EP1527191A1

EP1527191A1 - Method for the biotransformation of carotenoids by means of a cytochrome p450 monooxygnase

Info

Publication number: EP1527191A1
Application number: EP03766294A
Authority: EP
Inventors: Markus Matuschek; Bernhard Hauer; Rolf Schmid; Isabelle Melanie Kauffmann; Francesca Blasco; Claudia Schmidt-Dannert
Original assignee: BASF SE
Current assignee: BASF SE
Priority date: 2002-07-26
Filing date: 2003-07-25
Publication date: 2005-05-04
Also published as: CN1671857A; CN100447251C; US20060063226A1; CA2493935A1; AU2003253323A1; JP2006500922A; DE10234126A1; WO2004013345A1

Abstract

The invention relates to a method for the biotransformation of carotenoids using enzymes having a cytochrome P450 monooxygenase activity, especially monooxygenases of thermophilic bacteria, especially the genus Thermus sp.

Description

METHOD FOR BIOTRANSFORMING CAROTINOIDS BY MEANS OF CYTOCHROM P450 MONOXYGENASE

The invention relates to a method for the biotransformation of carotenoids using enzymes with cytochrome P450 monooxygenase activity; in particular monooxygenases from thermophilic bacteria, in particular of the genus Thermus sp. as well as the microorganisms and expression constructs which can be used for such processes.

State of the art

Xanthophylls, such as zeaxanthin and cryptoxanthin, are oxygen-containing carotenoids and, as pigmenting substances or precursors for vitamin A derivatives, are important additives for human or animal nutrition. Xanthophylls are also said to have a health-promoting effect. They strengthen the immune response and have anti-cancer effects due to their anti-oxidative properties, which makes them interesting as nutraceuticals.

Cytochrome P450 monooxygenases have the ability to catalyze technically interesting oxygenation reactions and have therefore been intensively investigated for some time. For example, the cytochrome P450 monooxygenase BM-3 from Bacillus megaterium has been isolated and characterized and is now accessible by a recombinant route (see e.g. DE-A-199 35 115).

This cytochrome P450 monooxygenase usually catalyzes the sub-terminal hydroxylation of long-chain, saturated acids and the corresponding amides and alcohols thereof or the epoxidation of unsaturated long-chain fatty acids or saturated medium-chain fatty acids. The optimal chain length of saturated fatty acids is 14 to 16 carbon atoms.

The structure of the H m domain of P450 BM-3 was determined by X-ray structure analysis. The substrate binding site is in the form of a long tunnel-like opening, which extends from the molecular surface to the heme molecule and is almost exclusively delimited by hydrophobic amino acid residues. The only charged residues on the surface of the heme domain are Arg47 and Tyr51. It is believed that these are involved in binding the carboxylate group of the substrate by forming a hydrogen bond. Through the targeted introduction of point mutations, it is in the meantime managed to expand the substrate spectrum of this enzyme. Thus, shorter and longer-chain carboxylic acids, alkanes, alkenes, cycloalkanes, cycloalkenes and a wide variety of aromatics can now be oxidized by this enzyme (cf. DE-A-199 35 115, 199 55 605, 100 11 723 and 100 14 085).

WO-A-02/33057 discloses cytochrome P450 monooxygenases from thermophilic bacteria which are suitable for the biotransformation of various organic substrates. Carotenoids, e.g. β-carotene is not mentioned as a potential substrate for the cytochrome P450 monooxygenases.

DE-A-199 16 140 describes a carotene hydroxylase from the green algae Haematococcus pluvialis which, among other things, catalyzes the conversion of β-carotene to zeaxanthin and cryptoxanthine. There is no indication of the possible usefulness of cytochrome P450 monooxygenases in the biotransformation of β-carotene.

In order to further improve the industrial applicability of the enzyme class of the cytochrome P450 monooxygenases, it would therefore be desirable to find new fields of application for these.

Brief description of the invention

The object of the present invention was therefore to provide new areas of application for cytochrome P450 monooxygenases.

The above object was achieved by providing a process for the oxidation of carotenoids, which is characterized in that a carotenoid is reacted in the presence of an enzyme with cytochrome P450 monooxygenase activity, which is also capable of carotenoid oxidation, and the oxidation product is isolated

According to the invention, an enzyme with cytochrome P450 monooxygenase activity, which is also capable of carotenoid oxidation, has the effect that a hydroxyl group is introduced on the carbon in position 3 of a β-ionone ring or on the carbon in position 3 of a 4-keto-β-ionone ring.

Examples of suitable carotenoids are ß.ß-carotene (hereinafter referred to as ß-carotene), ß.e-carotene or canthaxanthin. Carotene oxidation in the sense of the invention comprises the single or multiple hydroxylation of the carotene.

Oxidation products obtained according to the invention preferably comprise zeaxanthin, cryptotoxin, adonirubin, astaxanthin, lutein or mixtures thereof.

Detailed description

The invention will now be explained in more detail with reference to the accompanying figures. It shows

1 shows a sequence comparison of P450 from Thermus thermophilus with the heme domain of P450 BM3 from Bacillus megaterium. The heme binding site is shown twice underlined (Cys400 in P450 BM3 is the cysteine residue that coordinates with the iron atom of the prosthetic group). The region that is in contact with the T-end of the fatty acid chain is simply underlined. The degree of correspondence is marked by different symbols * "= identical residues;": "and". "= Similar residues).

FIG. 2 shows the result of a comparative test to determine the thermal stability of P450 BM3 and P450 from Thermus sp. The thermal stability was determined spectrometrically in the wavelength range between 400 and 500 nm via the heme group content.

FIG. 3 shows a reaction scheme for the biotransformation of β-carotene to cryptoxanthin and zeaxanthin according to the invention.

FIG. 4 shows the HPLC elution profile of standard samples containing β-carotene, zeaxanthin or cryptoxanthin.

FIG. 5 illustrates the results of biotransformation experiments with recombinant E. coli strains which, in addition to the carotenoid genes crtE, crtB, crtl and crtY (FIG. 5A), have been transformed with a construct according to the invention pKK_CYP (FIG. 5B); In the presence of pKK_CYP, significant production of zeaxanthin and cryptoxanthin is observed. a) Process for carotenoid oxidation

A first subject of the invention relates in particular to a process for the oxidation of carotenoids, e.g. of β-carotene, wherein a1) a recombinant microorganism which produces an enzyme with cytochrome P450 monooxygenase activity is cultured in a culture medium in the presence of exogenous or intermediate carotenoid; or a2) incubating a carotenoid-containing reaction medium with an enzyme with cytochrome P450 monooxygenase activity; and b) the oxidation product formed or a secondary product thereof is isolated from the medium.

The process according to the invention is carried out under conditions which preferably promote the oxidation of carotenoids, such as β-carotene, but at least do not hinder or even inhibit them. The oxidation is preferably carried out by culturing the recombinant microorganism in the presence of oxygen at a cultivation temperature of at least about 20 ° C, e.g. 20 to 40 ° C, and a pH of about 6 to 9.

It is preferred to use those microorganisms which, by heterologous complementation for carotenoid production, such as for ß-carotene production, are capable and also express an enzyme with cytochrome P450 monooxygenase activity. Heterologically complemented E. coli strains and other microorganisms in which a P450 monooxygenase activity according to the invention (with carotenoid oxidizing activity) can be incorporated in an analogous manner are, for example, in the above-mentioned DE-A-199 16 140, which is hereby expressly incorporated by reference.

According to another preferred variant, carotenoid, e.g. β-carotene, added to a medium as an exogenous substrate and the oxidation carried out by enzymatic reaction of the substrate-containing medium in the presence of oxygen at a temperature of at least about 20 ° C. and a pH of about 6 to 9, the substrate-containing medium also being related may contain an approximately 10 to 100-fold molar excess of reduction equivalents on the substrate.

The above processes can preferably be carried out in bioreactors. The invention therefore relates to such bioreactors comprising at least one monooxygenase according to the invention or at least one recombinant microorganism according to the invention, optionally in each case in immobilized form. If the reaction is carried out with a recombinant microorganism, the cultivation of the microorganisms is preferably first carried out in the presence of oxygen and in a complex medium, such as, for example, TB or LB medium at a cultivation temperature of about 20 ° C. or more, and a pH from about 6 to 9 until sufficient cell density is reached. In order to be able to better control the oxidation reaction, the use of an inducible promoter is preferred. The cultivation is continued after induction of monooxygenase production in the presence of oxygen, for example from 12 hours to 3 days.

If, on the other hand, the reaction according to the invention is carried out with purified or enriched enzyme, the enzyme according to the invention is dissolved or solubilized in a medium containing exogenous substrate (about 0.01 to 10 mM, or 0.05 to 5 mM) and the reaction is carried out, preferably in In the presence of oxygen, at a temperature of about 10 ° C or more, and a pH of about 6 to 9 (such as adjusted with 100 to 200 mM phosphate or Tris buffer), as well as in the presence of a reducing agent, whereby the substrate-containing medium also contains an approximately 10 to 100-fold molar excess of reduction equivalents (electron donor), based on the substrate to be oxidized. The preferred reducing agent is NADPH.

In the substrate oxidation process according to the invention, oxygen contained or added in the reaction medium is reductively enzymatically cleaved. The required reduction equivalents are provided by the added reducing agent (electron donor).

The oxidation product formed can then be processed in a conventional manner, e.g. by extraction and / or chromatography, separated from the medium and cleaned. Suitable methods are known to the person skilled in the art and therefore do not require any special explanation.

Methods in which the cytochrome P450 monooxygenase used has an amino acid sequence which comprises a partial sequence from amino acid residue Pro328 to Glu345 according to SEQ ID NO: 2 are particularly preferred; and optionally also includes a partial sequence from amino acid residue Val216 to Ala227 according to SEQ ID NO: 2.

Methods using a monooxygenase which has an amino acid sequence which comprises at least one further partial sequence which is selected from partial sequences of at least 10 consecutive amino acids are particularly preferred the sequence regions given by the amino acid residues Met1 to Phe327 and Gly346 to Ala389 according to SEQ ID NO: 2; and in particular methods using a monooxygenase having an amino acid sequence that substantially corresponds to SEQ ID NO: 2.

If the method according to the invention is carried out with the aid of microorganisms, a recombinant microorganism is cultivated which carries an expression construct which, under the control of regulatory nucleotide sequences, comprises the coding sequence for a cytochrome P450 monooxygenase as defined above.

Another object of the invention relates to the use of a cytochrome P450 monooxygenase as defined above or a nucleotide sequence coding therefor for the microbiological oxidation of carotenoids, such as e.g. beta-carotene.

b) recombinant microorganisms for performing the method

The invention also relates to recombinant microorganisms which, by heterologous complementation to carotenoid production, e.g. for ß-carotene production, are capable and also express an enzyme with cytochrome P450 monooxygenase activity. Such microorganisms are preferably associated with carotenoid genes, e.g. crtE, crtB, crtl and crtY, heterologously complemented. They are derived in particular from bacteria of the genus Escherichia sp, such as E. coli, in particular E. coli JM 109.

Microorganisms according to the invention are in particular transformed with an expression vector which, under the genetic control of regulatory nucleotide sequences, comprises the coding sequence for a cytochrome P450 monooxygenase as defined above.

A preferred expression vector comprising the coding sequence for a cytochrome P450 monooxygenase as defined above contains the strong tac promoter upstream thereof and the strong rrnB ribosomal terminator operatively linked downstream.

Further usable microorganisms and their preparation for carrying out the method according to the invention are known, for example, from DE-A-199 16 140, to which reference is hereby made. The invention also relates to the use of the P450 enzymes according to the invention with carotenoid, in particular β-carotene, oxidizing activity or a nucleic acid sequence coding therefor for the production of genetically modified organisms, in particular for carrying out the method according to the invention.

The invention further relates to genetically modified organisms, the genetic modification increasing the gene expression of the carotenoid according to the invention, in particular β-carotene oxidizing activity compared to a wild type in the event that the starting organism contains the gene used according to the invention or in the event that the Starting organism does not contain the gene used according to the invention.

A genetically modified organism is understood to mean an organism in which the P450 genes or nucleic acid constructs according to the invention have been inserted, preferably by one of the methods described herein.

The genetically modified organism contains at least one carotenoid, in particular β-carotene oxidizing gene according to the invention or at least one nucleic acid construct according to the invention. Depending on the starting organism, the nucleic acid can be chromosomal or extrachromosomal.

The genetically modified organisms preferably have an altered carotenoid metabolism compared to the wild type.

In principle, all organisms that are able to synthesize carotenoids or xanthophylls are suitable as genetically modified organisms.

Starting organisms which can naturally synthesize xanthophylls are preferred. But starting organisms that are able to synthesize xanthophylls due to the introduction of genes of carotenoid biosynthesis are also suitable.

Starting organisms are understood to mean prokaryotic or eukaryotic organisms such as, for example, microorganisms or plants. Preferred microorganisms are bacteria, yeast, algae or fungi.

Both bacteria can be used as bacteria that are able to introduce carotenoid biosynthesis genes into a carotenoid-producing organism. To synthesize xanthophylls, such as bacteria of the genus ash- richia, which contain, for example, crt genes from Erwinia, as well as bacteria which are capable of synthesizing xanthophylls, such as, for example, bacteria of the genus Erwinia, Agrobacterium, Flavobacterium, Alcaligenes or cyanobacteria of the genus Synechocystis. Preferred bacteria are Escherichia coli, Erwinia herbicola, Erwinia uredo-vora, Agrobacterium aurantiacum, Alcaligenes sp. PC-1, Flavobacterium sp. strain R1534, the Cyanobacterium Synechocystis sp. PCC6803, Paracoccus marcusu, or Paracoccus carotinifaciens.

Preferred yeasts are Candida, Saccharomyces, Hansenula or Pichia.

Preferred fungi are Aspergillus, Trichoderma, Ashbya, Neurospora, Blakeslea, Phycomyces, Fusarium or others in Indian Chem. Engr. Section B. Vol. 37, No. 1, 2 (1995) on page 15, table 6 described mushrooms.

Preferred algae are green algae, such as algae of the genus Haematococcus, Phaedactylum tricornatum, Volvox or Dunaliella. Particularly preferred algae are Haematococcus pluvialis or Dunaliella bardawil.

In a preferred embodiment, plants are used as starting organisms and, accordingly, as genetically modified organisms. Preferred plants are, for example, tagetes, sunflower, arabidopsis, tobacco, red pepper, soy, tomato, eggplant, paprika, carrot, carrot, potato, corn, salads and cabbages, oats, rye, wheat, triticale, millet, rice, alfalfa, flax , Brassicacaen, such as, for example, rape or canola, sugar beet, sugar cane, or woody plants, such as, for example, aspen or yew.

Arabidopsis thaliana, Tagetes erecta, rapeseed, canola, potatoes and oilseeds and typical carotenoid producers such as soya, sunflower, paprika, carrot, pepper or corn are particularly preferred.

c) Enzymes, polynucleotides and constructs

Cytochrome P450 monooxygenases which can be used according to the invention can be isolated in particular from thermophilic bacteria, preferably of the genus Thermus sp., Such as, for example, the species Thermus thermophilus, strain HB27 (deposited with the DSM under the number DSM7039). According to the invention, “thermophilic” bacteria meet the temperature tolerance criteria according to HG Schlegel, Allgemeine Mikrobiologie, Thieme Verlag Stuttgart, 5th edition, page 173, for thermophilic and extremely thermophilic organisms (ie optimum growth at over 40 ° C).

The monooxygenases preferably used according to the invention are preferably characterized by increased temperature stability. In comparison to the P450 BM-3 from Bacillus megate, this is expressed by less activity loss at elevated temperature (e.g. in a range from 30 to 60 ° C, pH 7.5, 25mM Tris / HCl).

According to a preferred embodiment, a cytochrome P450 monooxygenase from the thermophilic bacterium T. thermophilus is used according to the invention. The protein has a molecular weight of about 44 kDa (determined by SDS gel electrophoresis), is soluble and shows an absorption spectrum analogous to that of other P450 enzymes in the reduced state, oxidized state and as a carbonyl adduct. The following identities could be determined from sequence comparisons of this enzyme according to the invention from T. thermophilus and other known P450 enzymes: P450 BM3, 32% identity; CYP119, 29% identity; P450eryF, 31% identity. The enzyme according to the invention shows an extraordinary thermal stability, illustrated by a melting temperature of about 85 ° C, which is 30 ° C higher than that for P450cam.

Another object of the invention relates to the use of polynucleotides which code for a cytochrome P450 monooxygenase, in particular a cytochrome P450 monooxygenase from the genus Thermus sp. in processes for the oxidation of ß-carotene.

Preferred polynucleotides are those which essentially have a nucleic acid sequence in accordance with SEQ ID NO: 1, and the nucleic acid sequences which are complementary thereto and are derived therefrom.

Another object of the invention relates to the use of expression cassettes or of recombinant vectors for the production of recombinant microorganisms which are useful for the reactions according to the invention.

Also included in the invention is the use of “functional equivalents” of the specifically disclosed new P450 monooxygenases for the reactions according to the invention.

“Functional equivalents” or analogs of the specifically disclosed monooxygenases are different enzymes in the context of the present invention, which furthermore the have the desired substrate specificity in the context of the oxidation reaction described above and / or have increased thermal stability compared to P450 BM3, for example at temperatures in the range from about 30 to 60 ° C. and possibly higher temperatures after 30 minutes of treatment in 25 mM Tris / HCl.

According to the invention, “functional equivalents” means in particular mutants which have at least one of the above-mentioned sequence positions a different amino acid than the one specifically mentioned, but nevertheless catalyze one of the above-mentioned oxidation reactions. "Functional equivalents" thus include those by one or more, such as e.g. 1 to 30 or 1 to 20 or 1 to 10, amino acid additions, substitutions, deletions and / or inversions available mutants, the changes mentioned being able to occur in any sequence position as long as they lead to a mutant with the property profile according to the invention. Functional equivalence is particularly given when the reactivity patterns between mutant and unchanged enzyme match qualitatively, i.e. For example, the same substrates can be implemented at different speeds.

“Functional equivalents” encompassed according to the invention have an amino acid sequence that deviates from SEQ ID NO: 2 in at least one position, the change in the sequence preferably only insignificantly affecting the monooxygenase activity, that is to say by no more than about ± 90%, in particular + 50 % or no more than ± 30% This change can be determined using a reference substrate such as β-carotene under standardized conditions (for example 0.1 to 0.5 M substrate, pH range 6 to 8, in particular 7 ; T = 30 to 70 ° C) can be determined.

“Functional equivalents” in the above sense are also precursors of the described polypeptides and functional derivatives and salts of the polypeptides. The term “salts” means both salts of carboxyl groups and acid addition salts of amino groups of the protein molecules according to the invention. Salts of carboxyl groups can be prepared in a manner known per se and include inorganic salts, such as, for example, sodium, calcium, ammonium, iron and zinc salts, and salts with organic bases, such as, for example, amines, such as triethanolamine, arginine, lysine , Piperidine and the like. Acid addition salts, such as, for example, salts with mineral acids, such as hydrochloric acid or sulfuric acid, and salts with organic acids, such as acetic acid and oxalic acid, are also a subject of the invention. "Functional derivatives" of polypeptides according to the invention can also be prepared on functional amino acid side groups or on their N- or C-terminal end using known techniques. Such derivatives include, for example, aliphatic esters of carboxylic acid groups, amides of carboxylic acid groups, obtainable by reaction with ammonia or with a primary or secondary amine, N-acyl derivatives of free amino groups, produced by reaction with acyl groups, or O-acyl derivatives of free hydroxyl groups, produced by reaction with acyl groups.

“Functional equivalents” encompassed according to the invention are homologs to the specifically disclosed proteins. These have at least 60%, preferably at least 75%, in particular at least 85%, such as 90%, 95% or 99%, homology to one of the specifically disclosed Sequences calculated according to the algorithm of Pearson and Lipman, Proc. Natl. Acad, Sei. (USA) 85 (8), 1988, 2444-2448.

Homologs of the proteins or polypeptides of the invention can be generated by mutagenesis, e.g. by point mutation or shortening of the protein.

Homologs of the protein of the invention can be obtained by screening combinatorial libraries of mutants, e.g. Shortening mutants can be identified. For example, a varied bank of protein variants can be generated by combinatorial mutagenesis at the nucleic acid level, e.g. by enzymatically ligating a mixture of synthetic oligonucleotides. There are a variety of methods that can be used to generate banks of potential homologs from a degenerate oligonucleotide sequence. Chemical synthesis of a degenerate gene sequence can be performed in an automated DNA synthesizer, and the synthetic gene can then be ligated into an appropriate expression vector. The use of a degenerate set of genes makes it possible to provide all the sequences in a mixture which encode the desired set of potential protein sequences. Methods for the synthesis of degenerate oligonucleotides are known to the person skilled in the art (eg Narang, SA (1983) Tetra-hedron 39: 3; Itakura et al. (1984) Annu. Rev. Biochem. 53: 323; Itakura et al., (1984) Science 198: 1056; Ike et al. (1983) Nucleic Acids Res. 11: 477).

"Functional equivalents" naturally also include P450 monooxygenases which are accessible from other organisms, for example from bacteria other than those specifically mentioned here, and naturally occurring variants. For example, regions of homologous sequence regions can be determined by sequence comparison and, based on the specific requirements of the invention, equivalent enzymes can be determined. The invention also relates to the use of nucleic acid sequences (single and double stranded DNA and RNA sequences) coding for one of the above monooxygenases and their functional equivalents for carrying out the above methods. Further nucleic acid sequences according to the invention are derived from SEQ ID NO: 1 and differ from them by addition, substitution, insertion or detection of single or multiple nucleotides, but continue to code for a monooxygenase with the desired property profile.

All nucleic acid sequences mentioned herein can be produced in a manner known per se by chemical synthesis from the nucleotide building blocks, such as, for example, by fragment condensation of individual overlapping, complementary nucleic acid building blocks of the double helix. The chemical synthesis of oligonucleotides can be carried out, for example, in a known manner using the phosphoramidite method (Voet, Biochemie, 2nd edition, Wiley Press New York, pages 896-897). The attachment of synthetic oligonucleotides and the filling of gaps with the aid of the Klenow fragment of DNA polymerase and ligation reactions as well as general cloning methods are described in Sambrook et al. (1989) Molecular Cloning: A laboratory manual, Cold Spring Harbor Laboratory Press.

Also included according to the invention are those nucleic acid sequences which comprise so-called silent mutations or which have been modified in accordance with the codon usage of a specific source or host organism, in comparison to a specifically named sequence, as well as naturally occurring variants, such as e.g. Splice variants, of which. Sequences obtainable also by conservative nucleotide substitutions (i.e. the amino acid in question is replaced by an amino acid of the same charge, size, polarity and / or solubility).

Furthermore, the invention also encompasses nucleic acid sequences which hybridize with the above-mentioned coding sequences or are complementary thereto. These polynucleotides can be found when screening genomic or cDNA libraries and, if appropriate, can be amplified therefrom using suitable primers by means of PCR and then isolated, for example, using suitable probes. Another possibility is the transformation of suitable microorganisms with polynucleotides or vectors according to the invention, the multiplication of the microorganisms and thus the polynucleotides and their subsequent isolation. In addition, polynucleotides according to the invention can also be synthesized chemically. The property of being able to “hybridize” to polynucleotides means the ability of a poly- or oligonucleotide to bind to an almost complementary sequence under stringent conditions, while under these conditions non-specific bindings between non-complementary partners are avoided. For this purpose, the sequences should be closed 70-100%, preferably 90-100%, of complementary nature The property of complementary sequences to be able to bind specifically to one another is made for example in the Northern or Southern blot technique or in primer binding in PCR or RT-PCR Oligonucleotides with a length of more than 30 base pairs are usually used for this purpose, and stringent conditions mean, for example in Northern blot technology, the use of a washing solution which is 50-70 ° C., preferably 60-65 ° C., for example 0.1x SSC -Buffer with 0.1% SDS (20x SSC: 3M NaCI, 0.3M Na citrate, pH 7.0) for the elution nonspecific hybridisi first cDNA probes or oligonucleotides. As mentioned above, only highly complementary nucleic acids remain bound to one another.

These nucleic acids are preferably incorporated into expression constructs containing, under the genetic control of regulatory nucleic acid sequences, a nucleic acid sequence coding for an enzyme according to the invention; and vectors comprising at least one of these expression constructs. Such constructs according to the invention preferably comprise a promoter 5'-upstream of the respective coding sequence and a terminator sequence 3'-downstream and, if appropriate, further customary regulatory elements, in each case operatively linked to the coding sequence. An “operative linkage” is understood to mean the sequential arrangement of promoter, coding sequence, terminator and optionally further regulatory elements in such a way that each of the regulatory elements can fulfill its function in the expression of the coding sequence as intended. Examples of sequences which can be linked operatively are Targeting sequences, as well as translation enhancers, enhancers, polyadenylation signals, etc. Other regulatory elements include selectable markers, amplification signals, origins of replication and the like.

In addition to the artificial regulatory sequences, the natural regulatory sequence can still be present before the actual structural gene. This natural regulation can possibly be switched off by genetic modification and the expression of the genes increased or decreased. The gene construct can, however, also have a simpler structure, ie no additional regulation signals are inserted in front of the structural gene and the natural promoter with its regulation is not removed. Instead, the natural regulatory sequence is mutated so that regulation no longer takes place and the Gene expression is increased or decreased. The nucleic acid sequences can be contained in one or more copies in the gene construct.

Examples of useful promoters are: cos, tac, trp, tet, trp-tet, Ipp, lac, Ipp-lac, laclq, T7, T5, T3, gal, trc -, ara, SP6, Λ-PR or /.-PL promoter, which are advantageously used in gram-negative bacteria; as well as the gram-positive promoters amy and SPO2, the yeast promoters ADC1, MFσ, AC, P-60, CYC1, GAPDH or the plant promoters CaMV / 35S, SSU, OCS, Iib4, usp, STLS1, B33, not or the ubiquitin - or phaseolin promoter. The use of inducible promoters, such as, for example, light and in particular temperature-inducible promoters, such as the P _r P _r promoter, is particularly preferred.

In principle, all natural promoters with their regulatory sequences can be used. In addition, synthetic promoters can also be used advantageously.

The regulatory sequences mentioned are intended to enable the targeted expression of the nucleic acid sequences and the protein expression. Depending on the host organism, this can mean, for example, that the gene is only expressed or overexpressed after induction, or that it is expressed and / or overexpressed immediately.

The regulatory sequences or factors can preferably have a positive influence on the expression and thereby increase or decrease it. Thus, the regulatory elements can advantageously be strengthened at the transcription level by using strong transcription signals such as promoters and / or "enhancers". In addition, an increase in translation is also possible, for example, by improving the stability of the mRNA.

An expression cassette is produced by fusing a suitable promoter with a suitable monooxygenase nucleotide sequence and a terminator or polyadenylation signal. Common recombination and cloning techniques are used for this, as described, for example, in T. Maniatis, EF Fritsch and J. Sambrook, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1989) and in TJ Silhavy, ML Berman and LW Enquist, Experiments with Gene Fusions, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1984) and in Ausubel, FM et al., Curent Protocols in Molecular Biology, Greene Publishing Assoc. and Wiley Interscience (1987). For expression in a suitable host organism, the recombinant nucleic acid construct or gene construct is advantageously inserted into a host-specific vector which enables optimal expression of the genes in the host. Vectors are well known to those skilled in the art and can be found, for example, in "Cloning Vectors" (Pouwels PH et al., Ed., Elsevier, Amsterdam-New York-Oxford, 1985). In addition to plasmids, vectors are also understood to mean all other vectors known to the person skilled in the art, such as phages, viruses such as SV40, CMV, baculovirus and adenovirus, transposons, IS elements, phasmids, cosmids, and linear or circular DNA. These vectors can be replicated autonomously in the host organism or replicated chromosomally.

The following may be mentioned as examples of suitable expression vectors:

Common fusion expression vectors such as pGEX (Pharmacia Biotech Ine; Smith, DB and Johnson, KS (1988) Gene 67: 31-40), pMAL (New England Biolabs, Beverly, MA) and pRIT 5 (Pharmacia, Piscataway, NJ) which glutathione-S-transferase (GST), maltose E-binding protein or protein A is fused to the recombinant target protein.

Non-fusion protein expression vectors such as pTrc (Amann et al., (1988) Gene 69: 301-315) and pET 11 d (Studier et al. Gene Expression Technology: method in Enzymology 185, Academic Press, San Diego, California) (1990) 60-89).

Yeast expression vector for expression in the yeast S. cerevisiae, such as pYepSed (Baldari et al., (1987) Embo J. 6: 229-234), pMF (Kurjan and Herskowitz (1982) Cell 30: 933-943), pJRY88 (Schultz et al. (1987) Gene 54: 113-123) and pYES2 (Invitrogen Corporation, San Diego, CA). Vectors and methods of constructing vectors suitable for use in other fungi such as filamentous fungi include those described in detail in: van den Hondel, C.A.M.J.J. & Punt, P.J. (1991) "Gene transfer Systems and vector development for filamentous fungi", in: Applied Molecular Genetics of Fungi, J.F. Peberdy et al., Eds., Pp. 1-28, Cambridge University Press: Cambridge.

Baculovirus vectors available for expression of proteins in cultured insect cells (e.g. Sf9 cells) include the pAc series (Smith et al., (1983) Mol. Cell Biol .. 3: 2156-2165) and pVL series (Lucklow and Summers (1989) Virology 170: 31-39).

Plant expression vectors, such as those described in detail in: Becker, D., Kemper, E., Schell, J. and Masterson, R. (1992) "New plant binary vectors with selectable markers located proximal to the left border" , Plant Mol. Biol. 20: 1195-1197; and Bevan, MW (1984) "Binary Agrobacterium vectors for plant transformation", Nucl. Acids Res. 12: 8711-8721.

Mammalian expression vectors such as pCDMδ (Seed, B. (1987) Nature 329: 840) and pMT2PC (Kaufman et al. (1987) EMBO J. 6: 187-195).

Further suitable expression systems for prokaryotic and eukaryotic cells are described in chapters 16 and 17 by Sambrook, J., Fritsch, E.F. and Maniatis, T., Molecular cloning: A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989.

With the help of the expression constructs or vectors according to the invention, recombinant microorganisms can be produced which, for example, have been transformed with at least one vector according to the invention and can be used to produce the enzymes used according to the invention and / or to carry out the method according to the invention. The recombinant constructs according to the invention described above are advantageously introduced and expressed in a suitable host system. Common cloning and transfection methods known to the person skilled in the art, such as, for example, co-precipitation, protoplast fusion, electroporation, retroviral transfection and the like, are preferably used here in order to bring the nucleic acids mentioned into expression in the respective expression system. Suitable systems are described, for example, in Curent Protocols in Molecular Biology, F. Ausubel et al., Ed., Wiley Interscience, New York 1997.

In principle, all organisms which enable expression of the nucleic acids according to the invention, their allele variants, their functional equivalents or derivatives are suitable as host organisms. Host organisms are, for example, bacteria, fungi, yeasts, plant or animal cells. Preferred organisms are bacteria, such as those of the genera Escherichia, such as. B. Escherichia coli, Streptomyces, Bacillus or Pseudomonas, eukaryotic microorganisms such as Saccharomyces cerevisiae, Aspergillus, Blakeslea, Phycomyces, higher eukaryotic cells from animals or plants, for example Sf9 or CHO cells.

Successfully transformed organisms can be selected using marker genes, which are also contained in the vector or in the expression cassette. Examples of such marker genes are genes for antibiotic resistance and for enzymes which catalyze a coloring reaction which stains the transformed cell. These can then be be selected using automatic cell sorting. Microorganisms which have been successfully transformed with a vector and carry an appropriate antibiotic resistance gene (for example G418 or hygromycin) can be selected using appropriate antibiotic-containing media or nutrient media. Marker proteins that are presented on the cell surface can be used for selection by means of affinity chromatography.

The combination of the host organisms and the vectors which match the organisms, such as plasmids, viruses or phages, such as, for example, plasmids with the RNA polymerase / promoter system, the phages λ or μ or other temperate phages or transposons and / or further advantageous regulatory ones Sequences form an expression system. For example, the term “expression system” means the combination of mammalian cells, such as CHO cells, and vectors, such as pcDNA3neo vector, which are suitable for mammalian cells.

If desired, the gene product can also be expressed in transgenic organisms such as transgenic animals, such as in particular mice or sheep or transgenic plants.

The monooxygenases which can be used according to the invention can also be produced recombinantly, in which case a monooxygenase-producing microorganism is cultivated, where appropriate the expression of the monooxygenase is induced and the monooxygenase is isolated from the culture. The monooxygenase can thus also be produced on an industrial scale, if this is desired.

The recombinant microorganism can be cultivated and fermented by known methods. Bacteria can be propagated, for example, in TB or LB medium and at a temperature of 20 to 40 ° C and a pH of 6 to 9. Suitable cultivation conditions are described in detail, for example, in T. Maniatis, E.F. Fritsch and J. Sambrook, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1989).

If the monooxygenase is not secreted into the culture medium, the cells are then disrupted and the enzyme is obtained from the lysate by known protein isolation methods. The cells can be disrupted either by high-frequency ultrasound, by high pressure, such as in a French pressure cell, by osmolysis, by the action of detergents, lytic enzymes or organic solvents, by homogenizers or by a combination of several of the processes listed. Purification of the monooxygenase can be achieved with known chromatographic methods, such as molecular sieve chromatography (gel filtration), such as Q-Sepharose chromatography, ion exchange chromatography and hydrophobic chromatography, and with other conventional methods such as ultrafiltration, crystallization, salting out, dialysis and native gel electrophoresis. Suitable methods are described, for example, in Cooper, TG, Biochemical Working Methods, Verlag Walter de Gruyter, Berlin, New York or in Scopes, R., Protein Purification, Springer Verlag, New York, Heidelberg, Berlin.

To isolate the recombinant protein, it is particularly advantageous to use vector systems or oligonucleotides which extend the DNA by certain nucleotide sequences and thus code for modified polypeptides or fusion proteins which serve for easier purification. Such suitable modifications are, for example, so-called "tags" functioning as anchors, such as the modification known as hexa-histidine anchors, or epitopes that can be recognized as antigens of antibodies (described, for example, in Harlow, E. and Lane, D., 1988, Antibodies: A Laboratory Manual. Cold Spring Harbor (NY) Press ). These anchors can be used to attach the proteins to a solid support, e.g. a polymer matrix, which can be filled, for example, in a chromatography column, or can be used on a microtiter plate or on another support.

At the same time, these anchors can also be used to recognize the proteins. To recognize the proteins, customary markers, such as fluorescent dyes, enzyme markers which form a detectable reaction product after reaction with a substrate, or radioactive markers, can be used alone or in combination with the anchors to derivatize the proteins.

The following non-limiting examples describe specific embodiments of the invention. Examples

General experimental information:

a) General cloning procedures

The cloning steps carried out in the context of the present invention, e.g. Restriction cleavages, agarose gel electrophoresis, purification of DNA fragments, transfer of nucleic acids to nitrocellulose and nylon membranes, linking of DNA fragments, transformation of E. coli cells, cultivation of bacteria, multiplication of phages and sequence analysis of recombinant DNA were carried out as in Sambrook et al. (1989) op. Cit. described.

b) Polymerase chain reaction (PCR)

PCR was carried out according to the standard protocol with the following standard approach:

8 μl dNTP mix (200μM), 10 μl Taq polymerase buffer (10 ×) without MgCI ₂ , 8 μl MgCI ₂ (25mM), 1 μl primer (0.1 μM) each, 1 μl DNA to be amplified, 2, 5 U Taq polymerase (MBI Fermentas, Vilnius, Lithuania), ad 100 μl demineralized water.

c) Cultivation of E. coli

Recombinant E. coli strains DH5σ were cultivated in LB-Amp medium (trypton 10.0 g, NaCl 5.0 g, yeast extract 5.0 g, ampicillin 100 g / ml H ₂ 0 ad 1000 ml) at 37 ° C. For this purpose, one colony was transferred from an agar plate into 5 ml LB-Amp using an inoculation loop. After culturing for about 18 hours at a shaking frequency of 220 rpm, 400 ml of medium were inoculated with 4 ml of culture in a 2 l flask. P450 expression was induced in E. coli after an OD578 value of between 0.8 and 1.0 was reached by inducing heat shock at 42 ° C. for three to four hours.

d) cell disruption

Cell pellets with a bio-moist mass of up to 15 g of E. coli DH5 were thawed on ice and in 25 ml of potassium phosphate buffer (50 mM, pH 7.5, 1 mM EDTA) or Tris / HCl buffer (50 mM, pH 7.5 , 1 mM EDTA) suspended. Using three-minute ultrasound treatment (Branson

Sonifier W250, (Dietzenbach, Germany), power output 80 W, working interval 20%) the E. coli cell suspension cooled on ice was digested. Before protein purification, the cell suspension was centrifuged at 32,500 g for 20 min and filtered through a 0.22 mm Sterivex-GP filter (Millipore), giving a crude extract.

Example 1:

Cloning and expression of P450 from Thermus thermophilus HB27 and the His-tag derivatives thereof

1. Cloning of P450 from Thermus thermophilus HB27

A clone (TTHB66) comprising the coding P450 sequence (hereinafter also referred to as the CYP175A1 gene) was obtained from a Thermus gene bank. The coding P450 sequence (blunt ended) was cloned into the HinclI site of the plasmid pTZ19R (MBI Fermentas). The coding P450 sequence was amplified from the plasmid TTHB66 thus obtained with the aid of PCR. The following primers were used:

a) 30-mer sense oligonucleotide containing the Ndel interface (printed in italics) as part of the P450-ATG start codon: 5 ^, -CG GCTCΛ7 / .ΓG GCGCCTTTCCCTGAG (SEQ ID NO: 7).

b) 30-mer antisense oligonucleotide containing the EcoRI site (italics) as part of the TGA stop codon: 5'-GCGiAATrCACGCCCGCACCTCCTCCCTAGG (SEQ ID NO: 8).

The resulting fragment was cloned into the Ndel sites of the vector pCYTEXPl (plasmid with the temperature-inducible P _R P promoter system of bacteriophage 8 (Belev TN, et al., Plasmid (1991) 26: 147)) and in E. coli DH- 5α (Clontech, Heidelberg) transformed.

E. coli DH-5α, containing the plasmid of interest, was inoculated in LB medium in the presence of ampicillin and the culture was incubated at 37 ° C. overnight. A portion of the sample was inoculated into fresh LB medium (in the presence of ampicillin) and the resulting culture was cultured at 37 ° C to OD = 0.9. Induction was carried out by increasing the temperature to 42 ° C. over a period of 24 hours. The change in the P450 content during expression was determined on the basis of measurements of the CO difference spectrum.

2. Cloning of P450 from Thermus thermophilus HB27 with N-terminal His-tag

The coding P450 sequence was amplified by PCR from the plasmid TTHB66 using the following primers:

(a) 50-mer sense oligonucleotide containing the Ndel interface (printed in italics) as part of the P450 ATG start codon and the tag-coding codons (underlined): δ'-CGAAGCTCv TA 7GCATCACCATCATCATCACAAGCGCCTTTC (SEQ ID NO: 9);

(b) 30-mer antisense oligonucleotide containing the EcoRI site (italics) as part of the TGA stop codon:

5'-GCGAA77CACGCCCGCACCTCCTCCCTAGG (SEQ ID N0: 8).

The resulting fragment was cloned into the Ndel and EcoRI sites of the vector p-CYTEXP1 and expressed in E. coli DH-5.

E. coli DH-5α containing the plasmid of interest was inoculated in LB medium in the presence of ampicillin and the culture was incubated overnight at 37 ° C. A portion of the sample was inoculated into fresh LB medium (in the presence of ampicillin) and the resulting culture was cultured at 37 ° C to OD = 0.9. Induction was carried out by increasing the temperature to 42 ° C. over a period of 24 hours. The change in the P450 content during expression was determined on the basis of measurements of the CO difference spectrum.

3. Cloning of P450 from Thermus thermophilus HB27 with C-terminal His-tag

The coding P450 sequence was amplified by PCR from plasmid TTHB66 using the following primers:

(a) 30-mer sense oligonucleotide containing the Ndel interface (italics) as part of the P450 ATG start codon: 5'-CGAAGCTCΛΓATGAAGCGCCTTTCCCTGAG (SEQ ID NO: 7)

(b) 47-mer antisense oligonucleotide containing the EcoRI site (printed in italics) as part of the TGA stop codon and the underlined tag-coding partial sequence: 5'-CGGAATTCAGTGATGATGATGGTGATGCGCCCGCACCTCCTC (SEQ ID NO: 10).

The resulting fragment was cloned into the Ndel and EcoRI sites of the vector p-CYTEXP1 and expressed in E. coli DH-5α.

Example 2: Determination of the thermal stability of P450 from Thermus thermophilus compared to P450 BM3

The two enzymes were each incubated for 30 minutes in Tris / HCl buffer pH 7.5, 25mM at different temperatures. The batches were then cooled and the P450 concentration was determined spectrometrically. The results are summarized in the following table and shown graphically in FIG. 2.

As can be seen from the test results, the enzyme according to the invention has a significantly higher temperature stability after 30 minutes of incubation at all temperatures.

Example 3:

Production of an expression vector for cytochrome P450 monooxygenase from T. thermophilus HB 27

Plasmid DNA (clone TTHB66) containing the coding sequence of the cytochrome P450 monooxygenase (CYP175A1 gene) was assumed. Using the polymerase chain reaction (PCR), restriction sites EcoRI and Pstl were introduced into the CYP175A1 gene. The gene was amplified using the following primers: 5'-CCGGAATTCATGAAGCGCCTTTCCCTGAGG; (SEQ ID NO: 11) 5-CCAATGCATTGGTTCTGCAGTCAGGCCCGCACCTCCTCCCTAGG (SEQ ID NO: 12)

The new restriction interfaces are underlined. The reaction mixture for the PCR consisted of template DNA (100 ng), 2.5 U pfu DNA polymerase (Stratagene), 5 μl reaction buffer, 5 μl DMSO, 0.4 μmol of each oligonucleotide, 400 μmol dNTPs and H ₂ O ad 50 ul. The following PCR cycle parameters were set: 95 ° C, 1 minute; (95 ° C, 1 minute; 53 ° C, 1 minute 30 seconds; 68 ° C, 1 minute 30 seconds) 30 cycles; 68 ° C, 4 minutes. The CYP175A1 gene sequence was checked by DNA sequencing.

After restriction digestion of the PCR product, the CYP175A1 gene was cloned into the EcoRI and PstI sites of the plasmid pKK 223-3 (Amersham Pharmacia). pKK 223-3 contains the strong tac promoter upstream of a multiple cloning site and the strong rrnB ribosomal terminator downstream thereof to control protein expression. The plasmid obtained is called pKK_CYP.

Example 4:

Biotransformation of ß-carotene in recombinant E. coli strains

For the β-carotene biotransformation, recombinant E. coli strains were produced which were capable of producing β-carotene by heterologous complementation.

Strains of E.coli JM109 were used as host cells for the complementation experiments with the plasmids pACYC_Y and pKK_CYP (prepared according to Example 3). The

Plasmid pACYC_Y carries the carotenogen genes crtE, crtB, crtlC14 and crtY, isolated from E. uredovora. The genes mentioned were each cloned in with their own lac promoter in order to enable expression. The production of this Plamids is described in the

Dissertation by I. Kauffmann, increase in microbial diversity of carotenoids, June 2002, Institute for Technical Biology, University of Stuttgart. The precursor construct containing the carotinogenic genes crtE, crtB, crtlC14 is described in Schmidt-Dannert (2000), Curr. O-pin. Biotechnol. 11, 255-261.

Further details on heterologous complementation are also described, for example, in Ruther, A. Appl. Microbiol. Biotechnol. (1997) 48: 162-167; Sandmann, G., Trends in Plant Science (2001) 6: 1, 14-17 and Sandmann, G. et al., TIBTECH (1999), 17: 233-237. Reference is hereby expressly made to the disclosure of the above-mentioned publications.

Cultures of E.coli JM109 were transformed in a manner known per se with the plasmids pACYC_Y and pKK_CYP and cultivated in LB medium at 30 ° C. and 37 ° C. for two days. Ampicillin (1 μg / ml) chloramphenicol (50 μg / ml) and isopropyl-β-thiogalactoside (1 mmol) were added in the usual way. As a comparison sample, an E. coli strain JM109 was only transformed with the plasmid pACYC_Y and cultured in the same way.

To isolate the carotenoids from the recombinant E. coli strains, the cells were

Acetone and then extracted with hexane. The combined extracts were partitioned with water. The organic phase was isolated, evaporated to dryness and dried over a

DXSIL C8 column separated with water / acetonitrile (5:95) using HPLC. The following

Process conditions were set:

Separation column: DXSIL C8, 3μm, 120A, 2.1 x 100mm flow rate: 0.35mL / min

Eluents: isocratic water / acetonitrile 5/95 detection: UV_VIS_1.wavelength = 453nm

UV_VI S_1. Band width = 4nm

3DFIELD.Max. Wavelength = 600nm

3DField. Min. Wavelength = 190nm

3DFIELD.Ref. Wavelength = 399nm 3DFIELD.Ref. Bandwidth = 40nm

The spectra were determined directly from the elution peaks using a diode array detector. The isolated substances were identified by their absorption spectra and their retention times in comparison to standard samples.

Chromatograms of the standards for β-carotene, zeaxanthin and cryptoxanthin are shown in the attached FIGS. 4A to 4C. FIG. 5 A shows the chromatographic analysis of a sample obtained from the E. coli strain transformed with the plasmid pACYC_Y. It turns out that due to the heterologous complementation it is capable of producing ß-carotene. FIG. 5B shows the chromatogram of a heterologously complemented E. coli strain produced according to the invention and additionally transformed with the plasmid pKK_CYP. Surprisingly, it is shown here that, in addition to β-carotene, significant amounts of the corresponding hydroxylation products zeaxanthin and cryptoxanthin can be detected.

Claims

claims

1. Process for the oxidation of carotenoids, characterized in that a carotenoid is reacted with cytochrome P450 monooxygenase activity in the presence of an enzyme and the oxidation product is isolated.

2. The method according to claim 1, characterized in that a1) a recombinant microorganism which produces an enzyme with cytochrome P450 monooxygenase activity is cultured in a culture medium in the presence of exogenous or intermediate-formed β-carotene; or a2) a β-carotene-containing reaction medium with an enzyme with cytochrome

P450 monooxygenase activity incubated; and b) the oxidation product formed or a secondary product thereof is isolated from the medium.

3. The method according to claim 2, characterized in that the oxidation product comprises zeaxanthin, cryptoxanthin, adonirubin, astaxanthin, lutein or mixtures thereof.

4. The method according to any one of the preceding claims, characterized in that one carries out the oxidation by culturing the microorganism in the presence of oxygen at a cultivation temperature of at least about 20 ° C and a pH of about 6 to 9.

5. The method according to claim 4, characterized in that the microorganism is capable of producing carotenoids by heterologous complementation and also expresses an enzyme with cytochrome P450 monooxygenase activity.

6. The method according to any one of claims 1 to 3, characterized in that a carotenoid is added as an exogenous substrate to a medium and the oxidation by enzymatic reaction of the substrate-containing medium in the presence of oxygen at a temperature of at least about 20 ° C and one Carries out a pH of about 6 to 9, the substrate-containing medium also containing an approximately 10 to 100-fold molar excess of reduction equivalents, based on the substrate.

7. The method according to any one of the preceding claims, characterized in that the cytochrome P450 monooxygenase has an amino acid sequence which comprises a partial sequence of amino acid residue Pro328 to Glu345 according to SEQ ID NO: 2.

8. The method according to any one of the preceding claims, characterized in that the monooxygenase has an amino acid sequence which also comprises a partial sequence of amino acid residue Val216 to Ala227 according to SEQ ID NO: 2.

9. The method according to any one of the preceding claims, characterized in that the monooxygenase has an amino acid sequence which comprises at least one further partial sequence which is selected from partial sequences of at least 10 consecutive amino acids from those by the amino acid residues Met1 to Phe327 and Gly346 to Ala389 according to SEQ ID NO: 2 specified sequence ranges.

10. The method according to any one of the preceding claims, characterized in that the monooxygenase has an amino acid sequence which corresponds essentially to SEQ ID NO: 2.

11. The method according to any one of the preceding claims, characterized in that a cytochrome P450 monooxygenase from bacteria of the genus Thermus sp. used.

12. The method according to claim 11, characterized in that one is a cytochrome

P450 monooxygenase from a bacterium of the species Thermus thermophilus is used.

13. The method according to any one of the preceding claims, wherein one cultivates a recombinant microorganism which carries an expression construct which under the

Control of regulatory nucleotide sequences comprises the coding sequence for a cytochrome P450 monooxygenase as defined in any one of claims 7 to 12.

14. Use of a cytochrome P450 monooxygenase as defined in one of claims 7 to 12 or a nucleotide sequence coding therefor for the microbiological oxidation of carotenoids.

15. Recombinant microorganism which is capable of producing β-carotene by heterologous complementation and which also expresses an enzyme with cytochrome P450 monooxygenase activity.

16. Microorganism according to claim 15, which is heterologously complemented with carotenogenic genes.

17. Microorganism according to one of claims 15 and 16, derived from bacteria of the genus Escherichia sp.

18. Microorganism according to claim 17, derived from E. coli, in particular E. coli JM 109.

19. Microorganism according to one of claims 15 to 18, transformed with an expression vector which, under the genetic control of regulatory nucleotide sequences, comprises the coding sequence for a cytochrome P450 monooxygenase as defined in one of claims 7 to 12.

20. Expression vector comprising the coding sequence for a cytochrome P450

Monooxygenase as defined in any one of claims 7 to 12 which is operatively linked upstream to the strong tac promoter and downstream to the strong rrnB ribosomal terminator.