized by increased temperature stability. In comparison to the P450 BM-3 from Bacillus megate, this is expressed by less activity loss at elevated temperature (e.g. in a range from 30 to 60 ° C, pH 7.5, 25mM Tris / HCl).
  • a cytochrome P450 monooxygenase from the thermophilic bacterium T. thermophilus is used according to the invention.
  • the protein has a molecular weight of about 44 kDa (determined by SDS gel electrophoresis), is soluble and shows an absorption spectrum analogous to that of other P450 enzymes in the reduced state, oxidized state and as a carbonyl adduct.
  • identities could be determined from sequence comparisons of this enzyme according to the invention from T. thermophilus and other known P450 enzymes: P450 BM3, 32% identity; CYP119, 29% identity; P450eryF, 31% identity.
  • the enzyme according to the invention shows an extraordinary thermal stability, illustrated by a melting temperature of about 85 ° C, which is 30 ° C higher than that for P450cam.
  • Another object of the invention relates to the use of polynucleotides which code for a cytochrome P450 monooxygenase, in particular a cytochrome P450 monooxygenase from the genus Thermus sp. in processes for the oxidation of ß-carotene.
  • Preferred polynucleotides are those which essentially have a nucleic acid sequence in accordance with SEQ ID NO: 1, and the nucleic acid sequences which are complementary thereto and are derived therefrom.
  • Another object of the invention relates to the use of expression cassettes or of recombinant vectors for the production of recombinant microorganisms which are useful for the reactions according to the invention.
  • “Functional equivalents” or analogs of the specifically disclosed monooxygenases are different enzymes in the context of the present invention, which furthermore the have the desired substrate specificity in the context of the oxidation reaction described above and / or have increased thermal stability compared to P450 BM3, for example at temperatures in the range from about 30 to 60 ° C. and possibly higher temperatures after 30 minutes of treatment in 25 mM Tris / HCl.
  • “functional equivalents” means in particular mutants which have at least one of the above-mentioned sequence positions a different amino acid than the one specifically mentioned, but nevertheless catalyze one of the above-mentioned oxidation reactions.
  • “Functional equivalents” thus include those by one or more, such as e.g. 1 to 30 or 1 to 20 or 1 to 10, amino acid additions, substitutions, deletions and / or inversions available mutants, the changes mentioned being able to occur in any sequence position as long as they lead to a mutant with the property profile according to the invention.
  • Functional equivalence is particularly given when the reactivity patterns between mutant and unchanged enzyme match qualitatively, i.e. For example, the same substrates can be implemented at different speeds.
  • “Functional equivalents” encompassed according to the invention have an amino acid sequence that deviates from SEQ ID NO: 2 in at least one position, the change in the sequence preferably only insignificantly affecting the monooxygenase activity, that is to say by no more than about ⁇ 90%, in particular + 50 % or no more than ⁇ 30%
  • “Functional equivalents” in the above sense are also precursors of the described polypeptides and functional derivatives and salts of the polypeptides.
  • the term “salts” means both salts of carboxyl groups and acid addition salts of amino groups of the protein molecules according to the invention. Salts of carboxyl groups can be prepared in a manner known per se and include inorganic salts, such as, for example, sodium, calcium, ammonium, iron and zinc salts, and salts with organic bases, such as, for example, amines, such as triethanolamine, arginine, lysine , Piperidine and the like.
  • Acid addition salts such as, for example, salts with mineral acids, such as hydrochloric acid or sulfuric acid, and salts with organic acids, such as acetic acid and oxalic acid, are also a subject of the invention.
  • “Functional derivatives" of polypeptides according to the invention can also be prepared on functional amino acid side groups or on their N- or C-terminal end using known techniques.
  • Such derivatives include, for example, aliphatic esters of carboxylic acid groups, amides of carboxylic acid groups, obtainable by reaction with ammonia or with a primary or secondary amine, N-acyl derivatives of free amino groups, produced by reaction with acyl groups, or O-acyl derivatives of free hydroxyl groups, produced by reaction with acyl groups.
  • “Functional equivalents” encompassed according to the invention are homologs to the specifically disclosed proteins. These have at least 60%, preferably at least 75%, in particular at least 85%, such as 90%, 95% or 99%, homology to one of the specifically disclosed Sequences calculated according to the algorithm of Pearson and Lipman, Proc. Natl. Acad, Sei. (USA) 85 (8), 1988, 2444-2448.
  • Homologs of the proteins or polypeptides of the invention can be generated by mutagenesis, e.g. by point mutation or shortening of the protein.
  • Homologs of the protein of the invention can be obtained by screening combinatorial libraries of mutants, e.g. Shortening mutants can be identified.
  • a varied bank of protein variants can be generated by combinatorial mutagenesis at the nucleic acid level, e.g. by enzymatically ligating a mixture of synthetic oligonucleotides.
  • methods that can be used to generate banks of potential homologs from a degenerate oligonucleotide sequence. Chemical synthesis of a degenerate gene sequence can be performed in an automated DNA synthesizer, and the synthetic gene can then be ligated into an appropriate expression vector.
  • degenerate set of genes makes it possible to provide all the sequences in a mixture which encode the desired set of potential protein sequences.
  • Methods for the synthesis of degenerate oligonucleotides are known to the person skilled in the art (eg Narang, SA (1983) Tetra-hedron 39: 3; Itakura et al. (1984) Annu. Rev. Biochem. 53: 323; Itakura et al., (1984) Science 198: 1056; Ike et al. (1983) Nucleic Acids Res. 11: 477).
  • “Functional equivalents” naturally also include P450 monooxygenases which are accessible from other organisms, for example from bacteria other than those specifically mentioned here, and naturally occurring variants. For example, regions of homologous sequence regions can be determined by sequence comparison and, based on the specific requirements of the invention, equivalent enzymes can be determined.
  • the invention also relates to the use of nucleic acid sequences (single and double stranded DNA and RNA sequences) coding for one of the above monooxygenases and their functional equivalents for carrying out the above methods. Further nucleic acid sequences according to the invention are derived from SEQ ID NO: 1 and differ from them by addition, substitution, insertion or detection of single or multiple nucleotides, but continue to code for a monooxygenase with the desired property profile.
  • nucleic acid sequences mentioned herein can be produced in a manner known per se by chemical synthesis from the nucleotide building blocks, such as, for example, by fragment condensation of individual overlapping, complementary nucleic acid building blocks of the double helix.
  • the chemical synthesis of oligonucleotides can be carried out, for example, in a known manner using the phosphoramidite method (Voet, Biochemie, 2nd edition, Wiley Press New York, pages 896-897).
  • the attachment of synthetic oligonucleotides and the filling of gaps with the aid of the Klenow fragment of DNA polymerase and ligation reactions as well as general cloning methods are described in Sambrook et al. (1989) Molecular Cloning: A laboratory manual, Cold Spring Harbor Laboratory Press.
  • nucleic acid sequences which comprise so-called silent mutations or which have been modified in accordance with the codon usage of a specific source or host organism, in comparison to a specifically named sequence, as well as naturally occurring variants, such as e.g. Splice variants, of which. Sequences obtainable also by conservative nucleotide substitutions (i.e. the amino acid in question is replaced by an amino acid of the same charge, size, polarity and / or solubility).
  • the invention also encompasses nucleic acid sequences which hybridize with the above-mentioned coding sequences or are complementary thereto.
  • These polynucleotides can be found when screening genomic or cDNA libraries and, if appropriate, can be amplified therefrom using suitable primers by means of PCR and then isolated, for example, using suitable probes.
  • Another possibility is the transformation of suitable microorganisms with polynucleotides or vectors according to the invention, the multiplication of the microorganisms and thus the polynucleotides and their subsequent isolation.
  • polynucleotides according to the invention can also be synthesized chemically.
  • the property of being able to “hybridize” to polynucleotides means the ability of a poly- or oligonucleotide to bind to an almost complementary sequence under stringent conditions, while under these conditions non-specific bindings between non-complementary partners are avoided.
  • sequences should be closed 70-100%, preferably 90-100%, of complementary nature
  • the property of complementary sequences to be able to bind specifically to one another is made for example in the Northern or Southern blot technique or in primer binding in PCR or RT-PCR Oligonucleotides with a length of more than 30 base pairs are usually used for this purpose, and stringent conditions mean, for example in Northern blot technology, the use of a washing solution which is 50-70 ° C., preferably 60-65 ° C., for example 0.1x SSC -Buffer with 0.1% SDS (20x SSC: 3M NaCI, 0.3M Na citrate, pH 7.0) for the elution nonspecific hybridisi first cDNA probes or oligonucleotides.
  • a washing solution which is 50-70 ° C., preferably 60-65 ° C., for example 0.1x SSC -Buffer with 0.1% SDS (20x SSC: 3M NaCI, 0.3M Na citrate, pH 7.0
  • nucleic acids are preferably incorporated into expression constructs containing, under the genetic control of regulatory nucleic acid sequences, a nucleic acid sequence coding for an enzyme according to the invention; and vectors comprising at least one of these expression constructs.
  • Such constructs according to the invention preferably comprise a promoter 5'-upstream of the respective coding sequence and a terminator sequence 3'-downstream and, if appropriate, further customary regulatory elements, in each case operatively linked to the coding sequence.
  • An “operative linkage” is understood to mean the sequential arrangement of promoter, coding sequence, terminator and optionally further regulatory elements in such a way that each of the regulatory elements can fulfill its function in the expression of the coding sequence as intended. Examples of sequences which can be linked operatively are Targeting sequences, as well as translation enhancers, enhancers, polyadenylation signals, etc.
  • Other regulatory elements include selectable markers, amplification signals, origins of replication and the like.
  • the natural regulatory sequence can still be present before the actual structural gene. This natural regulation can possibly be switched off by genetic modification and the expression of the genes increased or decreased.
  • the gene construct can, however, also have a simpler structure, ie no additional regulation signals are inserted in front of the structural gene and the natural promoter with its regulation is not removed. Instead, the natural regulatory sequence is mutated so that regulation no longer takes place and the Gene expression is increased or decreased.
  • the nucleic acid sequences can be contained in one or more copies in the gene construct.
  • promoters examples include cos, tac, trp, tet, trp-tet, Ipp, lac, Ipp-lac, laclq, T7, T5, T3, gal, trc -, ara, SP6, ⁇ -PR or /.-PL promoter, which are advantageously used in gram-negative bacteria; as well as the gram-positive promoters amy and SPO2, the yeast promoters ADC1, MF ⁇ , AC, P-60, CYC1, GAPDH or the plant promoters CaMV / 35S, SSU, OCS, Iib4, usp, STLS1, B33, not or the ubiquitin - or phaseolin promoter.
  • inducible promoters such as, for example, light and in particular temperature-inducible promoters, such as the P r P r promoter, is particularly preferred.
  • the regulatory sequences mentioned are intended to enable the targeted expression of the nucleic acid sequences and the protein expression. Depending on the host organism, this can mean, for example, that the gene is only expressed or overexpressed after induction, or that it is expressed and / or overexpressed immediately.
  • the regulatory sequences or factors can preferably have a positive influence on the expression and thereby increase or decrease it.
  • the regulatory elements can advantageously be strengthened at the transcription level by using strong transcription signals such as promoters and / or "enhancers".
  • an increase in translation is also possible, for example, by improving the stability of the mRNA.
  • An expression cassette is produced by fusing a suitable promoter with a suitable monooxygenase nucleotide sequence and a terminator or polyadenylation signal. Common recombination and cloning techniques are used for this, as described, for example, in T. Maniatis, EF Fritsch and J. Sambrook, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1989) and in TJ Silhavy, ML Berman and LW Enquist, Experiments with Gene Fusions, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1984) and in Ausubel, FM et al., Curent Protocols in Molecular Biology, Greene Publishing Assoc. and Wiley Interscience (1987).
  • the recombinant nucleic acid construct or gene construct is advantageously inserted into a host-specific vector which enables optimal expression of the genes in the host.
  • Vectors are well known to those skilled in the art and can be found, for example, in "Cloning Vectors" (Pouwels PH et al., Ed., Elsevier, Amsterdam-New York-Oxford, 1985).
  • vectors are also understood to mean all other vectors known to the person skilled in the art, such as phages, viruses such as SV40, CMV, baculovirus and adenovirus, transposons, IS elements, phasmids, cosmids, and linear or circular DNA. These vectors can be replicated autonomously in the host organism or replicated chromosomally.
  • fusion expression vectors such as pGEX (Pharmacia Biotech Ine; Smith, DB and Johnson, KS (1988) Gene 67: 31-40), pMAL (New England Biolabs, Beverly, MA) and pRIT 5 (Pharmacia, Piscataway, NJ) which glutathione-S-transferase (GST), maltose E-binding protein or protein A is fused to the recombinant target protein.
  • GST glutathione-S-transferase
  • Non-fusion protein expression vectors such as pTrc (Amann et al., (1988) Gene 69: 301-315) and pET 11 d (Studier et al. Gene Expression Technology: method in Enzymology 185, Academic Press, San Diego, California) (1990) 60-89).
  • Yeast expression vector for expression in the yeast S. cerevisiae such as pYepSed (Baldari et al., (1987) Embo J. 6: 229-234), pMF (Kurjan and Herskowitz (1982) Cell 30: 933-943), pJRY88 (Schultz et al. (1987) Gene 54: 113-123) and pYES2 (Invitrogen Corporation, San Diego, CA).
  • Vectors and methods of constructing vectors suitable for use in other fungi such as filamentous fungi include those described in detail in: van den Hondel, C.A.M.J.J. & Punt, P.J. (1991) "Gene transfer Systems and vector development for filamentous fungi", in: Applied Molecular Genetics of Fungi, J.F. Peberdy et al., Eds., Pp. 1-28, Cambridge University Press: Cambridge.
  • Baculovirus vectors available for expression of proteins in cultured insect cells include the pAc series (Smith et al., (1983) Mol. Cell Biol .. 3: 2156-2165) and pVL series (Lucklow and Summers (1989) Virology 170: 31-39).
  • Plant expression vectors such as those described in detail in: Becker, D., Kemper, E., Schell, J. and Masterson, R. (1992) "New plant binary vectors with selectable markers located proximal to the left border” , Plant Mol. Biol. 20: 1195-1197; and Bevan, MW (1984) "Binary Agrobacterium vectors for plant transformation", Nucl. Acids Res. 12: 8711-8721.
  • Mammalian expression vectors such as pCDM ⁇ (Seed, B. (1987) Nature 329: 840) and pMT2PC (Kaufman et al. (1987) EMBO J. 6: 187-195).
  • recombinant microorganisms can be produced which, for example, have been transformed with at least one vector according to the invention and can be used to produce the enzymes used according to the invention and / or to carry out the method according to the invention.
  • the recombinant constructs according to the invention described above are advantageously introduced and expressed in a suitable host system.
  • Common cloning and transfection methods known to the person skilled in the art such as, for example, co-precipitation, protoplast fusion, electroporation, retroviral transfection and the like, are preferably used here in order to bring the nucleic acids mentioned into expression in the respective expression system. Suitable systems are described, for example, in Curent Protocols in Molecular Biology, F. Ausubel et al., Ed., Wiley Interscience, New York 1997.
  • Host organisms are, for example, bacteria, fungi, yeasts, plant or animal cells.
  • Preferred organisms are bacteria, such as those of the genera Escherichia, such as. B. Escherichia coli, Streptomyces, Bacillus or Pseudomonas, eukaryotic microorganisms such as Saccharomyces cerevisiae, Aspergillus, Blakeslea, Phycomyces, higher eukaryotic cells from animals or plants, for example Sf9 or CHO cells.
  • Successfully transformed organisms can be selected using marker genes, which are also contained in the vector or in the expression cassette.
  • marker genes are genes for antibiotic resistance and for enzymes which catalyze a coloring reaction which stains the transformed cell. These can then be be selected using automatic cell sorting.
  • Microorganisms which have been successfully transformed with a vector and carry an appropriate antibiotic resistance gene for example G418 or hygromycin
  • an appropriate antibiotic resistance gene for example G418 or hygromycin
  • Marker proteins that are presented on the cell surface can be used for selection by means of affinity chromatography.
  • the combination of the host organisms and the vectors which match the organisms, such as plasmids, viruses or phages, such as, for example, plasmids with the RNA polymerase / promoter system, the phages ⁇ or ⁇ or other temperate phages or transposons and / or further advantageous regulatory ones Sequences form an expression system.
  • expression system means the combination of mammalian cells, such as CHO cells, and vectors, such as pcDNA3neo vector, which are suitable for mammalian cells.
  • the gene product can also be expressed in transgenic organisms such as transgenic animals, such as in particular mice or sheep or transgenic plants.
  • the monooxygenases which can be used according to the invention can also be produced recombinantly, in which case a monooxygenase-producing microorganism is cultivated, where appropriate the expression of the monooxygenase is induced and the monooxygenase is isolated from the culture.
  • the monooxygenase can thus also be produced on an industrial scale, if this is desired.
  • the recombinant microorganism can be cultivated and fermented by known methods. Bacteria can be propagated, for example, in TB or LB medium and at a temperature of 20 to 40 ° C and a pH of 6 to 9. Suitable cultivation conditions are described in detail, for example, in T. Maniatis, E.F. Fritsch and J. Sambrook, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1989).
  • the cells are then disrupted and the enzyme is obtained from the lysate by known protein isolation methods.
  • the cells can be disrupted either by high-frequency ultrasound, by high pressure, such as in a French pressure cell, by osmolysis, by the action of detergents, lytic enzymes or organic solvents, by homogenizers or by a combination of several of the processes listed.
  • Purification of the monooxygenase can be achieved with known chromatographic methods, such as molecular sieve chromatography (gel filtration), such as Q-Sepharose chromatography, ion exchange chromatography and hydrophobic chromatography, and with other conventional methods such as ultrafiltration, crystallization, salting out, dialysis and native gel electrophoresis. Suitable methods are described, for example, in Cooper, TG, Biochemical Working Methods, Verlag Walter de Gruyter, Berlin, New York or in Scopes, R., Protein Purification, Springer Verlag, New York, Heidelberg, Berlin.
  • vector systems or oligonucleotides which extend the DNA by certain nucleotide sequences and thus code for modified polypeptides or fusion proteins which serve for easier purification.
  • suitable modifications are, for example, so-called “tags” functioning as anchors, such as the modification known as hexa-histidine anchors, or epitopes that can be recognized as antigens of antibodies (described, for example, in Harlow, E. and Lane, D., 1988, Antibodies: A Laboratory Manual. Cold Spring Harbor (NY) Press ).
  • These anchors can be used to attach the proteins to a solid support, e.g. a polymer matrix, which can be filled, for example, in a chromatography column, or can be used on a microtiter plate or on another support.
  • these anchors can also be used to recognize the proteins.
  • customary markers such as fluorescent dyes, enzyme markers which form a detectable reaction product after reaction with a substrate, or radioactive markers, can be used alone or in combination with the anchors to derivatize the proteins.
  • the cloning steps carried out in the context of the present invention e.g. Restriction cleavages, agarose gel electrophoresis, purification of DNA fragments, transfer of nucleic acids to nitrocellulose and nylon membranes, linking of DNA fragments, transformation of E. coli cells, cultivation of bacteria, multiplication of phages and sequence analysis of recombinant DNA were carried out as in Sambrook et al. (1989) op. Cit. described.
  • E. coli strains DH5 ⁇ were cultivated in LB-Amp medium (trypton 10.0 g, NaCl 5.0 g, yeast extract 5.0 g, ampicillin 100 g / ml H 2 0 ad 1000 ml) at 37 ° C.
  • LB-Amp medium trypton 10.0 g, NaCl 5.0 g, yeast extract 5.0 g, ampicillin 100 g / ml H 2 0 ad 1000 ml
  • one colony was transferred from an agar plate into 5 ml LB-Amp using an inoculation loop. After culturing for about 18 hours at a shaking frequency of 220 rpm, 400 ml of medium were inoculated with 4 ml of culture in a 2 l flask.
  • P450 expression was induced in E. coli after an OD578 value of between 0.8 and 1.0 was reached by inducing heat shock at 42 ° C. for three to four hours.
  • the E. coli cell suspension cooled on ice was digested. Before protein purification, the cell suspension was centrifuged at 32,500 g for 20 min and filtered through a 0.22 mm Sterivex-GP filter (Millipore), giving a crude extract.
  • a clone (TTHB66) comprising the coding P450 sequence (hereinafter also referred to as the CYP175A1 gene) was obtained from a Thermus gene bank.
  • the coding P450 sequence (blunt ended) was cloned into the HinclI site of the plasmid pTZ19R (MBI Fermentas).
  • the coding P450 sequence was amplified from the plasmid TTHB66 thus obtained with the aid of PCR.
  • the following primers were used:
  • the resulting fragment was cloned into the Ndel sites of the vector pCYTEXPl (plasmid with the temperature-inducible P R P promoter system of bacteriophage 8 (Belev TN, et al., Plasmid (1991) 26: 147)) and in E. coli DH- 5 ⁇ (Clontech, Heidelberg) transformed.
  • pCYTEXPl Plasmid with the temperature-inducible P R P promoter system of bacteriophage 8 (Belev TN, et al., Plasmid (1991) 26: 147)
  • E. coli DH- 5 ⁇ (Clontech, Heidelberg) transformed.
  • the coding P450 sequence was amplified by PCR from the plasmid TTHB66 using the following primers:
  • the resulting fragment was cloned into the Ndel and EcoRI sites of the vector p-CYTEXP1 and expressed in E. coli DH-5.
  • the coding P450 sequence was amplified by PCR from plasmid TTHB66 using the following primers:
  • the resulting fragment was cloned into the Ndel and EcoRI sites of the vector p-CYTEXP1 and expressed in E. coli DH-5 ⁇ .
  • Example 2 Determination of the thermal stability of P450 from Thermus thermophilus compared to P450 BM3
  • the two enzymes were each incubated for 30 minutes in Tris / HCl buffer pH 7.5, 25mM at different temperatures. The batches were then cooled and the P450 concentration was determined spectrometrically. The results are summarized in the following table and shown graphically in FIG. 2.
  • the enzyme according to the invention has a significantly higher temperature stability after 30 minutes of incubation at all temperatures.
  • Plasmid DNA (clone TTHB66) containing the coding sequence of the cytochrome P450 monooxygenase (CYP175A1 gene) was assumed. Using the polymerase chain reaction (PCR), restriction sites EcoRI and Pstl were introduced into the CYP175A1 gene. The gene was amplified using the following primers: 5'-CCGGAATTCATGAAGCGCCTTTCCCTGAGG; (SEQ ID NO: 11) 5-CCAATGCATTGGTTCTGCAGTCAGGCCCGCACCTCCTCCCTAGG (SEQ ID NO: 12)
  • the new restriction interfaces are underlined.
  • the reaction mixture for the PCR consisted of template DNA (100 ng), 2.5 U pfu DNA polymerase (Stratagene), 5 ⁇ l reaction buffer, 5 ⁇ l DMSO, 0.4 ⁇ mol of each oligonucleotide, 400 ⁇ mol dNTPs and H 2 O ad 50 ul.
  • the following PCR cycle parameters were set: 95 ° C, 1 minute; (95 ° C, 1 minute; 53 ° C, 1 minute 30 seconds; 68 ° C, 1 minute 30 seconds) 30 cycles; 68 ° C, 4 minutes.
  • the CYP175A1 gene sequence was checked by DNA sequencing.
  • pKK 223-3 contains the strong tac promoter upstream of a multiple cloning site and the strong rrnB ribosomal terminator downstream thereof to control protein expression.
  • the plasmid obtained is called pKK_CYP.
  • E.coli JM109 were used as host cells for the complementation experiments with the plasmids pACYC_Y and pKK_CYP (prepared according to Example 3).
  • the plasmids pACYC_Y and pKK_CYP prepared according to Example 3.
  • Plasmid pACYC_Y carries the carotenogen genes crtE, crtB, crtlC14 and crtY, isolated from E. uredovora. The genes mentioned were each cloned in with their own lac promoter in order to enable expression. The production of this Plamids is described in the
  • E.coli JM109 Cultures of E.coli JM109 were transformed in a manner known per se with the plasmids pACYC_Y and pKK_CYP and cultivated in LB medium at 30 ° C. and 37 ° C. for two days. Ampicillin (1 ⁇ g / ml) chloramphenicol (50 ⁇ g / ml) and isopropyl- ⁇ -thiogalactoside (1 mmol) were added in the usual way. As a comparison sample, an E. coli strain JM109 was only transformed with the plasmid pACYC_Y and cultured in the same way.
  • the spectra were determined directly from the elution peaks using a diode array detector.
  • the isolated substances were identified by their absorption spectra and their retention times in comparison to standard samples.
  • FIGS. 4A to 4C Chromatograms of the standards for ⁇ -carotene, zeaxanthin and cryptoxanthin are shown in the attached FIGS. 4A to 4C.
  • FIG. 5 A shows the chromatographic analysis of a sample obtained from the E. coli strain transformed with the plasmid pACYC_Y. It turns out that due to the heterologous complementation it is capable of producing ß-carotene.
  • FIG. 5B shows the chromatogram of a heterologously complemented E. coli strain produced according to the invention and additionally transformed with the plasmid pKK_CYP. Surprisingly, it is shown here that, in addition to ⁇ -carotene, significant amounts of the corresponding hydroxylation products zeaxanthin and cryptoxanthin can be detected.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

Die Erfindung betrifft ein Verfahren zur Biotransformation von Carotinoiden unter Verwendung von Enzymen mit Cytochrom P450 Monooxygenase Aktivität, insbesondere Monooxygenasen aus thermophilen Bakterien, insbesondere der Gattung Thermus sp...

Description

VERFAHREN ZUR BIOTRANSFORMATION VON CAROTINOIDEN MITTELS CYTOCHROM P450 MONOXYGENASE
Die Erfindung betrifft ein Verfahren zur Biotransformation von Carotinoiden unter Verwendung von Enzymen mit Cytochrom P450 Monooxygenase Aktivität; insbesondere Monooxy- genasen aus thermophilen Bakterien, insbesondere der Gattung Thermus sp. sowie die für derartige Verfahren brauchbaren Mikroorganismen und Expressionskonstrukte.
Stand der Technik
Xanthophylle, wie Zeaxanthin und Cryptoxanthin, sind sauerstoffhaltige Carotinoide und stellen als Pigmentierungsstoffe oder Vorstufen für Vitamin A-Derivate wichtige Zusatzstoffe für die Human- oder Tierernährung dar. Xanthophyllen wird auch eine gesundheitsfördernde Wirkung zugeschrieben. Sie verstärken die Immunantwort und besitzen aufgrund ihrer antio- xidativen Eigenschaften krebsvorbeugende Wirkung, was sie als Nutraceuticals interessant macht.
Cytochrom P450 Monooxygenasen besitzen die Fähigkeit technisch interessante Oxygenie- rungsreaktionen zu katalysieren und werden daher seit einiger Zeit intensiv untersucht. So wurde beispielsweise die Cytochrom P450 Monooxygenase BM-3 aus Bacillus megaterium isoliert und charakterisiert und ist mittlerweile auf rekombinantem Weg zugänglich (vgl. z.B. DE-A-199 35 115).
Diese Cytochrom P450-Monooxygenase katalysiert gewöhnlich die subterminale Hydroxylie- rung langkettiger, gesättigter Säuren und der entsprechenden Amide und Alkohole davon oder die Epoxydation ungesättigter langkettiger Fettsäuren oder gesättigter Fettsäuren mit mittlerer Kettenlänge. Die optimale Kettenlänge gesättigter Fettsäuren beträgt 14 bis 16 Kohlenstoffatome.
Die Struktur der H m-Domäne von P450 BM-3 wurde durch Röntgenstrukturanalyse be- stimmt. Die Substratbindungsstelle liegt in Form einer langen tunnelartigen Öffnung vor, welche von der Moleküloberfläche bis hin zum Häm-Molekül reicht und wird fast ausschließlich von hydrophoben Aminosäureresten begrenzt. Die einzigen geladenen Reste an der Oberfläche der Häm-Domäne sind die Reste Arg47 und Tyr51. Man nimmt an, daß diese an der Bindung der Carboxylatgruppe des Substrates durch Bildung einer Wasserstoffbrückenbin- düng beteiligt sind. Durch gezielte Einführung von Punktmutationen ist es zwischenzeitlich gelungen, das Substratspektrum dieses Enzyms zu erweitern. So können nunmehr auch kürzer- als auch längerkettige Carbonsäuren, Alkane, Alkene, Cycloalkane, Cycloalkene und verschiedenste Aromaten durch dieses Enzym oxidiert werden (vgl. DE-A-199 35 115, 199 55 605, 100 11 723 und 100 14 085).
Aus der WO-A-02/33057 sind Cytochrom P450-Monooxygenasen aus thermophilen Bakterien bekannt, welche zur Biotransformation verschiedener organischer Substrate geeignet sind. Carotinoide, wie z.B. ß-Carotin ist darin nicht als potentielles Substrat der Cytochrom P450-Monooxygenasen genannt.
Die DE-A-199 16 140 beschreibt eine Carotinhydroxylase aus der Grünalge Haematococcus pluvialis welche unter anderem die Umsetzung von ß-Carotin zu Zeaxanthin und Crypto- xanthin katalysiert. Es findet sich kein Hinweis auf die mögliche Brauchbarkeit von Cytochrom P450-Monooxygenasen bei der Biotransformation von ß-Carotin.
Um die industrielle Anwendbarkeit der Enzymklasse der Cytochrom P450-Monooxygenasen weiter zu verbessern, wäre es daher wünschenswert neue Anwendungsgebiete für diese zu finden.
Kurze Beschreibung der Erfindung
Aufgabe der vorliegenden Erfindung war daher die Bereitstellung neuer Anwendungsgebiete für Cytochrom P450-Monooxygenasen.
Obige Aufgabe wurde gelöst durch Bereitstellung eines Verfahrens zur Oxidation von Caroti- noiden, das dadurch gekennzeichnet ist, dass man ein Carotinoid in Gegenwart eines Enzyms mit Cytochrom P450 Monooxygenase Aktivität, das außerdem zur Carotinoid-Oxidation befähigt ist, umsetzt und das Oxidationsprodukt isoliert
Ein Enzym mit Cytochrom P450 Monooxygenase Aktivität, das außerdem zur Carotinoid- Oxidation befähigt ist, bewirkt erfindungsgemäß, dass am Kohlenstoff in Position 3 eines ß- lononringes oder dass am Kohlenstoff in Position 3 eines 4-Keto-ß-iononringes eine Hydroxylgruppe eingeführt wird.
Beispiele für geeignete Carotinoide sind ß.ß-Carotin (im folgenden bezeichnet ß-Carotin), ß.e-Carotin oder Canthaxanthin. Eine Carotin-Oxidation im Sinne der Erfindung umfasst die einfache oder mehrfache Hydro- xylierung des Carotins.
Erfindungsgemäß anfallende Oxidationsprodukte umfassen vorzugsweise Zeaxanthin, Cryp- toxanthin, Adonirubin, Astaxanthin, Lutein oder Gemische davon.
Detaillierte Beschreibung
Die Erfindung wird nun unter Bezugnahme auf beiliegenden Figuren näher erläutert. Dabei zeigt
Figur 1 einen Sequenzvergleich von P450 aus Thermus thermophilus mit der Häm-Domäne von P450 BM3 aus Bacillus megaterium. Doppelt unterstrichen ist dabei die Häm- Bindungsstelle gezeigt (Cys400 in P450 BM3 ist der Cysteinrest, der mit dem Eisenatom der prosthetischen Gruppe koordiniert). Einfach unterstrichen ist die Region die in Kontakt steht mit dem T-Ende der Fettsäurekette. Die Grad der Übereinstimmung ist durch verschiedenen Symbole gekennzeichnete*" = identische Reste; ":"und "." = ähnliche Reste).
Figur 2 zeigt das Ergebnis eines Vergleichstests zur Bestimmung der Thermostabilität von P450 BM3 und P450 aus Thermus sp.. Die Thermostabilität wurde spektrometrisch im Wellenlängenbereich zwischen 400 und 500nm über den Häm-Gruppen-Gehalt bestimmt.
Figur 3 zeigt ein Reaktionsschema für die erfindungsgemäße Biotransformation von ß- Carotin zu Cryptoxanthin und Zeaxanthin.
Figur 4 zeigt das HPLC-Elutionsprofil von Standardproben, enthaltend ß-Carotin, Zeaxanthin bzw. Cryptoxanthin.
Figur 5 veranschaulicht die Ergebriisse von Biotransformationsexperimenten mit rekombi- nanten E. coli-Stämmen, welche neben den Carotinogenen Gene crtE, crtB, crtl und crtY (Figur 5A) mit einem erfindungsgemäßen Konstrukt pKK_CYP transformiert sind (Figur 5B); in Gegenwart von pKK_CYP beobachtet man eine signifikante Produktion von Zeaxanthin und Cryptoxanthin. a) Verfahren zur Carotinoid-Oxidation
Ein erster Gegenstand der Erfindung betrifft insbesondere ein Verfahren zur Oxidation von Carotinoiden , wie z.B. von ß-Carotin, wobei man a1) einen rekombinanten Mikroorganismus, welcher ein Enzym mit Cytochrom P450 Monooxygenase Aktivität produziert, in einem Kulturmedium in Gegenwart von exogenem oder intermediär gebildetem Carotinoid kultiviert; oder a2) ein Carotinoid-haltiges Reaktionsmedium mit einem Enzym mit Cytochrom P450 Monooxygenase Aktivität inkubiert; und b) das gebildete Oxidationsprodukt oder ein Folgeprodukt davon aus dem Medium isoliert.
Das erfindungsgemäße Verfahren wird unter Bedingungen durchgeführt, welche die Oxidation von Carotinoiden, wie ß-Carotin, vorzugsweise fördern, zumindest aber nicht behindern oder gar inhibieren. Bevorzugt erfolgt die Oxidation durch Kultivierung des rekombinanten Mikroorganismus in Gegenwart von Sauerstoff bei einer Kultivierungstemperatur von mindestens etwa 20°C, wie z.B. 20 bis 40 °C, und einem pH-Wert von etwa 6 bis 9.
Bevorzugt verwendet man solche Mikroorganismen, die durch heterologe Komplementierung zur Carotinoidproduktion, wie z.B. zur ß-Carotinproduktion, befähigt sind und außerdem ein Enzym mit Cytochrom P450 Monooxygenase Aktivität exprimieren. Heterolog komplementierte E. coli-Stämme und weitere Mikroorganismen in welche in analoger Weise eine erfindungsgemäße P450-Monooxygenase-Aktivität (mit Carotinoid-oxidierender Aktivität) eingebaut werden kann, werden z.B. in der oben genannten DE-A-199 16 140 beschrieben, wor- auf hiermit ausdrücklich bezug genommen wird.
Nach einer anderen bevorzugten Variante wird Carotinoid, wie z.B. ß-Carotin, als exogenes Substrat einem Medium zugesetzt und die Oxidation durch enzymatische Umsetzung des substrathaltiges Mediums in Gegenwart von Sauerstoff bei einer Temperatur von mindestens etwa 20°C und einem pH-Wert von etwa 6 bis 9 durchgeführt, wobei das substrathaltige Medium außerdem bezogen auf das Substrat einen etwa 10-bis 100-fachen molaren Über- schuss an Reduktionsäquivalenten enthalten kann.
Obige Verfahren können bevorzugt in Bioreaktoren durchgeführt werden. Gegenstand der Erfindung sind daher solche Bioreaktoren, umfassend wenigstens eine erfindungsgemäße Monooxygenase oder wenigstens einen erfindungsgemäßen rekombinanten Mikroorganismus, gegebenenfalls jeweils in immobilisierter Form. Wird die Umsetzung mit einem rekombinanten Mikroorganismus durchgeführt, so erfolgt vorzugsweise zunächst die Kultivierung der Mikroorganismen in Gegenwart von Sauerstoff und in einem Komplexmedium, wie z.B. TB- oder LB- Medium bei einer Kultivierungstemperatur von etwa 20 °C oder mehr, und einem pH-Wert von etwa 6 bis 9, bis eine ausreichende Zelldichte erreicht ist. Um die Oxidationsreaktion besser steuern zu können, bevorzugt man die Verwendung eines induzierbaren Promotors. Die Kultivierung wird nach Induktion der Mo- nooxygenaseproduktion in Gegenwart von Sauerstoff, z.B. 12 Stunden bis 3 Tage, fortgesetzt.
Wird die erfindungsgemäße Umsetzung dagegen mit gereinigtem oder angereichertem Enzym durchgeführt so löst oder solubilisiert man das erfindungsgemäße Enzym in einem exogenes Substrat enthaltenden Medium (etwa 0,01 bis 10 mM, oder 0,05 bis 5 mM), und führt die Umsetzung, vorzugsweise in Gegenwart von Sauerstoff, bei einer Temperatur von etwa 10 °C oder mehr, und einem pH-Wert von etwa 6 bis 9 (wie z.B. eingestellt mit 100 bis 200 mM Phosphat- oder Tris-Puffer), sowie in Gegenwart eines Reduktionsmittels durch, wobei das Substrat-haltige Medium außerdem bezogen auf das zu oxidierende Substrat einen etwa 10-bis 100-fachen molaren Überschuß an Reduktionsäquivalenten (Elektronendonor) enthält. Bevorzugtes Reduktionsmittel ist NADPH.
Beim erfindungsgemäßen Substratoxidationsprozess wird im Reaktionsmedium enthaltener oder zugesetzter Sauerstoff reduktiv enzymatisch gespalten. Die erforderlichen Reduktionsäquivalente werden von dem zugesetzten Reduktionsmittel (Elektronendonor) zur Verfügung gestellt.
Das gebildete Oxidationsprodukt kann dann in herkömmlicher Weise, wie z.B. durch Extraktion und/oder Chromatographie, vom Medium abgetrennt und gereinigt werden. Geeignete Methoden sind dem Fachmann bekannt und bedürfen daher keiner besonderen Erläuterung.
Besonders bevorzugt sind Verfahren bei denen die eingesetzte Cytochrom P450 Monooxygenase eine Aminosäuresequenz aufweist, welche eine Teilsequenz von Aminosäurerest Pro328 bis Glu345 gemäß SEQ ID NO:2 umfasst; und gegebenenfalls außerdem eine Teilsequenz von Aminosäurerest Val216 bis Ala227 gemäß SEQ ID NO:2 umfasst.
Besonders bevorzugt sind Verfahren unter Verwendung einer Monooxygenase, die eine A- minosäuresequenz aufweist, welche wenigstens eine weitere Teilsequenz umfasst, die ausgewählt ist unter Teilsequenzen von wenigstens 10 aufeinanderfolgenden Aminosäuren aus den durch die Aminosäurereste Met1 bis Phe327 und Gly346 bis Ala389 gemäß SEQ ID NO:2 vorgegebenen Sequenzbereichen; und insbesondere Verfahren unter Verwendung einer Monooxygenase, die eine Aminosäuresequenz aufweist, welche im wesentlichen SEQ ID NO: 2 entspricht.
Wird das erfindungsgemäße Verfahren mit Hilfe von Mikroorganismen durchgeführt, so kultiviert man einen rekombinanten Mikroorganismus, der ein Expressionskonstrukt trägt, welches unter der Kontrolle regulativer Nukleotidsequenzen die kodierende Sequenz für eine Cytochrom P450 Monooxygenase gemäß obiger Definition umfasst.
Ein anderer Gegenstand der Erfindung betrifft die Verwendung einer Cytochrom P450 Monooxygenase gemäß obiger Definition oder einer dafür kodierenden Nukleotidsequenz zur mikrobiologischen Oxidation von Carotinoiden, wie z.B. ß-Carotin.
b) Rekombinante Mikroorganismen zur Durchführung des Verfahrens
Gegenstand der Erfindung sind außerdem rekombinante Mikroorganismen, welcher durch heterologe Komplementierung zur Carotinoidproduktion, wie z.B. zur ß-Carotinproduktion, befähigt sind und außerdem ein Enzym mit Cytochrom P450 Monooxygenase Aktivität exprimieren. Solche Mikroorganismen sind vorzugsweise mit carotinogenen Genen, wie z.B. crtE, crtB, crtl und crtY, heterolog komplementiert. Sie sind insbesondere abgeleitet von Bakterien der Gattung Escherichia sp, wie E. coli, insbesondere E. coli JM 109.
Erfindungsgemäße Mikroorganismen sind insbesondere transformiert mit einem Expressi- onsvektor, der unter der genetischen Kontrolle regulativer Nukleotidsequenzen die kodierende Sequenz für eine Cytochrom P450 Monooxygenase gemäß obiger Definition umfasst.
Ein bevorzugter Expressionsvektor, umfassend die kodierende Sequenz für eine Cytochrom P450 Monooxygenase gemäß obiger Definition enthält stromaufwärts davon den starken tac- Promotor und stromabwärts den starken rrnB ribosomalen Terminator in operativer Verknüpfung.
Weitere brauchbare Mikroorganismen und deren Herstellung zur Durchführung des erfindungsgemäßen Verfahrens sind z.B. aus der DE-A-199 16 140 bekannt, worauf hiermit Be- zug genommen wird. Die Erfindung betrifft auch die Verwendung der erfindungsgemäßen P450-Enzyme mit Carotinoid-, insbesondere ß-Carotin-oxidierender Aktivität oder eine dafür kodierende Nukleinsäu- resequenz zur Herstellung von genetisch veränderten Organismen, insbesondere zur Durchführung des erfindungsgemäßen Verfahrens.
Ferner betrifft die Erfindung entsprechend genetisch veränderte Organismen, wobei die genetische Veränderung die Genexpression der erfindungsgemäßen Carotinoid- insbesondere ß-Carotin-oxidierenden Aktivität gegenüber einem Wildtyp für den Fall, dass der Ausgangsorganismus das erfindungsgemäß verwendete Gen enthält, erhöht oder für den Fall, dass der Ausgangsorganismus das erfindungsgemäß verwendete Gen nicht enthält, verursacht.
Unter einem genetisch veränderten Organismus wird ein Organismus verstanden, in dem die erfindungsgemäßen P450 Gene oder Nukleinsäurekonstrukte, vorzugsweise nach einer der hierin beschriebenen Methoden, insertiert wurden.
Der genetisch veränderte Organismus enthält mindestens ein erfindungsgemäßes Carotinoid-, insbesondere ß-Carotin-oxidierendes-Gen oder mindestens ein erfindungsgemäßes Nukleinsäurekonstrukt. Je nach Ausgangsorganismus kann die Nukleinsäure chromosomal oder extrachromosomal vorliegen.
Vorzugsweise weisen die genetisch veränderten Organismen verglichen mit dem Wildtyp einen veränderten Carotinoid-Stoffwechsel auf.
Als genetisch veränderte Organismen eignen sich prinzipiell alle Organismen, die in der La- ge sind, Carotinoide oder Xanthophylle zu synthetisieren.
Bevorzugt sind Ausgangsorganismen, die natürlicherweise Xanthophylle synthetisieren können. Aber auch Ausgangsorganismen, die aufgrund des Einbringens von Genen der Caroti- noidbiosynthese in der Lage sind, Xanthophylle zu synthetisieren, sind geeignet.
Unter Ausgangsorganismen werden prokaryontische oder eukaryontische Organismen wie beispielsweise Mikroorganismen oder Pflanzen verstanden. Bevorzugte Mikroorganismen sind Bakterien, Hefen, Algen oder Pilze.
Als Bakterien können sowohl Bakterien verwendet werden, die aufgrund des Einbringens von Genen der Carotinoidbiosynthese eines Carotinoid-produzierenden Organismus in der Lage sind. Xanthophylle zu synthetisieren, wie beispielsweise Bakterien der Gattung Esche- richia, die beispielsweise crt-Gene aus Erwinia enthalten, als auch Bakterien, die von sich aus in der Lage sind, Xanthophylle zu synthetisieren wie beispielsweise Bakterien der Gattung Erwinia, Agrobacterium, Flavobacterium, Alcaligenes oder Cyanobakterien der Gattung Synechocystis. Bevorzugte Bakterien sind Escherichia coli, Erwinia herbicola, Erwinia uredo- vora, Agrobacterium aurantiacum, Alcaligenes sp. PC-1, Flavobacterium sp. strain R1534, das Cyanobacterium Synechocystis sp. PCC6803, Paracoccus marcusu, oder Paracoccus carotinifaciens.
Bevorzugte Hefen sind Candida, Saccharomyces, Hansenula oder Pichia.
Bevorzugte Pilze sind Aspergillus, Trichoderma, Ashbya, Neurospora, Blakeslea, Phycomy- ces, Fusarium oder weitere in Indian Chem. Engr. Section B. Vol. 37, No. 1 , 2 (1995) auf Seite 15, Tabelle 6 beschriebene Pilze.
Bevorzugte Algen sind Grünalgen, wie beispielsweise Algen der Gattung Haematococcus, Phaedactylum tricornatum, Volvox oder Dunaliella. Besonders bevorzugte Algen sind Haematococcus pluvialis oder Dunaliella bardawil.
In einer bevorzugten Ausführungsform werden Pflanzen als Ausgangsorganismen und dem- entsprechend auch als genetisch veränderte Organismen verwendet. Bevorzugte Pflanzen sind beispielsweise Tagetes, Sonnenblume, Arabidopsis, Tabak, Roter Pfeffer, Soja, Tomate, Aubergine, Paprika, Möhre, Karotte, Kartoffel, Mais, Salate und Kohlarten, Hafer, Roggen, Weizen, Triticale, Hirse, Reis, Luzerne, Flachs, Brassicacaen, wie beispielsweise Raps oder Canola, Zuckerrübe, Zuckerrohr, oder Holzgewächse wie beispielsweise Espe oder Eibe.
Besonders bevorzugt sind Arabidopsis thaliana, Tagetes erecta, Raps, Canola, Kartoffeln sowie Ölsaaten und typische Carotinoidproduzenten, wie Soja, Sonnenblume, Paprika, Karotte, Pfeffer oder Mais.
c) Enzyme, Polvnukleotide und Konstrukte
Erfindungsgemäß brauchbare Cytochrom P450 Monooxygenasen sind insbesondere aus thermophilen Bakterien, vorzugsweise der Gattung Thermus sp., wie z.B. der Spezies Ther- mus thermophilus, Stamm HB27 (hinterlegt bei der DSM unter der Nummer DSM7039) isolierbar. „Thermophile" Bakterien erfüllen erfindungsgemäß die Temperaturtoleranzkriterien nach H.G. Schlegel, Allgemeine Mikrobiologie, Thieme Verlag Stuttgart, 5. Auflage , Seite 173, für thermophile und extrem thermophile Organismen (d.h. Wachstumsoptimum bei über 40 °C).
Die erfindungsgemäß bevorzugt verwendeten Monooxygenasen sind vorzugsweise durch eine erhöhte Temperaturstabilität gekennzeichnet. Diese drückt sich in einem in Vergleich zum P450 BM-3 aus Bacillus megate um geringeren Aktivitätsverlust bei erhöhter Temperatur (z.B. in einem Bereich von 30 bis 60 °C, pH 7,5, 25mM Tris/HCI) aus.
Gemäß einer bevorzugten Ausführungsform wird erfindungsgemäß eine Cytochrom P450 Monooxygenase aus dem thermophilen Bakterium T. thermophilus verwendet. Das Protein besitzt ein Molekulargewicht von etwa 44 kDa (bestimmt durch SDS-Gelelektrophorese), ist löslich und zeigt im reduzierten Zustand, oxidierten Zustand und als Carbonyl-Addukt ein Absorbtionsspektrum analog zu dem anderer P450 Enzyme. Aus Sequenzvergleichen dieses erfindungsgemäßen Enzyms aus T. thermophilus und anderen bekannten P450 Enzy- men konnten folgende Identitäten bestimmt werden: P450 BM3, 32% Identität; CYP119, 29% Identität; P450eryF, 31% Identität. Das erfindungsgemäße Enzym zeigt eine außerordentliche Thermostabilität, veranschaulicht durch eine Schmelztemperatur von etwa 85°C, welcher Wert um 30°C über demjenigen für P450cam liegt.
Ein weiterer Gegenstand der Erfindung betrifft die Verwendung von Polynukleotiden, welche für eine Cytochrom P450 Monooxygenase kodieren, insbesondere eine Cytochrom P450 Monooxygenase aus der Gattung Thermus sp. in Verfahren zur Oxidation von ß-Carotin.
Bevorzugte Polynukleotide sind solche, die im wesentlichen eine Nukleinsäuresequenz ge- maß SEQ ID NO: 1 besitzen, sowie die dazu komplementären und davon abgeleiteten Nuk- leinsäuresequenzen.
Ein weiterer Gegenstand der Erfindung betrifft die Verwendung von Expressionskassetten oder von rekombinanten Vektoren zur Herstellung von rekombinanten Mikroorganismen, welche zu den erfindungsgemäßen Umsetzungen brauchbar sind.
Erfindungsgemäß mit umfasst ist ebenfalls die Verwendung „funktionaler Äquivalente" der konkret offenbarten neuen P450 Monooxygenasen zu den erfindungsgemäßen Umsetzungen.
„Funktionale Äquivalente" oder Analoga der konkret offenbarten Monooxygenasen sind im Rahmen der vorliegenden Erfindung davon verschiedene Enzyme, welche weiterhin die ge- wünschte Substratspezifität im Rahmen der oben bezeichneten Oxidationsreaktion besitzen und /oder im Vergleich zu P450 BM3 eine erhöhte Thermostabilität, z.B. bei Temperaturen im Bereich von etwa 30 bis 60 °C und gegebenenfalls höheren Temperaturen nach 30- minütiger Behandlung in 25mM Tris/HCI, besitzen.
Unter "funktionalen Äquivalenten" versteht man erfindungsgemäß insbesondere Mutanten, welche in wenigstens einer der oben genannten Sequenzpositionen eine andere als die konkret genannte Aminosäure aufweisen aber trotzdem eine der oben genannten Oxidationsre- aktionen katalysieren. "Funktionale Äquivalente" umfassen somit die durch eine oder mehre- re, wie z.B. 1 bis 30 oder 1 bis 20 oder 1 bis 10, Aminosäure-Additionen, -Substitutionen, - Deletionen und/oder -Inversionen erhältlichen Mutanten, wobei die genannten Veränderungen in jeglicher Sequenzposition auftreten können, solange sie zu einer Mutante mit dem erfindungsgemäßen Eigenschaftsprofil führen. Funktionale Äquivalenz ist insbesondere auch dann gegeben, wenn die Reaktivitätsmuster zwischen Mutante und unverändertem Enzym qualitativ übereinstimmen, d.h. beispielsweise gleiche Substrate mit unterschiedlicher Geschwindigkeit umgesetzt werden.
Erfindungsgemäß mit umfasste „funktionale Äquivalente" weisen eine von SEQ ID NO:2 in mindestens einer Position abweichende Aminosäuresequenz auf, wobei die Veränderung in der Sequenz die Monooxygenase Aktivität vorzugsweise nur unwesentlich, das heißt um nicht mehr als etwa ± 90%, insbesondere + 50% oder nicht mehr als ± 30% verändert. Diese Veränderung kann unter Verwendung eines Referenzsubstrates, wie zum Beispiel ß-Carotin, unter standardisierten Bedingungen (zum Beispiel 0,1 bis 0,5 M Substrat, pH-Bereich 6 bis 8, insbesondere 7; T = 30 bis 70°C) bestimmt werden.
„Funktionale Äquivalente" im obigen Sinne sind auch Präkursoren der beschriebenen Poly- peptide sowie funktionale Derivate und Salze der Polypeptide. Unter dem Ausdruck „Salze" versteht man sowohl Salze von Carboxylgruppen als auch Säureadditionssalze von Ami- nogruppen der erfindungsgemäßen Proteinmoleküle. Salze von Carboxylgruppen können in an sich bekannter Weise hergestellt werden und umfassen anorganische Salze, wie zum Beispiel Natrium-, Calcium-, Ammonium-, Eisen- und Zinksalze, sowie Salze mit organischen Basen, wie zum Beispiel Aminen, wie Triethanolamin, Arginin, Lysin, Piperidin und dergleichen. Säureadditionssalze, wie zum Beispiel Salze mit Mineralsäuren, wie Salzsäure oder Schwefelsäure und Salze mit organischen Säuren, wie Essigsäure und Oxalsäure sind eben- falls Gegenstand der Erfindung. „Funktionale Derivate" erfindungsgemäßer Polypeptide können an funktionellen Aminosäure- Seitengruppen oder an deren N- oder C-terminalen Ende mit Hilfe bekannter Techniken e- benfalls hergestellt werden. Derartige Derivate umfassen beispielsweise aliphatische Ester von Carbonsäuregruppen, Amide von Carbonsäuregruppen, erhältlich durch Umsetzung mit Ammoniak oder mit einem primären oder sekundären Amin; N-Acylderivate freier Ami- nogruppen, hergestellt durch Umsetzung mit Acylgruppen; oder O-Acylderivate freier Hydro- xygruppen, hergestellt durch Umsetzung mit Acylgruppen.
Erfindungsgemäß mit umfasste „funktionale Äquivalente" sind Homologe zu den konkret of- fenbarten Proteinen. Diese besitzen wenigstens 60 %, vorzugsweise wenigstens 75% ins besondere wenigsten 85 %, wie z.B. 90%, 95% oder 99%, Homologie zu einer der konkret offenbarten Sequenzen, berechnet nach dem Algorithmus von Pearson und Lipman, Proc. Natl. Acad, Sei. (USA) 85(8), 1988, 2444-2448.
Homologe der erfindungsgemäßen Proteine oder Polypeptide können durch Mutagenese erzeugt werden, z.B. durch Punktmutation oder Verkürzung des Proteins.
Homologe des erfindungsgemäßen Proteine können durch Screening kombinatorischer Banken von Mutanten, wie z.B. Verkürzungsmutanten, identifiziert werden. Beispielsweise kann eine variierte Bank von Protein-Varianten durch kombinatorische Mutagenese auf Nuklein- säureebene erzeugt werden, wie z.B. durch enzymatisches Ligieren eines Gemisches synthetischer Oligonukleotide. Es gibt eine Vielzahl von Verfahren, die zur Herstellung von Banken potentieller Homologer aus einer degenerierten Oligonukleotidsequenz verwendet werden können. Die chemische Synthese einer degenerierten Gensequenz kann in einem DNA- Syntheseautomaten durchgeführt werden, und das synthetische Gen kann dann in einen geeigneten Expressionsvektor ligiert werden. Die Verwendung eines degenerierten Gensatzes ermöglicht die Bereitstellung sämtlicher Sequenzen in einem Gemisch, die den gewünschten Satz an potentiellen Proteinsequenzen codieren. Verfahren zur Synthese degenerierter Oligonukleotide sind dem Fachmann bekannt (Z.B. Narang, S.A. (1983) Tetra- hedron 39:3; Itakura et al. (1984) Annu. Rev. Biochem. 53:323; Itakura et al., (1984) Science 198:1056; Ike et al. (1983) Nucleic Acids Res. 11 :477).
"Funktionale Äquivalente" umfassen natürlich auch P450-Monooxygenasen, welche aus anderen Organismen, z.B. aus anderen als den hierin konkret genannten Bakterien, zugänglich sind, sowie natürlich vorkommende Varianten. Beispielsweise lassen sich durch Sequenzvergleich Bereiche homologer Sequenzregionen festlegen und in Anlehnung an die konkreten Vorgaben der Erfindung äquivalente Enzyme ermitteln. Gegenstand der Erfindung ist auch die Verwendung von Nukleinsäuresequenzen (einzel- und doppelsträngige DNA- und RNA-Sequenzen), kodierend für eine der obigen Monooxygenasen und deren funktionale Äquivalente zur Durchführung obiger Verfahren. Weitere erfindungsgemäße Nukleinsäuresequenzen sind abgeleitet von SEQ ID NO:1 und unterscheiden sich davon durch Addition, Substitution, Insertion oder Detetion einzelner oder mehrerer Nukleotide, kodieren aber weiterhin für eine Monooxygenase mit der gewünschten Eigenschaftsprofil.
Alle hierin erwähnten Nukleinsäuresequenzen sind in an sich bekannter Weise durch chemische Synthese aus den Nukleotidbausteinen, wie beispielsweise durch Fragmentkondensation einzelner überlappender, komplementärer Nukleinsäurebausteine der Doppelhelix herstellbar. Die chemische Synthese von Oligonukleotiden kann beispielsweise, in bekannter Weise, nach der Phosphoramiditmethode (Voet, Biochemie, 2. Auflage, Wiley Press New York, Seiten 896-897) erfolgen. Die Anlagerung synthetischer Oligonukleotide und Auffüllen von Lücken mit Hilfe des Klenow-Fragmentes der DNA-Polymerase und Ligationsreaktionen sowie allgemeine Klonierungsverfahren werden in Sambrook et al. (1989), Molecular Clon- ing: A laboratory manual, Cold Spring Harbor Laboratory Press, beschrieben.
Erfindungsgemäß umfasst sind auch solche Nukleinsäuresequenzen, die sogenannte stumme Mutationen umfassen oder entsprechend der Codon-Nutzung eins speziellen Ursprungsoder Wirtsorganismus, im Vergleich zu einer konkret genannten Sequenz verändert sind, ebenso wie natürlich vorkommende Varianten, wie z.B. Spleißvarianten, davon. Gegenstand sind ebenso durch konservative Nukleotidsubstutionen (d.h. die betreffende Aminosäure wird durch eine Aminosäure gleicher Ladung, Größe, Polarität und/oder Löslichkeit ersetzt) erhältliche Sequenzen.
Weiterhin umfasst die Erfindung auch Nukleinsäuresequenzen, welchen mit oben genannten kodierenden Sequenzen hybridisieren oder dazu komplementär sind. Diese Polynukleotide lassen sich bei Durchmusterung von genomischen oder cDNA-Bibliotheken auffinden und gegebenenfalls daraus mit geeigneten Primern mittels PCR vermehren und anschließend beispielsweise mit geeigneten Sonden isolieren. Eine weitere Möglichkeit bietet die Transformation geeigneter Mikroorganismen mit erfindungsgemäßen Polynukleotiden oder Vektoren, die Vermehrung der Mikroorganismen und damit der Polynukleotide und deren an- schließende Isolierung. Darüber hinaus können erfindungsgemäße Polynukleotide auch auf chemischem Wege synthetisiert werden. Unter der Eigenschaft, an Polynukleotide „hybridisieren" zu können, versteht man die Fähigkeit eines Poly- oder Oligonukleotids unter stringenten Bedingungen an eine nahezu komplementäre Sequenz zu binden, während unter diesen Bedingungen unspezifische Bindungen zwischen nicht-komplementären Partnern unterbleiben. Dazu sollten die Sequenzen zu 70-100%, vorzugsweise zu 90-100%, komplementär sein. Die Eigenschaft komplementärer Sequenzen, spezifisch aneinander binden zu können, macht man sich beispielsweise in der Northern- oder Southern-Blot-Technik oder bei der Primerbindung in PCR oder RT-PCR zunutze. Üblicherweise werden dazu Oligonukleotide ab einer Länge von 30 Basenpaaren eingesetzt. Unter stringenten Bedingungen versteht man beispielsweise in der Northern-Blot- Technik die Verwendung einer 50 - 70 °C, vorzugsweise 60 - 65 °C warmen Waschlösung, beispielsweise 0,1x SSC-Puffer mit 0,1 % SDS (20x SSC: 3M NaCI, 0,3M Na-Citrat, pH 7,0) zur Elution unspezifisch hybridisierter cDNA-Sonden oder Oligonukleotide. Dabei bleiben, wie oben erwähnt, nur in hohem Maße komplementäre Nukleinsäuren aneinander gebunden.
Diese Nukleinsäuren sind vorzugsweise in Expressionskonstrukte eingebaut, enthaltend unter der genetischen Kontrolle regulativer Nukleinsäuresequenzen eine für ein erfindungsgemäßes Enzym kodierende Nukleinsäuresequenz; sowie Vektoren, umfassend wenigstens eines dieser Expressionskonstrukte. Vorzugsweise umfassen solche erfindungsgemäßen Konstrukte 5'-stromaufwärts von der jeweiligen kodierenden Sequenz einen Promotor und 3'- stromabwärts eine Terminatorsequenz sowie gegebenenfalls weitere übliche regulative Elemente, und zwar jeweils operativ verknüpft mit der kodierenden Sequenz. Unter einer „operativen Verknüpfung" versteht man die sequentielle Anordnung von Promotor, kodierender Sequenz, Terminator und gegebenenfalls weiterer regulativer Elemente derart, dass jedes der regulativen Elemente seine Funktion bei der Expression der kodierenden Sequenz be- stimmungsgemäß erfüllen kann. Beispiele für operativ verknüpfbare Sequenzen sind Targeting-Sequenzen sowie Translationsverstärker, Enhancer, Polyadenylierungssignale und dergleichen. Weitere regulative Elemente umfassen selektierbare Marker, Amplifikationssignale, Replikationsursprünge und dergleichen.
Zusätzlich zu den artifiziellen Regulationssequenzen kann die natürliche Regulationssequenz vor dem eigentlichen Strukturgen noch vorhanden sein. Durch genetische Veränderung kann diese natürliche Regulation gegebenenfalls ausgeschaltet und die Expression der Gene erhöht oder erniedrigt werden. Das Genkonstrukt kann aber auch einfacher aufgebaut sein, das heißt es werden keine zusätzlichen Regulationssignale vor das Strukturgen inser- tiert und der natürliche Promotor mit seiner Regulation wird nicht entfernt. Statt dessen wird die natürliche Regulationssequenz so mutiert, dass keine Regulation mehr erfolgt und die Genexpression gesteigert oder verringert wird. Die Nukleinsäuresequenzen können in einer oder mehreren Kopien im Genkonstrukt enthalten sein.
Beispiele für brauchbare Promotoren sind: cos-, tac-, trp-, tet-, trp-tet-, Ipp-, lac-, Ipp-lac-, laclq-, T7-, T5-, T3-, gal-, trc-, ara-, SP6-, Λ-PR- oder /.-PL-Promotor, die vorteilhafterweise in gram-negativen Bakterien Anwendung finden; sowie die gram-positiven Promotoren amy und SPO2, die Hefepromotoren ADC1 , MFσ , AC, P-60, CYC1 , GAPDH oder die Pflanzenpromo- toren CaMV/35S, SSU, OCS, Iib4, usp, STLS1 , B33, not oder der Ubiquitin- oder Phaseolin- Promotor. Besonders bevorzugt ist die Verwendung induzierbarer Promotoren, wie z.B. licht- und insbesondere temperaturinduzierbarer Promotoren, wie der PrPrPromotor.
Prinzipiell können alle natürlichen Promotoren mit ihren Regulationssequenzen verwendet werden. Darüber hinaus können auch synthetische Promotoren vorteilhaft verwendet werden.
Die genannten regulatorischen Sequenzen sollen die gezielte Expression der Nukleinsäuresequenzen und die Proteinexpression ermöglichen. Dies kann beispielsweise je nach Wirtsorganismus bedeuten, dass das Gen erst nach Induktion exprimiert oder überexprimiert wird, oder dass es sofort exprimiert und/oder überexprimiert wird.
Die regulatorischen Sequenzen bzw. Faktoren können dabei vorzugsweise die Expression positiv beeinflussen und dadurch erhöhen oder erniedrigen. So kann eine Verstärkung der regulatorischen Elemente vorteilhafterweise auf der Transkriptionsebene erfolgen, indem starke Transkriptionssignale wie Promotoren und/oder "Enhancer" verwendet werden. Daneben ist aber auch eine Verstärkung der Translation möglich, indem beispielsweise die Stabilität der mRNA verbessert wird.
Die Herstellung einer Expressionskassette erfolgt durch Fusion eines geeigneten Promotors mit einer geeigneten Monooxygenase-Nukleotidsequenz sowie einem Terminator- oder Po- lyadenylierungssignal. Dazu verwendet man gängige Rekombinations- und Klonierungstech- niken, wie sie beispielsweise in T. Maniatis, E.F. Fritsch und J. Sambrook, Molecular Clo- ning: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1989) sowie in T.J. Silhavy, M.L. Berman und L.W. Enquist, Experiments with Gene Fusions, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1984) und in Ausubel, F.M. et al., Cur- rent Protocols in Molecular Biology, Greene Publishing Assoc. and Wiley Interscience (1987) beschrieben sind. Das rekombinante Nukleinsäurekonstrukt bzw. Genkonstrukt wird zur Expression in einem geeigneten Wirtsorganismus vorteilhafterweise in einen wirtsspezifischen Vektor insertiert, der eine optimale Expression der Gene im Wirt ermöglicht. Vektoren sind dem Fachmann wohl bekannt und können beispielsweise aus "Cloning Vectors" (Pouwels P. H. et al., Hrsg, Elsevier, Amsterdam-New York-Oxford, 1985) entnommen werden. Unter Vektoren sind außer Plasmiden auch alle anderen dem Fachmann bekannten Vektoren, wie beispielsweise Phagen, Viren, wie SV40, CMV, Baculovirus und Adenovirus, Transposons, IS-Elemente, Phasmide, Cosmide, und lineare oder zirkuläre DNA zu verstehen. Diese Vektoren können autonom im Wirtsorganismus repliziert oder chromosomal repliziert werden.
Als Beispiele für geeignete Expressionsvektoren können genannt werden:
Übliche Fusionsexpressionsvektoren, wie pGEX (Pharmacia Biotech Ine; Smith, D.B. und Johnson, K.S. (1988) Gene 67:31-40), pMAL (New England Biolabs, Beverly, MA) und pRIT 5 (Pharmacia, Piscataway, NJ), bei denen Glutathion-S-Transferase (GST), Maltose E- bindendes Protein bzw. Protein A an das rekombinante Zielprotein fusioniert wird.
Nicht-Fusionsprotein-Expressionsvektoren wie pTrc (Amann et al., (1988) Gene 69:301-315) und pET 11 d (Studier et al. Gene Expression Technology: Methode in Enzymology 185, A- cademic Press, San Diego, Kalifornien (1990) 60-89).
Hefe-Expressionsvektor zur Expression in der Hefe S. cerevisiae , wie pYepSed (Baldari et al., (1987) Embo J. 6:229-234), pMF (Kurjan und Herskowitz (1982) Cell 30:933-943), pJRY88 (Schultz et al. (1987) Gene 54:113-123) sowie pYES2 (Invitrogen Corporation, San Diego, CA). Vektoren und Verfahren zur Konstruktion von Vektoren, die sich zur Verwendung in anderen Pilzen, wie filamentösen Pilzen, eignen, umfassen diejenigen, die eingehend beschrieben sind in: van den Hondel, C.A.M.J.J. & Punt, P.J. (1991) "Gene transfer Systems and vector development for filamentous fungi", in: Applied Molecular Genetics of Fungi, J.F. Peberdy et al., Hrsg., S. 1-28, Cambridge University Press: Cambridge.
Baculovirus-Vektoren, die zur Expression von Proteinen in gezüchteten Insektenzellen (bspw. Sf9-Zellen) verfügbar sind, umfassen die pAc-Reihe (Smith et al., (1983) Mol. Cell Biol.. 3:2156-2165) und die pVL-Reihe (Lucklow und Summers (1989) Virology 170:31-39).
Pflanzen-Expressionsvektoren, wie solche, die eingehend beschrieben sind in: Becker, D., Kemper, E., Schell, J. und Masterson, R. (1992) "New plant binary vectors with selectable markers located proximal to the left border", Plant Mol. Biol. 20:1195-1197; und Bevan, M.W. (1984) "Binary Agrobacterium vectors for plant transformation", Nucl. Acids Res. 12:8711- 8721.
Säugetier-Expressionsvektoren, wie pCDMδ (Seed, B. (1987) Nature 329:840) und pMT2PC (Kaufman et al. (1987) EMBO J. 6:187-195).
Weitere geeignete Expressionssysteme für prokaryontische und eukaryotische Zellen sind in Kapitel 16 und 17 von Sambrook, J., Fritsch, E.F. und Maniatis, T., Molecular cloning: A Laboratory Manual, 2. Auflage, Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989 beschrieben.
Mit Hilfe der erfindungsgemäßen Expressionskonstrukte bzw. Vektoren sind rekombinante Mikroorganismen herstellbar, welche beispielsweise mit wenigstens einem erfindungsgemäßen Vektor transformiert sind und zur Produktion der erfindungsgemäß verwendeten Enzy- me und/oder zur Durchführung des erfindungsgemäßen Verfahrens eingesetzt werden können. Vorteilhafterweise werden die oben beschriebenen erfindungsgemäßen rekombinanten Konstrukte in ein geeignetes Wirtssystem eingebracht und exprimiert. Dabei werden vorzugsweise dem Fachmann bekannte geläufige Klonierungs- und Transfektionsmethoden, wie beispielsweise Co-Präzipitation, Protoplastenfusion, Elektroporation, retrovirale Trans- fektion und dergleichen, verwendet, um die genannten Nukleinsäuren im jeweiligen Expressionssystem zur Expression zu bringen. Geeignete Systeme werden beispielsweise in Cur- rent Protocols in Molecular Biology, F. Ausubel et al., Hrsg., Wiley Interscience, New York 1997, beschrieben.
Als Wirtsorganismen sind prinzipiell alle Organismen geeignet, die eine Expression der erfindungsgemäßen Nukleinsäuren, ihrer Allelvarianten, ihrer funktioneilen Äquivalente oder Derivate ermöglichen. Unter Wirtsorganismen sind beispielsweise Bakterien, Pilze, Hefen, pflanzliche oder tierische Zellen zu verstehen. Bevorzugte Organismen sind Bakterien, wie solche der Gattungen Escherichia, wie z. B. Escherichia coli, Streptomyces, Bacillus oder Pseudomonas, eukaryotische Mikroorganismen, wie Saccharomyces cerevisiae, Aspergillus, Blakeslea, Phycomyces, höhere eukaryotische Zellen aus Tieren oder Pflanzen, beispielsweise Sf9 oder CHO-Zellen.
Die Selektion erfolgreich transformierter Organismen kann durch Markergene erfolgen, die ebenfalls im Vektor oder in der Expressionskassette enthalten sind. Beispiele für solche Markergene sind Gene für Antibiotikaresistenz und für Enzyme, die eine farbgebende Reaktion katalysieren, die ein Anfärben der transformierten Zelle bewirkt. Diese können dann mit- tels automatischer Zellsortierung selektiert werden. Erfolgreich mit einem Vektor transformierte Mikroorganismen, die ein entsprechendes Antibiotikaresistenzgen (z.B. G418 oder Hygromycin) tragen, lassen sich durch entsprechende Antibiotika-enthaltende Medien oder Nährböden selektieren. Markerproteine, die an der Zelloberfläche präsentiert werden, kön- nen zur Selektion mittels Affinitätschromatographie genutzt werden.
Die Kombination aus den Wirtsorganismen und den zu den Organismen passenden Vektoren, wie Plasmide, Viren oder Phagen, wie beispielsweise Plasmide mit dem RNA- Polymerase/Promoter-System, die Phagen λ oder μ oder andere temperente Phagen oder Transposons und/oder weiteren vorteilhaften regulatorischen Sequenzen bildet ein Expressionssystem. Beispielsweise ist unter dem Begriff "Expressionssystem" die Kombination aus Säugetierzellen, wie CHO-Zellen, und Vektoren, wie pcDNA3neo-Vektor, die für Säugetierzellen geeignet sind, zu verstehen.
Gewünschtenfalls kann das Genprodukt auch in transgenen Organismen wie transgenen Tieren, wie insbesondere Mäusen oder Schafen oder transgenen Pflanzen zur Expression gebracht werden.
Die erfindungsgemäß einsetzbaren Monooxygenasen können auch rekombinant hergestellt werden, wobei man einen Monooxygenase-produzierenden Mikroorganismus kultiviert, gegebenenfalls die Expression der Monooxygenase induziert und die Monooxygenase aus der Kultur isoliert. Die Monooxygenase kann so auch in großtechnischem Maßstab produziert werden, falls dies erwünscht ist.
Der rekombinante Mikroorganismus kann nach bekannten Verfahren kultiviert und fermentiert werden. Bakterien können beispielsweise in TB- oder LB-Medium und bei einer Temperatur von 20 bis 40°C und einem pH-Wert von 6 bis 9 vermehrt werden. Im Einzelnen werden geeignete Kultivierungsbedingungen beispielsweise in T. Maniatis, E.F. Fritsch and J. Sambrook, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1989) beschrieben.
Die Zellen werden dann, falls die Monooxygenase nicht in das Kulturmedium sezerniert wird, aufgeschlossen und das Enzym nach bekannten Proteinisolierungsverfahren aus dem Lysat gewonnen. Die Zellen können wahlweise durch hochfrequenten Ultraschall, durch hohen Druck, wie z.B. in einer French-Druckzelle, durch Osmolyse, durch Einwirkung von Deter- genzien, lytischen Enzymen oder organischen Lösungsmitteln, durch Homogenisatoren oder durch Kombination mehrerer der aufgeführten Verfahren aufgeschlossen werden. Eine Aufreinigung der Monooxygenase kann mit bekannten, chromatographischen Verfahren erzielt werden, wie Molekularsieb-Chromatographie (Gelfiltration), wie Q-Sepharose- Chromatographie, lonenaustausch-Chromatographie und hydrophobe Chromatographie, sowie mit anderen üblichen Verfahren wie Ultrafiltration, Kristallisation, Aussalzen, Dialyse und nativer Gelelektrophorese. Geeignete Verfahren werden beispielsweise in Cooper, T. G., Biochemische Arbeitsmethoden, Verlag Walter de Gruyter, Berlin, New York oder in Scopes, R., Protein Purification, Springer Verlag, New York, Heidelberg, Berlin beschrieben.
Besonders vorteilhaft ist es, zur Isolierung des rekombinanten Proteins Vektorsysteme oder Oligonukleotide zu verwenden, die die DNA um bestimmte Nucleotidsequenzen verlängern und damit für veränderte Polypeptide oder Fusionsproteine kodieren, die einer einfacheren Reinigung dienen. Derartige geeignete Modifikationen sind beispielsweise als Anker fungierende sogenannte "Tags", wie z.B. die als Hexa-Histidin-Anker bekannte Modifikation oder Epitope, die als Antigene von Antikörpern erkannt werden können (beschrieben zum Beispiel in Harlow, E. and Lane, D., 1988, Antibodies: A Laboratory Manual. Cold Spring Harbor (N.Y.) Press). Diese Anker können zur Anheftung der Proteine an einen festen Träger, wie z.B. einer Polymermatrix, dienen, die beispielsweise in einer Chromatographiesäule eingefüllt sein kann, oder an einer Mikrotiterplatte oder an einem sonstigen Träger verwendet wer- den kann.
Gleichzeitig können diese Anker auch zur Erkennung der Proteine verwendet werden. Zur Erkennung der Proteine können außerdem übliche Marker, wie Fluoreszenzfarbstoffe, En- zymmarker, die nach Reaktion mit einem Substrat ein detektierbares Reaktionsprodukt bil- den, oder radioaktive Marker, allein oder in Kombination mit den Ankern zur Derivatisierung der Proteine verwendet werden.
Folgende nichtlimitierende Beispiele beschreiben spezielle Ausführungsformen der Erfindung. Beispiele
Allgemeine experimentelle Angaben:
a) Allgemeine Klonierungsverfahren
Die im Rahmen der vorliegenden Erfindung durchgeführten Klonierungsschritte wie z.B. Restriktionsspaltungen, Agarose Gelelektrophorese, Reinigung von DNA-Fragmenten, Transfer von Nukleinsäuren auf Nitrozellulose und Nylonmembranen, Verknüpfen von DNA- Fragmenten, Transformation von E. coli Zellen, Anzucht von Bakterien, Vermehrung von Phagen und Sequenzanalyse rekombinanter DNA wurden wie bei Sambrook et al. (1989) a.a.O. beschrieben durchgeführt.
b) Polymerasekettenreaktion (PCR)
PCR wurde nach Standardprotokoll mit folgendem Standardansatz durchgeführt:
8 μl dNTP-Mix (200μM), 10 μl Taq-Polymerase-Puffer (10 x) ohne MgCI2, 8μl MgCI2 (25mM), je 1 μl Primer (0,1 μM), 1 μl zu amplifizierende DNA, 2,5 U Taq-Polymerase (MBI Fermentas, Vilnius, Litauen), ad 100 μl demineralisiertes Wasser.
c) Kultivierung von E.coli
Die Kultivierung von rekombinanten E. coli-Stämme DH5σ erfolgte in LB-Amp Medium (Tryp- ton 10,0g, NaCI 5,0 g, Hefeextrakt 5,0 g, Ampicillin 100 g/ml H20 ad 1000 ml) bei 37 °C. Dazu wurde jeweils eine Kolonie mittels Impföse von einer Agarplatte in 5 ml LB-Amp überführt. Nach ca. 18 h Stunden Kultivierung bei einer Schüttelfrequenz von 220 Upm wurden 400 ml Medium in einem 2-l-Kolben mit 4 ml Kultur inokuliert. Die Induktion der P450-Expression in E. coli erfolgte nach Erreichen eines OD578-Wert.es zwischen 0,8 und 1 ,0 durch eine drei- bis vierstündige Hitzeschockinduktion bei 42 °C.
d) Zellaufschluß
Zellpellets mit einer Biofeuchtmasse von bis zu 15 g E. coli DH5 wurden auf Eis aufgetaut und in 25 ml Kaliumphosphat-Puffer (50 mM, pH 7,5, 1 mM EDTA) oder Tris/HCI Puffer (50 mM, pH 7,5, 1 mM EDTA) suspendiert. Mittels dreiminütiger Ultraschallbehandlung (Branson
Sonifier W250, (Dietzenbach, Deutschland), Leistungsabgabe 80 W, Arbeitsintervall 20 %) wurde die auf Eis gekühlte E. coli-Zellsuspension aufgeschlossen. Vor der Proteinreinigung wurde die Zellsuspension für 20 min bei 32 500 g zentrifugiert und durch einen 0,22 mm Ste- rivex-GP-Filter (Millipore) filtriert, wobei man einen Rohextrakt erhält.
Beispiel 1:
Klonierunq und Expression von P450 aus Thermus thermophilus HB27 und den His-tag- Derivaten davon
1. Klonierung von P450 aus Thermus thermophilus HB27
Ein die kodierende P450-Sequenz (im folgenden auch als CYP175A1-Gen ezeichnet) umfassender Klon (TTHB66) wurde aus einer Thermus Genbank gewonnen. Die kodierende P450-Sequenz (blunt ended) wurde in die Hincll-Schnittstelle des Plasmids pTZ19R (MBI Fermentas) einkloniert. Aus dem so erhaltenen Plasmid TTHB66 wurde die kodierende P450-Sequenz mit Hilfe der PCR amplifiziert. Dazu wurden folgende Primer verwendet:
a) 30-mer sense-Oligonucleotid, enthaltend die Ndel-Schnittstelle (kursiv gedruckt) als Teil des P450-ATG-Startcodons: 5,-CG GCTCΛ7/.ΓG GCGCCTTTCCCTGAG (SEQ ID NO:7).
b) 30-mer antisense-Oligonucleotid, enthaltend die EcoRI-Schnittstelle (kursiv gedruckt) als Teil des TGA-Stopcodons: 5'-GCGiAATrCACGCCCGCACCTCCTCCCTAGG (SEQ ID NO:8).
Das resultierende Fragment wurde in die Ndel-Schnittstellen des Vektors pCYTEXPl (Plasmid mit dem temperaturinduzierbaren PRP -Promotorsystem des Bakteriophagen 8 (Belev T.N., et al., Plasmid (1991) 26:147)) kloniert und in E. coli DH-5α (Clontech, Heidelberg) transformiert.
E. coli DH-5α, enthaltend das interessierende Plasmid wurde in LB-Medium in Gegenwart von Ampicillin inokuliert und die Kultur wurde über Nacht bei 37 °C inkubiert. Ein Teil der Probe wurde in frisches LB-Medium (in Gegenwart von Ampicillin) inokuliert und die resultierende Kultur wurde bei 37 °C bis zu OD = 0,9 kultiviert. Die Induktion erfolgte durch Erhöhung der Temperatur auf 42 °C über einen Zeitraum von 24 Stunden. Die Veränderung des P450-Gehaltes während der Expression wurde anhand von Messungen des CO-Differenz- spektrums bestimmt.
2. Klonierung von P450 aus Thermus thermophilus HB27 mit N-terminalem His-tag
Die kodierende P450-Sequenz wurde durch PCR aus dem Plasmid TTHB66 unter Verwendung folgender Primer amplifiziert:
(a) 50-mer sense-Oligonucleotid, enthaltend die Ndel-Schnittstelle (kursiv gedruckt) als Teil des P450 ATG-Startcodons und die tag-kodierenden Codons (unterstrichen): δ'-CGAAGCTCv TA 7GCATCACCATCATCATCACAAGCGCCTTTC (SEQ ID NO:9);
(b) 30-mer antisense-Oligonucleotid, enthaltend die EcoRI-Schnittstelle (kursiv gedruckt) als Teil des TGA-Stop-Codons :
5'-GCGAA77CACGCCCGCACCTCCTCCCTAGG (SEQ ID N0:8).
Das resultierende Fragment wurde in die Ndel- und EcoRI-Schnittstellen des Vektors p- CYTEXP1 kloniert und in E. coli DH-5 exprimiert.
E. coli DH-5α, enthaltend das interessierende Plasmid, wurde in LB-Medium in Gegenwart von Ampicillin inokuliert und die Kultur wurde über Nacht bei 37 °C inkubiert. Ein Teil der Probe wurde in frisches LB-Medium (in Gegenwart von Ampicillin) inokuliert und die resultierende Kultur wurde bei 37 °C bis zu OD = 0,9 kultiviert. Die Induktion erfolgte durch Erhöhung der Temperatur auf 42 °C über einen Zeitraum von 24 Stunden. Die Veränderung des P450-Gehalt.es während der Expression wurde anhand von Messungen des CO-Differenz- spektrums bestimmt.
3. Klonierung von P450 aus Thermus thermophilus HB27 mit C-terminalem His-tag
Die kodierende P450-Sequenz wurde durch PCR aus dem Plasmid TTHB66 unter Verwendung der folgenden Primer amplifiziert:
(a) 30-mer sense-Oligonucleotid, enthaltend die Ndel-Schnittstelle (kursiv gedruckt) als Teil des P450 ATG-Start-Codons: 5'-CGAAGCTCΛΓATGAAGCGCCTTTCCCTGAG (SEQ ID NO:7)
(b) 47-mer antisense-Oligonucleotid, enthaltend die EcoRI-Schnittstelle (kursiv gedruckt) als Teil des TGA-Stop-Codons sowie die unterstrichene tag-kodierende Teilsequenz: 5'-CGGAATTCAGTGATGATGATGGTGATGCGCCCGCACCTCCTC (SEQ ID NO:10).
Das resultierende Fragment wurde in die Ndel- und EcoRI-Schnittstellen des Vektors p- CYTEXP1 cloniert und in E. coli DH-5α exprimiert.
E. coli DH-5α, enthaltend das interessierende Plasmid wurde in LB-Medium in Gegenwart von Ampicillin inokuliert und die Kultur wurde über Nacht bei 37 °C inkubiert. Ein Teil der Probe wurde in frisches LB-Medium (in Gegenwart von Ampicillin) inokuliert und die resultierende Kultur wurde bei 37 °C bis zu OD = 0,9 kultiviert. Die Induktion erfolgte durch Erhöhung der Temperatur auf 42 °C über einen Zeitraum von 24 Stunden. Die Veränderung des P450-Gehaltes während der Expression wurde anhand von Messungen des CO-Differenz- spektrums bestimmt.
Beispiel 2: Bestimmung der Thermostabilität von P450 aus Thermus thermophilus im Vergleich zu P450 BM3
Die beiden Enzyme wurden jeweils 30 Minuten in Tris/HCI-Puffer pH 7,5, 25mM bei verschiedenen Temperaturen inkubiert. Die Ansätze wurden anschließend abgekühlt und die P450 Konzentration wurde spektrometrisch bestimmt. Die Ergebnisse sind in folgender Tabelle zusammengefaßt und in Figur 2 graphisch dargestellt.
Wie man den Versuchsergebnissen entnimmt, besitzt das erfindungsgemäße Enzym nach 30-minütiger Inkubation bei allen Temperaturen eine signifikant höherer Temperaturstabilität.
Beispiel 3:
Herstellung eines Expressionsvektors für Cytochrom P450 Monooxygenase aus T. thermophilus HB 27
Es wurde von Plasmid-DNA (Klon TTHB66), enthaltend die kodierende Sequenz der Cytoch- rom P450 Monooxygenase (CYP175A1-Gen) ausgegangen. Mit Hilfe der Polymeraseketten- reaktion (PCR) wurden Restriktionsschnittstellen EcoRI und Pstl in das CYP175A1-Gen eingeführt. Mit Hilfe der folgenden Primer wurde das Gen amplifiziert: 5'-CCGGAATTCATGAAGCGCCTTTCCCTGAGG; (SEQ ID NO: 11 ) 5-CCAATGCATTGGTTCTGCAGTCAGGCCCGCACCTCCTCCCTAGG (SEQ ID NO:12)
Die neuen Restriktionsschnittstellen sind unterstrichen dargestellt. Das Reaktionsgemisch für die PCR bestand aus Template-DNA (100 ng), 2,5 U pfu DNA Polymerase (Stratagene), 5 μl Reaktionspuffer, 5 μl DMSO, 0,4 μmol jedes Oligonukleotids, 400 μmol dNTPs und H2O ad 50 μl. Folgende PCR Zyklusparameter wurden eingestellt: 95 °C, 1 Minute; (95 °C, 1 Minute; 53 °C, 1 Minute 30 Sekunden; 68 °C, 1 Minute 30 Sekunden) 30 Zyklen; 68 °C, 4 Minuten. Die CYP175A1 -Gensequenz wurde durch DNA-Sequenzierung überprüft.
Nach Restriktionsverdau des PCR-Produktes wurde das CYP175A1-Gen in die EcoRI und Pstl-Schnittstellen des Plasmids pKK 223-3 (Amersham Pharmacia) kloniert. pKK 223-3 enthält den starken tac-Promotor stromaufwärts einer Mehrfach-Klonierungsstelle und den starken rrnB ribosomalen Terminator stromabwärts davon zur Kontrolle der Protein-Expression. Das erhaltene Plasmid trägt die Bezeichnung pKK_CYP.
Beispiel 4:
Biotransformation von ß-Carotin in rekombinanten E.coli-Stämmen
Zur ß-Carotin-Biotransformation wurden rekombinante E.coli-Stämme hergestellt, welche durch heterologe Komplementation zur ß-Carotin-Produktion befähigt waren.
Stämme von E.coli JM109 wurden als Wirtszellen für die Komplementations-Experimente mit den Plasmiden pACYC_Y und pKK_CYP (hergestellt gemäß Beispiel 3) verwendet. Das
Plasmid pACYC_Y trägt die Carotinogenen Gene crtE, crtB, crtlC14 und crtY, isoliert aus E. uredovora. Die genannten Gene wurden jeweils mit einem eigenen lac-Promoter einkloniert, um die Expression zu ermöglichen. Die Herstellung dieses Plamids ist beschrieben in der
Dissertation von I. Kauffmann, Erhöhung mikrobieller Diversität von Carotinoiden, Juni 2002, Institut für Technische Biologie, Universität Stuttgart. Das die Carotinogenen Gene crtE, crtB, crtlC14 enthaltende Vorläuferkonstrukt ist beschrieben in Schmidt-Dannert (2000), Curr. O- pin. Biotechnol. 11, 255-261.
Weitere Details zur heterologen Komplementation sind beispielsweise auch beschrieben in Ruther, A. Appl. Mikrobiol. Biotechnol. (1997) 48: 162-167; Sandmann, G., Trends in Plant Science (2001 ) 6: 1, 14-17 und Sandmann, G. et al., TIBTECH (1999), 17: 233-237. Auf die Offenbarung der oben genannten Druckschriften wird hiermit ausdrücklich bezug genommen.
Kulturen von E.coli JM109 wurden in an sich bekannter Weise mit den Plasmiden pACYC_Y und pKK_CYP transformiert und in LB-Medium bei 30 °C bzw. 37 °C zwei Tage kultiviert. Ampicillin (1 μg/ml) Chloramphenicol (50 μg/ml) und Isopropyl-ß-thiogalactosid (1 mmol) wurden in üblicher weise zugegeben. Als Vergleichsprobe wurde ein E.coli-Stamm JM109 lediglich mit dem Plasmid pACYC_Y transformiert und in gleicher Weise kultiviert.
Zur Isolierung der Carotinoide aus den rekombinanten E.coli-Stämmen wurden die Zellen mit
Aceton und anschließend mit Hexan extrahiert. Die vereinigten Extrakte wurden mit Wasser partitioniert. Die organische Phase wurde isoliert, zur Trockne eingedampft und über eine
DXSIL C8-Säule mit Wasser/Acetonitril (5:95) mit Hilfe der HPLC aufgetrennt. Folgende
Verfahrensbedingungen wurden eingestellt:
Trennsäule: DXSIL C8, 3μm, 120A, 2.1 x 100mm Flussrate: 0,35mL/min
Eluenten: isokratisch Wasser / Acetonitril 5 / 95 Detektion: UV_VIS_1.Wellenlänge = 453nm
UV_VI S_1. Band breite = 4nm
3DFIELD.Max. Wellenlänge = 600nm
3DFIELD. Min. Wellenlänge = 190nm
3DFIELD.Ref. Wellenlänge = 399nm 3DFIELD.Ref. Bandbreite = 40nm
Die Spektren wurden direkt aus den Elutionspeaks unter Verwendung eines Diodenarray- Detektors bestimmt. Die isolierten Substanzen wurden über ihre Absorptionsspektren und ihre Retentionszeiten im Vergleich zu Standardproben identifiziert.
Chromatogramme der Standards für ß-Carotin, Zeaxanthin und Cryptoxanthin sind in den beiliegenden Figuren 4A bis 4C dargestellt. Figur 5 A zeigt die chromatograpische Analyse einer Probe erhalten aus dem mit dem Plasmid pACYC_Y transformierten E.coli-Stamm. Es zeigt sich, dass dieser aufgrund der heterologen Komplementation zur Bildung von ß-Carotin befähigt ist. Figur 5 B zeigt das Chromatogramm eines erfindungsgemäß hergestellten, zusätzlich mit dem Plasmid pKK_CYP transformierten, heterolog komplementierten E.coli- Stammes. Überraschenderweise zeigt sich hier, dass neben ß-Carotin signifikante Mengen der korrespondierenden Hydroxylierungsprodukte Zeaxanthin und Cryptoxanthin nachweisbar sind.

Claims

Patentansprüche
1. Verfahren zur Oxidation von Carotinoiden, dadurch gekennzeichnet, dass man ein Carotinoid in Gegenwart eines Enzyms mit Cytochrom P450 Monooxygenase Aktivi- tat umsetzt und das Oxidationsprodukt isoliert.
2. Verfahren nach Anspruch 1 , dadurch gekennzeichnet, dass man a1 ) einen rekombinanten Mikroorganismus, welcher ein Enzym mit Cytochrom P450 Monooxygenase Aktivität produziert, in einem Kulturmedium in Gegen- wart von exogenem oder intermediär gebildetem ß-Carotin kultiviert; oder a2) ein ß-Carotin-haltiges Reaktionsmedium mit einem Enzym mit Cytochrom
P450 Monooxygenase Aktivität inkubiert; und b) das gebildete Oxidationsprodukt oder ein Folgeprodukt davon aus dem Medium isoliert.
3. Verfahren nach Anspruch 2, dadurch gekennzeichnet, dass das Oxidationsprodukt Zeaxanthin, Cryptoxanthin, Adonirubin, Astaxanthin, Lutein oder Gemische davon umfasst.
4. Verfahren nach einem der vorhergehenden Ansprüche, dadurch gekennzeichnet, dass man die Oxidation durch Kultivierung des Mikroorganismus in Gegenwart von Sauerstoff bei einer Kultivierungstemperatur von mindestens etwa 20°C und einem pH-Wert von etwa 6 bis 9 durchführt.
5. Verfahren nach Anspruch 4, dadurch gekennzeichnet, dass der Mikroorganismus durch heterologe Komplementierung zur Carotinoidproduktion befähigt ist und außerdem ein Enzym mit Cytochrom P450 Monooxygenase Aktivität exprimiert.
6. Verfahren nach einem der Ansprüche 1 bis 3, dadurch gekennzeichnet, dass man ein Carotinoid als exogenes Substrat einem Medium zusetzt und die Oxidation durch en- zymatische Umsetzung des substrathaltiges Mediums in Gegenwart von Sauerstoff bei einer Temperatur von mindestens etwa 20°C und einem pH-Wert von etwa 6 bis 9 durchführt, wobei das substrathaltige Medium außerdem bezogen auf das Substrat einen etwa 10-bis 100-fachen molaren Überschuss an Reduktionsäquivalenten ent- hält.
7. Verfahren nach einem der vorhergehenden Ansprüche, dadurch gekennzeichnet, dass die Cytochrom P450 Monooxygenase eine Aminosäuresequenz aufweist, welche eine Teilsequenz von Aminosäurerest Pro328 bis Glu345 gemäß SEQ ID NO:2 umfasst.
8. Verfahren nach einem der vorhergehenden Ansprüche, dadurch gekennzeichnet, dass die Monooxygenase eine Aminosäuresequenz aufweist, welche außerdem eine Teilsequenz von Aminosäurerest Val216 bis Ala227 gemäß SEQ ID NO:2 umfasst.
9. Verfahren nach einem der vorhergehenden Ansprüche, dadurch gekennzeichnet, dass die Monooxygenase eine Aminosäuresequenz aufweist, welche wenigstens eine weitere Teilsequenz umfasst, die ausgewählt ist unter Teilsequenzen von wenigstens 10 aufeinanderfolgenden Aminosäuren aus den durch die Aminosäurereste Met1 bis Phe327 und Gly346 bis Ala389 gemäß SEQ ID NO:2 vorgegebenen Se- quenzbereichen.
10. Verfahren nach einem der vorhergehenden Ansprüche, dadurch gekennzeichnet, dass die Monooxygenase eine Aminosäuresequenz aufweist, welche im wesentlichen SEQ ID NO: 2 entspricht.
11. Verfahren nach einem der vorhergehenden Ansprüche, dadurch gekennzeichnet, dass man eine Cytochrom P450 Monooxygenase aus Bakterien der Gattung Thermus sp. verwendet.
12. Verfahren nach Anspruch 11 , dadurch gekennzeichnet, dass man eine Cytochrom
P450 Monooxygenase aus einer Bakterium der Spezies Thermus thermophilus verwendet.
13. Verfahren nach einem der vorhergehenden Ansprüche wobei man einen rekombinan- ten Mikroorganismus kultiviert, der ein Expressionskonstrukt trägt, welches unter der
Kontrolle regulativer Nukleotidsequenzen die kodierende Sequenz für eine Cytochrom P450 Monooxygenase gemäß der Definition in einem der Ansprüche 7 bis 12 umfasst.
14. Verwendung einer Cytochrom P450 Monooxygenase gemäß der Definition in einem der Ansprüche 7 bis 12 oder einer dafür kodierenden Nukleotidsequenz zur mikrobiologischen Oxidation von Carotinoiden.
15. Rekombinanter Mikroorganismus, welcher durch heterologe Komplementierung zur ß-Carotinproduktion befähigt ist und außerdem ein Enzym mit Cytochrom P450 Monooxygenase Aktivität exprimiert.
16. Mikroorganismus nach Anspruch 15, welcher mit carotinogenen Genen heterolog komplementiert ist.
17. Mikroorganismus nach einem der Ansprüche 15 und 16, abgeleitet von Bakterien der Gattung Escherichia sp.
18. Mikroorganismus nach Anspruch 17, abgeleitet von E. coli, insbesondere E. coli JM 109.
19. Mikroorganismus nach einem der Ansprüche 15 bis 18, transformiert mit einem Expressionsvektor, der unter der genetischen Kontrolle regulativer Nukleotidsequenzen die kodierende Sequenz für eine Cytochrom P450 Monooxygenase gemäß der Definition in einem der Ansprüche 7 bis 12 umfasst.
20. Expressionsvektor, umfassend die kodierende Sequenz für eine Cytochrom P450
Monooxygenase gemäß der Definition in einem der Ansprüche 7 bis 12 welche stromaufwärts mit dem starken tac-Promotor und stromabwärts mit dem starken rrnB ribosomalen Terminator operativ verknüpft ist.
EP03766294A 2002-07-26 2003-07-25 Verfahren zur biotransformation von carotinoiden mittels cytochrom p450 monooxygnase Withdrawn EP1527191A1 (de)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
DE10234126 2002-07-26
DE10234126A DE10234126A1 (de) 2002-07-26 2002-07-26 Verfahren zur Biotransformation von Carotinoiden
PCT/EP2003/008199 WO2004013345A1 (de) 2002-07-26 2003-07-25 Verfahren zur biotransformation von carotinoiden mittels cytochrom p450 monooxygnase

Publications (1)

Publication Number Publication Date
EP1527191A1 true EP1527191A1 (de) 2005-05-04

Family

ID=30010431

Family Applications (1)

Application Number Title Priority Date Filing Date
EP03766294A Withdrawn EP1527191A1 (de) 2002-07-26 2003-07-25 Verfahren zur biotransformation von carotinoiden mittels cytochrom p450 monooxygnase

Country Status (8)

Country Link
US (1) US20060063226A1 (de)
EP (1) EP1527191A1 (de)
JP (1) JP2006500922A (de)
CN (1) CN100447251C (de)
AU (1) AU2003253323A1 (de)
CA (1) CA2493935A1 (de)
DE (1) DE10234126A1 (de)
WO (1) WO2004013345A1 (de)

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103589650A (zh) 2005-03-18 2014-02-19 米克罗比亚公司 产油酵母和真菌中类胡萝卜素的产生
WO2008042338A2 (en) 2006-09-28 2008-04-10 Microbia, Inc. Production of carotenoids in oleaginous yeast and fungi
US8101399B2 (en) * 2006-12-12 2012-01-24 The Regents Of The University Of California Artemisinic epoxide and methods for producing same

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
TR199902183T2 (xx) * 1997-03-07 1999-12-21 Novartis Ag Sitokrom P450 monoksigenazlar
EP1238068A1 (de) * 1999-12-08 2002-09-11 California Institute Of Technology Zielgerichtete evolution von biosynthese- und abbauwegen
DE10051175A1 (de) * 2000-10-16 2002-05-02 Basf Ag Cytochrom P450 Monoxygenasen aus thermophilen Bakterien

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO2004013345A1 *

Also Published As

Publication number Publication date
CN100447251C (zh) 2008-12-31
DE10234126A1 (de) 2004-02-05
WO2004013345A1 (de) 2004-02-12
AU2003253323A1 (en) 2004-02-23
CA2493935A1 (en) 2004-02-12
US20060063226A1 (en) 2006-03-23
JP2006500922A (ja) 2006-01-12
CN1671857A (zh) 2005-09-21

Similar Documents

Publication Publication Date Title
EP2692729B1 (de) Verfahren zur biotechnologischen Herstellung von Dihydrochalkonen
JP2022515041A (ja) 新規なアセチルトランスフェラーゼ
EP2410047B9 (de) Oxidoreduktase und deren Verwendung zur Reduktion von Secodionderivaten
EP1196605A1 (de) Neue cytochrom p450-monooxygenasen und deren verwendung zur oxidation von organischen verbindungen
EP1963516B1 (de) Verfahren zur enantioselektiven enzymatischen reduktion von hydroxyketoverbindungen
US20220325290A1 (en) Biosynthesis of eriodictyol
WO2017036495A1 (de) Verfahren zur fermentativen alpha-ionen produktion
DE69526842T3 (de) Ketogruppe-einführendes enzym, dafür kodierende dna und verfahren zur herstellung von ketocarotenoid
US20030207947A1 (en) Production of lutein in microorganisms
EP1326984B1 (de) Cytochrom p450 monooxygenasen aus thermophilen bakterien
EP1527191A1 (de) Verfahren zur biotransformation von carotinoiden mittels cytochrom p450 monooxygnase
WO2017011879A1 (en) Monooxygenases and method for production of hydroxylated cineole
JP2003525626A (ja) 微生物におけるルテインの生産
EP4301864A1 (de) Verfahren zur herstellung von hydroxytyrosol
EP2054510A2 (de) Verfahren zur herstellung von optisch aktiven hydroxyalkylacetaten durch racematspaltung von 4-hydroxy-2-ketonen unter verwendung von baeyer-villiger monooxygenasen
EP3875596A1 (de) Verfahren zur hydroxylierung von steroiden
EP3625352A1 (de) Verfahren zur fermentativende novo
DE112023004151T5 (de) Rekombinante wirtssysteme für die herstellung von aleuritinsäure und verfahren dazu
CN118119716A (zh) 从脂肪酸中生物合成产生大环麝香内酯
Blasco Cloning, expression, purification and characterization of a novel cytochrome P450 isolated from Thermus thermophilus HB27
EP1369475A1 (de) Mikrobiologisches Verfahren zur enantioselektiven (S)-Hydroxylierung
WO2007134817A1 (de) Biokatalysatoren und verfahren zur herstellung von organischen verbindungen
DE10133372A1 (de) Neue Stress-assoziierte Genprodukte aus Ashbya gossypii

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20050228

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LI LU MC NL PT RO SE SI SK TR

AX Request for extension of the european patent

Extension state: AL LT LV MK

RAP1 Party data changed (applicant data changed or rights of an application transferred)

Owner name: BASF SE

17Q First examination report despatched

Effective date: 20080925

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20090203