EP1517606A2 - Acide nucleique et proteine correspondante appelee 193p1e1b utile dans le traitement et la detection du cancer - Google Patents

Acide nucleique et proteine correspondante appelee 193p1e1b utile dans le traitement et la detection du cancer

Info

Publication number
EP1517606A2
EP1517606A2 EP02797238A EP02797238A EP1517606A2 EP 1517606 A2 EP1517606 A2 EP 1517606A2 EP 02797238 A EP02797238 A EP 02797238A EP 02797238 A EP02797238 A EP 02797238A EP 1517606 A2 EP1517606 A2 EP 1517606A2
Authority
EP
European Patent Office
Prior art keywords
protein
193p1e1b
cancer
amino acid
peptide
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP02797238A
Other languages
German (de)
English (en)
Other versions
EP1517606A4 (fr
Inventor
Arthur B. Raitano
Pia M. Challita-Eid
Mary Faris
Rene S. Hubert
Wangmao Ge
Aya Jakobovits
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Agensys Inc
Original Assignee
Agensys Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Agensys Inc filed Critical Agensys Inc
Publication of EP1517606A2 publication Critical patent/EP1517606A2/fr
Publication of EP1517606A4 publication Critical patent/EP1517606A4/fr
Withdrawn legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/30Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants from tumour cells
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • A61P35/02Antineoplastic agents specific for leukemia
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • A61P35/04Antineoplastic agents specific for metastasis
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/505Medicinal preparations containing antigens or antibodies comprising antibodies
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/30Immunoglobulins specific features characterized by aspects of specificity or valency
    • C07K2317/34Identification of a linear epitope shorter than 20 amino acid residues or of a conformational epitope defined by amino acid residues
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/136Screening for pharmacological compounds
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/158Expression markers
    • YGENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02ATECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Definitions

  • the invention described herein relates to a gene and its encoded protein, termed 193P1E1B, expressed in certain cancers, and to diagnostic and therapeutic methods and compositions useful in the management of cancers that express 193P1E1B.
  • Cancer is the second leading cause of human death next to coronary disease. Worldwide, millions of people die from cancer every year. In the United States alone, as reported by the American Cancer Society, cancer causes the death of well over a half-million people annually, with over 1.2 million new cases diagnosed per year. While deaths from heart disease have been declining significantly, those resulting from cancer generally are on the rise. In the early part of the next century, cancer is predicted to become the leading cause of death.
  • carcinomas of the lung, prostate, breast, colon, pancreas, and ovary represent the primary causes of cancer death. These and virtually all other carcinomas share a common lethal feature. With very few exceptions, metastatic disease from a carcinoma is fatal. Moreover, even for those cancer patients who initially survive their primary cancers, common experience has shown that their lives are dramatically altered. Many cancer patients experience strong anxieties driven by the awareness of the potential for recurrence or treatment failure. Many cancer patients experience physical debilitations following treatment. Furthermore, many cancer patients experience a recurrence.
  • prostate cancer is the fourth most prevalent cancer in men. In North America and Northern Europe, it is by far the most common cancer in males and is the second leading cause of cancer death in men. In the United States alone, well over 30,000 men die annually of this disease - second only to lung cancer. Despite the magnitude of these figures, there is still no effective treatment for metastatic prostate cancer. Surgical prostatectomy, radiation therapy, hormone ablation therapy, surgical castration and chemotherapy continue to be the main treatment modalities. Unfortunately, these treatments are ineffective for many and are often associated with undesirable consequences.
  • PSA serum prostate specific antigen
  • the LAPC Los Angeles Prostate Cancer
  • SCID severe combined immune deficient mice
  • More recently identified prostate cancer markers include PCTA-1 (Su etal., 1996, Proc. Natl. Acad. Sci.
  • PSM prostate-specific membrane
  • PSCA prostate stem cell antigen
  • Renal cell carcinoma accounts for approximately 3 percent of adult malignancies. Once adenomas reach a diameter of 2 to 3 cm, malignant potential exists. In the adult, the two principal malignant renal tumors are renal cell adenocarcinoma and transitional cell carcinoma of the renal pelvis or ureter. The incidence of renal cell adenocarcinoma is estimated at more than 29,000 cases in the United States, and more than 11 ,600 patients died of this disease in 1998. Transitional cell carcinoma is less frequent, with an incidence of approximately 500 cases per year in the United States.
  • bladder cancer represents approximately 5 percent in men (fifth . most common neoplasm) and 3 percent in women (eighth most common neoplasm).
  • the incidence is increasing slowly, , concurrent with an increasing older population.
  • 1998 there was an estimated 54,500 cases, including 39,500 in men and 15,000 in women.
  • the age-adjusted incidence in the United States is 32 per 100,000 for men and eight per 100,000 in women.
  • the historic male/female ratio of 3:1 may be decreasing related to smoking patterns in women.
  • Bladder cancer incidence and mortality strongly increase with age and will be an increasing problem as the population becomes more elderly.
  • Bladder cancer is managed with a combination of transurethral resection of the bladder (TUR) and intravesical chemotherapy or immunotherapy.
  • TUR transurethral resection of the bladder
  • the multifocal and recurrent nature of ' bladder cancer points out the limitations of TUR.
  • Most muscle-invasive cancers are not cured by TUR alone. Radical . cystectomy and urinary diversion is the most effective means to eliminate the cancer but carry an undeniable impact on urinary and sexual function. There continues to be a significant need for treatment modalities that are beneficial for bladder cancer patients.
  • Treatment options for lung and bronchial cancer are determined by the type and stage of the cancer and include surgery, radiation therapy, and chemotherapy. For many localized cancers, surgery is usually the treatment of choice. Because the disease has usually spread by the time it is discovered, radiation therapy and chemotherapy are often needed in combination with surgery. Chemotherapy alone or.combined with radiation is the treatment of choice for small cell lung cancer; on this regimen, a large percentage of patients experience remission, which in some cases is long lasting. There is however, an ongoing need for effective treatment and diagnostic approaches for lung and bronchial cancers.
  • treatment of breast cancer may ⁇ involve lumpectomy (local removal of the tumor) and removal of the lymph nodes under the arm; mastectomy (surgical removal of the-breast) and removal of the lymph nodes under the arm; radiation therapy; chemotherapy; or hormone therapy.
  • lumpectomy local removal of the tumor
  • mastectomy surgical removal of the-breast
  • radiation therapy chemotherapy
  • hormone therapy chemotherapy
  • two or more method ' s are used in combination.
  • Numerous studies have shown that, for early stage disease, long-term survival rates after lumpectomy plus radiotherapy are similar to survival rates after modified radical mastectomy.
  • DCIS ductal carcinoma in situ
  • Surgery, radiation therapy, and chemotherapy are treatment options for ovarian cancer.
  • Surgery usually includes the removal of one or both ovaries, the fallopian tubes (salpingo-oophorectomy), and the uterus (hysterectomy).
  • the fallopian tubes salivary-oophorectomy
  • the uterus hematoma-oophorectomy
  • pancreatic cancer There were an estimated 28,300 new cases of pancreatic cancer in the United States in 2000. Over the past 20 years, rates of pancreatic cancer have declined in men. Rates among women have remained approximately constant but may be beginning to decline. Pancreatic cancer caused an estimated 28,200 deaths in 2000 in the United States. Over the past 20 years, there has been a slight but significant decrease in mortality rates among men (about -0.9% per year) while rates have increased slightly among women.
  • pancreatic cancer Surgery, radiation therapy, and chemotherapy are treatment options for pancreatic cancer. These treatment options can extend survival and/or relieve symptoms in many patients but are not likely to produce a cure for most. There is a significant need for additional therapeutic and diagnostic options for pancreatic cancer.
  • the present invention relates to a gene, designated 193P1E1B, that has now been found to be over-expressed in the cancer(s) listed in Table I.
  • Northern blot expression analysis of 193P1E1B gene expression in normal tissues shows a restricted expression pattern in adult tissues.
  • the nucleotide ( Figure 2) and amino acid ( Figure 2, and Figure 3) sequences of 193P1E1B are provided..
  • the invention provides polynucleotides corresponding or complementary to all or part of the 193P1E1B genes, mRNAs, and/or coding sequences, preferably in isolated form, including polynucleotides encoding 193P1E1 B-related proteins and fragments of 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or more than 25 contiguous amino acids; at least 30, 35, 40, 45, 50, 55, 60, 65, 70, 80, 85, 90, 95, 100 or more than 100 contiguous amino acids of a 193P1E1 B-related protein, as well as the peptides/proteins themselves; DNA, RNA, DNA/RNA hybrids, and related molecules, polynucleotides or oligonucleotides complementary or havjng at least.a 90% homology to the 193P1 E1 B genes or mRNA sequences or parts thereof, and polynucleotides or oligonucleotides that hybridize to
  • the invention further . provides antibodies that bind to 193P1E1B proteins and polypeptide fragments thereof, including polyclonal and monoclonal antibodies, murine and other mammalian antibodies, chimeric antibodies, humanized and fully human antibodies, and .antibodies labeled with a detectable marker or therapeutic agent.
  • the entire nucleic acid sequence of Figure 2 is not encoded and/or the entire amino acid sequence of Figure 2 is not prepared. In certain embodiments, the entire nucleic acid sequence of Figure 2 is encoded and/or the entire amino acid sequence of Figure 2 is prepared, either of which are in respective human unit dose forms.
  • the invention further provides methods for detecting the presence and status of 193P1 E1 B polynucleotides and proteins in various biological samples, as well as methods for identifying cells that express 193P1 E1 B.
  • a typical embodiment of this in ention provides methods for monitoring 193P1 E1 B gene products in a tissue or hematology sample having or suspected of having some form of growth dysregulatio ⁇ such as cancer.
  • the invention further provides various immunogenic or therapeutic compositions and strategies for treating cancers that express 193P1 E1 B such as cancers of tissues listed in Table I, including therapies aimed at inhibiting the transcription, translation, processing or function of 193P E1 B as well as cancer vaccines.
  • the invention provides compositions, and methods comprising them, for treating a cancer that expresses 193P1 E1 B in a human subject wherein the composition comprises a carrier suitable for human use and a human unit dose of one or more than one agent that inhibits the production or function of 193P1 E1 B.
  • the carrier is a uniquely human carrier.
  • the agent is a moiety that is immunoreactive with 193P1E1B protein.
  • Non-limiting examples of such moieties include, but are not limited to, antibodies (such as single chain, monoclonal, polyclonal, humanized, chimeric, or human antibodies), functional equivalents thereof (whether naturally occurring or synthetic), and combinations thereof.
  • the antibodies can be conjugated to a diagnostic or therapeutic moiety.
  • the agent is a small molecule as defined herein.
  • the agent comprises one or more than one peptide which comprises a cytotoxic T lymphocyte (CTL) epitope that binds an HLA class I molecule in a human to elicit a CTL response to 193P1 E1B and/or one or more than one peptide which comprises a helper T lymphocyte (HTL) epitope which binds an HLA class II molecule in a human to elicit an HTL response.
  • CTL cytotoxic T lymphocyte
  • HTL helper T lymphocyte
  • the peptides of the invention may be on the same or on one or more separate polypeptide molecules.
  • the agent comprises one or more than one nucleic acid molecule that expresses one or more than one of the CTL or HTL response stimulating peptides as described above.
  • the one or more than one nucleic acid molecule may express a moiety that is immunologically reactive with 193P1 E1B as described above.
  • the one or more than one nucleic acid molecule may also be, or encodes, a molecule that inhibits production of 193P1E1B.
  • Non-limiting examples of such molecules include, but are not limited to, those complementary to a- nucleotide sequence essential for production of 193P1 E1B (e.g. antisense sequences or molecules that form a triple helix with a nucleotide double helix essential for 193P1 E1 B production) or a ribozyme effective to lyse 193P1 E1 B mRNA.
  • HLA Peptide Tables respective to its parental protein, e.g., variant 1 , variant 2, etc.
  • HLA Peptide Tables a unique Search Peptide is used to obtain HLA peptides of a particular for a particular variant. The position of each Search Peptide relative to its respective parent molecule is listed in Table VII.
  • a Search Peptide begins at position "X"
  • a particular Search Peptide begins at position 150 of its parental molecule, one must add 150 - 1, i.eflower 149' to each HLA peptide amin ⁇ acid position to calculate the position of that amino acid in the parent molecule.
  • One embodiment of the invention comprises an HLA peptide, that occurs at least twice in Tables VIII-XXI and XXII to XLIX collectively, or an oligonucleotide that encodes the HLA peptide.
  • Another embodiment of the invention comprises an HLA peptide that occurs at least once in Tables VIII-XXI and at least once in tables XXII to XLIX, or an oligonucleotide that encodes the HLA peptide.
  • antibody epitopes which comprise a peptide regions, or an oligonucleotide encoding the peptide region, that has one two, three, four, or five of the following characteristics: i) a peptide region of at least 5 amino acids of a particular peptide of Figure 3, in any whole number increment up to the full length of that protein in Figure 3, that includes an amino acid position having a value equal to or greater than 0.5, 0.6, 0.7, 0.8, 0.9, or having a value equal to 1.0, in the Hydrophilicity profile of Figure 5; ii) a peptide region of at least 5 amino acids of a particular peptide of Figure 3, in any whole number increment up to the full length of that protein in Figure 3, that includes an amino acid position having a value equal to or less than 0.5, 0.4, 0.3, 0.2, 0.1, or having a value equal to 0.0, in the Hydropathicity profile of Figure 6; iii) a peptide region of at least 5
  • FIG. 1 The 193P.1 E1 B SSH sequence of 227 nucleotides.
  • 193P1 E1 B variant 2 (also called “193P1 E1 B v.2") is shown in Figure 2B.
  • the codon for the start methionine is underlined.
  • the open reading frame extends from nucleic acid 805-2043 including the stop codon.
  • 193P1E1B variant 3 (also called “193P1E1B v.3") is shown in Figure 2C.
  • the codon for the start methionine is underlined...
  • the open reading frame extends from nucleic acid 805-2043 including the stop codon.
  • 193P1E1 B variant 4 (also called “193P1 E1 B v.4") is shown in Figure 2D.
  • the codon for the start methionine is underlined.
  • the open reading frame extends from nucleic acid 805-2043 including the stop codon.
  • 193P1E1B variant 6 (also called “193P1E1B v.6") is shown in Figure 2F.
  • the codon for the start methionine is underlined.
  • the open reading frame extends from nucleic acid 805-2043 including the stop codon.
  • 193P1E1B variant 7 (also called “193P1E1B v.7") is shown in Figure 2G.
  • the codon for the start methionine is underlined.
  • the open reading frame extends from nucleic acid 805-2043 including the stop codon.
  • 193P1E1B variant 8 (also called “193P1E1B v.8") is shown in Figure 2H.
  • the codon for the start methionine is underiined.
  • the open reading frame extends from nucleic acid 805-2043 including the stop codon.
  • the cDNA and amino acid sequence of 193P1 E1 B variant 9 (also called “193P1 E1 B v.9") is shown in Figure 21.
  • the codon for the start methionine is underlined.
  • the open reading frame extends from nucleic acid 989-1981 including the stop codon.
  • the cDNA and amino acid sequence of 193P1E1B variant 10 (also called “193P1E1B v.10 n ) is shown in Figure 2J.
  • the codon for the start methionine is underlined.
  • the open reading frame extends from nucleic acid 805-1971 including the stop codon.
  • 193P1E1B variant 11 (also called “193P1E1B v.1 ) is shown in Figure 2K.
  • the codon for the start methionine is underlined.
  • the open reading frame extends from nucleic acid 989-1909 including the stop codon.
  • 193P1E1B variant 12 (also called “193P1E1B v.12") is shown in Figure 2L.
  • the codon for the start methionine is underlined.
  • the open reading frame extends from nucleic acid 805-1026 including the stop codon.
  • 193P1 E1 B variant 13 (also called “193P1 E1 B v.13") is shown in Figure 2M.
  • the codon for the start methionine is underlined.
  • the open reading frame extends from nucleic acid 952-2070 including the stop codon.
  • Amino acid sequence of 193P1 E1B v.1 is shown in Figure 3A; it has 412 amino acids.
  • 193P1E1B v.13 The amino acid sequence of 193P1E1B v.13 is shown in Figure3H; ithas 372amino acids.
  • a reference to 193P1 E1 B includes all variants thereof, including those shown in Figures 2, 3, 10, and 11 , unless the context clearly indicates otherwise.
  • Figure 4A shows the alignment of 193P1E1B v.1 with gi 2178775.
  • Figure 4B shows the alignment of 193P1E1B v.5 with gi 2178775.
  • Figure 4C shows the alignment of 193P1E1B v.11 with gi 2178775.
  • Figure 4D shows the alignment of 193P1E1B v.12 with gi 2178775.
  • Figure 4E shows the alignment of 193P1E1B v.1 with £co/ ⁇ arginine represser.
  • Figure 4F shows the Alignment of 193P1E1B v.i with human adenosine deaminase.
  • Figure 4G shows the Clustal alignment of 193P1E1B protein variants.
  • Hydrophilicity amino acid profile of 193P1 E1 B determined by computer algorithm sequence analysis using the method of Hopp and Woods (Hopp T.P., Woods K.R., 1981. Proc. Natl. Acad. Sci. U.S.A. 78:3824-3828) accessed on the Protscale website located on the World Wide Web at (expasy.ch/cgi-bin/protscale.pl) through the ExPasy molecular biology server.
  • Figure 7 Percent accessible residues amino acid profile of 193P1E1B determined by computer algorithm sequence analysis using the method of Janin (Janin J., 1979 Nature 277:491-492) accessed on the ProtScale website located on the World Wide Web at (.expasy.ch/cgi-bin/protscale.pl) through the ExPasy molecular biology server.
  • Figure 8 Average flexibility amino acid profile of 193P1E1 B determined by computer algorithm sequence analysis using the method of Bhaskaran and Ponnuswamy (Bhaskaran R., and Ponnuswamy P.K., 1988. Int. J. Pept. Protein Res. 32:242-255) accessed on the ProtScale website located on the World Wide Web at (,expasy.ch/cgi-bin/protscale.pl) through the ExPasy molecular biology server.
  • Figure 9 Beta-turn amino acid profile of 193P1 E1 B determined by computer algorithm sequence analysis using the method of Deleage and Roux (Deleage, G., Roux B. 1987 Protein Engineering 1:289-294) accessed on the ProtScale website located on the World Wide Web at (.expasy.ch/cgi-bin/protscale.pl) through the ExPasy molecular biology server.
  • FIG. 10 Schematic alignment of SNP variants of 193P1 E1 B.
  • Variants 193P1 E1 B v.2 through v.8 are variants with single nucleotide differences. Though these SNP variants are shown separately, they could also occur in any combinations and in any transcript variants that contains the base pairs. Numbers correspond to those of 193P1E1B v.1. Black box shows the same sequence as 193P1 E1 B v.1. SNPs are indicated above the box.
  • FIG 11. Schematic alignment of protein variants of 193P1 E1 B. Protein variants correspond to nucleotide variants. Nucleotide variants 193P1 E1 B v.2, v.3, v.4, v.7, and v.8 in Figure 10 code for the same protein as 193P1 E1 B v.1. Nucleotide variants 193P1E1B v.9 through v.13 are splice variants of v.1. Single amino acid differences were indicated above the boxes. Black boxes represent the same sequence as 193P1 E1 B v.1. Numbers underneath the box correspond to amino acid positions in 193P1E1B v.1.
  • FIG. 13 Secondary structure prediction for 193P1E1B (SEQ ID NO: 123).
  • This method predicts the presence and location of alpha helices, extended strands, and ⁇ • random coils from the primary protein sequence.
  • the percent of the protein in a given secondary-structure is as follows: h: Alpha helix 29.13%; c: Random coil 60.92%; e: Extended strand 9.95%.
  • FIG. 14 Expression of 193P1E1B by RT-PCR.
  • A The schematic diagram depicts the location of PCR primers Set A and set B on the sequences of the 3 variants of 193P1 E1 B.
  • B and C First strand cDNA was prepared from vital pool 1 (VP1: liver, lung and kidney), vital pool 2 (VP2, pancreas, colon and stomach), prostate xenograft pool (LAPC-4AD, LAPC- 4AI, LAPC-9AD, LAPC-9AI), normal thymus, prostate cancer pool, bladder cancer pool , kidney cancer pool, colon cancer pool , lung cancer pool, ovary cancer pool, breast cancer pool, metastasis cancer pool, pancreas cancer pool, and from prostate cancer metastasis to lymph node from 2 different patients.
  • VP1 vital pool 1
  • VP2 vital pool 2
  • VP2 pancreas, colon and stomach
  • prostate xenograft pool LAPC-4AD, LAPC- 4AI, LAPC-9AD, LAPC
  • Figure 14C shows that the transcipt encoding encoding 193P1E1B v.1 through v.8, is expressed ate higher levels that the transcript encoding 193P1E1B v.9. But both transcripts are expressed at similar proportion in all tissues tested.
  • FIG. 15 Expression of 193P1 E1 B in normal human tissues. Two multiple tissue northern blots, with 2 ⁇ g of ⁇ . mRNA/lane, were probed with 193P1 E1 B sequence. Size standards in kilobases (kb) are indicated on the side. The results ⁇ show expression of two 193P1 E1 B transcripts, approximately 3.5 kb and 2 kb, in testis and thymus.
  • FIG. 16 Expression of 193P1E1B in prostate cancer xenografts.
  • RNA was extracted from normal prostate, and from prostate cancer xenografts, LAPC-4AD, LAPC-4AI, LAPC-9AD, and LAPC-9AI.
  • Northern blot with 10 ⁇ g of total RNA/lane was probed with 193P1E1 B sequence. Size standards in kilobases (kb) are indicated on the side. The results show expression of 193P1 E1 B in all 4 xenografts but not in normal prostate.
  • RNA was extracted from a pool of three patients for each of the following, bladder cancer, colon cancer, ovary cancer and metastasis cancer, as well as from normal prostate (NP), normal bladder (NB), normal kidney (NK), normal colon (NC).
  • Northern blots with 10 ⁇ g of total RNA/lane were probed with 193P1E1B sequence. Size standards in kilobases (kb) are indicated on the side. The results show expression of 193P1 E1 B in bladder cancer pool, colon cancer pool, ovary cancer pool and metastasis cancer pool, but not in any of the normal tissues tested.
  • FIG. 18 Expression of 193P1 E1 B in bladder cancer patient specimens. RNA was extracted from bladder cancer cell lines (CL), normal bladder (N), bladder tumors (T) and matched normal adjacent tissue (NAT) isolated from bladder cancer patients. Northern blots with 10 ⁇ g of total RNA/lane were probed with 193P1 E1 B sequence. Size standards in kilobases (kb) are indicated on the side. The results show expression of 193P1 E1 B in the two bladder cancer ceil lines, and in 3 patient bladder tumors tested but not in normal bladder tissues.
  • CL bladder cancer cell lines
  • N normal bladder
  • T bladder tumors
  • NAT normal adjacent tissue
  • RNA was extracted from the following cancer metastasis tissues, colon metastasis to lung, lung metastasis to lymph node, lung metastasis to skin, and breast metastasis to lymph node, as well as from normal bladder (NB), normal lung (NL), normal breast (NBr), and normal ovary (NO).
  • Northern blots with 10 ⁇ g of total RNA/lane were probed with 193P1 E1 B sequence. Size standards in kilobases (kb) are indicated on the side. The results show expression of 193P1 E1 B in all four different cancer metastasis samples but not in normal tissues.
  • FIG. 20 Expression of 193P1 E1 B in pancreas, ovary and testis cancer patient specimens.
  • RNA was extracted from pancreatic cancer (P1 ), ovarian cancer (P2, P3), and testicular cancer (P4, P5) isolated from cancer patients, as well as from nor al pancreas (NPa).
  • Northern blots with 10 ⁇ g of total RNA/lane were probed with 193P1E1B sequence. Size standards in kilobases (kb) are indicated on the side. The results show expression of 193P1 E1 B in pancreatic, ovarian and testicular cancer specimens but not in normal pancreas.
  • Figure 21 Expression of 193P1 E1 B in Normal versus Patient Cancer Specimens.
  • First strand cDNA was prepared from a panel of normal tissues (stomach, brain, heart, liver, spleen, skeletal muscle, testis prostate, bladder, kidney, colon, lung and pancreas) and from a panel of patient cancer pools (prostate cancer pool, bladder cancer pool , kidney cancer pool, colon cancer pool , lung cancer pool, pancreas cancer pool, ovary cancer pool, breast cancer pool, metastasis cancer pool, LAPC prostate xenograft pool (XP), and from prostate cancer metastasis to lymph node from 2 different patients (PMLN2). Normalization was performed by PCR using primers to actin.
  • Figure 22 Expression of 193P1 E1 B in Normal versus Patient Cancer Specimens.
  • First strand cDNA was prepared from a panel of normal tissues (stomach, brain, heart, liver, spleen, skeletal muscle, testis prostate, bladder, kidney, colon/lung and pancreas) and from a panel of patient cancer pools (prostate cancer pool, bladder cancer pool , kidney cancer pool, colon cancer pool , lung cancer pool, pancreas cancer pool, ovary cancer pool, breast cancer pool, metastasis cancer pool, LAPC prostate xenograft pool (XP), and from prostate cancer metastasis to lymph node from 2 different patients (PMLN2). Normalization was performed by PCR using primers to actin.
  • Vaccine Compositions Comprising DC Pulsed with CTL and/or HTL Peptides
  • prostate cancer locally advanced prostate cancer
  • advanced disease and “locally advanced disease” mean prostate cancers that have extended through the prostate capsule, and are meant to include stage C disease under the American Urological Association (AUA) system, stage C1 - C2 disease under the Whitmore-Jewett system, and stage T3 - T4 and N+ disease under the TNM (tumor, node, metastasis) system.
  • AUA American Urological Association
  • stage C1 - C2 disease under the Whitmore-Jewett system
  • TNM tumor, node, metastasis
  • surgery is not recommended for patients with locally advanced disease, and these patients have substantially less favorable outcomes . compared to patients having clinically localized (organ-confined) prostate cancer.
  • Locally advanced disease is clinically identified by palpable evidence of induration beyond the lateral border of the prostate, or asymmetry or induration above the prostate base.
  • Locally advanced prostate cancer is presently diagnosed pathologically following radical prostatectomy if the tumor invades or penetrates the prostatic capsule, extends into the surgical margin, or invades the seminal vesicles.
  • “Altering the native glycosylation pattern” is intended for purposes herein to mean deleting one or more carbohydrate moieties found in native sequence 193P1E1B (either by removing the underlying glycosylation site or by deleting the glycosylation by chemical and/or enzymatic means), and/or adding one or more glycosylation sites that are not present in the native sequence 193P1 E1 B.
  • the phrase includes qualitative changes in the glycosylation of the • native proteins, involving a change in the nature and proportions of the various carbohydrate moieties present.
  • analog refers to a molecule which is structurally similar or shares similar or corresponding attributes with ⁇ another molecule (e.g. a 193P1 E1 B-related protein).
  • a 193P1 E1 B-related protein e.g. an analog of a 193P1 E1 B protein can be specifically bound by an antibody or T cell that specifically binds to 193P1 E1 B.
  • an “antibody” is used in the broadest sense. Therefore, an “antibody” can be naturally occurring or man-made such as monoclonal antibodies produced by conventional hybridoma technology.
  • Antj-193P1E1B antibodies comprise monoclonal and polyclonal antibodies as well as fragments containing the antigen-binding domain and/or one or more complementarity determining regions of these antibodies.
  • an "antibody fragment' is defined as at least a portion of the variable region of the immunoglobulin molecule that binds to its target, i.e., the antigen-binding region. In one embodiment it specifically covers single anti-193P1 E1 B antibodies and clones thereof (including agonist, antagonist and neutralizing antibodies) and anti-193P1 E1 B antibody compositions with polyepitopic specificity.
  • codon optimized sequences refers to nucleotide sequences that have been optimized for a particular host species by replacing any codons having a usage frequency of less than about 20%. Nucleotide sequences that have been optimized for expression in a given host species by elimination of spurious polyadenylation sequences, elimination of exon/intron splicing signals, elimination of transposon-like repeats and/or optimization of GC content in addition to codon optimization are referred to herein as an "expression enhanced sequences.”
  • a “combinatorial library” is a collection of diverse chemical compounds generated by either chemical synthesis or biological synthesis by combining a number of chemical "building blocks” such as reagents.
  • a linear combinatorial chemical library such as a polypeptide (e.g., mutein) library, is formed by combining a set of chemical building blocks called amino acids in every possible way for a given compound length (i.e., the number of amino acids in a polypeptide compound).
  • Numerous chemical compounds are synthesized through such combinatorial mixing of chemical building blocks (Gallop et al., J. Med. Chem. 37(9): 1233-1251 (1994)).
  • combinatorial chemical libraries include, but are not limited to, peptide libraries (see, e.g., U.S. Patent No. 5,010,175, Furka, Pept. Prot. Res. 37:487-493 (1991), Houghton et al., Nature, 354:84-88 (1991)), peptoids (PCT Publication No WO 91/19735), encoded peptides (PCT Publication WO 93/20242), random bio- oligomers (PCT Publication WO 92/00091), benzodiazepines (U.S. Pat.
  • Patent 5,539,083) antibody libraries (see, e.g., Vaughn et al., Nature Biotechnology 14(3): 309-314 (1996), and PCT/US96/10287), carbohydrate libraries (see, e.g., Liang et al., Science 274:1520-1522 (1996), and U.S. Patent No.5,593,853), and small organic molecule libraries (see; e.g., benzodiazepines, . Baum, C&EN,- Jan 18, page 33 (1993); isoprenoids, U.S. Patent No. 5,569,588; thiazolidinones and metathiazanones, U.S. ' Patent No.
  • cytotoxic agent refers to a substance that inhibits or prevents the expression activity of cells, function of cells and/or causes destruction of cells.
  • the term is intended to include radioactive isotopes chemotherapeutic agents, and . toxins such as small molecule toxins or enzymatically active toxins of bacterial, fungal, plant or animal origin, including fragments and/or variants thereof.
  • cytotoxic agents include, but are not limited to auristatins, auromycins, maytansinoids, yttrium, bismuth, ricin, ricin A-chain, combrestaiin, duocarmycins, dolostatins, doxorubicin, daunorubicin, taxol, cisplatin, cc1065, ethidium bromide, mitomycin, etoposide, tenoposide, vincristine, vinblastine, colchicine, dihydroxy anthracin dione, actinomycin, diphtheria toxin, Pseudomonas exotoxin (PE) A, PE40, abrin, abrin A chain, modeccin A chain, alpha-sarcin, gelonin, mitogeliin, retstrictocin, phenomycin, enomycin, curicin, crotin, calicheamicin, Sapaonaria officinalis
  • Antibodies may also be conjugated to an anti- cancer pro-drug activating enzyme capable of converting the pro-drug to its active form.
  • the "gene product” is sometimes referred to herein as a protein or mRNA.
  • a “gene product of the invention” is sometimes referred to herein as a "cancer amino acid sequence", “cancer protein”, “protein of a cancer listed in Table I”, a “cancer mRNA”, “mRNA of a cancer listed in Table I”, etc.
  • the cancer protein is encoded by a nucleic acid of Figure 2.
  • the cancer protein can be a fragment, or alternatively, be the full-length protein to the fragment encoded by the nucleic acids of Figure 2.
  • a cancer amino acid sequence is used to determine sequence identity or similarity.
  • the sequences are naturally occurring allelic variants of a protein encoded by a nucleic acid of Figure 2.
  • the sequences are sequence variants as further described herein.
  • high throughput screening systems are commercially available (see, e.g., Amersham Biosciences, . Piscataway, NJ; Zymark Corp., Hopkinton, MA; Air Technical Industries, Mentor, OH; Beckman Instruments, Inc. Fullerton, CA; Precision Systems, Inc., Natick, MA; etc.). These systems typically automate entire procedures, including all sample - and reagent pipetting, liquid dispensing, timed incubations, and final readings of the microplate in detector(s) appropriate for. the assay. These configurable systems provide high throughput and rapid start up as well as a high degree offlexibility and customization. The manufacturers of such systems provide detailed protocols for various high throughput systems. Thus, e.g., Zymark Corp. provides technical bulletins describing screening systems for detecting the modulation of gene • transcription, ligand binding, and the like.
  • homolog refers to a molecule which exhibits homology to another molecule, by for example, having sequences of chemical residues that are the same or similar at corresponding positions.
  • HLA Human Leukocyte Antigen
  • HLA Human Leukocyte Antigen
  • MHC Major Histocompatibility Complex
  • hybridize used in the context of polynucleotides, are meant to refer to-conventional hybridization conditions, preferably such as hybridization in 50% formamide/6XSSC/0.1% SDS/100 ⁇ g/ml ssDNA;in which temperatures for hybridization are above 37 degrees G and temperatures for washing in 0.1XSSC/0.1 % SDS are above 55 degrees C.
  • isolated or “biologically pure” refer to material which is substantially or essentially free from components which normally accompany the material ' as it is found in its native state.
  • isolated peptides in accordance with the invention preferably do not contain materials normally associated with the peptides in their in situ environment.
  • a polynucleotide is said to be “isolated” when it is substantially separated from contaminant polynucleotides that correspond or are complementary to genes other than the 193P1 E1 B genes or that encode polypeptides other than 193P1 E1 B gene product or fragments thereof.
  • a skilled artisan can readily employ nucleic acid isolation procedures to obtain an isolated 193P1 E1 B polynucleotide.
  • a protein is said to be "isolated,” for example, when physical, mechanical or chemical methods are employed to remove the 193P1E1B proteins from cellular constituents that are normally associated with the protein.
  • a skilled artisan can readily employ standard purification methods to obtain an isolated 193P1E1B protein.
  • an isolated protein can be prepared by chemical means.
  • mammal refers to any organism classified as a mammal, including mice, rats, rabbits, dogs, cats, cows, horses and humans. In one embodiment of the invention, the mammal is a mouse. In another embodiment of the invention, the mammal is a human.
  • the terms "metastatic prostate cancer” and “metastatic disease” mean prostate cancers that have spread to regional lymph nodes or to distant sites, and are meant to include stage D disease under the AUA system and stage TxNxM+ under the TNM system. As is the case with locally advanced prostate cancer, surgery is generally not indicated for patients with metastatic disease, and hormonal (androgen ablation) therapy is a preferred treatment modality.
  • Prostatic prostate cancer patients with metastatic prostate cancer eventually develop an andragen-refractory state within 12 to 18 months of treatment initiation. Approximately half of these androgen-refractory patients die within 6 months after developing that status.
  • the most common site for prostate cancer metastasis is bone. Prostate cancer bone metastases are often osteoblastic rather than osteolytic (i.e., resulting in net bone formation). Bone metastases are found most frequently in the spine, followed by the femur, pelvis, rib cage, skull and humerus. Other common sites for metastasis include lymph nodes, lung, liver and brain. Metastatic prostate cancer is typically diagnosed by open or laparoscopic pelvic lymphadenectomy, whole body radionuclide scans, ⁇ skeletal radiography, and/or bone lesion biopsy.
  • modulator or “test compound” or “drug candidate” or grammatical equivalents as used herein describe any molecule, e.g., protein, oligopeptide, small organic molecule, polysaccharide, polynucleotide, etc., to be tested for the capacity to directly or indirectly alter the cancer phenotype or the expression of a cancer sequence, e.g., a nucleic acid or . protein sequences, or effects of cancer sequences (e.g., signaling, gene expression, protein interaction, etc.)
  • a modulator will-neutralize the effect of a cancer protein of the invention.
  • neutralize is meant that an activity of a protein.
  • a modulator will neutralize the effect of a gene, and its corresponding protein, of the invention by normalizing levels of said protein, in preferred embodiments, modulators alter expression profiles, or expression profile nucleic acids or proteins provided herein, or downstream effector pathways.
  • the modulator suppresses a cancer phenotype, e.g. to a normal tissue fingerprint.
  • a modulator induced a cancer phenotype.
  • a plurality of assay mixtures is run in parallel with
  • Modulators, drug candidates or test compounds encompass numerous chemical classes, though typically they are organic molecules, preferably small organic compounds, having a molecular weight of more than 100 and less than about .. 2,500 Daltons. Preferred small molecules are less than 2000, or less than 1500 or less than 1000 or less than 500' D.
  • Candidate agents comprise functional groups necessary for structural interaction with proteins, particularly hydrogen bonding, and typically include at least an amine, carbonyl, hydroxyl or carboxyl group, preferably at least two of the functional chemical groups.
  • the candidate agents often comprise cyclical carbon or heterocyclic structures and/or aromatic or polyaromatic structures substituted with one or more of the above functional groups.
  • Modulators also comprise biomolecules such as peptides, saccharides, fatty acids, steroids, purines, pyrimidines, derivatives, structural analogs or combinations ⁇ thereof. Particularly preferred are peptides.
  • One class of modulators are peptides, for example of from about five to about 35 amino acjds, with from about five to about 20 amino acids being preferred, and from about 7 to about 15 being particularly
  • the cancer modulatory protein is soluble, includes a non-transmembrane region, and/or, has an N- terminal Cys to aid in solubility.
  • the C-terminus of the fragment is kept as a free.acid and the N-temninus is a free amine to aid in coupling, i.e., to cysteine.
  • a cancer protein of the invention is conjugated to an immunogenic agent as discussed herein.
  • the cancer protein is conjugated to BSA.
  • the peptides of the invention e.g., of preferred lengths, can be linked to each other or to other amino acids to create a longer peptide/protein.
  • the modulatory peptides can be digests of naturally occurring proteins as is outlined above, random peptides, or "biased" random peptides.
  • peptide/protein-based modulators are antibodies, and fragments thereof, as defined herein.
  • Modulators of cancer can also be nucleic acids.
  • Nucleic acid modulating agents can be naturally occurring nucleic acids, random nucleic acids, or "biased” random nucleic acids.
  • digests of prokaryotic or eukaryotic genomes can be used in an approach analogous to that outlined above for proteins.
  • the term "monoclonal antibody” refers to an antibody obtained from a population of substantially homogeneous antibodies, i.e., the antibodies comprising the population are identical except for possible naturally occurring mutations that are present in minor amounts.
  • a "motif, as in biological motif of a 193P1E1 B-related protein, refers to any pattern of amino acids forming part of the primary sequence of a protein, that is associated with a particular function (e.g. protein-protein interaction, protein-DNA interaction, etc) or modification (e.g. that is phosphorylated, glycosylated or amidated), or localization (e.g. secretory sequence, nuclear localization sequence, etc.) or a sequence that is correlated with being immunogenic, either humorally or cellularly.
  • a motif can be either contiguous or capable of being aligned to certain positions that are generally correlated with a certain function or property.
  • motif refers to the pattern of residues in a peptide of defined length, usually a peptide of from about 8 to about 13 amino acids for a class I HLA motif and from about 6 to about 25 amino acids for a class II HLA motif, which is recognized by a particular HLA molecule.
  • Peptide motifs for HLA binding are typically different for each protein encoded by each human HLA allele and differ in the pattern of the primary and secondary anchor residues.
  • a “pharmaceutical excipient” comprises a material such'as an adjuvant, a carrier, pH-adjusting and buffering agents, tonicity adjusting agents, wetting agents, preservative, and the like.
  • “Pharmaceutically acceptable” refers to a non-toxic, inert, and/or composition that is physiologically compatible with humans or other mammals.
  • polynucleotide means a polymeric form of nucleotides of at least 10 bases or base pairs in length, either ribonucleotides or deoxynucleotides or a modified form of either type of nucleotide, and is meant to include single and double stranded forms of DNA and/or RNA. In the art, this term if often used interchangeably with “oligonucleotide”.
  • a polynucleotide can comprise a nucleotide sequence disclosed herein wherein thymidine (T), as shown for example in Figure 2, can also be' uracil (U); this definition pertains to the differences between the chemical structures of DNA and RNA, in particular the observation that one of the four major bases in RNA is uracil (U) instead of thymidine (T).
  • T thymidine
  • U uracil
  • polypeptide means a polymer of at least about 4, 5, 6, 7, or 8 amino acids. Throughout the specification, standard three letter or single letter designations for amino acids are used. In the art, this term is often used interchangeably with “peptide” or "protein”.
  • HLA "primary , anchor residue” is an amino acid at a specific position along a peptide sequence which is understood to provide a contact point between the immunogenic peptide and the HLA molecule.
  • One to three, usually two, primary anchor residues within a peptide of defined length generally defines a "motif for an immunogenic peptide. These residues are understood to fit in close contact with peptide binding groove of an HLA molecule, with their side chains buried in specific pockets of the binding groove.
  • the primary anchor residues for an HLA class I molecule are located at position 2 (from the amino terminal position) and at the carboxyl terminal position of a 8, 9, 10, 11 , or 12 residue peptide epitope in accordance with the invention.
  • the primary anchor residues of a peptide binds an HLA class II molecule are spaced relative to each other, rather than to the termini of a peptide, where the peptide is generally of at least 9 amino acids in length.
  • the primary anchor positions for each motif and super otif are set forth in Table IV.
  • analog peptides can be created by altering the presence or absence of particular residues in the primary and/or secondary anchor positions shown in Table IV. Such analogs are used to modulate the binding affinity and/or population coverage of a peptide comprising a particular HLA motif or supermotif.
  • Radioisotopes include, but are not limited to the following (non-limiting exemplary uses are also set forth): Examples of Medical Isotopes:
  • Radium-223 which is an alpha emitter used to treat metastases in the skeleton resulting from cancer (i.e., breast and prostate cancers), and cancer radioimmunotherapy
  • Radiation source for radiotherapy of cancer for food irradiators, and for sterilization of medical supplies
  • Beta/gamma emitter used in cancer radioimmunotherapy and diagnostic studies (i.e., breast and colon cancers, and lymphoma)
  • Radiation source for food irradiation and for sterilization of medical supplies
  • Radiation source for food irradiation and for sterilization of medical supplies
  • Gold-198 Implant and intracavity therapy of ovarian, prostate, and brain cancers
  • Osteoporosis detection diagnostic imaging, tracer drugs, brain cancer treatment, radiolabeling, tumor imaging, mapping of receptors in the brain, interstitial radiation therapy, brachytherapy for treatment of prostate cancer, determination of glomerular filtration rate (GFR), determination of plasma volume, detection of deep vein thrombosis of the legs lodine-131 (1-131)
  • thyroid function evaluation thyroid disease detection, treatment of thyroid cancer as well as other non- malignant thyroid diseases (i.e., Graves disease, goiters, and hyperthyroidism), treatment of leukemia, lymphoma, and other forms of cancer (e.g., breast cancer) using radioimmunotherapy lrid ⁇ um-192
  • Brachytherapy brain and spinal cord tumor treatment, treatment of blocked arteries (i.e., arteriosclerosis and ' restenosis), and implants for breast and prostate tumors
  • Tc-99m Parent of Technetium-99m which is used for imaging the brain, liver, lungs, heart, and other organs.
  • Tc-99m is the most widely used radioisotope used for diagnostic imaging of various cancers and diseases involving the brain, heart, liver, lungs; also used in detection of deep vein thrombosis of the legs
  • Polycythemia rubra vera blood cell disease
  • leukemia treatment bone cancer diagnosis/treatment
  • colon • pancreatic, and liver cancer treatment
  • radiolabeling nucleic acids for in vitro research diagnosis of superficial tumors, treatment of blocked arteries (i.e., arteriosclerosis and restenosis), and intracavity therapy
  • Radiotracer used in brain studies, imaging of adrenal cortex by gamma-scintigraphy, lateral locations of steroid secreting tumors, pancreatic scanning, detection of hyperactive parathyroid glands, measure rate of bile acid loss from the endogenous pool
  • Bone cancer pain relief multiple myeloma treatment, and osteoblastic therapy
  • Rhenium-188 which is used for cancer diagnostics/treatment, bone cancer pain relief, rheumatoid arthritis treatment, and treatment of blocked arteries (i.e., arteriosclerosis and restenosis)
  • Neuroimaging of brain disorders high resolution SPECT studies, pulmonary function tests, and cerebral blood flow studies
  • Y-90 Yttrium-90
  • cancer radioimmunotherapy i.e., lymphoma, breast, colon, kidney, lung, ovarian, prostate, pancreatic, and inoperable liver cancers
  • each nucleic acid and peptide consists of essentially random nucleotides and amino acids, respectively. These random peptides (or nucleic acids, discussed herein) can incorporate any nucleotide or amino acid at any position.
  • the synthetic process can be designed to generate randomized proteins or nucleic acids, to allow the formation of all or most of the possible combinations over the length of the sequence, thus forming a library of randomized candidate bioactive proteinaceous agents.
  • a library is "fully randomized,” with no sequence preferences or constants at any position.
  • the library is a "biased random” library. That is, some positions within the sequence either are held constant, or are selected from a limited number of possibilities.
  • the nucleotides or amino acid residues are randomized within a defined class, e.g., of hydrophobic amino acids, hydrophilic residues, sterically biased (either small or ' large) residues, towards the creation of nucleic acid binding domains, the creation of cysteines, for cross-linking, proiines for SH-3 domains, serines, threonines, tyrosines or histidines for phosphorylation sites, etc., or to purines, etc.
  • a "recombinanF DNA or RNA molecule is a DNA or RNA molecule that has been subjected to molecular manipulation in vitro.
  • Non-limiting examples of small molecules include compounds that bind or interact with 193P1E1B, ligands including hormones, neuropeptides, chemokines, odorants, phospholipids, and functional equivalents thereof that bind and preferably inhibit 193P1 E1 B protein function.
  • Such non-limiting small molecules preferably have a molecular weight of less than about 10 kDa, more preferably below about 9, about 8, about 7, about 6, about 5 or about 4 kDa.
  • small molecules physically associate with, or bind, 193P1E1B protein; are not found in naturally occurring metabolic pathways; and/or are more soluble in aqueous than non-aqueous solutions
  • “Stringency” of hybridization reactions is readily determinable by one of ordinary skill in the art, and generally is an empirical calculation dependent upon probe length, washing temperature, and salt concentration. In general, longer probes require higher temperatures for proper annealing, while shorter probes need lower temperatures. Hybridization generally depends on the ability of denatured nucleic acid sequences to reanneal when complementary strands are present in an environment below their melting temperature. The higher the degree of desired homology between the probe and hybridizable sequence, the higher the relative temperature that can be used. As a result, it follows that higher relative temperatures would tend to make the reaction conditions more stringent, while lower temperatures less so. For additional details and explanation of stringency of hybridization reactions, see Ausubel et al., Current Protocols in Molecular Biology, Wiley Interscience Publishers, (1995).
  • “Stringent conditions” or “high stringency conditions”, as defined herein, are identified by, but not limited to, those that: (1) employ low ionic strength and high temperature for washing, for example 0.015 M sodium chloride/0.0015 M sodium citrate/0.1% sodium dodecyl sulfate at 50°C; (2) employ during hybridization a denaturing agent, such as formamide, for example, 50% (v/v) formamide with 0.1 % bovine serum albumin/0.1% Ficoll/0.1% polyvinylpyrrolidone/50 M sodium phosphate buffer at pH 6.5 with 750 mM sodium chloride, 75 mM sodium citrate at 42 °C; or (3) employ 50% formamide, 5 x SSC (0.75 M NaCl, 0.075 M sodium citrate), 50 M sodium phosphate (pH 6.8), 0.1% sodium pyrophosphate, 5 x Denhardt's solution, sonicated salmon sperm DNA (50 ⁇ g/ml), 0.1% SDS, and 10% de
  • Modely stringent conditions are described by, but not limited to, those in Sambrook et a/., Molecular Cloning: A Laboratory Manual, New York: Cold Spring Harbor Press, 1989, and include the use of washing solution and hybridization conditions (e.g., temperature, ionic strength and %SDS) less stringent than those described above.
  • washing solution and hybridization conditions e.g., temperature, ionic strength and %SDS
  • moderately stringent conditions is overnight incubation at 37°C in a solution comprising: 20% formamide, 5 x SSC (150 mM NaCl, 15 mM trisodium citrate), 50 mM sodium phosphate (pH 7.6), 5 x Denhardt's solution, 10% dextran sulfate, and 20 mg/mL denatured sheared salmon sperm DNA, followed by washing the filters in 1 x SSC at about 37-50°C.
  • 5 x SSC 150 mM NaCl, 15 mM trisodium citrate
  • 50 mM sodium phosphate pH 7.6
  • 5 x Denhardt's solution 10% dextran sulfate
  • 20 mg/mL denatured sheared salmon sperm DNA followed by washing the filters in 1 x SSC at about 37-50°C.
  • the skilled artisan will recognize how to adjust the temperature, ionic strength, etc. as necessary to accommodate factors such as probe length and the like.
  • HLA-supermotif is a peptide binding specificity shared by HLA molecules encoded by two or more HLA alleles. Overall phenotypic frequencies of HLA-supertypes in different ethnic populations are set forth in Table IV (F). The non- limiting constituents of various supetypes are as follows:
  • A2j A*0201, A i 0202, A*0203, A*0204, A* 0205, A*0206, A*6802, A * 6901, A*0207
  • A3 A3, A11 , A31 , A*3301 , A*6801 , A*0301 , A*1101 , A*3101
  • B7 B7, B*3501-03, B*51, B*5301, B*5401, B*5501, B*5502, B*5601, B*6701, B*7801, B*0702, B*5101 , B*5602
  • B44 B*3701, B*4402, B*4403, B*60 (B*4001), B61 (B O06)
  • A24 A*24, A*30. A*2403. A*2404. A*3002, A*3003
  • B27 B*1401-02, B*1503, B*1509, B*1510, B*1518, B*3801-02, B*3901, B*3902, B*3903-04, B 801-02, B7301, B*2701-08
  • B58 B*1516, B*1517, B*5701, B*5702, B58
  • B62 B'4601. B52, B*1501 (B62), B*1502 (B75), B*1513 (B77) Calculated population coverage afforded by different HLA-supertype combinations are set forth in Table IV (G).
  • to treat or "therapeutic” and grammatically related terms, refer to any improvement of any consequence of disease, such as prolonged survival, less morbidity, and/or a lessening of side effects which are the byproducts of an alternative therapeutic modality; full eradication of disease is not required.
  • transgenic animal e.g., a mouse or rat
  • transgene is an animal having cells that contain a transgene, which transgene was introduced into the animal or an ancestor of the animal at a prenatal, e.g., an embryonic stage.
  • transgene is a DNA that is integrated into the genome of a cell from which a transgenic animal develops.
  • an HLA or cellular immune response "vaccine” is a composition that contains or encodes one or more peptides of the invention.
  • vaccines such as a cocktail of one or more individual peptides; one or more peptides of the invention comprised by a polyepitopic peptide; or nucleic acids that encode such individual peptides or polypeptides, e.g., a minigene that encodes a polyepitopic peptide.
  • the "one or more peptides” can include any whole unit integer from 1-150 or more, e.g., at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, or 150 or more peptides of the invention.
  • the peptides or polypeptides can optionally be modified, such as by lipidation, addition of targeting or other sequences.
  • HLA class I peptides of the invention can be admixed with, or linked to, HLA class II peptides, to facilitate activation of both cytotoxic T lymphocytes and helper T lymphocytes.
  • HLA vaccines can also comprise peptide-pulsed antigen presenting cells, e.g., dendritic cells.
  • variant refers to a molecule that exhibits a variation from a described type or norm, such as a protein that has one or more different amino acid residues in the corresponding positions) of a specifically described protein (e.g. the 193P1 E1 B protein shown in Figure 2 or Figure 3.
  • An analog is an example of a variant protein.
  • Splice isoforms and single nucleotides polymo ⁇ hisms (SNPs) are further examples of variants.
  • the "193P1 E1 B-related proteins" of the invention include those specifically identified herein, as well as allelic variants, conservative substitution variants, analogs and homologs that can be isolated/generated and characterized without undue experimentation following the methods outlined herein or readily available in the art. Fusion proteins that combine parts of different 193P1 E1 B proteins or fragments thereof, as well as fusion proteins of a 193P1 E1 B protein and a heterologous polypeptide are also included. Such 193P1E1B proteins are collectively referred to as the 193P1E1B-reiated proteins, the proteins of the invention, or 193P1 E1 B.
  • 193P1 E1 B-related protein refers to a polypeptide fragment or a 193P1 E1 B protein sequence of 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or more than 25 amino acids; or, at least 30, 35, 40, 45, 50, 55, 60, 65, 0, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150, 155, 160, 165, 170, 175, 180, 185, 190, 195, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 525, 550, 575, 600, 625, 650, or 664 or more amino acids.
  • One aspect of the invention provides polynucleotides corresponding or complementary to all or part of a 193P1E1B gene, mRNA, and/or coding sequence, preferably in isolated form, including polynucleotides encoding a 193P1 E1 B-related protein and fragments thereof, DNA, RNA, DNA/RNA hybrid, and related molecules, polynucleotides or oligonucleotides complementary to a 193P1E1 B gene or mRNA sequence or a part thereof, and polynucleotides or oligonucleotides that hybridize to a 193P1E1B gene, mRNA, or to a 193P1E1B encoding polynucleotide (collectively, "193P1E1B polynucleotides").
  • T can also be U in Figure 2.
  • Embodiments of a 193P1E1B polynucleotide include: a 193P1E1B polynucleotide having the sequence shown in Figure 2, the nucleotide sequence of 193P1 E1 B as shown in Figure 2 wherein T is U; at least 10 contiguous nucleotides of a polynucleotide having the sequence as shown in Figure 2; or, at least 10 contiguous nucleotides of a polynucleotide having the sequence as shown in Figure 2 where T is U.
  • embodiments of 193P1 E1 B nucleotides comprise, without limitation:
  • V a polynucleotide comprising, consisting essentially of, or consisting of the-sequence as shown in Figure 2D, from nucleotide residue number 805 through nucleotide residue number 2043, including the stop codon, wherein T can also be U;
  • VI a polynucleotide comprising, consisting essentially of, or consisting of the sequence as shown in Figure 2E, from nucleotide residue number 805 through nucleotide residue number 2043, including the stop codon, wherein T can also be U;
  • VII a polynucleotide comprising, consisting essentially of, or consisting of the sequence as shown in Figure ' 2F, .from nucleotide residue number 805 through nucleotide residue number 2043, including the stop codon, wherein T can also be U;
  • VIII a polynucleotide comprising, consisting essentially of, or consisting of the sequence as shown in Figure 2G, from nucleotide residue number 805 through nucleotide residue number 2043, including the stop codon, wherein T can also be U;
  • (IX) a polynucleotide comprising, consisting essentially of, or consisting of the sequence as shown in Figure nucleotide residue number 805 through nucleotide residue number 2043, including the stop codon, wherein T can also be U;
  • (X) a polynucleotide comprising, consisting essentially of, or consisting of the sequence as shown in Figure 21, from nucleotide residue number 989 through nucleotide residue number 1981 , including the stop codon, wherein T can also be U;
  • (XI) a polynucleotide comprising, consisting essentially of, or consisting of the sequence as shown in Figure 2J, from nucleotide residue number 805 through nucleotide residue number 1971, including the stop codon, wherein T can also be U;
  • (XII) a polynucleotide comprising, consisting essentially of, or consisting of the sequence as shown in Figure 2K, from nucleotide residue number 989 through nucleotide residue number 1909, including the stop codon, wherein T can also be U;
  • (XV) a polynucleotide that encodes a 193P1 E1 B-related protein that is at least 90, 91 , 92, 93, 94, 95, 96, 97, 98, 99 or 100% homologous to an entire amino acid sequence shown in Figure 2A-M;
  • XVI a polynucleotide that encodes a 193P1 E1 B-related protein that is at least 90, 91 , 92, 93, 94, 95, 96, 97, 98, 99 or 100% identical to an entire amino acid sequence shown in Figure 2A-M;
  • XVII a polynucleotide that encodes at least one peptide set forth in Tables VIII-XXI and XXII-XLIX;
  • (XVIII) a polynucleotide that encodes a peptide region of at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 amino acids of a peptide of Figure 3A-C in any whole number increment up to 412 that includes at least 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35 amino acid positions) having a value greater than 0.5 in the Hydrophilicity profile of Figure 5;
  • (XIX) a polynucleotide that encodes a peptide region of at least 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 amino acids of a peptide of Figure 3A-C in any whole number increment up to 412 that includes 1, 2, 3, 4 f 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 amino acid position(s) having a value less than 0.5 in the Hydropathicity profile of Figure 6;
  • (XX) a polynucleotide that encodes a peptide region of at least 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 amino acids of a peptide of Figure 3A-C in any whole number increment up to 412 that includes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 amino acid position(s) having a value greater than 0.5 in the Percent Accessible Residues profile of Figure 7;
  • (XXI) a polynucleotide that encodes a peptide region of at least 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 amino acids of a peptide of Figure 3A-C in any whole number increment up to 412 that includes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 amino acid position(s) having a value greater than 0.5 in the Average Flexibility profile of Figure 8;
  • (XXII) a polynucleotide that encodes a peptide region of at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35 amino acids of a peptide of Figure 3A-C in any whole number increment up to 412 that includes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35 amino acid position(s) having a value greater than 0.5 in the Beta-turn profile of Figure 9;
  • (XXIII) a polynucleotide that encodes a peptide region of at least 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35 amino acids of a peptide of Figure 3D in any whole number increment up to 330 that includes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 amino acid position(s) having a value greater than 0.5 in the Hydrophilicity profile of Figure 5;
  • (XXIV) a polynucleotide that encodes a peptide region of at least 5, 6, 7, 8, 9, 0, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 amino acids of a peptide of Figure 3D in any whole number increment up to 330 that includes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 amino acid position(s) having a value less than 0.5 in the Hydropathicity profile of Figure 6;
  • (XXV) a polynucleotide that encodes a peptide region of at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 amino acids of a peptide of Figure 3D in any whole number increment up to 330 that includes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35 amino acid positions) having a value greater than 0.5 in the Percent Accessible Residues profile of Figure 7;
  • (XXVI) a polynucleotide that encodes a peptide region of at least 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 amino acids of a peptide of Figure 3D in any whole number increment up to 330 that includes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35 amino acid position(s) having a value greater than 0.5 in the Average Flexibility profile of Figure 8;
  • (XXVII) a polynucleotide that encodes a peptide region of at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35 amino acids of a peptide of Figure 3D in any whole number increment up to 330 that includes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 amino acid position(s) having a value greater than 0.5 in the Beta- turn profile of Figure 9
  • (XXVIII) a polynucleotide that encodes a peptide region of at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, ' 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 amino acids of a peptide of Figure 3E in any whole number increment up to 388 that includes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 amino acid position(s) having a value greater than 0.5 in the Hydrophilicity profile of Figure 5;
  • (XXIX) a polynucleotide that encodes a peptide region of at least 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 amino acids of a peptide of Figure 3E in any whole number increment up to 388 that includes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 amino acid position(s) having a value less than 0.5 in the Hydropathicity profile of Figure 6;
  • (XXX) a polynucleotide that encodes a peptide region of at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 amino acids of a peptide of Figure 3E in any whole number increment up to 388 that includes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 amino acid position(s) having a value greater than 0.5 in the Percent Accessible Residues profile of Figure 7; (XXXI) a polynucleotide that encodes a peptide region of at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 7, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35 amino acids of a peptide of Figure 3E in any whole number increment up to 388 that includes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15,
  • (XXXII) a polynucleotide that encodes a peptide region of at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35 amino acids of a peptide of Figure 3E in any whole number increment up to 388 that includes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 amino acid position(s) having a value greater than 0.5 in the Beta- turn profile of Figure 9
  • (XXXIII) a polynucleotide that encodes a peptide region of at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35 amino acids of a peptide of Figure 3F in any whole number increment up to 308 that includes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 amino acid position(s) having a value greater than 0.5 in the Hydrophilicity profile of Figure 5;
  • (XXXIV) a polynucleotide that encodes a peptide region of at leasts, 6, 7, 8, 9, 0, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, .31 , 32, 33, 34, 35 amino acids of a peptide of Figure 3F in any whole number increment up to 308 that includes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 amino acid position(s) having a value less than 0.5 in the Hydropathicity profile of Figure 6;
  • (XXXV) a polynucleotide that encodes a peptide region of at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 amino acids of a peptide of Figure 3F in any whole number increment up to 308 that includes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35 amino acid position(s) having a value greater than 0.5 in the Percent Accessible Residues profile of Figure 7;
  • (XXXVI) a polynucleotide that encodes a peptide region of at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 amino acids of a peptide of Figure 3F in any whole number increment up to 308 that includes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35 amino acid position(s) having a value greater than 0.5 in the Average Flexibility profile of Figure 8;
  • (XXXVII) a polynucleotide that encodes a peptide region of at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 amino acids of a peptide of Figure 3F in any whole number increment up to 308 that includes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35 amino acid positions) having a value greater than 0.5 in the Beta- turn profile of Figure 9
  • (XXXVIII) a polynucleotide that encodes a peptide region of at least 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 amino acids of a peptide of Figure 3G in any whole number increment up to 73 that includes 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 amino acid position(s) having a value greater than 0.5 in the Hydrophilicity profile of Figure 5;
  • (XXXIX) a polynucleotide that encodes a peptide region of at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35 amino acids of a peptide of Figure 3G in any whole number increment up to 73 that includes 1, 2,,3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, • 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 amino acid position(s) having a value less than 0.5 in the Hydropathicity profile of Figure 6;
  • (XL) a polynucleotide that encodes a peptide region of at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35 amino acids of a peptide of Figure 3G in any whole number increment up to 73 that includes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 amino acid position(s) having a value greater than 0.5 in the Percent Accessible Residues profile of Figure 7;
  • (XLI) a polynucleotide that encodes a peptide region of at least 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35 amino acids of a peptide of Figure 3G in any whole number increment up to 73 that includes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 amino acid position(s) having a value greater than 0.5 in the Average Flexibility profile of Figure 8;
  • XLII a polynucleotide that encodes a peptide region of at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35 amino acids of a peptide of Figure 3G in any whole number increment up to 73 that includes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 amino acid position(s) having a value greater than 0.5 in the Beta- turn profile of Figure 9
  • (XLIII) a polynucleotide that encodes a peptide region of at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 amino acids of a peptide of Figure 3H in any whole ' number increment up to 372 that includes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, ⁇ 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35 amino acid position(s) having a value greater than 0.5 in the Hydrophilicity profile of Figure 5;
  • (XLI ) a polynucleotide that encodes a peptide. region of at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 amino acids of a peptide of Figure 3H in any whole number increment up to 372 that includes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 amino acid position(s) having a value less than 0.5 in the Hydropathicity profile of Figure 6;
  • (XLV) a polynucleotide that encodes a peptide region of at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 amino acids of a peptide of Figure 3H in any whole number increment up to 372 that includes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 amino acid position(s) having a value greater than 0.5 in the Percent Accessible Residues profile of Figure 7;
  • (XLVI) a polynucleotide that encodes a peptide region of at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35 amino acids of a peptide of Figure 3H in any whole number increment up to 372 that includes 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 amino acid position(s) having a value greater than 0.5 in the Average Flexibility profile of Figure 8;
  • (XLVI I) a polynucleotide that encodes a peptide region of at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 amino acids of a peptide of Figure 3H in any whole number increment up to 372 that includes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 amino acid position(s) having a value greater than 0.5 in the Beta- turn profile of Figure 9
  • (XLVIII) a polynucleotide that is fully complementary to a polynucleotide of any one of (l)-(XLVII).
  • (L) a composition comprising a polynucleotide of any of (l)-(XLVIII) or peptide of (XLIX) together with a pharmaceutical excipient and/or in a human unit dose form.
  • (LI) a method of using a polynucleotide of any (l)-(XLVIII) or peptide of (XLIX) or a composition of (L) in a method to modulate a cell expressing 193P1E1B,
  • UI a method of using a polynucleotide of any (l)-(XLVill) or peptide of (XLIX) or a composition of (L) in a method to diagnose, prophylax, prognose, or treat an individual who bears a cell expressing 193P1 E1 B
  • (Llll) a method of using a polynucleotide of any (l)-(XLVIII) or peptide of (XLIX) or a composition of (L) in a method to diagnose, prophylax, prognose, or treat an individual who bears a cell expressing 193P1 E1 B, said cell from a cancer of a tissue listed in Table I;
  • UV a method of using a polynucleotide of any (l)-(XLVIII) or peptide of (XLIX) or a composition of (L) in a method to diagnose, prophylax, prognose, or treat a a cancer;
  • (LV) a method of using a polynucleotide of any (l)-(XLVI 11) or peptide of (XLIX) or a composition of (L) in a method to diagnose, prophylax, prognose, or treat a a cancer of a tissue listed in Table I;
  • (LVI) a method of using a polynucleotide of any (l)-(XLVIII) or peptide of (XLIX) or a composition of (L) in a method to identify or characterize a modulator of a cell expressing 193P1 E1 B.
  • Typical embodiments of the invention disclosed herein include 193P1E1B polynucleotides that encode specific portions of 193P1 E1 B mRNA sequences (and those which are complementary to such sequences) such as those that encode the proteins and/or fragments thereof, for example: .
  • representative embodiments of the invention disclosed herein include: polynucleotides and their encoded peptides themselves encoding about amino acid 1 to about amino acid 10 of the 193P1E1B protein shown in Figure 2 or Figure 3, polynucleotides encoding about amino acid 10 to about amino acid 20 of the 193P1E B protein shown in Figure 2 or Figure 3, polynucleotides encoding about amino acid 20 to about amino acid 30 of the 193P1E1B protein shown in Figure 2 or Figure 3, polynucleotides encoding about amino acid 30 to about amino acid 40 of the 193P1 E1 B protein shown in Figure 2 or Figure 3, polynucleotides encoding about amino acid 40 to about amino acid 50 of the 193P1E1B protein shown in Figure 2 or Figure 3, polynucleotides encoding about amino acid 50 to about amino acid 60 of the 193P1E1B protein shown in Figure 2 or Figure 3, polynucleotides encoding about amino acid 60 to about amino acid 60
  • polynucleotides encoding portions of the amino acid sequence (of about 10 amino acids), of amino acids, 100 through the carboxyl terminal amino acid ofthe 193P1E1B protein are embodiments of the invention. Wherein it is understood that each particular amino acid position discloses that position plus or minus five amino acid residues.
  • Polynucleotides encoding relatively long portions of a 193P1 E1 B protein are also within the scope of the invention.
  • polynucleotides encoding from about amino acid 1 (or 20 or 30 or 40 etc.) to about amino acid 20, (or 30, or 40 or 50 etc.) of the 193P1E1B protein "or variant" shown in Figure 2 or Figure 3 can be generated by a variety of techniques well known in the art.
  • These polynucleotide fragments can include any portion of the 193P1 E1 B sequence as shown in Figure 2.
  • Additional illustrative embodiments ofthe invention disclosed herein include 193P1E1B polynucleotide fragments encoding one or more of the biological motifs contained within a 193P1 E1 B protein "or variant" sequence, including one or more ofthe motif-bearing subsequences of a 193P1E1B protein "or variant” set forth in Tables VIII-XXI and XXII-XLIX.
  • typical polynucleotide fragments ofthe invention encode one or more ofthe regions of 193P1E1B ⁇ protein or variant that exhibit homology to a known molecule.
  • typical polynucleotide fragments can encode one or more of the 193P1 E1 B protein or variant N-glycosylation sites, cAMP and cGMP-dependent protein kinase phosphorylation sites, casein kinase II phosphorylation sites or N-myristoylation site and amidation sites.
  • HLA Peptide Tables e.g., variant 1, variant 2, etc.
  • HLA Peptide Tables e.g., variant 1, variant 2, etc.
  • search Peptides listed in Table LVII Generally, a unique Search Peptide is used to obtain HLA peptides for a particular variant. The position of each Search Peptide relative. to its respective parent molecule is listed in Table VII.
  • the polynucleotides of the preceding paragraphs have a number of different specific uses.
  • the human 193P1 E1 B gene maps to the chromosomal location set forth in the Example entitled "Chromosomal Mapping of 193P1 E1B.”
  • polynucleotides that encode different regions of the 193P1 E1 B proteins are used to characterize cytogenetic abnormalities of this chromosomal locale, such as abnormalities that are identified as being associated with various cancers.
  • cytogenetic abnormalities of this chromosomal locale such as abnormalities that are identified as being associated with various cancers.
  • a variety of chromosomal abnormalities including rearrangements have been identified as frequent cytogenetic abnormalities in a number of different cancers (see e.g.
  • polynucleotides encoding specific regions ofthe 193P1E1B proteins provide new tools that can.be used to delineate, with greater precision than previously possible, cytogenetic abnormalities in the chromosomal region that encodes 193P1 E1 B that may contribute to the malignant phenotype.
  • these polynucleotides satisfy a need in the art for expanding the sensitivity of chromosomal screening in order to identify more subtle and less common chromosomal abnormalities (see e.g. Evans ef al., Am. J. Obstet. Gynecol 171(4): 1055-1057 (1994)).
  • 193P1E1B was shown to be highly expressed in bladder and other cancers, 193P1E1B polynucleotides are used in methods assessing the status of 193P1 E1 B gene products in normal versus cancerous tissues. Typically, polynucleotides that encode specific regions ofthe 193P1E1B proteins are used to assess the presence.of perturbations (such as deletions, insertions, point mutations, or alterations resulting in a loss of an antigen etc.) in specific regions of the 193P1 E1 B gene, such as regions containing one or more motifs.
  • perturbations such as deletions, insertions, point mutations, or alterations resulting in a loss of an antigen etc.
  • Exemplary assays include both RT-PCR assays as well as single-strand conformation polymorphism (SSCP) analysis (see, e.g., Marrogi et al., J. Cutan. Pathol. 26(8): 369-378 (1999), both of which utilize polynucleotides encoding specific regions of a protein to examine these regions within the protein.
  • SSCP single-strand conformation polymorphism
  • nucleic acid related embodiments ofthe invention disclosed herein are genomic DNA, cDNAs, ribozymes, and antisense molecules, as well as nucleic acid molecules based on an alternative backbone, or including alternative bases, whether derived from natural sources or synthesized, and include molecules capable of inhibiting the RNA or protein expression of 193P1E1B.
  • antisense molecules can be RNAs or other molecules, including peptide nucleic acids (PNAs) or non-nucleic acid molecules such as phosphorothioate derivatives that specifically bind DNA or RNA in a base pair-dependent manner.
  • PNAs peptide nucleic acids
  • non-nucleic acid molecules such as phosphorothioate derivatives that specifically bind DNA or RNA in a base pair-dependent manner.
  • a skilled artisan can readily obtain these classes of nucleic acid molecules using the 193P1 E1 B polynucleotides and polynucleotide sequences disclosed herein.
  • Antisense technology entails the administration of exogenous oligonucleotides.that bind to a target polynucleotide located within the cells.
  • the term "antisense” refers to the fact that such oligonucleotides are complementary to their intracellular targets, e.g., 193P1E1B. See for example, Jack Cohen, Oligodeoxynucleotides, Antisense Inhibitors of Gene Expression, CRC Press, 1989; and Synthesis 1:1-5 (1988).
  • the 193P1E1B antisense oligonucleotides ofthe present invention include derivatives such as S-oligonucleotides (phosphorothioate derivatives or S-oligos, see, Jack Cohen, supra), which exhibit enhanced cancer cell growth inhibitory action.
  • S-oligos are isoelectronic analogs of an oligonucleotide (O-oligo) in which a nonbridging oxygen atom ofthe phosphate group is replaced by a sulfur atom.
  • the S-oligos of the present invention can be prepared by treatment of the corresponding O-oligos with 3H-1 ,2- benzodithiol-3-one-1 ,1 -dioxide, which is a sulfur transfer reagent. See, e.g., Iyer, R. P. ef al., J. Org. Chem.55:4693-4698 (1990); and Iyer, R. P. ef al., J. Am. Chem. Soc. 112:1253-1254 (1990).
  • Additional 193P1E1B antisense oligonucleotides of the present invention include morpholino antisense oligonucleotides known in the art (see, e.g., Partridge ef al., 1996, Antisense & Nucleic Acid Drug Development 6: 169-175).
  • the 193P1 E1 B antisense oligonucleotides of the present in ention typically can be RNA or DNA that is complementary to and stably hybridizes with the first 1005' codons or last 1003' codons of a 193P1E1B genomic sequence or the corresponding mRNA Absolute complementarity is not required, although high degrees of complementarity are preferred.
  • Use of an oligonucleotide complementary to this region allows for the selective hybridization to 193P1E1B mRNA and not to mRNA specifying other regulatory subunits of protein kinase.
  • 193P1 E1 B antisense oligonucleotides of the present invention are 15 to 30-mer fragments ofthe antisense DNA molecule that have a sequence that hybridizes to 193P1E1B mRNA.
  • 193P1E1B antisense oligonucleotide is a 30-mer oligonucleotide that is complementary to a region in the first 105' codons or last 103' codons of 193P1 E1 B.
  • the antisense molecules are modified to employ ribozymes in the inhibition of 193P1 E1 B expression, see, e.g., L. A. Couture & D. T. Stinchcomb; Trends Genet 12: 510-515 (1996).
  • nucleotides of the invention include primers and primer pairs, which allow the specific amplification of polynucleotides of the invention or of any specific parts thereof, and probes that selectively or specifically hybridize to nucleic acid molecules of the invention or to any part thereof.
  • Probes can be labeled with a detectable marker, such as; for example, a radioisotope, fluorescent compound, bioluminescent compound, a : .- chemiluminescent compound, metal chelator or enzyme.
  • a detectable marker such as; for example, a radioisotope, fluorescent compound, bioluminescent compound, a : .- chemiluminescent compound, metal chelator or enzyme.
  • Such probes and primers are used to detect the presence of a 193P1 E1 B polynucleotide in a sample and as a means for detecting a cell expressing a 193P1 E1 B protein.
  • probes include polypeptides comprising all or part of the human 193P1 E1 B cDNA sequence shown in Figure 2.
  • primer pairs capable of specifically amplifying 193P1 E1 B mRNAs are also described in the Examples.
  • primer pairs capable of specifically amplifying 193P1 E1 B mRNAs are also described in the Examples.
  • a great many different primers and probes can be prepared based on the sequences provided herein and used effectively to amplify and/or detect a 193P1E1B mRNA.
  • the 193P1 E1 B polynucleotides of the invention are useful for a variety of purposes, including but not limited to their use as probes and primers for the amplification and/or detection of the 193P1E1 B gene(s), mRNA(s), or fragments thereof; as reagents for the diagnosis and/or prognosis of prostate cancer and other cancers; as coding sequences-capable of directing the expression of 1 3P1 E1 B polypeptides; as tools for modulating or inhibiting the expression of the 193P1 E1 B gene(s) and/or translation of the 193P1 E1 B transcript(s); and as therapeutic agents.
  • the present invention includes the use of any probe as described herein to identify and isolate a 193P1 E1 B or 193P1 E1 B related nucleic acid sequence from a naturally occurring source, such as humans or other mammals, as well as the isolated nucleic acid sequence per se, which would comprise all or most of the sequences found in the probe used. II.A.4.) Isolation of 193P1E1 B-Encoding Nucleic Acid Molecules
  • the 193P1E1B cDNA sequences described herein enable the isolation of other polynucleotides encoding 193P1E1B gene product(s), as well as the isolation of polynucleotides encoding 193P1 E1 B gene product homologs, alternatively spliced isoforms, allelic variants, and mutant forms of a 193P1 E1 B gene product as well as polynucleotides that encode analogs of 193P1 E1 B-related proteins.
  • Various molecular cloning methods that can be employed to isolate full length cDNAs encoding a 193P1E1 B gene are well known (see, for example, Sambrook, J.
  • a 193P1 E1 B cDNA (e.g., Figure 2) or a portion thereof can be synthesized and used as a probe to retrieve overlapping and full-length cDNAs corresponding to a 193P1E1B gene.
  • a 193P1E1B gene itself can be isolated by screening genomic DNA libraries, bacterial artificial chromosome libraries (BACs), yeast artificial chromosome libraries (YACs), and the like, with 193P1E1B DNA probes or primers. II.A.5.) Recombinant Nucleic Acid Molecules and Host-Vector Systems
  • the invention also provides recombinant DNA or RNA molecules containing a 193P1 E1 B polynucleotide, a fragment, analog or homologue thereof, including but not limited to phages, plasmids, phagemids, cosmids, YACs, BACs, as well as various viral and non-viral vectors well known in the art, and cells transformed or transfected with such recombinant DNA or RNA molecules. Methods for generating such molecules are well known (see, for example, Sambrook ef al., 1989, supra).
  • the invention further provides a host-vector system comprising a recombinant DNA molecule containing a 193P1 E1 B polynucleotide, fragment, analog or homologue thereof within a suitable prokaryotic or eukaryotic host cell.
  • suitable eukaryotic host cells include a yeast cell, a plant cell, or an animal cell, such as a mammalian cell or an insect cell (e.g., a baculovirus-infectible cell such as an Sf9 or HighFive cell).
  • suitable mammalian cells include various prostate cancer cell lines such as DU145 and TsuPrl , other transfectable or transducible prostate cancer cell lines, primary cells (PrEC), as well as a number of mammalian cells routinely used for the expression of recombinant proteins (e.g., COS, CHO, 293, 293T cells). More particularly, a polynucleotide comprising the coding sequence of 193P1E1B or a fragment, , analog or homolog thereof can be used to generate 193P1 E1 B proteins or fragments thereof using any number of host-vector ⁇ systems routinely used and widely known in the art. .
  • 193P1 E1 B proteins or fragments thereof are . available, see for example, Sambrook ef al., 1989, supra; Current Protocols in Molecular Biology, 1995, supra).
  • Preferred vectors • for mammalian expression include but are not limited to pcDNA 3.1 myc-His-tag (Invitrogen) and the retroviral vector pSR ⁇ tkneo (Muller ef al., 1991, MCB 11:1785).
  • 193P1E1B can be expressed in several prostate cancer and non-prostate cell lines, including for example 293, 293T, rat-1, NIH 3T3 and TsuPrl.
  • the host-vector systems ofthe invention are useful for the production of a 193P1E1B protein or fragment thereof. Such host-vector systems can be employed to study the functional properties of 193P1 E1B and 193P1E1 B mutations or analogs.
  • Recombinant human 193P1 E1 B protein or an analog or homolog or fragment thereof can be produced by mammalian cells transfected with a construct encoding a 193P1E1 B-related nucleotide.
  • 293T cells can be transfected with an expression plasmid encoding 193P1 E1 B or fragment, analog or homolog thereof, a 193P1 E1 B-related protein is expressed in the 293T cells, and the recombinant 193P1E1B protein is isolated using standard purification methods (e.g., affinity purification using anti-193P1E1B antibodies).
  • a 193P1E1B coding sequence is subcloned into the retroviral vector pSR ⁇ MSVtkneo and used to infect various mammalian cell lines, such as NIH 3T3, TsuPrl, 293 and rat-1 in order to establish 193P1E1B expressing cell lines.
  • various mammalian cell lines such as NIH 3T3, TsuPrl, 293 and rat-1
  • Various other expression systems well known in the art can also be employed.
  • Expression constructs encoding a leader peptide joined in frame to a 193P1E1B coding sequence can be used for the generation of a secreted form of recombinant 193P1 E1 B protein.
  • codon preferences for a specific species are calculated, for example, by utilizing codon usage tables available on the INTERNET such as at URL dna.affrc.go.jp/ ⁇ nakamura/codon.html.
  • Additional sequence modifications are known to enhance protein expression in a cellular host. These include elimination of sequences encoding spurious polyadenylation signals, exon/intron splice site signals, transposon-like repeats, and/or other such well-characterized sequences that are deleterious to gene expression.
  • the GC content ofthe sequence is adjusted to levels average for a given cellular host, as calculated by reference to known genes expressed in the host cell. Where possible, the sequence is modified to avoid predicted hai ⁇ in secondary mRNA structures.
  • Other useful modifications include the addition of a translational initiation consensus sequence at the start of the open reading frame, as described in Kozak, Mol. Cell Biol., 9:5073-5080 (1989).
  • 193P1 E1 B-related proteins Another aspect of the present invention provides 193P1 E1 B-related proteins.
  • Specific embodiments of 193P1 E1 B proteins comprise a polypeptide having all or part of the amino acid sequence of human 193P1 E1 B as shown in Figure 2 or ⁇ Figure 3.
  • embodiments of 193P1 E1 B proteins comprise variant, homolog or analog polypeptides that have • alterations in the amino acid sequence of 193P1 E1 B shown in Figure 2 or Figure 3.
  • Embodiments of a 193P1 E1 B polypeptide include: a 193P1 E1 B polypeptide having a sequence shown in Figure 2, a peptide sequence of a 193P1 E1 B as shown in Figure 2 wherein T is U; at least 10 contiguous nucleotides of a polypeptide having the sequence as shown in Figure 2; or, at least 10 contiguous peptides of a polypeptide having the sequence as shown in Figure 2 where T is U.
  • embodiments of 193P1E1B peptides comprise, without limitation:
  • VII a protein that comprises at least two peptides selected from the peptides set forth in Tables Vlll to XLIX collectively, with a proviso that the protein is not a contiguous sequence from an amino acid sequence of Figure 2;
  • (VIII) a protein that comprises ' at least one peptide selected from the peptides set forth in Tables VIII-XXI; and at least one peptide selected from the peptides set forth in Tables XXII to XLIX, with a proviso that the protein is not a contiguous sequence from an amino acid sequence of Rgure 2;
  • (IX) a polypeptide comprising at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35 amino acids of a protein of Figure 3A, 3B, 3C, 3D, 3E, 3F, 3G, or 3H in any whole number increment up to 412, 412, 12, 330, 388, 308, 73, or 372 respectively that includes at least 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 amino acid position(s) having a value greater than 0.5 in the Hydrophilicity profile of Figure 5;
  • (X) a polypeptide comprising atleast ⁇ , 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35 amino acids of a protein of Figure 3A, 3B, 3C, 3D, 3E, 3F, 3G, or 3H in any whole number increment up to 412, 412, 412, 330, 388, 308, 73, or 372 respectively, that includes at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 amino acid positions) having a value less than 0.5 in the Hydropathicity profile of Figure 6;
  • (XI) a polypeptide comprising at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 ⁇ 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35 amino acids of a protein of Figure 3A, 3B, 3C, 3D, 3E, 3F, 3G, or 3H in any whole number increment up to 412, 412, 412, 330, 388, 308, 73, or 372 respectively, that includes at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 3 ' 1, 32, 33, 34, 35 amino acid posifion(s) having a value greater than 0.5 in the Percent Accessible Residues profile of Figure 7;
  • (XII) a polypeptide comprising atleast 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35 amino acids of a protein of Figure 3A, 3B, 3C, 3D, 3E, 3F, 3G, or 3H in any whole number increment up To 412, 412, 412, 330, 388, 308, 73, or 372 respectively, that includes at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 amino acid position(s) having a value greater than 0.5 in the Average Flexibility profile of Figure 8;
  • (XIII) a polypeptide comprising at least 5, 6, 7, 8, 9, 0, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35 amino acids of a protein of Figure 3A, 3B, 3C, 3D, 3E, 3F, 3G, or 3H in any whole number increment up to 412, 412, 412, 330, 388, 308, 73, or 372 respectively, that includes at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 amino acid position(s) having a value greater than 0.5 in the Beta-turn profile of Figure 9;
  • XXI a peptide that occurs at least twice in Tables VIII-XXI, and at least twice in tables XXII to XLIX;
  • (XXII) a peptide which comprises one two, three, four, or five of the following characteristics, or an oligonucleotide encoding such peptide: i) a region of at least 5 amino acids of a particular peptide of Figure 3, in any whole number increment up to the full length of that protein in Figure 3, that includes an amino acid position having a value equal to or greater than 0.5, 0.6, 0.7, 0.8, 0.9, or having a value equal to 1.0, in the Hydrophilicity profile of Figure 5; ii) a region of at least 5 amino acids of a particular peptide of Figure 3, in any whole number increment up to the full length of that protein in Figure 3, that includes an amino acid position having a value equal to or less than 0.5, 0.4, 0.3, 0.2, 0.1, or having a value equal to 0.0, in the Hydropathicity profile of Figure 6; iii) a region of at least 5 amino acids of a particular peptide of Figure 3, in any whole number increment up to
  • (XXIII) a composition comprising a peptide of (IHXXH) or an antibody or binding region thereof together with a pharmaceutical, excipient and/or in a human unit dose form.
  • (XXIV) a method of using a peptide of (l)-(XXII), or an antibody or binding region thereof or a composition of (XXIII) in a method to modulate a cell expressing 193P1E1B,
  • (XXV) a method of using a peptide of (l)-(XXII) or an antibody or binding region thereof or a composition of (XXIII) in a method to diagnose, prophylax, prognose, or treat an individual who bears a cell expressing 193P1 E1 B
  • (XXVI) a method of using a peptide of (l)-(XXH) or an antibody or binding region thereof or a composition (XXIII) in a method to diagnose, prophylax, prognose, or treat an individual who bears a cell expressing 193P1 E1 B, said cell from a ⁇ cancer of a tissue listed in Table I;
  • (XXVII) a method of using a peptide of (l)-(XXII) or an antibody or binding region thereof or a composition of (XXIII) in a method to diagnose, prophylax, prognose, or treat a a cancer;
  • (XXVIII) a method of using a peptide of (l)-(XXII) or an antibody or binding region thereof or a composition of (XXIII) in a method to diagnose, prophylax, prognose, or treat a a cancer of a tissue listed in Table I;
  • (XXIX) a method of using a a peptide of ( l)-(XXI I) or an antibody or binding region thereof or a composition (XXIII) in a method to identify or characterize a modulator of a cell expressing 193P1 E1B.
  • Typical embodiments of the invention disclosed herein include 193P1 E1 B polynucleotides that encode specific portions of 193P1E1B mRNA sequences (and those which are complementary to such sequences) such as those that encode the proteins and/or fragments thereof, for example:
  • allelic variants of human 193P1 E1 B share a high degree of structural identity and homology (e.g., 90% or more homology).
  • allelic variants of a 193P1E1B protein contain conservative amino acid substitutions within the 193P1 E1 B sequences described herein or contain a substitution of an amino acid from a corresponding position in a homologue of 193P1 E1 B.
  • One class of 193P1 E1 B allelic variants are proteins that share a high degree of homology with at least a small region of a particular 193P1 E1 B amino acid sequence, but further contain a radical departure from the sequence, such as a non-conservative substitution, truncation, insertion or frame shift.
  • Proteins of the invention can comprise 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 conservative substitutions. Such changes include substituting any of isoleucine (I), valine (V), and leucine (L) for any other of these hydrophobic amino acids; aspartic acid (D) for glutamic acid (E) and vice versa; glutamine (Q) for asparagine (N) and vice versa; and serine (S) for threonine (T) and vice versa. Other substitutions .
  • glycine (G) and alanine (A) can frequently be interchangeable/as can alanine (A) and valine (V).
  • Methionine (M) which is relatively hydrophobic, can frequently be interchanged with leucine and isoleucine, and sometimes with valine.
  • Lysine (K) and arginine (R) are frequently interchangeable in locations in which the significant feature of the amino acid residue is its charge and the differing pK's of these two amino acid residues are not significant. Still, other changes can be considered "conservative" in particular environments (see, e.g.
  • Embodiments of the invention disclosed herein include a wide variety of art-accepted variants or analogs of 193P1E1B proteins such as polypeptides having amino acid insertions, deletions and substitutions.
  • 193P1E1B variants can be made using methods known in the art such as site-directed mutagenesis, alanine scanning, and PCR mutagenesis. Site- directed mutagenesis (Carter ef al., Nucl. Acids Res., 13:4331 (1986); Zoller ef al., Nucl.
  • Scanning amino acid analysis can also be employed to identify one or more amino acids along a contiguous sequence that is involved in a specific biological activity such as a protein-protein interaction.
  • preferred scanning amino acids are relatively small, neutral amino acids.
  • amino acids include alanine, glycine, serine, and cysteine.
  • Alanine is typically a preferred scanning amino acid among this group because it eliminates the side-chain beyond the beta- carbon and is less likely to alter the main-chain conformation of the variant. Alanine is also typically preferred because it is the most common amino acid. Further, it is frequently found in both buried and exposed positions (Creighton, The Proteins, (W.H. Freeman & Co., N.Y.); Chothia, J. Mol. Biol., 150:1 (1976)). If alanine substitution does not yield adequate amounts of variant, an isosteric amino acid can be used.
  • 193P1 E1 B variants, analogs or homologs have the distinguishing attribute of having at least one epitope that is "cross reactive" with a 193P1 E1 B protein having an amino acid sequence of Figure 3.
  • cross reactive means that an antibody or T cell that specifically binds to a 193P1 E1 B variant also specifically binds to a 193P1E1B protein having an amino acid sequence set forth in Figure 3.
  • a polypeptide ceases to be a variant of a protein shown in Figure 3, when it no longer contains any epitope capable of being recognized by an antibody or T cell that specifically binds to the starting 193P1 E1 B protein.
  • 193P1 E1 B-related protein variants share 70%, 75%, 80%, 85% or 90% or more similarity with an amino acid sequence of Figure 3, or a fragment thereof.
  • Another specific class of 193P1E1B protein variants or analogs comprises one or more ofthe 193P1E1B biological motifs described herein or presently known in the art.
  • analogs of 193P1 E1 B fragments that have altered functional (e.g. immunogenic) properties relative to the starting fragment. It is to be appreciated that motifs now or which become part ofthe art are to be applied to the nucleic or amino acid sequences of Figure 2 or Figure 3.
  • embodiments of the claimed invention include polypeptides containing less than the full amino acid sequence of a 193P1 E1 B protein shown in Figure 2 or Figure 3.
  • representative embodiments of the invention comprise peptides/proteins having any 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or more contiguous amino acids of a 193P1 E1 B protein shown in Figure 2 or Figure 3.
  • representative embodiments ofthe invention disclosed herein include polypeptides consisting of about amino acid 1 to about amino acid 10 of a 193P1E1B protein shown in Figure 2 or Figure 3, polypeptides consisting of about amino acid 10 to about amino acid 20 of a 193P1E1B protein shown in Figure 2 or Figure 3, polypeptides consisting of about amino acid 20 to about amino acid 30 of a 193P1E1B protein shown in Figure 2 or Figure 3, polypeptides ⁇ nsisting of about amino acid 30 to about amino acid 40 of a 193P1E1B protein shown in Figure 2 or Figure 3, polypeptides consisting of about amino acid 40 to about amino acid 50 of a 193P1 E1 B protein shown in Figure 2 or Figure 3, polypeptides consisting of about amino acid 50 to about amino acid 60 of a 193P1E1B protein shown in Figure 2 or Figure 3, polypeptides consisting of about amino acid 60 to about amino acid 70 of a 193P1 E1 B protein shown in Figure 2 or Figure 3,
  • polypeptides consisting of about amino acid 1 (or 20 or 30 or 40 etc.) to about amino acid 20, (or 130, or 140 or 150 etc.) of a 93P1 E1 B protein shown in Figure 2 or Figure 3 are embodiments of the invention. It is to be appreciated that the starting and stopping positions in this paragraph refer to the specified position as well as that position plus or minus 5 residues.
  • 193P1 E1 B-related proteins are generated using standard peptide synthesis technology or using chemical cleavage methods well known in the art. Alternatively, recombinant methods can be used to generate nucleic acid molecules that encode a 193P1 E1 B-related protein. In one embodiment, nucleic add molecules provide a means to generate defined fragments of a 193P1 E1 B protein (or variants, homologs or analogs thereof).
  • Additional illustrative embodiments ofthe invention disclosed herein include 193P1E1B polypeptides comprising the amino acid residues of one or more of the biological motifs contained within a 193P1 E1 B polypeptide sequence set forth in Figure 2 or Figure 3.
  • Table V sets forth several frequently occurring motifs based on pfam searches (see URL address pfam.wustl.edu/). The columns of Table V list (1 ) motif name abbreviation, (2) percent identity found amongst the different member of the motif family, (3) motif name or description and (4) most common function; location information is included if the motif is relevant for location.
  • Polypeptides comprising one or more ofthe 193P1E1B motifs discussed above are useful in elucidating the specific characteristics of a malignant phenotype in view of the observation that the 193P1 E1 B motifs discussed above are associated with growth dysregulation and because 193P1E1B is overexpressed in certain cancers (See, e.g., Table I).
  • Casein kinase II, cAMP and camp-dependent protein kinase, and Protein Kinase C are enzymes known to be associated with the development of the malignant phenotype (see e.g.
  • proteins of the invention comprise one or more of the immunoreactive epitopes identified in accordance with art-accepted methods, such as the peptides set forth in Tables VIII-XXI and XXII-XLIX.
  • CTL epitopes can be determined using specific algorithms to identify peptides within a 193P1E1B protein that are capable of optimally binding to specified HLA alleles (e.g., Table IV; EpimatrixTM and EpimerTM, Brown University, URL brown.edu/ResearcfvTB- HIV_Lab/epimatrix/epimatrix.html; and BIMAS, URL bimas.dcrt.nih.gov/.)
  • processes for identifying peptides that have sufficient binding affinity for HLA molecules and which are correlated with being immunogenic epitopes are well known in the art, and are carried out without undue experimentation.
  • processes for identifying peptides that are immunogenic epitopes are well known in the art
  • epitopes in order to modulate immunogenicity. For example, one begins with an epitope that bears a CTL or HTL motif (see, e.g., the HLA Class I and HLA Class II motifs/supermotifs of Table IV).
  • the epitope is analoged by substituting out an amino acid at one of the specified positions, and replacing it with another amino acid specified for that position.
  • residues defined in Table IV one can substitute out a deleterious residue in favor of any other residue, such as a preferred residue; substitute a less- preferred residue with a preferred residue; or substitute an originally-occurring preferred residue with another preferred residue. Substitutions can occur at primary anchor positions or at other positions in a peptide; see, e.g., Table IV.
  • Preferred embodiments contain no insertions, deletions or substitutions either within the motifs or within the intervening sequences of the polypeptides.
  • embodiments which include a number of either N-terminal and/or C-terminal amino acid residues on either side of these motifs may be desirable (to, for example, include a greater portion of the polypeptide architecture in which the motif is located).
  • the number of N-terminal and/or C-terminal amino acid residues on either side of a motif is between about 1 to about 100 amino acid residues, preferably 5 to about 50 amino acid residues.
  • 193P1E1 B-related proteins are embodied in many forms, preferably in isolated form.
  • a purified 193P1E1B protein molecule will be substantially free of other proteins or molecules that impair the binding of 193P1 E1 B to antibody, T cell or other ligand. The nature and degree of isolation and purification will depend on the intended use.
  • Embodiments of a 193P1E1 B-related proteins include purified 193P1E1 B-related proteins and functional, soluble 193P1E1 B-related proteins.
  • a functional, soluble 193P1E1B protein or fragment thereof retains the ability to be bound by antibody, T cell or other ligand.
  • the invention also provides 193P1 E1 B proteins comprising biologically active fragments of a 193P1 E1 B amino acid sequence shown in Figure 2 or Figure 3. Such proteins exhibit properties of the starting 193P1 E1 B protein, such as the ability to elicit the generation of antibodies that specifically bind an epitope associated with the starting 193P1E1B protein; to be bound by such antibodies; to elicit the activation of HTL or CTL; and/or, to be recognized by HTL or CTL that also specifically bind to the starting protein.
  • 193P E1 B-related polypeptides that contain particularly interesting structures can be predicted and/or identified using various analytical techniques well. known in the art, including, for example, the methods of Chou-Fasman, Garnier-Robson, Kyte- Doolittle, Eisenberg, Karplus-Schultz or Jameson-Wolf analysis, or based on immunogenicity. Fragments that contain such structures are particularly useful in generating subunit-specjfic anti-193P1 E1 B antibodies or T cells or in identifying cellular factors • that bind to 193P1E1B. For example, hydrophilicity profiles can be generated, and immunogenic peptide fragments identified, using the method of Hopp, T.P. and Woods, K.R., 1981; Proc.
  • Hydropathicity profiles ⁇ can be generated, and immunogenic peptide fragments, identified, using the method of Kyte, J. and Doolittle, R.F., 1982, J. " Mol. Biol. 157:105-132. Percent (%) Accessible Residues profiles can be generated, and immunogenic peptide fragments identified, using the method of Janin J., 1979, Nature 277:491-492. Average Flexibility profiles can be generated, and immunogenic peptide fragments identified, using the method of Bhaskaran R., Ponnuswamy P.K., 1988, Int. J. Pept. Protein • Res. 32:242-255. Beta-turn profiles can be generated, and immunogenic peptide fragments identified, using the method of Deleage, G. , Roux B. , 1987, Protein Engineering 1 :289-294.
  • CTL epitopes can be determined using specific algorithms to identify peptides within a 193P1 E1 B protein that are capable of optimally binding to specified HLA alleles (e.g., by using the SYFPEITHI site at World Wide Web URL syfpeithLbmi- • heidelberg.com/; the listings in Table IV(A)-(E); EpimatrixTM and EpimerTM, Brown University, URL (brown.edu/Research/TB- HIV_Lab/epimatrix/epimatrixhtml); and BIMAS, URL bimas.dcrt.nih.gov/).
  • peptide epitopes from 193P1E1B that are presented in the context of human MHC Class I molecules, e.g., HLA-A1 , A2, A3, A11 , A24, B7 and B35 were predicted (see, e.g., Tables VIII-XXI, XXII-XLIX).
  • the complete amino acid sequence ofthe 193P1E1B protein and relevant portions of other variants i.e., for HLA Class I predictions 9 flanking residues on either side of a point mutation or exon juction, and for HLA Class II predictions 14 flanking residues on either side of a point mutation or exon junction corresponding to that variant, were entered into the HLA Peptide Motif Search algorithm found in the Bioinformatics and Molecular Analysis Section (BIMAS) web site listed above; in addition to the site SYFPEITHI, at URL syfpeithi.bmi- heidelberg.com/.
  • the HLA peptide motif search algorithm was developed by Dr.
  • the epitopes preferably contain a leucine (L) or methionine (M) at position 2 and a valine (V) or leucine (L) at the C-terminus (see, e.g., Parker etal, J. Immunol. 149:3580-7 (1992)).
  • Selected results of 193P1E1B predicted binding peptides are shown in Tables VIII-XXI and XXII-XLIX herein.
  • Tables VIII-XXI and XXII-XLVII selected candidates, 9-mers and 10-mers, for each family member are.shown along with their location, the amino acid sequence of each specific peptide, and an estimated binding score.
  • Tables XLVI-XLIX selected candidates, 15- mers. for each family member are shown along with their location, the amino acid sequence of each specific peptide, and an estimated binding score.
  • the binding score corresponds to the estimated half time of dissociation of complexes containing the peptide at 37°C at pH 6.5.
  • Peptides with the highest binding score are predicted to be the most tightly bound to HLA Class I on the cell surface for the greatest period of time and thus represent the best immunogenic targets for T-cell recognition.
  • every epitope predicted by the BIMAS site, EpimerTM and EpimatrixTM sites, or specified by'the HLA class I or class II motifs available in the art or which become part ofthe art such as set forth in Table IV (or determined using World Wide Web site URL syfpeithi.bmi-heidelberg.com/, or BIMAS, bimas.dcrt.nih.gov/) are to be "applied” to a 193P1 E1 B protein in accordance with the invention.
  • “applied” means that a 193P1 E1 B protein is evaluated, e.g., * visually or by computer-based patterns finding methods, as appreciated by those of skill in the relevant art.
  • Every subsequence of a 193P1 E1 B protein of 8, 9, 10, or 11 amino acid residues that bears an HLA Class I motif, or a subsequence of 9 of more amino acid residues that bear an HLA Class II motif are within the scope ofthe invention.
  • 193P1E1B can be conveniently expressed in celis (such ⁇ as 293T cells) transfected with a commercially available expression vector such as a CMV-driven expression vector encoding 193P1 E1 B with a C-terminal 6XHis and MYC tag (pcDNA3.1/mycHIS, Invitrogen or Tag5, GenHunter Corporation, Nashville TN).
  • the Tag5 vector provides an IgGK secretion signal that can be used to facilitate the production of a secreted 193P1E1B protein in transfected cells.
  • the secreted HIS-tagged 193P1E1B in the culture media can be purified, e.g., using a nickel column:using standard techniques.
  • 193P1 E1 B-related proteins such as covalent modifications are included within the scope of this invention.
  • One type of covalent modification includes reacting targeted amino acid residues of a 193P1 E1 B polypeptide with an organic derivatizing agent that is capable of reacting with selected side chains or the N- or C- terminal residues of a 193P1 E1 B protein.
  • Another type of covalent modification of a 193P1 E1 B polypeptide included within the scope of this invention comprises altering the native glycosylation pattern of a protein of the invention.
  • 193P1 E1 B Another type of covalent modification of 193P1 E1 B comprises linking a 193P1 E1 B polypeptide to one of a variety of nonproteinaceous polymers, e.g., polyethylene glycol (PEG), polypropylene glycol, or polyoxyalkylenes, in the manner set forth in U.S. Patent Nos.4,640,835; 4,496,689; 4,301,144; 4,670,417; 4,791,192 or 4,179,337.
  • PEG polyethylene glycol
  • polypropylene glycol polypropylene glycol
  • polyoxyalkylenes polyoxyalkylenes
  • the 193P1E1 B-related proteins ofthe present invention can also be modified to form a chimeric molecule comprising 193P1E1B fused to another, heterologous polypeptide or amino acid sequence.
  • a chimeric molecule can be synthesized chemically or recombinantly.
  • a chimeric molecule can have a protein ofthe invention fused to another tumor- associated antigen or fragment thereof.
  • a protein in accordance with the invention can comprise a fusion of fragments of a 193P1 E1 B sequence (amino or nucleic acid) such that a molecule is created that is not, through its length, directly homologous to the amino or nucleic acid sequences shown in Figure 2 or Figure 3.
  • Such a chimeric molecule can comprise multiples of the same subsequence of 193P1 E1 B.
  • a chimeric molecule can comprise a fusion of a 193P1 E1 B- related protein with a polyhistidine epitope tag, which provides an epitope to which immobilized nickel can selectively bind, ⁇ with cytokines or with growth factors.
  • the epitope tag is generally placed at the amino- or carboxyl- terminus of a 193P1 E1 B protein.
  • the chimeric molecule can comprise a fusion of a 193P1 E1 B-related protein with an immunoglobulin or a particular region of an immunoglobulin.
  • the chimeric molecule also referred to as an "immunoadhesin"
  • a fusion could, be to the Fc region of an IgG molecule.
  • the Ig fusions preferably include the substitution of a soluble (transmembrane domain deleted or inactivated) form of a 193P1 E1 B polypeptide in place of at least one variable region within an Ig molecule.
  • the immunoglobulin fusion includes the hinge, CH2 and CH3, or the hinge, CHI, CH2 and CH3 regions of an IgGI molecule.
  • the proteins of the invention have a number of different specific uses.
  • 193P1E1B is highly expressed in prostate and other cancers
  • 193P1 E1 B-related proteins are used in methods that assess the status of 193P1 Et B gene products in normal versus cancerous tissues, thereby elucidating the malignant phenotype.
  • polypeptides from specific regions, of a 193P1E1B protein are used to assess the presence of perturbations (such as deletions, insertions, point mutations etc.) in those regions (such as regions containing one or more motifs).
  • Exemplary assays utilize antibodies or T cells targeting 193P1E1 B-related proteins comprising the amino acid residues of one or more ofthe biological motifs contained within a 193P1 E1 B polypeptide sequence in order to evaluate the characteristics of this region in normal versus cancerous tissues or to elicit an immune response to the epitope.
  • 193P1E1B-related proteins that contain the amino acid residues, of one or more of the biological motifs in a 193P1 E1 B protein are used to screen for factors that interact with that region of 193P1E1B.
  • 193P1E1B protein fragments/subsequences are particularly useful in generating and characterizing domain-specific antibodies (e.g. , antibodies recognizing an extracellular or intracellular epitope of a 193P1 E1 B protein), for identifying agents or cellular factors that bind to 193P1 E1 B or a particular structural domain thereof, and in various therapeutic and diagnostic contexts, including but not limited to diagnostic assays, cancer vaccines and methods of preparing such vaccines.
  • domain-specific antibodies e.g. , antibodies recognizing an extracellular or intracellular epitope of a 193P1 E1 B protein
  • Proteins encoded by the 193P1E1B genes, or by analogs, homologs or fragments thereof, have a variety of uses, including but not limited to generating antibodies and in methods for identifying ligands and other agents and cellular constituents that. bind to a 193P1 E1 B gene product.
  • Antibodies raised against a 193P1 E1 B protein or fragment thereof are . useful in diagnostic and prognostic assays, and imaging methodologies in the management of human cancers characterized by expression of 193P1E1 B protein, such as those listed in Table I. Such antibodies can be expressed intracellularly and used in methods of treating patients with such cancers.
  • 193P1E1 B-related nucleic acids or proteins are also used in generating HTL or CTL responses.
  • Various immunological assays useful for the detection of 193P1 E1 B proteins are used, including but not limited to various types of radioimmunoassays, enzyme-linked immunosorbent assays (ELISA), enzyme-linked immunofluorescent assays (ELIFA), immunocytochemical methods, and the like.
  • Antibodies can be labeled and used as immunological imaging reagents capable of detecting 193P1E1B-expressing cells (e.g., in radioscintigraphic imaging methods).
  • 193P1E1B proteins are also particularly useful in generating cancer vaccines, as further described herein.
  • Another aspect of the in ention provides antibodies that bind to 193P1 E1 B-related proteins.
  • Preferred antibodies specifically bind , to a 193P1 E1 B-related protein and do not bind (or bind weakly) to peptides or proteins that are not 193P1 E1 B- related proteins under physiological conditions.
  • physiological conditions include: 1) phosphate buffered saline; 2) Tris-buffered saline containing 25mM Tris and 150 mM NaCl; or saline (0.9% NaCl); 4) animal serum such as human serum; or 5) a combination of any of 1) through 4); these reactions preferably taking place at pH 7.5, alternatively in a range of pH 7.0 to 8.0, or alternatively in a range of pH 6.5 to 8.5; also, these reactions taking place at a temperature between 4°C to 37°C.
  • antibodies that bind 193P1E1B can bind 193P1E1 B-related proteins such as the homologs or analogs thereof.
  • 193R1E1B antibodies ofthe invention are particularly useful in cancer (see, e.g., Table I) diagnostic and prognostic assays, and imaging methodologies. Similarly, such antibodies are useful in the treatment, diagnosis, and/or prognosis of other cancers, to the extent 193P1 E1 B is also expressed or overexpressed in these other cancers. Moreover, intracellularly expressed antibodies (e.g., single chain antibodies) are therapeutically useful in treating cancers in which the expression of 193P1 E1 B is involved, such as advanced or metastatic prostate cancers.
  • the invention also provides various immunological assays useful for the detection.and quantification of 193P1 E1 B and mutant 193P1 E1 B-related proteins.
  • Such assays can comprise one or more 193P1 E1 B antibodies capable of recognizing and binding a 193P1 E1 B-related protein, as appropriate.
  • These assays are performed within various immunological assay formats well known in the art, including but not limited to various types of radioimmunoassays, enzyme-linked immunosorbent assays (ELISA), enzyme-linked immunofluorescent assays (ELIFA), and the like.
  • Immunological non-antibody assays ofthe invention also comprise T cell immunogenicity assays (inhibitory or stimulatory) as well as major histocompatibility complex (MHC) binding assays.
  • T cell immunogenicity assays inhibitory or stimulatory
  • MHC major histocompatibility complex
  • immunological imaging methods capable of detecting prostate cancer and other cancers expressing 193P1 E1 B are also provided:by the invention, including but not limited to radioscintigraphic imaging methods using labeled 193P1E1B antibodies.
  • Such assays are clinically useful in the detection, monitoring, and prognosis of 193P1E1B expressing cancers such as prostate cancer. .
  • - 193P1E1B antibodies are also used in methods for purifying a 193P1E1 B-related protein and for isolating 193P1E1B homologues and related molecules.
  • a method of purifying a 193P1 E1 B-related protein comprises incubating a 193P1 E1 B antibody, which has been coupled to a solid matrix, with a lysate or other solution containing a 193P1 E1 B-related protein under conditions that permit the 193P1 E1 B antibody to bind to the 193P1 E1 B-related protein; washing the solid matrix to eliminate impurities; and eluting the 193P1 E1 B-related protein from the coupled antibody.
  • Other uses of 193P1 E1 B antibodies in accordance with the invention include generating anti-idiotypic antibodies that mimic a 193P1 E1 B protein.
  • antibodies can be prepared by immunizing a suitable mammalian host using a 193P1 E1 B-related protein, peptide, or fragment, in isolated or immunoconjugated form (Antibodies: A Laboratory Manual, CSH Press, Eds., Hariow, and Lane (1988); Hariow, Antibodies, Cold Spring Harbor Press, NY (1989)).
  • fusion proteins of 193P1E1B can also be used, such as a 193P1E1B GST-fusion protein.
  • a GST fusion protein comprising all or most of the amino acid sequence of Rgure 2 or Figure 3 is produced, then used as an im unogen to generate appropriate antibodies.
  • a 193P1 E1 B-related protein is synthesized and used as an immunogen.
  • naked DNA immunization techniques known in the art are used (with or without purified 193P1 E1 B-related protein or 193P1E1B expressing cells) to generate an immune response to the encoded immunogen (for review, see Donnelly et a/., 1997, Ann. Rev. Immunol. 15: 617-648).
  • the amino acid sequence of a 193P1 E1 B protein as shown in Figure 2 or Figure 3 can be analyzed to select specific regions of the 193P1 E1 B protein for generating antibodies.
  • hydrophobicity and hydrophilicity analyses of a 193P1 E1 B amino acid sequence are used to identify hydrophilic regions in the 193P1 E1 B structure.
  • Regions of a 193P1 E1 B protein that show immunogenic structure, as well as other regions and domains, can readily be identified using various other methods known.in.-the art, such as Chou-Fasman, Gamier-Robson, Kyte-Doolittle, Eisenberg, Karplus-Schultz or Jameson-Wolf analysis.
  • Hydrophilicity profiles can be generated using the method of Hopp, T.P. and Woods, K.R., 1981, Proc. Natl. Acad. Sci. U.S.A. 78:3824-3828. Hydropathicity profiles can be generated using the method of Kyte, J. and Doolittle, R.F., 1982, J. Mol. Biol.157:105-132. Percent (%) Accessible Residues profiles can be generated using the method of Janin J., 1979, Nature 277:491-492: Average Flexibility profiles can be generated using the method of Bhaskaran R., Ponnuswamy P.K., 1988, Int. J. Pept. Protein Res.32:242-255.
  • Beta-turn profiles can be generated using the method of Deleage, G., Roux B., ⁇ 1987, Protein Engineering 1:289-294. Thus, each region identified by any of these programs or methods is within the scope of ⁇ ⁇ the present invention. Methods for the generation of 193P1 E1 B antibodies are further illustrated by way of the examples provided . ⁇ herein. Methods for preparing a protein or polypeptide for use as an immunogen are well known in the art; Also well known in the . art are methods for preparing immunogenic conjugates of a protein with a carrier, such as BSA, KLH or other carrier.protein. In .
  • 193P1E1B monoclonal antibodies can be producedbyvarious meanswell known in theart
  • immortalized cell lines that secrete a desired monodonal antibody are prepared using the standard hybridoma technology of Kohler and Milstein • or modifications that immortalize antibody-producing B cells, as is generally known.
  • Immortalized cell lines that secrete the desired antibodies are screened by immunoassay in which the antigen is a 193P1E1 B-related protein.
  • the appropriate immortalized cell culture is identified, the cells can be expanded and antibodies produced either from in vitro cultures orfrom ascites fluid.
  • the antibodies or fragments of the invention can also be produced, by recombinant means. Regions that bind specifically to the desired regions of a 193P1 E1 B protein can also be produced in the context of chimeric or complementarity- determining region (CDR) grafted antibodies of multiple species origin. Humanized or human 193P1 E1 B antibodies can also be produced, and are. preferred for use in therapeutic contexts.
  • CDR complementarity- determining region
  • Fully human 193P1E1B monoclonal antibodies can be generated •• using cloning technologies employing large human Ig gene combinatorial libraries (i.e., phage display) (Griffiths and Hoogenboo , Building an in vitro immune system: human antibodies from phage display libraries. In: Protein Engineering of Antibody Molecules for Prophylactic and Therapeutic Applications in Man, Clark, M. (Ed.), Nottingham Academic, pp 45-64 (1993); Burton and Barbas, Human Antibodies from combinatorial libraries. Jd., pp 65-82).
  • Fully human 193P1 E1 B monoclonal antibodies can also be produced using transgenic mice engineered to contain human immunoglobulin gene loci as described in PCT Patent Application W098/24893, Kucherlapati and Jakobovits et al, published December 3, 1997 (see also, Jakobovits, 1998, Exp. Opin. Invest. Drugs 7(4): 607-614; U.S. patents 6,162,963 issued 19 December 2000; 6,150,584 issued 12 November 2000; and, 6,114598 issued 5 September 2000). This method avoids the in itro manipulation required with phage display technology and efficiently produces high affinity authentic human antibodies.
  • 193P1 E1 B antibodies with a 193P1 E1 B-related protein can be established by a number of well known means, including Western blot, immunoprecipitation, ELISA, and FACS analyses using, as appropriate, 193P1E1 B-related proteins, 193P1 E1 B-expressing cells or extracts thereof.
  • a 193P1 E1 B antibody or fragment thereof can be labeled with a detectable marker or conjugated to a second molecule. Suitable detectable markers include, but are not limited to, a radioisotope, a fluorescent compound, a bioluminescent compound, chemiluminescent compound, a metal chelatoror an enzyme.
  • bi-specific antibodies specific for two or more 193P1 E1 B epitopes are generated using methods generally known in the art.
  • Homodimeric antibodies can also be generated by cross-linking techniques known in the art (e.g., Wolff ef al, Cancer Res.53: 2560-2565). ,
  • compositions'Of the invention induce a therapeutic or prophylactic immune responses in very broad segments of the world- . wide, population.
  • immunology-related technology For an understanding of the value and efficacy of compositions of the invention that induce cellular immune responses, a brief review of immunology-related technology is provided.
  • a complex of an HLA molecule and a peptidic antigen acts as the ligand recognized by HLA-restricted T cells (Bulls, S. etalfCell 47:1071 , 1986; Babbitt, B. P. etal, Nature 317:359, 1985; Townsend, A. and Bodmer, H., Annu. Rev. Immunol.7:601, 1989; Germain, R. N., Annu. Rev. Immunol. 11:403, 1993).
  • class I and class II allele-specific HLA binding motifs allows identification of regions within a protein that are correlated with binding to particular HLA antigen(s).
  • T us by a process of HLA motif identification, candidates for epitope-based vaccines have been identified; such candidates can be further evaluated by HLA-peptide binding assays to determine binding affinity and/or the time period of association ofthe epitope and its corresponding HLA molecule. Additional confirmatory work can be performed to select, amongst these vaccine candidates, epitopes with preferred characteristics in terms of population coverage, and/or immunogenicity.
  • HLA transgenic mice see, e.g., Wentworth, P. A. ef al, J. Immunol.26:97, 1996; Wentworth, P. A. etal, Int. Immunol. 8:651, 1996; Alexander, J. ef al, J. Immunol 159:4753, 1997).
  • peptides in incomplete Freund's adjuvant are administered subcutaneously to HLA transgenic mice.
  • splenocytes are removed and cultured in vitro in the presence of test peptide for approximately one week.
  • Peptide-specific T cells are detected using, e.g:, a 51 Cr-release assay involving peptide sensitized target cells and target ceils expressing endogenously generated antigen.
  • recall responses are detected by culturing PBL from subjects that have been exposed to the antigen due to disease and thus have generated an immune response "naturally", or from patients who were vaccinated against the antigen.
  • PBL from subjects are cultured in vitro for 1 -2 weeks in the presence of test peptide plus antigen presenting cells (APC) to allow activation of "memory" T cells, as compared to "naive” T cells.
  • APC antigen presenting cells
  • T cell activity is detected using assays including 51 Cr release involving peptide-sensitized targets, T cell proiiferation, or lymphokine release.
  • Nucleic acids that encode a 193P1E1 B-related protein can also be used to generate either transgenic animals or "knock out" animals that, in turn, are useful in the development and screening of therapeutically useful reagents.
  • cD A encoding 193P1 E1 B can be used to clone genomic DNA that encodes 193P1E1B. The cloned genomic sequences can then be used to generate transgenic animals containing cells that express DNA that encode 193P1 E1 B.
  • Methods for generating transgenic animals, particularly animals such as mice or rats have become conventional in the art and are described, for example, in U.S. Patent Nos. 4,736,866 issued 12 April 1988, and 4,870,009 issued 26 September 1989.
  • particular cells would be targeted for 193P1 E1 B transgene incorporation with tissue-specific enhancers.
  • Transgenic animals that include a copy of a transgene encoding 193P1 E1 B can be used to examine the effect of increased expression of DNA that encodes 193P1E1 B. Such animals can.be used as tester animals for reagents.thought to confer protection from, for example, pathological conditions associated with its overexpression.
  • an animal is treated with a reagent and a reduced incidence of a pathological condition, compared to untreated animals that bear the transgene, would indicate a potential therapeutic intervention for the pathological condition.
  • non-human homologues of 193P1E1B can be used to constructa 193P1E1B "knock out" animal that has a defective or altered gene encoding 193P1E1B as a result of homologous recombination between the endogenous gene encoding 193P1 E1 B and altered genomic DNA encoding 193P1 E1 B introduced into an embryonic cell of the animal.
  • cDNA that encodes 193P1 E1B can be used to clone genomic DNA encoding 193P1 E1 B in accordance with established techniques.
  • Aportion of the genomic DNA encoding 193P1E1B can be deleted or replaced with another gene, such as a gene encoding a selectable marker that can be used to monitor integration.
  • another gene such as a gene encoding a selectable marker that can be used to monitor integration.
  • several kilobases of unaltered flanking DNA are included in the vector (see, e.g., Thomas and Capecchi, CeJ, 51:503 (1987) for a description of homologous recombination vectors).
  • the vector is introduced into an embryonic stem cell line (e.g., by electroporation) and cells in which the introduced DNA has homologously recombined with the endogenous DNA are selected (see, e.g., Li ef a/., Cell, 69:915 (1992)).
  • the selected cells are then injected into a blastocyst of an animal (e.g., a mouse or rat) to form aggregation chimeras (see, e.g., Bradley, in Teraiocarcinomas and Embryonic Stem.Cells: A Practical Approach, E. J. Robertson, ed. (IRL, Oxford, 1987), pp. 113-152).
  • a chimeric embryo can then be implanted into a • suitable pseudopregnant female foster animal, and the embryo brought to term to create a "knock out" animal.
  • Progeny harboring the homologously recombined DNA in their germ cells can be identified by standard techniques and used to breed . animals in which, all cells of the animal contain the homologously recombined DNA.
  • Knock out animals can be characterized, for example, for their ability to defend against certain pathological conditions or for their development of pathological conditions due to absence of a 193P1E1B polypeptide.
  • Another aspect of the present invention relates to methods for detecting 193P1 E1 B polynucleotides and 193P1E1B- related proteins, as well as methods for identifying a cell that expresses 193P1 E1 B.
  • the expression profile of 193P1 E1 B makes it a diagnostic marker for metastasized disease. Accordingly, the status of 193P1E1B gene products provides information useful for predicting a variety of factors induding susceptibility to advanced stage disease, rate of progression, and/or tumor aggressiveness.
  • the status of 193P1E1B gene products in patient samples can be analyzed by a variety protocols that are well known in the art including immunohistochemical analysis, the variety of Northern blotting techniques including in situ hybridization, RT-PCR analysis (for example on laser capture micro-dissected samples), Western blot analysis and tissue array analysis.
  • the invention provides assays for the detection of 193P1 E1 B polynucleotides in a biological sample, such as serum, bone, prostate, and other tissues, urine, semen, cell preparations, and the like.
  • Detectable 193P1E1B polynucleotides include, for example, a 193P1E1B gene or fragment thereof, 193P1E1B mRNA, alternative splice variant 193P-1E1 B mRNAs, and recombinant DNA or RNA molecules that contain a i 93P1 E1 B polynucleotide.
  • a number of methods for amplifying and/or detecting the presence of 193P1 E1 B polynucleotides are well known in the art and can be employed in the practice of this asped of the invention.
  • a method for detecting a 193P1 E1 B mRNA in a biological sample comprises producing cDNA from the sample by reverse transcription using at least one primer; amplifying the cDNA so produced using a 193P1 E1 B polynucleotides as sense and antisense primers to amplify 193P1 E1B cDNAs therein; and detecting the presence ofthe amplified 193P1 E1 B cDNA.
  • the sequence of the amplified 193P1 E1 B cDNA can be determined.
  • a method of detecting a 193P1 E1 B gene in a biological sample comprises first isolating genomic DNA from the sample; amplifying the isolated genomic DNA using 193P1E1 B polynucleotides as sense and antisense primers; and detecting the presence of the amplified 193P1 E1 B gene.
  • Any number of appropriate sense and antisense probe combinations can be designed from a 193P1 E1 B nucleotide sequence (see, e.g., Figure 2) and used for this purpose.
  • the invention also provides assays for detecting the presence of a 193P1 E1 B protein in a tissue or other biological sample such as serum, semen, bone, prostate, urine, cell preparations, and the like.
  • Methods for detecting a 193P1 E1 B-related protein are also well known and include, for example, immu ⁇ oprecipitation, immunohistochemical analysis, Western blot analysis, molecular binding assays, ELISA, ELIFA and the like.
  • a method of detecting the presence of a 193P1 E1 B-related protein in a biological sample comprises first contacting the sample with a 193P1E1B antibody, a 193P1E1B-reactive fragment thereof, or a recombinant protein containing an antigen-binding region of a 193P1E1B antibody; and then detecting the binding of 193P1E1B-related protein in the sample.
  • an assay for identifying a cell that expresses a 193P1 E1 B gene comprises detecting the presence of 193P1 E1 B mRNA in the cell.
  • Methods for the detection of particular mRNAs in cells include, for example, hybridization assays using complementary DNA probes (such as in situ hybridization using labeled 193P1E1B riboprobes, Northern blot and related techniques) and various nucleic acid amplification assays (such as RT-PCR using complementary primers specific for 193P1E1B, and other amplification type detection methods, such as, for example, branched DNA, SISBA, TMA and the like).
  • an assay for identifying a ceil that expresses a 193P1E1B gene comprises detecting the presence of 193P1E1 B-related protein in the cell or secreted by the cell.
  • Various methods for the detection of proteins are well known in the art and are employed for the detection of 193P1 E1 B-related proteins and cells that express 193P1 E1 B-related proteins.
  • 193P1E1B expression analysis is also useful as a tool for identifying and evaluating agents that modulate 193P1E1B gene expression.
  • 193P1E1B expression is significantly upregulated in prostate cancer, and is expressed in cancers of the tissues listed in Table I.
  • Identification of a molecule or biological agent that inhibits 193P1 E1 B expression or over-expression in cancer cells is of therapeutic value.
  • such an agent can be identified, by using a screen that quantifies 193P1 E1 B expression by RT-PCR, nucleic acid hybridization or antibody binding.
  • Oncogenesis is known to be a multistep process where cellular growth becomes progressively dysregulated and cells progress from a normal physiological state to precancerous and then cancerous states (see, e.g., Alers ef al, Lab • Invest: 77(5): 437-438 (1997) and Isaacs ef al, Cancer Surv.23: 19-32 (1995)).
  • examining a biological sample for evidence of dysregulated cell growth allows for early detection of such aberrant physiology, before a pathologic state such as cancer has progressed to a stage that therapeutic options are more limited and or the prognosis is worse.
  • the status of 193P1E1B in a biological sample of interest can be compared, for example, to the status of 193P1 E1 B in a corresponding normal sample (e.g, a sample from that individual or alternatively another individual that is not affected by a pathology).
  • a corresponding normal sample e.g, a sample from that individual or alternatively another individual that is not affected by a pathology.
  • An alteration in the status of 193P1E1B in the biological sample provides evidence of dysregulated cellular growth.
  • a predetermined normative value such as a predetermined normal level of mRNA expression (see, e.g., Grever ef al, J. Comp. Neurol. 1996 Dec 9; 376(2): 306-14 and U.S. Patent No.5,837,501) to compare 193P1E1B status in a sample.
  • status'' in this context is used according to its art accepted meaning and refers to the condition or state of a gene and its products. Typically, skilled artisans use a number- of parameters to evaluate the condition or state of a gene and its products. These indude, but are not limited to the location of expressed gene products (including the location of 193P1 E1 B expressing cells) as well as the level, and biological activity of expressed gene products (such as 193P1E1 B mRNA, . polynucleotides and polypeptides).
  • an alteration in the status of 193P1E1B comprises a change in the location of 193P1E1B and/or 193P1 E1B expressing cells and/or an increase in 193P1E1B mRNA and/or protein expression.
  • 193P1E1B status in a sample can be analyzed by a number of means well known in the art, including without limitation, immunohistochemical analysis, in situ hybridization, RT-PCR analysis on laser capture micro-disseded samples, Western blot analysis, and tissue array analysis.
  • Typical protocols for evaluating the status of a 193P1 E1 B gene and gene produds are found, for example in Ausubel ef al. eds., 1995, Current Protocols In Molecular Biology, Units 2 (Northern Blotting), 4 (Southern Blotting), 15 (Immunoblotting) and 18 (PCR Analysis).
  • the status of 193P1E1B in a biological sample is evaluated by various methods utilized by skilled artisans including, but not limited to genomic Southern analysis (to examine, for example perturbations in a 193P1 E1 B gene), Northern analysis and/or PCR analysis of 193P1 E1 B mRNA (to examine, for example alterations in the polynucleotide sequences or expression levels of 193P1 E1 B mRNAs), and, Western and/or immunohistochemical analysis (to examine, for example alterations in polypeptide sequences, alterations in polypeptide ⁇ localization within a sample, alterations in expression levels of 193P1E1B proteins and/or associations of 193P1E1B proteins with polypeptide binding partners).
  • genomic Southern analysis to examine, for example perturbations in a 193P1 E1 B gene
  • Northern analysis and/or PCR analysis of 193P1 E1 B mRNA to examine, for example alterations in the polynucleotide sequences or expression levels of 193P1 E1
  • Detectable 193P1 E 1 B polynucleotides include, for example, a 193P1 E1 B gene or fragment thereof, 193P1E1B mRNA, alternative splice variants, 193P1E1B mRNAs, and recombinant DNA or RNA molecules containing a 193P1E1B polynucleotide.
  • the expression profile of 193P1E1B makes it a diagnostic marker for local and/or metastasized disease, and provides information on the growth or oncogenic potential of a biological sample.
  • the status of 193P1E1B provides information useful for predicting susceptibility to particular disease stages, progression, and/or tumor aggressiveness.
  • the invention provides methods and assays for determining 193P1 E1 B status and diagnosing cancers that express 193P1 E1 B, such as cancers of the tissues listed in Table I.
  • assays that evaluate the levels of 193P1 E1 B mRNA transcripts or proteins in a biological sample can be used to diagnose a disease assodated with 193P1E1B dysregulation, and can provide prognostic information useful in .defining appropriate therapeutic options. ., ⁇
  • the expression status of 193P1 E1 B provides information including the presence, stage and location of dysplastic, precancerous and cancerous cells, predicting susceptibility to various stages of disease, and/or for gauging tumor aggressiveness. Moreover, the.expression profile makes it useful as an imaging reagent for metastasized disease. : Consequently, an aspect of the invention is directed to the various molecular prognostic and diagnostic methods for examining the status of 193P1E1B.in biological samples such as those from individuals suffering from, or suspected of suffering from a pathology characterized by dysregulated cellular growth, such as cancer.
  • the status of 193P1E1B in a biological sample can be examined by a number of well-known procedures in the art. For example, the status of 193P1E1B in a biological sample taken from a specific location in the body can be examined ⁇ by : evaluaf ⁇ ng the sample for the presence or absence of 193P1E1B expressing cells (e.g. those that express 193P1E1B mRNAs or proteins).
  • This examination can provide evidence of dysregulated cellular growth,- for example, when.193P1E1B-expressing cells are found in a biological sample that does not normally contain such cells (such as aly ph node), because such alterations in the status of 193P1E1B in a biological sample are often associated with dysregulated cellular growth.
  • one indicator of dysregulated cellular growth is the metastases of cancer cells from an organ of origin (such as the prostate) to a different area of the body (such as a lymph node).
  • evidence of dysregulated cellular growth is important for example because occult lymph node metastases can be detected in a substantial proportion of patients with prostate cancer, and such metastases are associated with known predictors of disease progression (see, e.g., Murphy ef a/., Prostate 42(4): 315-317 (2000);Su ef a/., Se in. Surg. Oncol. 18(1): 17-28 (2000) and Freeman etal, J Urol 1995 Aug 154(2 Pt 1):474-8).
  • the invention provides methods for monitoring 193P1 E1 B gene products by determining the status of 193P1E1B gene products expressed by cells from an individual suspected of having a disease associated with ; dysregulated cell growth (such as hyperplasia or cancer) and then comparing the status so determined to the status of 193P1E1B gene products in a corresponding normal sample.
  • dysregulated cell growth such as hyperplasia or cancer
  • the presence of aberrant 193P1E1B gene products in the test sample relative to the normal sample provides an indication ofthe presence of dysregulated cell growth within the cells ofthe individual.
  • the invention provides assays useful in determining the presence of cancer in an individual, comprising detecting a significant increase in 193P1 E1 B mRNA or protein expression in a test cell or tissue sample relative to expression levels in the corresponding normal cell or tissue.
  • the presence of 193P1E1B mRNA can, for example, be evaluated in tissues including but not limited to those listed in Table I.
  • the presence of significant 193P1E1B expression in any of these tissues is useful to indicate the emergence, presence and/or severity of a cancer, since the corresponding normal tissues do not express 193P1E1B mRNA or express it at lower levels.
  • 193P1 E1 B status is determined at the protein level rather than at the nucleic acid level.
  • a method comprises determining the level of 193P1 E1 B protein expressed by cells in a test tissue sample and comparing the level so determined to the level of 193P1 E1 B expressed in a corresponding normal sample.
  • - the presence of 193P1 E1B protein is evaluated, for example, using immunohistochemical methods.
  • 193P1E1B antibodies or binding partners capable of detecting 193P1E1B protein expression are used in a variety of assay formats well known in the art for this purpose.
  • methylation status of a 193P1 E1 B gene in a biological sample. Aberrant demethylation and/or hypermethylation of CpG islands in gene 5' regulatory regions frequently occurs in immortalized and transformed cells, and can result in altered expression of various genes. For example, promoter hypermethylation of the pi-class . glutathione S-transferase (a protein expressed in normal prostate but not expressed in >90% of prostate carcinomas) appears to permanently silence transcription of this gene and is the most frequently detected genomic alteration in prostate carcinomas (De Marzo ef a/., Am. J. Pathol. 155(6): 1985-1992 (1999)).
  • MSP methylation specific PCR
  • This procedure involves initial modification of DNA by sodium bisulfite (which will convert all ⁇ nmethylated cytosines to uradl) followed by amplification using primers specific for methylated versus unmethylated DNA Protocols involving methylation interference can also be found for example in Current Protocols In Molecular Biology, Unit 12, Frederick M. Ausubel etal eds., 1995.
  • Gene amplification is an additional method for assessing the status of 193P1E1B.
  • Gene amplification is measured in a sample directly, for example, by conventional Southern blotting or Northern blotting to quantitate the transcription of mRNA (Thomas, 1980, Proc. Natl. Acad. Sci. USA, 77:5201-5205), dot blotting (DNA analysis), or in situ hybridization, using an appropriately labeled probe, based on the sequences provided herein.
  • antibodies are employed that recognize specific duplexes, including DNA duplexes, RNA duplexes, and DNA-RNA hybrid duplexes or DNA-protein duplexes. The antibodies in turn are labeled and the assay carried out where the duplex is bound to a surface, so that upon the formation of duplex on the surface, the presence of antibody bound to the duplex can be detected.
  • Biopsied tissue or peripheral blood can be conveniently assayed for the presence of cancer cells using for example, Northern, dot Motor RT-PCR analysis to detect 193P1 E1 B expression.
  • the presence of RT-PCR amplifiable 193P1 E1 B mRNA provides an indication of the presence of cancer.
  • RT-PCR assays are well known in the art.
  • RT-PCR detection assays for tumor cells in peripheral blood are currently being evaluated for use in the diagnosis and management of a number of human solid tumors. In the prostate cancer field, these include RT-PCR assays for the detection of cells expressing PSA and PSM (Verkaik ef a/., 1997, Ural. Res.25:373-384; Ghossein etal, 1995, J. Clin. Oncol. 13:1195-2000; Heston etal, 1995, Clin. Chem.41:1687- 1688). ; ⁇ • ; ⁇ -
  • a further aspect of the invention is an assessment of the susceptibility that an individual has for developing cancer.
  • a method for prediding susceptibility to cancer comprises detecting 193P1 E1 B mRNA or 193P1 E1 B protein in a tissue sample, its presence indicating susceptibility to cancer, wherein the degree of 193P1E1B mRNA expression correlates to the degree of susceptibility.
  • the presence of 193P1 E1 B in prostate or other tissue is examined, with the : presence of 193P1 E1 B in the sample providing an indication of prostate cancer susceptibility (or the emergence or existence of a prostate tumor).
  • 193P1 E1 B nucleotide and amino acid sequences in a biological sample, in order to identify perturbations in the structure of these molecules such as insertions, deletions, substitutions and the like.
  • the presence of one or more perturbations in 193P1E1B gene products in the sample is an indication of cancer susceptibility (or the emergence or existence of a tumor).
  • a method for gauging aggressiveness of a tumor comprises determining the level of 193P1 E1 B mRNA or 193P1 E1 B protein expressed by-tumor cells, comparing the level so detemiined to the level of 193P1E1B mRNA or 193P1E1B protein expressed in a corresponding-normal tissue-taken from the same individual or a normal tissue reference sample, wherein the degree of 193P1E1B mRNAor 193P1E1B protein expression in the tumor sample relative to the normal sample indicates the degree of aggressiveness.
  • aggressiveness of a tumor is evaluated- by determining the extent to which 193P1E1B is expressed in the tumor cells, with higher expression levels indicating more aggressive tumors.
  • Another embodiment is the evaluation of the- integrity of 193P1E1B nucleotide and amino acid sequences in a biological sample, in order to identify perturbations in the structure of these ⁇ • molecules such as insertions, deletions, substitutions and the like. The presence of one or more perturbations indicates more aggressive tumors.
  • methods for observing the progression of a malignancy in an individual overtime comprise determining the level of 193P1 E1 B mRNA or 193P1 E1 B protein expressed by cells in a sample of the tumor, comparing • the level so determined to the level of 193P1E1B mRNA or 193P1E1B protein expressed in an equivalent tissue sample taken from the same individual at a different time, wherein the degree of 193P1 E1 B mRNA or 193P1 E1 B protein expression s the tumor sample overtime provides information on the progression ofthe cancer.
  • the progression of a cancer is evaluated by determining 193P1E1B expression in the tumor cells overtime, where increased expression overtime indicates a progression of the cancer. Also, one can evaluate the integrity 193P1 E1 B nucleotide and amino acid sequences in a biological sample in order to identify perturbations in the structure of these molecules such as insertions, deletions, substitutions and the like, where the presence of one or more perturbations indicates a progression ofthe cancer.
  • Another embodiment of the invention is directed to methods for observing a coinddence between the expression of 193P1 E1 B gene and 193P1 E1B gene products (or perturbations in 193P1 E1 B gene and 193P1 E1 B gene products) and a factor that is associated with malignancy, as a means for diagnosing and prognosticating the status of a tissue sample.
  • factors associated with malignancy can be utilized, such as the expression of genes associated with malignancy (e.g.
  • Methods for observing a coincidence between the expression of 193P1E1B gene and 193P1E1B gene products (or perturbations in 193P1E1B gene and 193P1E1B gene products) and another factor that is associated with malignancy are useful, for example, because the presence of a set of specific factors that coincide with disease provides information crucial for diagnosing and prognosticating the status of a tissue sample.
  • methods for observing a coincidence between the expression of 193P1 E1 B gene and 193P1E1B are possible.
  • gene products or perturbations in 193P1E1Bgene and 193P1E1B gene products
  • another factor associated with.malignancy • i ⁇ htails detecting the overexpression of 193P1 E1 B mRNA or protein in a tissue sample, detecting the overexpression of PSA mRNA or protein in a tissue sample (or PSCA or PSM expression), and observing a coincidence of 193P1 E1 B mRNA or protein and PSA mRNAor protein overexpression (or PSCA or PSM expression).
  • the expression of 193P1E1B and PSA mRNA in prostate tissue is examined, where the coincidence of 193P1 E1 B and PSA mRNA overexpression in the .sample indicates the existence of prostate cancer, prostate cancer susceptibility or the emergence or status of a prostate tumor.
  • RT-PCR is used to detect and quantify 193P1 E1 B mRNA expression.
  • Any number of primers capable of amplifying 193P1E1B can be used for this purpose, including but not limited to the various primer sets specifically described herein.
  • polyclonal or monoclonal antibodies spedfically reactive with the wild-type 193P1E1B.protein ⁇ can be used in an immunohistochemical assay of biopsied tissue. • • • ⁇ ⁇ ⁇
  • the 193P1E1 B protein and nucleic acid sequences disclosed herein allow a skilled artisan to identify proteins, small molecules and other agents that interact with 193P1E1B, as well as pathways activated by 193P1E1B via any one of a variety of art accepted protocols.
  • one can utilize one of the so-called interaction trap systems also referred to as the "two-hybrid assay".
  • molecules interact and reconstitute a transcription factor which directs expression of a reporter gene, whereupon the expression of the reporter gene is assayed.
  • Other systems identify protein- protein interactions In vivo through reconstitution of a eukaryotic transcriptional activator, see, e.g., U.S. Patent Nos.
  • peptide libraries can be screen peptide libraries to identify molecules that interact with 193P1 E1 B protein sequences.
  • peptides that bind to 193P1E1B are identified by screening libraries that encode a random or controlled collection of amino acids.
  • Peptides encoded by the libraries are expressed as fusion proteins of bacteriophage coat proteins, the bacteriophage particles are then screened against the 193P1E1B protein(s).
  • peptides having a wide variety of uses are thus identified without any prior information on the structure of the expected ligand or receptor molecule.
  • Typical peptide libraries and screening methods that can be used to identify molecules that interact with 193P1E1B protein sequences are disclosed for example in U.S. Patent Nos. 5,723,286 issued 3 March 1998 and 5,733,731 issued 31 March 1998.
  • cell lines that express 193P1 E1 B are used to identify protein-protein interactions mediated by 193P1 E1 B. Such interactions can be examined using immunoprecipitation techniques (see, e.g., Hamilton B. J., ef al Biochem. Biophys. Res. Commun. 1999, 261:646-51).
  • 193P1E1B protein can be immunoprecipitated from 193P1E1B- expressing cell lines using anti-193P1E1B antibodies.
  • antibodies against His-tag can be used in a cell line engineered to express fusions of 193P1E1B and a His-tag (vectors mentioned above).
  • the immunoprecipitated complex can be examined for protein association by procedures such as Western blotting, 35 S-methionine labeling of proteins, protein microsequencing, silver staining and two-dimensional gel electrophoresis.
  • Small molecules and ligands that interact with 193P1 E1 B can be identified through related embodiments of such ; screening assays. For example, small molecules can be identified that interfere with protein function, including -molecules that interfere with 193P1E1B's ability to mediate phosphorylation and de-phosphorylation, interaction with DNA or RNA molecules as'an indication of regulation of cell cycles/second messenger signaling or tumorigenesis. Similarly, small molecules that modulate 193P1E1 B-related ion channel, protein pump,- or cell communication functions are identified and used.
  • ligands that regulate 193P1E1B function can be . ' identified based on their ability to bind 193P1 E1 B and activate a reporter construct. Typical methods are discussedior example in U.S. Patent No. 5,928,868 issued 27 July 1999; and include methods for forming hybrid ligands in which at least one ligand is a small molecule.
  • cells engineered to express a fusion protein of 193P1E1B and a DNA-binding protein are used to co-express a fusion protein of a hybrid ligand/small molecule and a cDNA library transcriptional activator protein.
  • the cells further contain a reporter gene,, the expression of which is conditioned on the proximity of the first and second fusion proteins to each other, an event that occurs only if the hybrid ligand binds to target ' sites, on both hybrid proteins.
  • Those cells that express the reporter gene are selected and the unknown small molecule or ' the unknown ligand is identified. This method provides a means of identifying modulators, which activate or inhibit ⁇ ⁇ - 193P1E1B.
  • An embodiment of this invention comprises a method of screening for a molecule that interacts with a 193P1 E1 B amino acid sequence shown in Figure 2 or Figure 3, comprising the steps of contacting a population of molecules with a 193P1 E1 B amino acid sequence, allowing the population of molecules and the 193P1 E1 B amino acid sequence to interact under conditions that facilitate an interaction, determining the presence of a molecule that interacts with the 193P1E1 B amino acid sequence, and then separating molecules that do not interact with the 193P1 E1 B amino acid sequence from molecules that do.
  • the method further comprises purifying, characterizing and identifying a molecule that interacts with the 193P1E1B amino acid sequence. The identified molecule can be used to modulate a function performed by 193P1E1B.
  • the 193P1E1B amino acid sequence is contacted with a library of peptides;
  • 193P1 E1 B functions as a transcription factor involved in activating tumor-promoting genes or repressing genes that block tumorigenesis;
  • therapeutic approaches that inhibit the activity of a 193P1E1B protein are useful for patients suffering from a cancer that expresses 193P1 E1 B.
  • These therapeutic approaches generally fall into two classes.
  • One class comprises various methods for inhibiting the binding or association of a 193P1 E1 B protein with its binding partner or with other proteins.
  • Another class comprises a variety of methods for inhibiting the transcription of a 193P1 E1 B gene or' translation of 193P1 E1 B mRNA.
  • the invention provides cancer vaccines comprising a 193P1E1 B-related protein or 193P1E1 B-related nucleic acid.
  • cancer vaccines prevent and/or treat 193P1 E1 B-expressing cancers with minimal or no effects on non-target tissues.
  • the use of a tumor antigen in a vaccine mat generates humoral and/or cell-mediated immune responses as anti-cancer therapy is well known in the art and has been employed in prostate cancer using human PSMA and rodent PAP immunogens (Hodge ef al, 1995, Int. J. Cancer 63:231-237; Fong ef al, 1997; J. Immunol. 159:3113-3117); .
  • Such methods can be readily practiced by employing a 193P1E1 B-related protein, or a 193P1E1B-encoding nucleic acid molecule and recombinant vectors capable of expressing and presenting the 193P1E1 B immunoge fwhich typically comprises.a number of antibody or T cell epitopes).
  • Skilled artisans understand that a wide variety of vaccine systems for deliveryOf immunoreactive epitopes are known in the art (see, e.g., Heryln et al, Ann Med 1999 Feb 31(1):66- 78; Maruyama et al, Cancer Immunol Immunother 2000 Jun 49(3):123-32) Briefly, such methods of generating an immune . response (e.g.
  • a mammal's immune system comprises the steps of: exposing the mammal's immune system to an immunoreactive epitope (e.g. an epitope present in a 193P1 E1 B protein shown in Figure 3 or analog or homolog thereof) so that the mammal generates an immune response that is specific for that epitope (e.g. generates antibodies that specifically recognize that epitope).
  • an immunoreactive epitope e.g. an epitope present in a 193P1 E1 B protein shown in Figure 3 or analog or homolog thereof
  • a 193P1E1B immunogen contains a biological motif, see e.g., Tables VIII-XXI and XXII-XLIX, or a peptide of a size range from 193P1E1B indicated in Figure 5, Figure 6, Figure 7; Figure 8, and Figure 9.
  • Such vaccine compositions can include, for example, lipopeptides (e.g.,Vitiello, A. ef al, J. Clin. Invest. -95:341, 1995), peptide compositions encapsulated in poly(DL-lactide-co-glycolide) ("PLG”) microspheres (see, e.g., Eldridge, ef al, Molec. Immunol.
  • lipopeptides e.g.,Vitiello, A. ef al, J. Clin. Invest. -95:341, 1995
  • PLG poly(DL-lactide-co-glycolide)
  • Toxin-targeted delivery technologies also known as receptor mediated targeting, such as those of Avant Immunotherapeutics, Inc. (Needham, Massachusetts) may also be used.
  • the vacdne compositions ofthe invention can also be used in conjunction with other treatments used for cancer, e.g., surgery, chemotherapy, drug therapies, radiation therapies, efc. including use in combination with immune adjuvants such as IL-2, IL-12, GM-CSF, and the like.
  • CTL epitopes can be determined using specific algorithms to identify peptides within 193P1 E1 B protein that bind corresponding HLA alleles (see e.g., Table IV; EpimerTM and EpimatrixTM, Brown University (URL brown.edu/Research/TB- HIV_Lab/epimatrix/epimatrix.html); and, BIMAS, (URL bimas.dcrt.nih.gov/; SYFPEITHI at URL syfpeithi.bmi-heidelberg.comt).
  • a 193P1E1B immunogen contains one or more amino acid sequences identified using techniques well known in the art, such as the sequences shown in Tables VIII-XXI and XXII-XLIX or a peptide of 8, 9, 10 or 11 amino acids specified by an HLA Class I motif/supermotif (e.g., Table IV (A), Table IV (D), or Table IV (E)) and/or a peptide of at least 9 amino acids that comprises an HLA Class II motif/supermotif (e.g., Table IV (B) or Table IV (C)).
  • HLA Class I motif/supermotif e.g., Table IV (A), Table IV (D), or Table IV (E)
  • HLA Class II motif/supermotif e.g., Table IV (B) or Table IV (C)
  • the HLA Class I binding groove is essentially closed ended so that peptides of only a particular size range can fit into the groove and be bound, generally HLA Class I epitopes are 8, 9, 10, or 11 amino acids long.
  • the HLA Class II binding groove is essentially open ended; therefore a peptide of about 9 or more amino acids can be bound by an HLA Class I molecule. Due to the binding groove differences between HLA Class I and II, HLA Class I motifs are length specific, i.e., position two of a Class I motif is the second amino acid in an amino to carboxyl direction of the peptide.
  • HLA Class II epitopes are often 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 amino acids long, or longer than 25 amino acids.
  • Methods of generating an immune response in a mammal comprise exposing the mammal's immune system to an immunogenic epitope on a protein (e.g. a 193P1E1B protein) so that an immune response is generated.
  • a protein e.g. a 193P1E1B protein
  • a typical embodiment consists of a method for generating an immune response to 193P1 E1 B in a host, by contacting the host with a sufficient amount of at least one 193P1E1B B cell or cytotoxic T-cell epitope or analog thereof; and at least one periodic interval thereafter re-contacting the host with the 193P1 E1 B B cell or cytotoxic T-cell epitope or analog thereof.
  • a specific embodiment consists of a method of generating an immune response against a 193P1 E1 B-related protein or a man-made multiepitopic peptide comprising: administering 193P1 E1 B immunogen (e.g.
  • vacdne preparations further contain a suitable adjuvant (see, e.g., U.S. Patent No. 6,146,635) or a universal helper epitope such as a PADRETM peptide (Epimmune Inc., San Diego, CA; see, e.g., Alexander ef al, J- Immunol. 2000 164(3); 164(3): 1625-1633; Alexander et al, Immunity 1994 1(9): 751-761 and Alexander ef a/., Immunol. Res.
  • a suitable adjuvant see, e.g., U.S. Patent No. 6,146,635
  • a universal helper epitope such as a PADRETM peptide (Epimmune Inc., San Diego, CA; see, e.g., Alexander ef al, J- Immunol. 2000 164(3); 164(3): 1625-1633; Alexander et al, Immunity 1994 1(9): 751-761 and Alexander
  • An alternative method comprises generating an immune response in an individual against a 193P1E1B immunogen by: administering in vivo to muscle or skin ofthe individual's body a DNA molecule that comprises a DNA sequence that encodes a 193P1E1B immunogen, the DNA sequence operatively linked to regulatory sequences which control the expression of the DNA sequence; wherein the DNA molecule is taken up by cells, the DNA sequence is expressed in the cells and an immune response is generated against the immunogen (see, e.g., U.S. Patent No. 5,962,428).
  • a genetic vaccine facilitator such as anionic lipids; saponins; lectins; estrogenic compounds; hydroxylated lower alkyls; dimethyl sulfoxide; and urea is also administered.
  • an antiidiotypic antibody can be administered that mimics 193P1E1B, in order to generate a response to the target antigen.
  • Vaccine compositions ofthe invention include nucleic acid-mediated modalities.
  • DNA or RNA that encode protein(s) of the invention can be administered to a patient.
  • Genetic immunization methods can be employed to generate prophylactic or therapeutic humoral and cellular immune responses directed against cancer cells expressing 193P1 E1 B.
  • Constructs comprising DNA encoding a 193P1 E1B-related protein/immunogen and appropriate regulatory sequences can be injected directly into muscle or skin of an individual, such that the cells of the muscle or skin take-up the construct and express the encoded 193P1E1B protein/immunogen.
  • a vaccine comprises a 193P1 E 1 B-related protein.
  • 193P1E1 B-related protein immunogen results in the generation of prophylactic or therapeutic humoral and cellular immunity against cells that bear a 193P1 E1 B protein.
  • Various prophylactic and therapeutic genetic immunization techniques known in the art can be used (for review, see information and references published at Internet address . genweb.com). Nucleic acid-based delivery is described, for instance, in Wolff ef. al, Science 247:1465 (1990) as well as • U.S. Patent Nos. 5,580,859; 5,589,466; 5,804,566; 5,739,118; 5,736,524; 5,679,647; WO 98/04720.
  • DNA-based delivery technologies include "naked DNA”, facilitated (bupivicaine, polymers, peptide-mediated) delivery, cationic lipid complexes, ancfparticle-mediated (“gene gun”) or pressure-mediated delivery (see, e.g., U.S. Patent No.5,922,687).
  • proteins of the invention can be expressed via viral or bacterial vectors.
  • viral gene delivery systems that- can be used in the pradice of the invention include, but are not limited to,:Vaccinia, fowlpox, canarypox, adenovirus, influenza, poliovirus, adeno : associated virus, lentivirus, and Sindbis virus (see, e.g., Restifo, 1996, Curr. Opin. Immunol.8:658-663; Tsang ef al. J. Natl. Cancer Inst. 87:982-990 (1995)).
  • Non-viral delivery-systems : ⁇ ⁇ can also be employed by introducing naked DNA encoding a 193P1 E1 B-related protein into the patient (e.g., intramuscularly or intradermally) to.induce an anti-tumor response.
  • Vaccinia virus is used; for example, as a vector to express nucleotide sequences that encode the peptides of the invention. Upon introduction into a host, the recombinant vaccinia virus expresses the protein immunogenic peptide, and thereby elicits a host immune response.
  • Vaccinia vectors and methods useful in immunization protocols are described in, e.g.,,.U.S. Patent No.4,722,848.
  • Another vector is BCG (Bacille Calmette Guerin). BCG vectors are described in Stover ef ⁇ al., -Nature 351:456-460 (1991).
  • vectors useful for therapeutic administration or immunization ofthe ..- peptides of the invention e.g. adeno and adeno-associated virus vectors, retroviral vectors, Salmonella typhi vectors, detoxified anthrax toxin vectors, and the like, will be apparent to those skilled in the art from the description herein.
  • gene delivery systems are used to deliver a 193P1 E1 B-related nucleic acid molecule.
  • the full-length human 193P1E1B cDNA is employed.
  • 193P1E1Bnucleic acid molecules encoding spedfic .., cytotoxic T lymphocyte (CTL) and/or antibody epitopes are employed. . , Ex Vivo Vaccines
  • APCs antigen presenting cells
  • DC dendritic cells
  • DRCs antigen presenting cells
  • DRCs dendritic cells
  • Dendritic ceils express MHC class I and II molecules, B7 co-stimulator, and IL-12, and are thus highly specialized antigen presenting cells.
  • PSMA prostate-specific membrane antigen
  • dendritic cells can be used to present 193P1E1B peptides to T cells in the context of MHC class I or II molecules.
  • autologous dendritic cells are pulsed with 193P1 E1 B peptides capable of binding to MHC class I and/or class 11 molecules.
  • dendritic cells are pulsed with the complete 193P1E1B protein.
  • Yet another embodiment involves engineering the overexpression of a 193P1 E1 B gene in dendritic cells using various implementing vectors known in the art, such as adenovirus (Arthur ef al,
  • 193P1 E1 B is an attractive target for antibody-based therapeutic strategies.
  • a number of antibody strategies are known in the art for targeting both extracellular and intracellular molecules (see, e.g., complement and ADCC mediated killing as well as the use of intrabodies).
  • 193P1 E1 B is expressed by cancer cells of various lineages relative to corresponding normal cells, systemic administration of 193P1E1B-immunoreactive compositions are prepared that exhibit excellent sensitivity without toxic, non-specific and/or non-target effects caused by binding of the immunoreactive composition to non-target organs and tissues.
  • Antibodies specifically reactive with domains of 193P1E1B are useful to treat 193P1 E1 B-expressing cancers systemically, either as conjugates with a toxin or therapeutic agent, or as naked antibodies - capable of inhibiting cell proliferation or function.
  • •.: • • • ' ⁇ ' • 193P1E1B antibodies can be introduced into a patient such that the antibody binds to 193P1 E1 B and modulates a ' function, such as an interaction with a binding partner, and consequently mediates destruction of the tumor cells and/or ⁇ inhibits the growth of the tumor cells.
  • Mechanisms by which such antibodies exert a therapeutic effect can include . complement-mediated cytolysis, antibody-dependent cellular cytotoxicity, modulation ofthe physiological function of -. • 193P1E1B, inhibition of ligand binding or signal transduction pathways, modulation of tumor cell differentiation, alteration of tumor angiogenesis factor profiles, and/or apoptosis.
  • antibodies can be used to specifically target and bind immunogenic molecules such as an immunogenic region of a 193P1 E1 B sequence shown in Figure 2 or Figure 3.
  • cytotoxic agents see, e.g., Slevers ef al. Blood 93:11 3678- 3684 (June 1, 1999)
  • the cytotoxic agent will exert its known ⁇ ⁇ biological effect (i.e. cytotoxicity) on those cells. ⁇ ,.
  • compositions and methods for using antibody-cytotoxic agent conjugates to kill cells are known in - the, art.
  • typical methods entail administering to an animal having a tumor a biologically effective amount of a conjugate comprising a selected cytotoxic and/or therapeutic agent linked to a targeting agent (e.g-. an anti- 193P1 E1 B antibody) that binds to a marker (e.g. 193P1 E1 B) expressed, accessible ' to binding or localized on the cell- surfaces.
  • a targeting agent e.g-. an anti- 193P1 E1 B antibody
  • a marker e.g. 193P1 E1 B
  • a typical embodiment is a method of delivering a cytotoxic and/or therapeutic agent to a cell expressing 193P1 E1 B, comprising conjugating the cytotoxic agent to an antibody that immunospecifically binds to a 193P1 E1 B epitope, and, exposing the cell to the antibody-agent conjugate.
  • Another illustrative embodiment is a method of treating an individual suspected of suffering from metastasized cancer, comprising a step of administering parenterally to said individual a pharmaceutical composition comprising a therapeutically effective amount of an antibody, conjugated to a cytotoxic and/or therapeutic agent.
  • Cancer immunotherapy using anti-193P1 E1 B antibodies can be done in accordance with various approaches that have been successfully employed in the treatment of other types of cancer, including but not limited to colon cancer (Arlen et al, 1998, Crit. Rev. Immunol. 18:133-138), multiple myeloma (Ozaki ef al, 1997, Blood 90:3179-3186, Tsunenari etal, 1997, Blood 90:2437-2444), gastric cancer (Kasprzyk ef al, 1992, Cancer Res.52:2771-2776), B-cell lymphoma (Funakoshi ef al, 1996, J. Immunother. Emphasis Tumor Immunol.
  • leukemia Zhong ef a/., 1996, Leuk. Res. 20:581-589
  • colorectal cancer Moun ef al, 1994, Cancer Res.54:6160-6166; Velders ef al, 1995, Cancer Res.55:4398-4403
  • breast cancer Shepard ef al, 1991 , J. Clin. Immunol. 11:117-127.
  • Some therapeutic approaches involve conjugation of naked antibody to a toxin or radioisotope, such as the conjugation of Y 91 or I 131 to anti-CD20 antibodies (e.g., ZevalinTM, IDEC Pharmaceuticals Corp.
  • antibodies and other therapeutic agents such as HerceptinTM (trastuzumab) with paclitaxel (Genentech, Inc.).
  • the antibodies can be conjugated to a therapeutic agent.
  • 193P1 E1 B antibodies can be administered in conjunction with radiation, chemotherapy or hormone ablation.
  • antibodies can be conjugated to a toxin such as calicheamicin (e.g., MylotargTM, Wyeth-Ayerst, Madison, NJ, a recombinant humanized lgG4 kappa antibody conjugated to antitumor antibiotic calicheamicin) or a maytansinoid (e.g., taxane-based Tumor-Activated Prodrug, TAP, platform, ImmunoGen, Cambridge, MA, also see e:g.; US Patent 5,416,064).
  • a toxin such as calicheamicin (e.g., MylotargTM, Wyeth-Ayerst, Madison, NJ, a recombinant humanized lgG4 kappa antibody conjugated to antitumor antibiotic calicheamicin) or a maytansinoid (e.g., taxane-based Tumor-Activated Prodrug, TAP, platform, ImmunoGen, Cambridge, MA, also see e:g.;
  • antibody therapy can be particularly appropriate in advanced or metastatic cancers. Treatment with the antibody therapy of the invention is indicated for patients who have received one or more rounds of chemotherapy. Alternatively, antibody therapy of the invention is combined with a chemotherapeutic or radiation regimen for patients who have not received chemotherapeutic treatment. Additionally, antibody therapy can enable the use of reduced dosages of concomitant chemotherapy, particularly for patients who do not tolerate the toxicity of the chemotherapeutic agent very well. Fan et al. (Cancer Res. 53:4637-4642, 1993), Prewett et al. ' (International J. of Onco. 9:217-224, 1996), and Hancock et al. (Cancer Res. 51:4575-4580, 1991) describe the use of various antibodies together with chemotherapeutic agents.
  • antibody therapy can be particularly appropriate in advanced or metastatic cancers. Treatment with the antibody therapy of the invention is indicated for patients ⁇ who have received one or more rounds of chemotherapy. Alternatively, antibody therapy ofthe invention is combined with a chemotherapeutic or radiation regimen for patients who have not received chemotherapeutic treatment. Additionally, antibody therapy can enable the use of reduced dosages of concomitant chemotherapy, particularly for patients who do not tolerate the toxicity of the chemotherapeutic agent very well.
  • Ca ⁇ cer ⁇ patients can be evaluated for the presence and level of 193P1 E1B expression, preferably using immunohistochemical assessments of tumor tissue, quantitative 193P1E1B imaging, or other techniques that reliably indicate the presence and degree of 193P1E1B expression. Immunohistochemical analysis of tumor biopsies or surgical specimens is preferred for this purpose. Methods for immunohistochemical analysis of tumor tissues are well known in the art.
  • Anti-193P1 E1 B monoclonal antibodies that treat prostate and other cancers include those that initiate a potent immune response against the tumor or those that are directly cytotoxic.
  • anti-193P1 E1 B monoclonal antibodies can elicit tumor cell lysis by either complement-mediated or antibody-dependent cell cytotoxicity (ADCC) mechanisms, both of which require an intact Fc portion of the immunoglobulin molecule for interaction with effector cell Fc receptor sites on complement proteins.
  • ADCC antibody-dependent cell cytotoxicity
  • anti-193P1 E1 B mAbs that exert a direct biological effect on tumor growth are useful to treat cancers that express 193P1 E1 B.
  • Mechanisms by which directly cytotoxic mAbs act include: inhibition of cell growth, modulation of cellular differentiation, modulation of tumor angiogenesis factor profiles, and the induction of apoptosis.
  • the mechanism(s) by which a particular anti-193P1 E1 B mAb exerts an anti-tumor effect is evaluated using any number of in vitro assays that evaluate cell death such as ADCC, ADMMC, complement-mediated cell lysis, and so forth, as is generally known in the art.
  • murine or other non-human monoclonal antibodies, or human/mouse chimeric mAbs can induce moderate to ⁇ trong immune responses against the non-human antibody. This can result in clearance ofthe antibody from circulation and reduced efficacy. In the most severe cases, such an immune response can lead to the extensive formation of immune complexes which, potentially, can cause renal failure.
  • preferred monoclonal antibodies used in the therapeutic methods of the invention are those that are either fully human or humanized and that bind specifically to the target 193P1 E1 B antigen with high affinity but exhibit low or no antige ⁇ icity in the patient
  • Therapeutic methods ofthe invention contemplate the administration of single anti-193P1E1B mAbs as well as combinations, or cocktails, of different mAbs.
  • Such Ab cocktails can have certain advantages inasmuch as they contain mAbs that target different epitopes, exploit different effector mechanisms or combine directly cytotoxic mAbs with mAbs that rely on immune effector functionality. Such mAbs in combination can exhibit synergistic therapeutic effects.
  • anti- 193P1 E1 B mAbs can be administered concomitantly with other therapeutic modalities, including but not limited to various chemotherapeutic agents, androgen-blockers, immune modulators (e.g., IL-2, GM-CSF), surgery or radiation.
  • the anti- 193P1E1B mAbs are administered in their "naked” or unconjugated form, or can have a therapeutic agent(s) conjugated to them.
  • Anti-193P1 E1 B antibody formulations are administered via any route capable of delivering the antibodies to a tumor, cell.
  • Routes of administration include, but are not limited to, intravenous, intraperitoneal, intramuscular, intratumor, intradermal, and: the like.
  • Treatment generally involves repeated administration of the anti-193P1 E1 B antibody preparation, ⁇ via an acceptable route of administration such as intravenous injection (IV), typically at a dose in the range of about 0.1 , .2, - ⁇ .3, .4, .5, .6, .7, .8, .9., 1, 2, 3, 4, 5, 6, 7, 8, 9, 0, 15, 20, or 25 mg/kg body weight.
  • IV intravenous injection
  • doses in the range of 10-1000 mg mAb per week are effective. and well tolerated.
  • an initial loading dose of approximately 4 mg/kg patient body weight IV, followed by weekly doses of about 2 mg/kg IV of the anti- •193P1E1B mAb preparation represents an acceptable dosing regimen.
  • the initial loading dose is administered as . a- 90 minute or longer infusion.
  • the periodic maintenance dose is administered as a -30 minute or longer infusion; provided ⁇ the initial dose was well tolerated.
  • factors can influence the ideal dose regimen in a particular case. Such factors include, for example, the binding affinity and.
  • patients should be evaluated forthe levels of 193P1E1B in a given sample (e.g. the levels of circulating 193P1 E1 B antigen and/or 193P1 E1 B expressing cells) in order to assist in the determination ofthe most effective dosing regimen, etc.
  • levels of 193P1E1B in a given sample e.g. the levels of circulating 193P1 E1 B antigen and/or 193P1 E1 B expressing cells
  • Such evaluations are also used for monitoring purposes throughout therapy, and are useful to gauge therapeutic success, in combination with the evaluation of other parameters (for example, urine cytology and/or ImmunoCyt levels in bladder cancer therapy, or by analogy, serum PSA levels in prostate cancer therapy).
  • Anti-idiotypic antirl 93P1 E1 B antibodies can also be used in anti-cancer therapy as a vaccine for inducing an immune response to cells expressing a 193P1E1 B-related protein.
  • the generation of anti-idiotypic antibodies is well-known ' in the art; this methodology can readily be adapted to generate anti-idiotypic anti-193P1E1B antibodies that mimic an epitope on a 193P1 E1 B-related protein (see, for example, Wagner et al, 1997, Hybridoma 16: 33-40; Foon ef al, ⁇ • 1995, J. Clin. Invest. 96:334-342; Herlyn ef al. , 1996, Cancer Immunol. Immunother. 43:65-76).
  • Such an anti-idiotypic antibody can be used in cancer vaccine strategies. ⁇ ? ' .
  • Vaccines and methods of preparing vaccines that contain an i munogenically effective amount of one or more HLA-binding peptides as described herein are further embodiments of the invention.
  • vaccines in accordance with the invention encompass compositions ofone or more of the claimed peptides.
  • a peptide can be present in a vaccine individually.
  • the peptide can exist as a homopolymer comprising multiple copies ofthe same peptide, or as a heteropolymer of various peptides.
  • Polymers have the advantage of increased immunological reaction and, where different peptide epitopes are used to make up the polymer, the additional ability to induce antibodies and/or CTLs that react with different antigenic determinants of the pathogenic organism or tumor-related peptide targeted for an immune response.
  • the composition can be a naturally occurring region of an antigen or can be prepared, e.g., reco binantly or by chemical synthesis.
  • Carriers that can be used with vaccines of the invention are well known in the art, and include, e.g., thyroglobulin, albumins such as human serum albumin, tetanus toxoid, polyamino acids such as poly L-lysine, poly L-glutamic acid, influenza, hepatitis B virus core protein, and the like.
  • the vaccines can contain a physiologically tolerable (;.e.,,acceptable) .
  • diluent such as water, or saline, preferably phosphate buffered saline.
  • the vaccines also typically include an adjuvant.
  • Adjuvants such as incomplete Freund's adjuvant, aluminum phosphate, aluminum hydroxide, or alum are examples of materials well known in the art. Additionally, as disclosed herein, CTL responses can be primed by conjugating peptides of the invention to lipids, such as tripalmitoyl-S-glycerylcysteinlyseryl- serine (P3CSS). Moreover, an adjuvant such as a synthetic cytosine-phosphorothiolated-guanine-containing (CpG) oligonucleotides has been found to increase CTL responses 10- to 100-fold, (see, e.g. Davila and Celis, J. Immunol. 165:539-547 (2000))
  • the immune system of the host responds to the vaccine by producing large amounts of CTLs and/or HTLs specific for the desired antigen. Consequently, the hostbecomes at.least partially immune to later development of cells that express or overexpress 193P1 E1 B antigen, or derives at least some therapeuticbenefit when the antigen was tumor-associated.
  • a preferred embodiment of such a composition comprises dessert I and class II epitopes in accordance with the invention.
  • An: alternative • embodiment of such a composition comprises a class I and/or class II epitope in accordance with the invention, along with a ⁇ cross reactive HTL epitope such as PADRETM (Epimmune, San Diego, CA) molecule (described e.g., in U.S. Patent Number 5,736,142).
  • a vaccine of the invention can also include antigen-presenting cells (APC), such as dendritic cells (DC), as a .vehicle to present peptides of the invention.
  • APC antigen-presenting cells
  • DC dendritic cells
  • Vaccine compositions can be created in vitro, following dendritic cell - mobilization and harvesting, whereby loading.of dendritic cells occurs in vitro.
  • dendritic cells are transfected, e:g., ⁇ with a minigene in accordance with the invention, or are pulsed with peptides.
  • the dendritic cell can then be' : administered to a patient to elicit immune responses in vivo.
  • - Vaccine compositions either DNA- or peptide-based, can also be administered in vivo in combination with dendritic cell mobilization whereby loading of dendritic cells occurs in vivo.
  • the following principles are utilized when selecting an array of epitopes for inclusion in a polyepitopic composition for use in a vaccine, or for selecting discrete epitopes to be induded in a vaccine and/or to be encoded by nucleic acids such as a minigene. It is preferred that each of the following principles be balanced in order to make the selection.
  • the multiple epitopes to be incorporated in a given vaccine composition may be, but need not be, contiguous in sequence in the native antigen from which the epitopes are derived.
  • Epitopes are selected which, upon administration, mimic immune responses that have been observed to be correlated with tumor clearance.
  • this includes 3-4 epitopes that come from at least one tumor associated antigen (TAA).
  • TAA tumor associated antigen
  • HLA Class II a similar rationale is employed; again 3-4 epitopes are selected from at least one TAA (see, e.g., Rosenberg ef al. Science 278:1447-1450).
  • Epitopes from one TAA may be used in combination with epitopes from one ⁇ or more additional TAAs to produce a vaccine that targets tumors with varying expression patterns of frequently-expressed TAAs.
  • Epitopes are selected that have the requisite binding affinity established to be correlated with immunogenicity: for HLA Class I an IC50 of 500 nM or less, often 200 nM or less; and for Class II an IC50 of 1000 nM or less. 3.) Sufficient supermotif bearing-peptides, or a sufficient array of allele-specific motif-bearing peptides, are selected to give broad population coverage. For example, it is preferable to have at least 80% population coverage. A Monte Carlo analysis, a statistical evaluation known in the art, can be employed to assess the breadth, or redundancy of, population coverage.
  • nested epitopes are epitopes referred to as "nested epitopes.” Nested epitopes occur where at least two epitopes overlap in a given peptide sequence.
  • a nested peptide sequence can comprise B cell, HLA class I and/or HLA class II epitopes.
  • a general objective is to provide the greatest number of epitopes per sequence.
  • an aspect is to avoid providing a peptide that is any longer than the amino terminus ofthe amino terminal epitope and the carboxyl terminus ofthe carboxyl terminal epitope in the peptide.
  • a multi-epitopic sequence such as a sequence comprising nested epitopes, it is generally important to screen the sequence in order to insure that it does not have pathological or other deleterious biological properties.
  • a polyepitopic protein is created, or when creating a minigene, an objective is to generate the smallest peptide that encompasses the epitopes of interest. This principle is similar, if not the same as that employed when selecting a peptide comprising nested epitopes. However, with an artificial polyepitopic peptide, the size minimization objective is . balanced against the need to integrate any spacer sequences between epitopes in the polyepitopic protein.
  • Spacer amino acid residues can, for example, be introduced to avoid junctional epitopes (an epitope recognized by the immune system, not present in the target antigen, and only created by the man-made juxtaposition of epitopes), or to facilitate cleavage between epitopes and thereby enhance epitope presentation.
  • Junctional epitopes are generally to be avoided because the recipient may generate an immune response to that non-native epitope. Of particular concern is a junctional epitope that is a "dominant epitope.” A dominant epitope may lead to such a zealous response that immune responses to other epitopes are diminished or suppressed.
  • potential peptide epitopes can also be selected on the basis of their conservancy.
  • a criterion for conservancy may define that the entire sequence of an HLA class I binding peptide or the entire 9-mer core of a class II binding peptide be conserved in a designated percentage of the sequences evaluated for a specific protein antigen.
  • Nucleic acids encoding the peptides of the invention are a particularly useful embodiment of the invention. Epitopes for inclusion in a minigene are preferably selected according to the guidelines set forth in the previous section.
  • a preferred means of administering nucleic acids encoding the peptides of the invention uses minigene constructs encoding a peptide comprising one or multiple epitopes of the invention.
  • a vaccine may also comprise epitopes that are derived from other TAAs.
  • the immunogenicity of a multi-epitopic minigene can be confirmed in transgenic mice to evaluate the magnitude of CTL induction responses against the epitopes tested. Further, the immunogenicity of DNA-encoded epitopes in vivo can be correlated with the in vitro responses of specific CTL lines against target cells transfected with the DNA plasmid. Thus, these experiments can show that the minigene serves to both: 1.) generate a CTL response and 2.) that the induced CTLs recognized cells expressing the encoded epitopes.
  • the amino acid sequences of the epitopes may be reverse translated.
  • a human codon usage table can be used to guide the ' codon choice for each amino acid.
  • These epitope-encoding DNA sequences may be directly adjoined, so that when translated, a continuous polypeptide sequence is created.
  • additional elements can be incorporated into the minigene design.
  • amino acid sequences that can be reverse translated and included in the minigene sequence include: HLA class I epitopes, HLA class II epitopes, antibody epitopes. a ubiquitination signal sequence, and/or an endoplasmic reticulum targeting signal.
  • HLA presentation of CTL and HTL epitopes may be improved by including synthetic (e.g. poly-alanine) or naturally-occurring flanking sequences adjacent : to the CTL or HTL epitopes; these larger peptides comprising the epitope(s) are within the scope of the invention.
  • the minigene sequence may be converted to DNA by assembling oligonucleotides that encode the plus and minus strands ofthe minigene. Overlapping oligonucleotides (30-100 bases long) may be synthesized, phosphorylated, purified and annealed under appropriate conditions using well known techniques. The ends of the oligonucleotides can be joined, for • example, using T4 DNA ligase. This synthetic minigene, encoding the epitope polypeptide, can then be cloned into a desired expression vector. ⁇ • ⁇ •
  • Standard regulatory sequences well known to those of skill in the art are preferably included in the vector to ensure expression in the target cells.
  • a promoter with a down-stream cloning site for minigene insertion a polyadenylation signal for efficient transcription termination; an E. coli origin of replication; and an E. co// selectable marker (e.g. ampicillin or kanamycin resistance).
  • Numerous promoters can be used for this purpose, e.g., the human cytomegalovirus (hCMV) promoter. See, e.g., U.S. Patent Nos. 5,580,859 and 5,589,466 for other suitable promoter ⁇ ⁇ sequences.
  • introns are required for efficient gene expression, and one or more synthetic or naturally-occurring introns could be . incorporated into the transcribed region ofthe minigene.
  • mRNA stabilization sequences and sequences for replication in mammalian cells may also be considered for increasing minigene expression.
  • the minigene is cloned into the polylinker region downstream of the promoter.
  • This plasmid is transformed into an appropriate E. coli strain, and DNA is prepared using standard techniques. The orientation and DNA sequence of the minigene, as well as all other elements included in the vector, are confirmed using ⁇ restriction mapping and DNA sequence analysis. Bacterial cells harboring the correct plasmid can be stored as a master ceil . bank and a working cell bank.
  • immunostimulatory sequences appear to play a role in the immunogenicity of DNA vaccines. These sequences may be included in the vector, outside the minigene coding sequence, if desired to enhance immunogenicity.' ,
  • a bi-cistronic expression vector which allows production of both the minigene-encoded epitopes and a second protein (included to enhance or decrease immunogenicity) can be used.
  • proteins or polypeptides that could beneficially enhance the immune response if co-expressed include cytokines (e.g., IL-2, IL-12, GM- CSF), cytokine inducing molecules (e.g., LelF), costimulatory molecules, or for HTL responses, pan-DR binding proteins (PADRETM, Epimmune, San Diego, CA).
  • Helper (HTL) epitopes can be joined to intracellular targeting signals and expressed separately from expressed CTL epitopes; this allows direction of the HTL epitopes to a cell compartment different than that of the CTL epitopes. If required, this could facilitate more efficient entry of HTL epitopes into the HLA class II pathway, thereby improving HTL induction.
  • immunosuppressive molecules e.g. TGF- ⁇
  • TGF- ⁇ immunosuppressive molecules
  • Therapeutic quantities of plasmid DNA can be produced for example, by fermentation in £ coli, followed by purification. Aliquots from the working cell bank are used to inoculate growth medium, and grown to saturation in shaker flasks or a bioreactor according to well-known techniques. Plasmid DNA can be purified using standard bioseparation technologies such as solid phase anion-exchange resins supplied by QIAGEN, Inc. (Valencia, California). If required, supercoiled DNA can be isolated from the open circular and linear forms using gel electrophoresis or other methods.
  • Purified plasmid DNA can be prepared for injection using a variety of formulations. The simplest of these is reconstitution of lyophilized DNA in sterile phosphate-buffer saline (PBS). This approach, known as "naked DNA,” is currently being used for intramuscular (IM) administration in clinical trials. To maximize the immunotherapeutic effects of minigene DNAvacdnes, an alternative method for formulating purified plasmid DNA may be desirable. A variety of methods have been described, and new techniques may become available.
  • Cationic lipids, glycolipids, and fusogenic liposomes can also be used in the formulation (see, e.g., as described by WO 93/24640; Mannino & Gould-Fogerite, BioTechniques 6(7): 682 (1988); U.S. Pat No. 5,279,833; WO 91/06309; and Feigner, ef al, Proc. Nat'IAcad. Sci. USA 84:7413 (1987).
  • peptides and compounds referred to collectively as protective, interactive; non-condensing compounds (PINC) • . ⁇ could also be complexed to purified plasmid DNA to influence variables such as stability, intramuscular dispersion, or ⁇ trafficking to specific organs or cell types.
  • Target cell sensitization can be used as a functional assay for expression and HLA class I presentation of minigene-e ⁇ eoded CTL epitopes.
  • the plasmid DNA is introduced into a mammalian cell line that is suitable as a target for standard CTL chromium release assays.
  • the transfection method used will be dependent on the final formulation. Electroporation can be used for "naked" DNA, whereas cationic lipids allow direct in vitro transfection.
  • a plasmid expressing green fluorescent protein (GFP) can be co-transfected to allow enrichment of transfected cells using fluorescence activated cell sorting (FACS).
  • FACS fluorescence activated cell sorting
  • HTL epitopes are then chromium-51 ( 51 Cr) labeled and used as target cells for epitope-specific CTL lines; cytolysis, detected by 51 Cr release, indicates both production of, and HLA presentation of, ⁇ minigene-encoded CTL epitopes. Expression of HTL epitopes may be evaluated in an analogous manner using assays to assess HTL activity.
  • 51 Cr chromium-51
  • In vivo immunogenicity is a second approach for functional testing of minigene DNA formulations.
  • Transgenic mice expressing appropriate human HLA proteins are immunized with the DNA product
  • the dose and rbute of administration are formulation dependent (e.g., IM for DNA in PBS, intraperitoneal (i.p.) for lipid-complexed DNA).
  • Twenty-one days after • immunization splenocytes are harvested and restimulated for one week in the presence of peptides encoding each epitope being tested. Thereafter, for CTL effector cells, assays are conducted for cytolysis of peptide-loaded, 51 Cr-labeled target cells using standard techniques.
  • Lysis of target cells that were sensitized by HLA loaded with peptide epitopes, . corresponding to minigene-encoded epitopes, demonstrates DNA vaccine function for in vivo induction of CTLs. Immunogenicity of HTL epitopes is confirmed in transgenic mice in an analogous manner.
  • nucleic acids can be administered using ballistic delivery as described, for instance, in U.S. Patent No.5,204,253.
  • particles comprised solely of DNA are administered.
  • DNA can be adhered to particles, such as gold particles.
  • Minigenes can also be delivered using other bacterial or viral delivery systems well known in the art, e.g., an expression construct encoding epitopes of the invention can be incorporated into a viral vector such as vaccinia. X.C.2. Combinations of CTL Peptides with Helper Peptides
  • Vaccine compositions comprising CTL peptides ofthe invention can be modified, e.g., analoged, to provide desired attributes, such as Improved serum half life, broadened population coverage or enhanced immunogenicity.
  • desired attributes such as Improved serum half life, broadened population coverage or enhanced immunogenicity.
  • the ability of a peptide to induce CTL activity can be enhanced by linking the peptide to a sequence which contains at least one epitope that is capable of inducing a T helper cell response.
  • a CTL peptide can be directly linked to a T helper peptide, often CTL epitope/HTL epitope conjugates are linked by a spacer molecule.
  • the spacer is typically comprised of relatively small, neutral molecules, such as amino acids or amino acid mimetics, which are substantially uncharged under physiological conditions.
  • the spacers are typically selected from, e.g., Ala, Gly, or other : . neutral spacers of nonpolar amino acids or neutral polar amino acids. It will be understood that the optionally present spacer need not be comprised of the same residues and thus may be a hetero- or homo-oligomer. When present, the spacer will usually be at least one or two residues, more usually three to six residues and sometimes 10 or more residues.
  • the CTL peptide epitope can be linked to the T helper peptide epitope either directly or via a spacer either at the amino or.carboxy . terminus of the CTL peptide. The amino terminus of either the immunogenic peptide or the T helper peptide may be
  • the T helper peptide is one that is recognized by T helper cells present in a majority of a genetically diverse population. This can be accomplished by selecting peptides that bind to many, most, or all of the HLA , class II molecules. Examples of such amino acid bind many HLA Class II molecules include sequences from antigens such
  • GAVDSILGGVATYGAA SEQ ID NO: 50
  • Other examples include peptides bearing a DR 1-4-7 supermotif, or
  • HLA-DR human HLA class II
  • pan-DR binding epitope comprises all "L" natural amino acids and can be provided in the form of nucleic acids that encode the epitope.
  • HTL peptide epitopes can also be modified to alter their biological properties. For example, they can be modified
  • to include D ⁇ amino acids to increase their resistance to proteases and thus extend their serum half life, or they can be i conjugated. to:other molecules such as lipids, proteins, carbohydrates, and the like to increase their biological activity.
  • a T. helper peptide can be conjugated to one or more palmitic acid chains at either the amino or carboxyl termini.
  • compositions of the invention at least one component which primes B lymphocytes or T lymphocytes.
  • Lipids have been identified as agents capable of priming * CTL in vivo.
  • palmitic acid residues can be attached to the ⁇ -and - amino groups of a lysine residue and then linked, e.g., via one or more linking residues such as Gly, Gly-Gly-, Ser, Ser-Ser, or the like, to an immunogenic peptide.
  • the lipidated peptide can then be administered either directly in a micelle or particle, incorporated into a liposome, or emulsified in an adjuvant, e.g., incomplete Freund's adjuvant.
  • a particularly effective immunogenic composition comprises palmitic acid attached to ⁇ - and ⁇ - amino groups of Lys, which is attached via linkage, e.g., Ser-Ser, to the amino terminus of the immunogenic peptide.
  • £ coli lipoproteins such as tripalmitoyl-S- glycerylcysteinlyseryl- serine (P3CSS) can be used to prime virus specific CTL when covalently attached to an appropriate peptide (see, e.g., Deres, et al, Nature 342:561, 1989).
  • Peptides ofthe invention can be coupled to PaCSS, for example, and the lipopeptide administered to an individual to prime specifically an immune response to the target antigen.
  • two such compositions can be combined to more effectively elicit both humoral and cell-mediated responses.
  • Vaccine Compositions Comprising DC Pulsed with CTL and/or HTL Peptides
  • An embodiment of a vaccine composition in accordance with the invention comprises ex vivo administration of a cocktail of epitope-bearing peptides to PBMC, or isolated DC therefrom, from the patient's blood.
  • a pharmaceutical to facilitate harvesting of DC can be used, such as ProgenipoietinTM (Pharmacia-Monsanto, St. Louis, MO) or GM-CSF/IL4. After pulsing the DC with peptides and prior to reinfusion into patients, the DC are washed to remove unbound peptides.
  • a vaccine comprises peptide-pulsed DCs which present the pulsed peptide epitopes complexed with HLA molecules on their surfaces.
  • the DC can be pulsed ex vivo with a cocktail of peptides, some of which stimulate CTL responses to 193P1 E1 B.
  • a helper T cell (HTL) peptide such as a natural or artificial loosely restricted HLA Class II peptide, can be • ⁇ included to facilitate the CTL response.
  • HTL helper T cell
  • a vaccine in accordance with the invention is used to treat a cancer which 'expresses or overexpresses 193P1 E1 B.
  • Antigenic 193P1 E1 B-related peptides are used to elicit a CTL and/or HTL response ex vivo, as well.
  • the resulting CTL or HTL cells can be used to treat tumors in patients that do not respond to other conventional forms of therapy, or will 'not respond to a therapeutic vaccine peptide or nucleic acid in accordance with the invention.
  • Ex vivo CTL or HTL responses to a particular antigen are induced by incubating in tissue culture the patient's, or genetically compatible, CTL or HTL precursor cells togetherwith a source of antigen-presenting cells (APC), such as dendritic cells, and the appropriate immunogenic peptide.
  • APC antigen-presenting cells
  • Transfected dendritic cells may also be used as antigen presenting cells.:. ⁇
  • compositions of the invention are typically used to treat and/or prevent a cancer that expresses or overexpresses 193P1 E1 B;
  • peptide and/or nucleic acid compositions are administered to a patient in an amount sufficient to elicit an effective B cell, CTL and/or HTL response to the antigen and to cure or at least partially arrest or slow symptoms and/or complications.
  • An amount adequate to accomplish this is defined as "therapeutically effective dose.” Amounts effective for this use will depend on, e.g., the particular composition administered, the manner of administration, the stage and severity of the disease being treated, the weight and general state of health of ⁇ the patient, and the judgment of the prescribing physician.
  • the immunogenic peptides of the invention are generally administered to an individual already bearing a tumor that expresses 193P1 E1 B.
  • the peptides or DNA encoding them can be administered individually or as fusions of one or more peptide sequences.
  • Patients can be treated with the -. immunogenic peptides separately or in conjunction with other treatments, such as surgery, as appropriate.
  • administration should generally begin at the first diagnosis of 193P1E1 B-associated cancer. This is followed by boosting doses until at least symptoms are substantially abated and for a period thereafter.
  • the embodiment of the vaccine composition i.e., including, but not limited to embodiments such as peptide cocktails, polyepitopic polypeptides, minigenes, orTAA-specific CTLs or pulsed dendritic cells
  • delivered to the patient may vary according to the stage of the disease or the patient's health status. For example, in a patient with a tumor that expresses 193P1 E1 B, a vaccine comprising 193P1 E1 B-specific CTL may be more efficacious in killing tumor cells in patient with advanced disease than alternative embodiments.
  • compositions which stimulate helper T cell responses can also be given in accordance with this embodiment of the invention.
  • the dosage for an initial therapeutic immunization generally occurs in a unit dosage range where the lower value is about 1 , 5, 50, 500, or 1,000 ⁇ g and the higher value is about 10,000; 20,000; 30,000; or 50,000 ⁇ g.
  • Dosage values for a human typically range from about 500 ⁇ g to about 50,000 ⁇ g per 70 kilogram patient.
  • Boosting dosages of between about 1.0 ⁇ g to about 50,000 ⁇ g of peptide pursuant to a boosting regimen over weeks to months may be administered depending upon the patient's response and condition as determined by measuring the specific activity of CTL and HTL obtained from the patient's blood. Administration should continue until at least clinical symptoms or laboratory tests indicate that the ' ' neoplasia, has been eliminated or reduced and for a period thereafter.
  • the dosages, routes of administration, and dose schedules are adjusted in accordance with methodologies known in the art.
  • the peptides and compositions of the present invention are employed in serious disease ⁇ states, that is, life-threatening or potentially life threatening situations.
  • ⁇ states that is, life-threatening or potentially life threatening situations.
  • the relative nontoxic nature of the peptides in preferred compositions of the invention it is . « • possible and may be felt .desirable by the treating physician to administer substantial excesses of these peptide compositions relative to these stated dosage amounts.
  • the vaccine compositions of the invention can. also be used purely as prophylactic agents.
  • the dosage • for an initial prophylactic immunization generally occurs in a unit dosage range where the lower value is about 1 , 5, 50, 500, or 1000 ⁇ g and the higher value is about 10,000; 20,000; 30,000; or 50,000 ⁇ g.
  • Dosage values for a human typically range from about 500 ⁇ g to about 50,000 ⁇ g per 70 kilogram patient. This is followed by boosting dosages of between about 1.0 ⁇ ⁇ g to about 50,000 ⁇ g of peptide administered at defined intervals from about four weeks to six months after the initial administration of vaccine.
  • the immunogenicity of the vaccine can be assessed by measuring the specific activity of CTL and HTL obtained from a sample ofthe patient's blood.
  • compositions for therapeutic treatment are intended for parenteral, topical, oral, nasal, intrathecal, or local (e.g. as a cream or topical ointment) administration.
  • the pharmaceutical compositions are : administered parentally, e.g., intravenously, subcutaneously, intradermally, or intramuscularly.
  • the invention provides ⁇ compositions for parenteral administration which comprise a solution of the immunogenic peptides dissolved or suspended iri an acceptable carrier, preferably an aqueous carrier.
  • aqueous carriers may be used, e.g., water, buffered water, 0.8% saline, 0.3% glycine, hyafuronic acid and the like. These compositions may be sterilized by conventional, well-known sterilization techniques, or may be sterile filtered. The resulting aqueous solutions may be packaged for use as is, or lyophilized, the lyophilized preparation being combined with a sterile solution prior to administration.
  • compositions may contain pharmaceutically acceptable auxiliary substances as required to approximate physiological conditions, such as pH-adjusting and buffering agents, tonicity adjusting agents, wetting agents, preservatives, and the like, for example, sodium acetate, sodium lactate, sodium chloride, potassium chloride, calcium chloride, sorbitan monolaurate, triethanolamine oleate, etc.
  • auxiliary substances such as pH-adjusting and buffering agents, tonicity adjusting agents, wetting agents, preservatives, and the like, for example, sodium acetate, sodium lactate, sodium chloride, potassium chloride, calcium chloride, sorbitan monolaurate, triethanolamine oleate, etc.
  • concentration of peptides ofthe invention in the pharmaceutical formulations can vary widely, i.e., from less than about 0.1 %, usually at or at least about 2% to as much as 20% to 50% or more by weight, and will be selected primarily by fluid volumes, viscosities, efc, in accordance with the particular mode of administration selected.
  • a human unit dose form of a composition is typically included in a pharmaceutical composition that comprises a human unit dose of an acceptable carrier, in one embodiment an aqueous carrier, and is administered in a volume/quantity that is known by those of skill in the art to be used for administration of such compositions to humans (see, e.g., Remington's Pharmaceutical Sciences, 17 ⁇ Edition, A.
  • a peptide dose for initial immunization can be from about 1 to about 50,000 ⁇ g, generally 100-5,000 ⁇ g, for a 70 kg patient.
  • an initial immunization may be performed using an expression vector in the form of naked nucleic acid administered IM (or SC or ID) in the amounts of 0.5-5 mg at multiple sites.
  • the nucleic acid (0.1 to 1000 ⁇ g) can also be administered using a gene gun.
  • a booster dose is then administered.
  • the booster can be recombinant fowlpox virus administered at a dose of 5-10 7 to 5x10 9 pfu.
  • a treatment generally involves repeated administration of the anti-193P1 E1 B antibody preparation, via an acceptable route of administration such as intravenous injection (IV), typically at a dose in the range of about 0.1 to about 10 mg/kg body weight.
  • IV intravenous injection
  • doses in the range of 10-500 mg mAb per week are effective and well tolerated.
  • an initial loading dose of approximately 4 mg/kg patient body weight IV, followed by weekly doses of about 2 mg/kg IV of the anti- 193P1E1B mAb preparation represents an acceptable dosing regimen.
  • various factors can influence the ideal dose in a particular case.
  • Such factors include, for example, half life of a ⁇ composition; the binding' affinity of an Ab, the immunogenicity of a substance, the degree of 193P1 E1 B expression in the patient, the extent of circulating shed 193P1 E1 B antigen, the desired steady-state concentration level, frequency of treatment, and the influence of chemotherapeutic or other agents used in combination with the treatment method of the invention, as well as the health status of a particular patient.
  • Non-limiting preferred human unit doses are, for example, - 500 ⁇ g - 1mg, Img - 50mg; 50mg - 100mg, 100mg - 200mg, 200mg - 300mg, 400mg - 500mg, 500mg - 600mg,-600mg - 700mg, 700mg - 800mg; 800mg - 900mg, 900mg - 1g, or 1mg - 700mg.
  • the dose is in a range of 2- 5 mg/kg body weight, e:g., with follow on weekly doses of 1-3 mg/kg; 0.5mg, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10mg/kg body weight followed, e.g., in two, three or four weeks by weekly doses; 0.5 - 10mg/kg body weight, e.g., followed in two, three or four weeks by weekly doses; 225, 250, 275-, 300, 325, 350, 375, 400mg m 2 of body area weekly; 1 -600mg m 2 of bodyarea weekly; 225-400mg m 2 of body area weekly; these does can be followed by weekly doses for 2, 3, 4, 5, 6, 7, 8, 9, 19, 11, 12 or more weeks.
  • human unit dose forms of polynucleotides comprise a suitable dosage range or effective amount that provides any therapeutic effect.
  • a therapeutic effect depends on a number of factors.-including the sequence of the polynucleotide, molecular weight of the polynucleotide and route of ⁇ administration. Dosages are generally selected by the physician or other health care professional in accordance with a variety of parameters known in the art, such as severity of symptoms, history of the patient and the like.
  • a dosage range may be selected from, for example, an independently selected lower limit such as about 0.1, 0.25, 0.5, 1, 2, 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400 or 500 mg/kg up to ah independently selected, upper limit, greater than the lower limit, of about 60, 80, 100, 200, 300, 400, 500, 750, 10 ⁇ , 1500, ; 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000 or 10,000 mg/kg.
  • an independently selected lower limit such as about 0.1, 0.25, 0.5, 1, 2, 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400 or 500 mg/kg up to ah independently selected, upper limit, greater than the lower limit, of about 60, 80, 100, 200, 300, 400, 500, 750, 10 ⁇ , 1500, ; 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000 or 10,000 mg/kg.
  • a dose may be about any of the following: ,0.1 to 100 mg/kg, 0.1 to 50 mg/kg, 0.1 to 25 mg/kg, 0.1 to 10 mg/kg, 1 to 500 mg/kg, 100 to 400 mg/kg, 200 to 300 mg/kg, 1 to 100 mg/kg, 100 to 200 mg/kg, 300 to 400 mg/kg, 400 to 500 mg/kg, 500 to 1000 mg/kg, 500 to 5000 mg/kg, or 500 to 10,000 mg/kg.
  • parenteral routes of administration may require higher doses of polynucleotide compared to more direct application to the nucleotide to diseased tissue, as do polynucleotides of increasing length.
  • human unit dose forms of T-celis comprise a suitable dosage range or effective amount that provides any therapeutic effect.
  • a therapeutic effect depends on a number of factors. Dosages are generally selected by the physician or other health care professional in accordance with a variety of parameters known in the art, such as severity of symptoms, history ofthe patient and the like.
  • a dose may be about 10 4 cells to about 10 6 cells, about 10 6 cells to about 10 8 cells, about 10 ⁇ to about 10 11 cells, or about 10 8 ⁇ 0 about 5 x 10 10 cells.
  • a dose may also about 10 ⁇ cells/m 2 to about 10 10 cells/m 2 , or about 10 6 cells/m 2 to about 10 8 cells/m 2 .
  • Proteins(s) of the invention, and/or nucleic acids encoding the protein(s), can also be administered via liposomes, which may also serve to: 1) target the proteins(s) to a particular tissue, such as lymphoid tissue; 2) to target selectively to diseases cells; or, 3) to increase the half-life of the peptide composition.
  • liposomes include emulsions, foams, micelles, insoluble monolayers, liquid crystals, phospholipid dispersions, lamellar layers and the like.
  • the peptide to be delivered is incorporated as part of a liposome, alone or in conjunction with a molecule which binds to a ; receptor prevalent among lymphoid cells, such as monoclonal antibodies which bind to the CD45 antigen, or with other therapeutic or immunogenic compositions.
  • liposomes either filled or decorated with a desired peptide of the invention . can be directed to the site of lymphoid cells, where the liposomes then deliver the peptide compositions.
  • Liposomes for use in accordance. ith the invention are formed from standard vesicle-forming lipids, which generally include neutral and negatively charged phospholipids and a sterol, such as cholesterol. The selection of lipids is generally guided by.
  • liposome size consideration of, e.g., liposome size, acid lability and stability of the liposomes in the blood stream.
  • a variety of methods are available for preparing liposomes, as described in, e.g., Szoka, ef al, Ann. Rev. Biophys. Bioeng. 9:467 (1980),' and U.S. Patent Nos.4,235,871 , ,501 ,728, 4,837,028, and 5,019,369.
  • aiigand to be incorporated into the liposome can include, e.g., antibodies or fragments thereof specific for cell surface determinants of the desired immune system cells.
  • a liposome suspension containing a peptide may be administered intravenously, locally, topically, efc. in a dose which varies according .. to, inter alia, ; the manner of administration, the peptide being delivered, and the stage of the disease being treated.
  • nontoxic solid carriers include, for example, pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharin, talcum, cellulose, glucose, . sucrose, magnesium carbonate, and the like.
  • a pharmaceutically acceptable nontoxic composition is formed by incorporating any of the normally employed excipients, such as those carriers previously listed, and generally 10- 95% of active ingredient, that is, one or mo e peptides of the invention, and more preferably at a concentration of 25%-75.%.
  • immunogenic peptides are preferably supplied in finely divided form along with a surfactant and propellant. Typical percentages of peptides are about 0.01 %-20% by weight, preferably about 1 %-10%.
  • the , surfactant must, of course, be nontoxic, and preferably soluble in the propellant.
  • Representative of such agents are the • .. , esters or partial esters of fatty acids containing from about 6 to 22 carbon atoms, such as caproic, octanoic, lauric, palmitic* stearic, linoteic, , linolenic, olesteric and oieic acids with an aliphatic polyhydric alcohol or its cyclic anhydride.
  • the surfactant may constitute about 0.1 %-20% by weight of the composition, preferably about 0.25-5%.
  • the balance of the composition is ordinarily propellant.
  • a carrier can also be included, as desired, as with, e.g., lecithin for intranasal delivery. ,
  • 193P1E1B polynucleotides, polypeptides, reactive cytotoxic T cells (CTL), reactive helper T . cells (HTL) and anti-polypeptide antibodies are used in well known, diagnostic, prognostic and therapeutic assays that examine conditions associated with dysregulated cell growth such as cancer, in particular the cancers listed in Table I (see, e.g., both its specific pattern of tissue expression as well as its overexpression in certain cancers as described for example in the Example entitled "Expression analysis of 193P1E1B in normal tissues, and patient specimens").
  • 193P1 E1 B can be analogized to a prostate associated antigen PSA, the archetypal marker that has been used by medical practitioners for years to identify and monitor the presence of prostate cancer (see, e.g., Merrill etal, J. Urol. 163(2): 503-5120 (2000); Polascik ef a/., J. Ural. Aug; 162(2):293-306 (1999) and Fortier ef a/., J. Nat. Cancer Inst.91(19): 1635- 1640(1999)).
  • PSA prostate associated antigen PSA
  • Typical embodiments of diagnostic methods which utilize the 193P1E1B polynucleotides, polypeptides, reactive T cells and antibodies are analogous to those methods from well-established diagnostic assays, which employ, e.g., PSA polynucleotides, polypeptides,, reactive T cells and antibodies.
  • PSA polynucleotides are used as probes (for example in. Northern analysis, see, e.g., Sharief ef al, Biochem. Mol. Biol. Int. 33(3):567-74(1994)>and primers (for example in PCR analysis, see, e.g., Okegawa ef al, J. Urol.
  • the 193P1 E1 B polynucleotides described herein can be utilized in the same way to detect 193P1E1B overexpression or the metastasis of prostate and other cancers expressing this gene.
  • PSA polypeptides are used to generate antibodies ,- - specific for PSA which can then be used to observe the presence and/or the level of PSA proteins in methods to monitor - .
  • PSA protein overexpression see, e.g., Stephan ef al, Urology 55(4):560-3 (2000)
  • metastasis of prostate cells see, . e.g., Alanen etal, Pathol. Res. Pract 192(3):233-7 (1996)
  • the 193P1E1B polypeptides described herein can be utilized to generate.antibodies for use in detecting 193P1E1 B overexpression or the metastasis of prostate cells and cells of other cancers expressing this gene.
  • metastases involves the movement of cancer cells from an organ of origin (such as the lung or prostate gland etc.) to a different area of the body (such as a lymph node)
  • assays which examine a biological sample for the presence of cells expressing 193P1 E1 B polynucleotides and/or polypeptides can be used to provide evidence of metastasis.
  • a biological sample from tissue that does not normally contain 193P1 E1 B-expressing cells lymph node
  • xenografts isolated from lymph node and bone metastasis is indicative of metastasis.
  • 193P1 E1 B polynucleotides and/or polypeptides can be used to provide evidence of cancer, for example, when cells in a biological sample that do not normally express 193P1 E1B or express 193P1 E1 B at a different level are found to. express 193P1E1B or have an increased expression of 193P1E1B (see, e.g., the 193P1E1B expression in the-.- cancers listed in Table I and in patient samples etc. shown in the accompanying Figures).
  • artisans may further wish to generate supplementary evidence of metastasis by testing the biological sample for the presence of a second . tissue restricted marker (in addition to 193P1E1B) such.as PSA, PSCA etc. (see, e.g., Alanen et al, Pathol. Res. Pract. 192(3): 233-237 (1996)).
  • PSA polynucleotide fragments and polynucleotide variants are employed by skilled artisans for use in methods of monitoring PSA
  • 193P1 E1 B polynucleotide fragments and. polynucleotide variants are used in an analogous manner.
  • typical PSA polynucleotides used in methods of monitoring PSA are probes or primers which consist .of fragments ofthe PSA cDNA sequence.
  • primers used to PCR amplify a PSA polynucleotide must include less than the whole PSA sequence to function in the polymerase chain reaction.
  • PCR reactions In the context of such PCR reactions, skilled artisans generally create a variety of different polynucleotide fragments that can be used as primers in order to amplify different portions of a polynucleotide of interest or to optimize amplification reactions (see, e.g., Caetano-Anolles, G. Biotechniques 25(3): 472-476, 478-480 (1998); Robertson etal, Methods Mol. Biol. 98:121-154 (1998)).
  • Polynucleotide fragments and variants are useful in this context where they are capable of binding to a target polynucleotide sequence (e.g., a 193P1 E1 B polynucleotide shown in Figure 2 or variant thereof) under conditions of high stringency.
  • a target polynucleotide sequence e.g., a 193P1 E1 B polynucleotide shown in Figure 2 or variant thereof
  • PSA polypeptides which contain an epitope that can be recognized by an antibody or T cell that specifically binds to that epitope are used in methods of monitoring PSA.
  • 193P1 E1 B polypeptide fragments and polypeptide analogs or variants can also be used in an analogous manner. This practice of using polypeptide fragments or polypeptide variants to generate antibodies (such as anti-PSA antibodies or T cells) is typical in the art with a wide variety of systems such as fusion proteins being used by practitioners (see, e.g., Current Protocols In Molecular Biology, Volume 2, Unit 16, Frederick M. Ausubel ef al. eds,, 1995).
  • each epitope(s) functions to provide the architecture with which an - antibody or T cell is reactive.
  • skilled artisans create a variety of different polypeptide fragments that can be used in order to generate immune responses specific for different portions of a polypeptide of interest (see, e.g., U.S. Patent No. -. > 5,840,501 and U.S. Patent No. 5,939,533).
  • a polypeptide comprising one of the . 193P1E1B biological motifs discussed herein or a motif-bearing subsequence which is readily identified by one:of skill in the . art based on motifs available in the art.
  • Polypeptide fragments, variants or analogs are typically useful in this context as long - ' as they comprise an epitope capable of generating an antibody or T cell specific for a target polypeptide sequence (e.g. a 193P1E1B polypeptide shown in Figure 3).
  • a target polypeptide sequence e.g. a 193P1E1B polypeptide shown in Figure 3.
  • the 193P1E1B polynucleotides and polypeptides exhibit specific properties that make them useful in diagnosing cancers such as those listed in Table I.
  • Diagnostic assays that measure the presence of 193P1 E1 B gene products in order to evaluate the presence or onset of a disease condition described herein, such as prostate cancer, are used to identify patients for preventive measures or further monitoring, as has been done so successfully with PSA.
  • these materials satisfy a need in the art for molecules having similar or complementary characteristics to PSA in situations where, for example, a definite diagnosis of metastasis of prostatic origin cannot be made on the basis of a test for PSA alone (see, e.g., Alanen et al, Pathol. Res. Pract. 192(3): 233-237 (1996)), and consequently, ' materials such. as 193P1E1B polynucleotides and polypeptides (as well as the 193P1E1B polynucleotide probes and anti- 193P1E1B antibodies used to identify the presence of these molecules) need to be employed to confirm a metastases of , prostatic origin.
  • the 193P1E1B polynucleotides disclosed herein have a number of other utilities such as their use in the identification of oncogenetic associated chromosomal abnormalities in the chromosomal region to which the 193P1E1B gene maps (see the Example entitled "Chromosomal Mapping of 193P1E1B" below).
  • the 193P1E1 B-related proteins and polynucleotides disclosed herein have other utilities such as their use in the forensic analysis of tissues of unknown origin (see, e.g., Takahama K Forensic Sci Int 1996 Jun 28;80(1-2): 63-9).
  • 193P1 E1 B-related proteins or polynucleotides of the invention can be used to treat a pathologic condition characterized by the over-expression of 193P1E1 B.
  • the amino acid or nucleic acid sequence of Figure 2 or Figure 3, or fragments of either can be used to generate an.immune response to a 193P1E1B antigen.
  • Antibodies or other molecules that react with 193P1 E1 B can be used to modulate the function of this molecule, and thereby provide a therapeutic benefit.
  • XII. Inhibition of 193P1 E1 B Protein Function
  • the invention indudes various methods and compositions for inhibiting the binding of 193P1E1B to its binding partner or its association with other protein(s) as well as methods for inhibiting 193P1 E1 B function.
  • a recombinant vector that encodes single chain antibodies that specifically bind to 193P1E1B are introduced into 193P1E1B expressing cells via gene transfer technologies. Accordingly, the encoded single chain anti- 193P1E1B antibody is expressed intracellularly, binds to 193P1E1B protein, and thereby inhibits its function.
  • Methods for engineering such intracellular single chain antibodies are well known.
  • intracellular antibodies also known as "intrabodies” are specifically targeted to a particular compartment within the cell, providing control over where the inhibitory activity ofthe treatment is focused. This technology has been successfully applied in the art (for review, see Richardson and Marasco, 1995, TIBTECH vol. 13).
  • Intrabodies have-been shown to virtually eliminate the expression of otherwise abundant cell surface receptors (see, e.g., Richardson etal, 1995, Proc. Natl. Acad. Sci. USA 92: 3137-3141; Beerli et al, 1994, J. Biol. Chem. 289: 23931-23936; Deshane etal, 1994, Gene Ther. 1: 332-337).
  • Single chain antibodies comprise the variable domains of the heavy and light chain joined by a flexible linker polypeptide, and are expressed as a single polypeptide.
  • single chain antibodies are expressed as a single chain • variable region fragment joined to the light chain constant region.
  • Well-known intracellular trafficking signals are engineered
  • intrabodies targeted to the endoplasmic reticulum (ER) are engineered to incorporate a leader peptide and, optionally, a C-terminal ER retention signal, such as the KDEL amino acid motif.
  • Intrabodies intended to exert activity in the nucleus are engineered to include a nuclear localization signal, Lipid moieties are joined to intrabodies in order to tether the intrabody to the cytosolic side ofthe plasma membrane, Intrabodies can also be targeted to exert function in the cytosol.
  • cytosolic intrabodies are used to sequester factors within the cytosol,' thereby preventing them from being transported to their natural cellular destination.
  • intrabodies are used to capture 193P1E1B in the nucleus, thereby preventing its activity within the nucleus.
  • Nuclear targeting signals are engineered into such 193P1 E1 B intrabodies in order to achieve the desired targeting.
  • Such 193P1 E1 B intrabodies are designed to bind specifically to a particular 193P1 E1 B domain.
  • cytosolic intrabodies that specifically bind to a 193P1 E1 B protein are used to prevent 193P1 E1 B from gaining access to the nucleus, thereby preventing it from exerting any biological activity within the nucleus (e.g s , preventing 193P1 E1 B from forming transcription complexes with other factors).
  • is placed under the regulatory control of an appropriate tumor-specific promoter and/or enhancer.
  • the PSA promoter and/or promoter/enhancer can be utilized (See, for example, U:S. Patent No. 5,919,652 issued 6 July 1999).
  • recombinant molecules bind to 193P1E1B and thereby inhibit 193P1E1B function.
  • these recombinant molecules prevent or inhibit 193P1 E1 B from accessing/binding to its binding partner(s) or associating with other protein(s).
  • Such recombinant molecules can, for example, contain the reactive part(s) of a 193P1E1B specific antibody molecule.
  • the 193P1E1B binding domain of a 193P1E1B binding partner is engineered into a dimeric fusion protein, whereby the fusion protein comprises two 193P1 E1 B ligand binding domains linked to the Fc portion of a human IgG, such as human lgG1.
  • a human IgG such as human lgG1.
  • IgG portion can contain, for example, the CH2 and CH3 domains and the hinge region, but not the CH1 domain.
  • dimeric fusion proteins are administered in soluble form to patients suffering from a cancer associated with the expression of 193P1E1B, whereby the dimeric fusion protein specifically binds to 193P1E1B and blocks 193P1 E1 B interaction with a binding partner.
  • Such dimeric fusion proteins are further combined into multimeric proteins using known antibody linking technologies.
  • the present invention also comprises various methods and compositions for inhibiting the transcription ofthe 193P1E1B gene. Similarly, the invention also provides methods and compositions for inhibiting the translation of 193P1E1B. mRNA into protein.
  • a method of inhibiting the transcription ofthe 193P1E1B gene comprises contacting the 193P1 E1 B gene with a 193P1 E1 B antisense polynucleotide.
  • a method of inhibiting 193P1 E1 B mRNA translation comprises contacting a 193P1E1B mRNA with an antisense polynucleotide.
  • a 193P1E1B specific ribozyme is used to cleave a 193P1E1B message, thereby inhibiting translation.
  • Such antisense and ribozyme based methods can also be directed to the regulatory- regions ofthe 193P1E1B gene, such as 193P1E1B promoter and/or enhancer elements.
  • proteins capable of inhibiting a 193P1E1B gene transcription factor are used to inhibit 193P1E1B mRNA transcription.
  • the various polynucleotides and compositions useful in the aforementioned methods have been described above.
  • the use of antisense and ribozyme molecules to inhibit transcription and translation is well known in the art.
  • Gene transfer and gene therapy technologies can be used to deliver therapeutic polynucleotide molecules to tumor cells synthesizing 193P1E1B (i.e., antisense, ribozyme, polynucleotides encoding intrabodies and other 193P1E1B inhibitory molecules).
  • 193P1E1B i.e., antisense, ribozyme, polynucleotides encoding intrabodies and other 193P1E1B inhibitory molecules.
  • Recombinant vectors encoding 193P1 E1 B antisense polynucleotides, ribozymes, factors capable of interfering with 193P1E1B transcription, and so forth, can be delivered to target tumor cells using such gene therapy approaches.
  • the above therapeutic approaches can be combined with any one of a wide variety of surgical, chemotherapy or radiation therapy regimens ⁇
  • the therapeutic approaches of the invention can enable the use of reduced dosages of chemotherapy (or other therapies) and/or less frequent administration, an advantage for all patients and particularly for those that do not tolerate the toxicity of the chemotherapeutic agent well.
  • the anti-tumor activity of a particular composition can be evaluated using various in vitro and in vivo assay systems.
  • In vitro assays that evaluate therapeutic activity include cell growth assays, soft agar assays and other assays indicative of tumor promoting activity, binding assays capable of determining the extent to which a therapeutic composition will inhibit the binding of 193P1E1B to a binding partner, etc.
  • a 193P1 E1 B therapeutic composition can be evaluated in a suitable animal model.
  • xenogenic prostate cancer models can be used, wherein human prostate cancer explants or passaged xenograft tissues are introduced into immune compromised animals, such as nude or SCID mice (Klein ef al, 1997, Nature Medicine 3: 402-408).
  • PCT Patent Application W098/16628 and U.S. Patent 6,107,540 describe various xenograft models of human prostate cancer capable of recapitulating the development of primary tumors, micrometastasis, and the formation of osteoblastic metastases characteristic of late stage disease. Efficacy can be predicted using assays that measure inhibition of tumor formation, tumor regression or metastasis, and the like.
  • xenografts from tumor bearing mice treated with the therapeutic composition can be examined for the presence of apoptotic foci and compared to untreated control xenograft-bearing mice. The extent to which apoptotic foci are found in the tumors of the treated mice provides an indication of the therapeutic efficacy of the composition.
  • Suitable carriers include any material that when combined with the therapeutic composition retains the anti-tumor function of the therapeutic composition and is generally non-reactive with the patient's immune system. Examples include, but are not limited to, any of a number of standard pharmaceutical carriers such as sterile phosphate buffered saline solutions, bacteriostatic water, and the like (see, generally,. Remington's Pharmaceutical Sciences 1i ⁇ Edition, A. Osal., Ed., 1980).
  • Therapeutic formulations can be solubilized and administered via any route capable of delivering the therapeutic composition to the tumor site.
  • Potentially effective routes of administration include, but are not limited to, intravenous, parenteral, intraperitoneal, intramuscular, intratumor, intradermal, intraorgan, orthotopic, and the like.
  • a preferred formulation for intravenous injection comprises the therapeutic composition in a solution of preserved bacteriostatic water, sterile unpreserved water, and/or diluted in polyvinylchloride or polyethylene bags containing 0.9% sterile Sodium Chloride for Injection, USP.
  • Therapeutic protein preparations can be lyophilized and stored as sterile powders, preferably under vacuum, and then reconstituted in bacteriostatic water (containing for example, benzyl alcohol preservative) or in sterile water prior to injection.
  • Dosages and administration protocols for the treatment of cancers using the foregoing methods will vary with the method and the target cancer, and will generally depend on a number of other factors appreciated in the art.
  • screening is performed to identify modulators that induce or suppress a particular expression profile, suppress or induce specific pathways, preferably generating the associated phenotype thereby, in another embodiment, having identified differentially expressed genes important in a particular state; screens are performed to identify modulators that alter expression of individual genes, either increase or decrease.
  • screening is performed to identify modulators that alter a biological function ofthe expression product of a differentially expressed gene. Again, having identified the importance of a gene in a particular state, screens are performed to identify agents that bind and/or modulate the biological activity of the gene product.
  • screens are done for genes that are induced in response to a candidate agent.
  • identifying a modulator one that suppresses a cancer expression pattern leading to a normal expression pattern, or a modulator of a cancer gene that leads to expression ofthe gene as in normal tissue
  • a screen is performed to identify genes that are specifically modulated in response to the agent. Comparing expression profiles between normal tissue and agent-treated cancer tissue reveals genes that are not expressed in normal tissue or cancer tissue, but are expressed in agent treated tissue, and vice versa.
  • agent-specific sequences are identified and used by methods described herein for cancer genes or proteins. In particular these sequences and the proteins they encode are used in marking or identifying agent- treated cells.
  • antibodies are raised against the agent-induced proteins and used to target novel therapeutics to the treated cancer tissue sample.
  • Proteins, nucleic acids, and antibodies ofthe invention are used in screening assays.
  • the cancer-associated proteins, antibodies, nucleic acids, modified proteins and cells containing these sequences are used in screening assays, such as evaluating the effect of drug candidates on a "gene expression profile," expression profile of polypeptides or alteration of biological function.
  • the expression profiles are used, preferably in conjunction with high throughput screening techniques to allow monitoring for expression profile genes after treatment with a candidate agent (e.g., Davis, GF ; et al, J Biol Screen 7:69 (2002); Zlokarnik, et al., Science 279:84-8 (1998); Heid, Genome Res 6:986- 94,1996).
  • a candidate agent e.g., Davis, GF ; et al, J Biol Screen 7:69 (2002); Zlokarnik, et al., Science 279:84-8 (1998); Heid, Genome Res 6:986- 94,1996).
  • the cancer proteins, antibodies, nucleic acids, modified proteins and cells containing the native or modified cancer proteins or genes are used in screening assays. That is, the present invention comprises methods for screening for compositions which modulate the cancer phenotype or a physiological function of a cancer protein of the invention. This is done on a gene itself or by evaluating the effect of drug candidates on a "gene expression profile" or biological function, in one embodiment, expression profiles are used, preferably in conjunction with high throughput screening techniques to allow : monitoring after treatment with a candidate agent, see Zlokarnik, supra.
  • a variety of assays are executed directed to the genes and proteins of the invention. Assays are run on an individual nucleic acid or protein level. That is, having identified a particular gene as up regulated in cancer, test compounds are screened for the ability to modulate gene expression or for binding to the cancer protein ofthe invention. "Modulation" in this context includes an increase or a decrease in gene expression. The preferred amount of modulation will depend on the ⁇ original change of the gene expression in normal versus tissue undergoing cancer, with changes of at least 10%, preferably 50%, more preferably 100-300%, and in some embodiments 300-1000% or greater.
  • a gene exhibits a 4-fold increase in cancer tissue compared to normal tissue, a decrease of about four-fold is often desired; similarly, a 10-fold decrease in cancer tissue compared to normal tissue a target value of a 10-fold increase in expression by the test compound is often desired.
  • Modulators that exacerbate the type of gene expression seen in cancer are also useful, e.g., as an upregulated target in further analyses.
  • the amount of gene expression is monitored using nucleic acid probes and the quantification of gene expression levels, or, alternatively, a gene product itself is monitored, e.g., through the use of antibodies to the cancer protein and standard immunoassays. Proteomics and separation techniques also allow for quantification of expression. -.
  • gene expression monitoring i.e., an expression profile
  • Such profiles will typically involve one or more of the genes of Figure 2.
  • cancer nucleic acid probes are attached to biochips to detect and quantify cancer sequences in a particular cell.
  • PCR can be used.
  • a series e.g., wells of a microtiter plate, can be used with dispensed primers in desired wells. A PCR reaction can then be performed and analyzed for each well.
  • Expression monitoring is performed to identify compounds that modify the expression of one or more cancer- associated sequences, e.g., a polynucleotide sequence set out in Figure 2.
  • a test modulator is added to the cells prior to analysis.
  • screens are also provided to identify agents that modulate cancer, modulate cancer proteins of the invention, bind to a cancer protein of the invention, or interfere with the binding of a cancer protein of the invention and an antibody or other binding partner.
  • high throughput screening methods involve providing a library containing a large number of potential therapeutic compounds (candidate compounds). Such "combinatorial chemical libraries" are then screened in one or more assays to identify those library members (particular chemical species or subclasses) that display a desired characteristic activity. The compounds thus identified can serve as conventional "lead compounds,” as compounds for screening, or as therapeutics.
  • combinatorial libraries of potential modulators are screened for an ability to bind to a cancer polypeptide or to modulate activity.
  • new chemical entities with useful properties are generated by identifying a chemical compound (called a "lead compound") with some desirable property or activity, e.g., inhibiting activity, creating variants of the lead compound, and evaluating the property and activity of those variant compounds.
  • HTS high throughput screening
  • gene expression monitoring is conveniently used to test candidate modulators (e.g., protein, nucleic acid or small molecule).
  • candidate modulators e.g., protein, nucleic acid or small molecule.
  • the target sequence is prepared using known techniques. For example, a sample is treated to lyse the cells, using known lysis buffers, electroporation, etc., with purification and/or amplification such as PCR performed as appropriate. For example, an in vitro transcription with labels covalently attached to the nucleotides is performed. Generally, the nucleic acids are labeled with biotin-FITC or PE, or with cy3 or cy5. ⁇
  • the target sequence can be labeled with, e:g., a fluorescent, a chemiluminescent, a chemical, or a radioactive signal, to provide a means of detecting the target sequence's specific binding to a probe.
  • the label also can be an enzyme; such as alkaline phosphatase or horseradish peroxidase, which when provided with an appropriate substrate produces a : product that is detected.
  • the label is a labeled compound or small molecule, such as an enzyme inhibitor, that binds but is not catalyzed or altered by the enzyme.
  • the label also can be a moiety or compound, such as, an epitope tag or biotin which specifically binds to sfreptavidin.
  • the streptavidin is labeled as described above, thereby, providing a detectable signal for the bound target sequence. Unbound labeled streptavidin is typically removed prior to analysis.
  • these assays can be direct hybridization assays or can comprise "sandwich assays", which include the use of multiple probes, as is generally outlined in U.S. Patent Nos. 5, 681,702; 5,597,909; 5,545,730; 5,594,117; 5,591,584; 5,571,670; 5,580,731; 5,571,670; 5,591,584; 5,624,802; 5,635,352; 5,594,118; ⁇ 5,359,100; 5,124, 246; and 5,681,697.
  • the target nucleic acid is prepared as outlined above, and then added to the biochip comprising a plurality of nucleic acid probes, under conditions that allow the formation of a hybridization complex.
  • hybridization conditions are used in the present invention, including high, moderate and low stringency - conditions as outlined above.
  • the assays are generally run under stringency conditions which allow formation ofthe label probe hybridization complex only in the presence of target.
  • Stringency can be controlled by altering a step parameter that is a thermodynamic variable, including, but not limited to, temperature, formamide concentration, salt concentration, chaotropic salt concentration pH, organic solvent concentration, etc. These parameters may also be used to control non-specific binding, as is generally outlined in U.S. Patent No. 5,681,697. Thus, it can be desirable to perform certain steps at higher stringency conditions to reduce non-specific binding.
  • the reactions outlined herein can be accomplished in a variety of ways. Components of the reaction can be added simultaneously, or sequentially, in different orders, with preferred embodiments outlined below.
  • the reaction may include a variety of other reagents. These include salts, buffers, neutral proteins, e.g. albumin, detergents, etc. which can be used to facilitate optimal hybridization and detection, and/or reduce nonspecific or background interactions. Reagents that otherwise improve the efficiency ofthe assay, such as protease inhibitors, nuclease inhibitors, anti-microbial agents, etc., may also be used as appropriate, depending on the sample preparation methods and purity of the target.
  • the assay data are analyzed to determine the expression levels of individual genes, and changes in expression levels as between states, forming a gene expression profile.
  • the invention provides methods identify or screen for a compound that modulates the activity of a cancer-related gene or protein of the invention.
  • the methods comprise adding a test compound, as defined above, to a cell comprising a cancer protein of the invention.
  • the cells contain a recombinant nucleic acid that encodes a cancer protein of the invention.
  • a library of candidate agents is tested on a plurality of cells.
  • the assays are evaluated in the presence or absence or previous or subsequent exposure of physiological signals, e.g. hormones, antibodies, peptides, antigens, cytokines, growth factors, action potentials, pharmacological agents including chemotherapeutics, radiation, carcinogenics, or other cells (i.e., cell-cell contacts).
  • physiological signals e.g. hormones, antibodies, peptides, antigens, cytokines, growth factors, action potentials, pharmacological agents including chemotherapeutics, radiation, carcinogenics, or other cells (i.e., cell-cell contacts).
  • the determinations are made at different stages of the cell cycle process. In this way, compounds that . , modulate genes or proteins ofthe invention are identified. Compounds with pharmacological activity are able to enhance or interfere with the activity of the cancer protein of the invention. Once identified, similar structures are evaluated to identify • critical structural features of the compound.
  • a method of modulating (e.g., inhibiting) cancer cell division is provided; the method ⁇ comprises administration of a cancer modulator.
  • a method of modulating (e.g., inhibiting) cancer is provided; the method comprises administration of a cancer modulator.
  • methods of treating cells or individuals with cancer are provided; the method comprises administration of a cancer modulator.
  • a method for modulating the status of a cell that expresses a gene ofthe invention comprises such art-accepted parameters such as growth, proliferation, survival, function, apoptosis, senescence, location, enzymatic activity, signal transduction, etc. of a cell.
  • a cancer inhibitor is an antibody as discussed above.
  • the cancer inhibitor is an antisense molecule.
  • a variety of cell growth, proliferation, and metastasis assays are known to those of skill in the art, as described herein.
  • the assays to identify suitable modulators are amenable to high throughput screening. Preferred assays thus detect enhancement or inhibition of cancer gene transcription, inhibition or enhancement of polypeptide expression, and ⁇ inhibition or enhancement of polypeptide activity.
  • modulators evaluated in high throughput screening methods are proteins, often naturally occurring proteins or fragments of naturally occurring proteins.
  • proteins e.g., cellular extracts containing proteins, or random or directed digests of proteinaceous cellular extracts, are used.
  • libraries of proteins are made for screening in the methods of the invention.
  • Particularly preferred in this embodiment are libraries of bacterial, fungal, viral, and mammalian proteins, with the latter being preferred, and human proteins being especially preferred.
  • Particularly useful test compound will be directed to the ensemble of proteins to which the target belongs, e.g., substrates for enzymes, or ligands and receptors.
  • Normal cells require a solid substrate to attach and grow. When cells are transformed, they lose this phenotype . and grow detached from the substrate.
  • transformed cells can grow in stirred suspension culture or suspended in semi-solid media, such as semi-solid or soft agar.
  • the transformed cells when transfected with tumor suppressor genes, can regenerate normal phenotype and once again require a solid substrate to attach to and grow.
  • Soft agar growth or colony formation in assays are used to identify modulators of cancer sequences, which when expressed in host ceils, inhibit abnormal cellular proliferation and transformation.
  • a modulator reduces or eliminates the host cells' ability to grow suspended in solid or semisolid media, such as agar.
  • Normal cells typically grow in a flat and organized pattern in cell culture until they touch other cells. When the cells touch one another, they are contact inhibited and stop growing. Transformed cells, however, are not contact inhibited and continue to grow to high densities in disorganized foci. Thus, transformed cells grow to a higher saturation density than corresponding normal cells. This is detected morphologically by the formation of a disoriented monolayer of cells or cells in foci. Alternatively, labeling index with ( 3 H)-thymidine at saturation density is used to measure density limitation of growth, similarly an MTT or Alamar blue assay will reveal proliferation capacity of cells and the the ability of modulators to affect same. See Freshney (1994), supra. Transformed cells, when transfected with tumor suppressor genes, can regenerate a normal phenotype and become contact inhibited and would grow to a lower density.
  • labeling index with 3 H)-thymidine at saturation density is a preferred method of measuring density .
  • limitation of growth Transformed host cells are transfected with a cancer-associated sequence and are grown for 24 hours at saturation density in non-limiting medium conditions. The percentage of cells labeling with ( 3 H)-thymidine is determined by . incorporated cpm.
  • a modulator reduces or eliminates contact independent growth, and returns the cells to a normal phenotype.
  • Transformed cells have lower serum dependence than their normal counterparts (see, e.g., Temin, J. Natl. Cancer Inst. 37:167-175 (1966); Eagle et al., J. Exp. Med 131:836-879 (1970)); Freshney, supra. This is in part due to release of various growth factors by the transformed cells.
  • the degree of growth factor or serum dependence of transformed host cells can be compared with that of control. For example, growth factor or serum dependence of a cell is monitored in methods to identify and characterize compounds that modulate cancer-associated sequences of the invention.
  • Tumor cells release an increased amount of certain factors (hereinafter "tumor specific markers") than their normal counterparts.
  • plas inogen activator PA
  • PA plas inogen activator
  • Tumor Angiogenesis Factor TAF
  • TAF Tumor Angiogenesis Factor
  • the degree of invasiveness into Matrigel or an extracellular matrix constituent can be used as an assay to identify and characterize compounds that modulate cancer associated sequences.
  • Tumor cells exhibit a positive correlation between malignancy and invasiveness of cells into Matrigel or some other extracellular matrix constituent.
  • tumorigenic cells are typically used as host cells. Expression of a tumor suppressor gene in these host cells would decrease invasiveness ofthe host cells. Techniques described in Cancer Res. 1999; 59:6010; Freshney (1994), supra, can be used. Briefly, the level of invasion of host cells is measured by using filters coated with Matrigel or some other extracellular matrix constituent.
  • Penetration into the gel, or through to the distal side ofthe filter, is rated as invasiveness, and rated histologically by number of cells and distance moved, or by prelabeiing the cells with 125 1 and counting the radioactivity on the distal side of the filter or bottom ofthe dish. See, e.g., Freshney (1984), supra.
  • Transgenic organisms are prepared in a variety of art-accepted ways. For example, knock-out transgenic organisms, e.g., mammals such- as mice, are made, in which a cancer gene is disrupted or in which a cancer gene is inserted. Knock-out transgenic mice are made by insertion of a marker gene or other heterologous gene into the endogenous cancer gene site in the mouse genome via homologous recombination. Such mice can also be made by substituting the endogenous cancer gene with a mutated version of the cancer gene, or by mutating the endogenous cancer gene, e.g., by exposure to carcinogens.
  • knock-out transgenic organisms e.g., mammals such- as mice
  • Knock-out transgenic mice are made by insertion of a marker gene or other heterologous gene into the endogenous cancer gene site in the mouse genome via homologous recombination.
  • Such mice can also be made by substituting the endogenous cancer gene with a mutated version
  • transgenic chimeric animals e.g., mice
  • a DNA construct is introduced into the nuclei of embryonic stem cells.
  • Cells containing the newly engineered genetic lesion are injected into a host mouse embryo, which is re- impianted into a recipient female. Some of these embryos develop into chimeric mice that possess germ cells some of which are derived from the mutant cell line. Therefore, by breeding the chimeric mice it is possible to obtain a new line of mice containing the introduced genetic lesion (see, e.g., Capecchi et al., Science 244:1288 (1989)).
  • Chimeric mice can be derived according to US Patent 6,365,797, issued 2 April 2002; US Patent 6,107,540 issued 22 August 2000; Hogan et al. Manipulating the Mouse Embryo: A laboratory Manual, Cold Spring Harbor Laboratory (1988) and Teratocarcinomas and Embryonic Stem Cells: A Practical Approach, Robertson, ed., IRL Press, Washington, D C, (19
  • various immune-suppressed or immune-deficient host animals can be used.
  • a genetically athymic "nude” mouse see, e.g, Giovanella et al, J. Natl. Cancer Inst. 52:921 (1974)
  • SCID mouse see, e.g, Giovanella et al, J. Natl. Cancer Inst. 52:921 (1974)
  • SCID mouse see, e.g, Giovanella et al, J. Natl. Cancer Inst. 52:921 (1974)
  • SCID mouse see, e.g, a SCID mouse, a thymectomized mouse, or an irradiated mouse
  • irradiated mouse see, e.g, Bradley et al, Br. J. Cancer 38:263 (1978); Selby et al, Br. J. Cancer 41 :52 (1980)
  • Transpiantable tumor cells typically about 10 6 ceils injected into isogenic hosts produce invasive tumors in a high proportion of cases, while normal cells of similar origin will not.
  • cells expressing cancer-associated sequences are injected subcutaneously or orthotopically. Mice are then separated into groups, including control groups and treated experimental groups) e.g. treated with a modulator). After a suitable length of time, preferably 4-8 weeks, tumor growth is measured (e.g, by volume or by its two largest dimensions, or weight) and compared to the control. Tumors that have statistically significant reduction (using, e.g. Student's T test) are said to have inhibited growth.
  • Assays to identify compounds with modulating activity can be performed in vitro.
  • a cancer polypeptide is first contacted with a potential modulator and incubated for a suitable amount of time, e.g, from 0.5 to 48 hours.
  • the cancer polypeptide levels are determined in vitro by measuring the level of protein or mRNA.
  • the level of protein is measured using immunoassays such as Western blotting, ELISA and the like with an antibody that selectively binds to the cancer polypeptide or a fragment thereof.
  • amplification e.g, using PCR, LCR, or hybridization assays, e. g. Northern hybridization, RNAse protection, dot blotting, are preferred.
  • the level of protein or mRNA is detected using directly or indirectly labeled detection agents, e.g, fluorescently or radioactively labeled nucleic acids, radioactively or enzymatically labeled antibodies, and the like, as described herein.
  • a reporter gene system can be devised using a cancer protein promoter operably linked to a reporter gene such as luciferase, green fluorescent protein, CAT, or P-gal.
  • the reporter construct is typically transfected into a cell. After treatment with a potential modulator, the amount of reporter gene transcription, translation, or activity is measured according to standard techniques known to those of skill in the art (Davis GF, supra; Gonzalez, J. & Negulescu, P. Curr. Opin. Biotechnol. 1998: 9:624).
  • in vitro screens are done on individual genes and gene products. That is, having identified a particular differentially expressed gene as important in a particular state, screening of modulators of the expression of the gene or the gene product itself is performed.
  • screening for modulators of expression of specific gene(s) is performed. Typically, the expression of only one or a few genes is evaluated. In another embodiment, screens are designed to first find compounds that bind to differentially expressed proteins. These compounds are then evaluated for the ability to modulate differentially ⁇ expressed activity. Moreover, once initial candidate compounds are identified, variants can be further screened to better evaluate structure activity relationships.
  • a purified or isolated gene product of the invention is generally used.
  • antibodies are generated to a protein of the invention, and immunoassays are run to determine the amount and/or location of protein.
  • cells comprising the cancer proteins are used in the assays.
  • the methods comprise combining a cancer protein of the invention and a candidate compound such as a ligand, and determining the binding ofthe compound to the cancer protein ofthe invention.
  • Preferred embodiments utilize the human cancer protein; animal models of human disease of can also be developed and used.
  • other analogous mammalian, proteins also can be used as appreciated by those of skill in the art.
  • variant or derivative cancer proteins are used.
  • the cancer protein ofthe invention is non-diffusibly bound to an insoluble support.
  • the support can, e ; g, be one having isolated sample receiving areas (a microtiter plate, an array, etc.).
  • the insoluble supports can be made of any composition to which the compositions can be bound, is readily separated from soluble material, and is - otherwise compatible with the overall method of screening.
  • the surface of such supports can be solid or porous and of any convenient shape.
  • suitable insoluble supports include microtiter plates, arrays, membranes and beads. These are typically made of glass, plastic (e.g, polystyrene), polysaccharide, nylon, nitrocellulose, or TeflonTM, etc. Microtiter plates " and arrays are especially convenient because a large number of assays can be carried out simultaneously, using small amounts of reagents and samples.
  • Preferred methods of binding include the use of antibodies which do not sterically block either the ligand binding site or activation sequence when attaching the protein to the support, direct binding to "sticky" or ionic supports, chemical crosslinking, the synthesis of the protein or agent on the surface, etc.
  • excess unbound material is removed by washing.
  • the sample receiving areas may then be blocked through incubation with bovine serum albumin (BSA), casein or other innocuous protein or other moiety.
  • BSA bovine serum albumin
  • Binding agents include spedfic antibodies, non-natural binding agents identified in screens of chemical libraries, peptide analogs, etc.
  • assays to identify agents that have a low toxicity for human cells.
  • a wide variety of assays can be used for this purpose, including proliferation assays, cAMP assays, labeled in vitro protein-protein binding assays, elecfrophoretic mobility shift assays, immunoassays for protein binding, functional assays (phosphorylation assays, etc.) and the like.
  • a determination of binding of the test compound (ligand, binding agent, modulator, etc.) to a cancer protein of the invention can be done in a number of ways.
  • the test compound can be labeled, and binding determined directly, e.g, by attaching all or a portion of the cancer protein of the invention to a solid support, adding a labeled candidate compound (e.g, a fluorescent label), washing off excess reagent, and determining whether the label is present on the solid support.
  • a labeled candidate compound e.g, a fluorescent label
  • only one of the components is labeled, e.g, a protein of the invention or ligands labeled.
  • more than one component is labeled with different labels, e.g, I 125 , for the proteins and a fluorophor for the compound.
  • Proximity reagents e.g, quenching or energy transfer reagents are also useful.
  • the binding of the "test compound” is determined by competitive binding assay with a "competitor.”
  • the competitor is a binding moiety that binds to the target molecule (e.g, a cancer protein of the invention). Competitors include compounds such as antibodies, peptides, binding partners, ligands, etc. Under certain circumstances, the competitive binding between the test compound and the competitor. displaces the test compound.
  • the test compound is labeled. Either the test compound, the competitor, or both, is added to the protein for a time sufficient to allow binding. Incubations are performed at a temperature that facilitates optimal activity, typically between four and 40°C.
  • Incubation periods are typically optimized, e.g, to facilitate rapid high throughput screening; typically between zero and one hour will be sufficient. Excess reagent is generally removed or washed away. The second component is then added, and the presence or absence of the labeled component is followed, to indicate binding.
  • the competitor is added first, followed by the test compound.
  • Displacement ofthe competitor is an indication that the test compound is binding to the cancer protein and thus is capable of binding to, and potentially modulating, the activity of the cancer protein.
  • either component can be labeled.
  • the presence of label in the post-test compound wash solution indicates displacement by the test compound.
  • the presence of the label on the support indicates displacement.
  • the test compound is added first, with incubation and washing, followed by the competitor.
  • the absence of binding by the competitor indicates that the test compound binds to the cancer protein with higher affinity than the competitor.
  • the presence of the label on the support, coupled ⁇ ⁇ with a lack of competitor binding indicates that the test compound binds to and thus potentially modulates the cancer protein of the invention.
  • the competitive binding methods comprise differential screening to identity agents that are ' capable of modulating the activity of the cancer proteins ofthe invention.
  • the methods comprise combining a cancer protein and a competitor in a first sample.
  • a second sample comprises a test compound, the cancer protein, and a competitor.
  • the binding of the competitor is determined for both samples, and a change, or difference in binding between the two samples indicates the presence of an agent capable of binding to the cancer protein and potentially modulating its activity. That is, if the binding of the competitor is different in the second sample relative to the first sample, the agent is capable of binding to the cancer protein.
  • differential screening is used to identify drug candidates mat bind to the native cancer protein, but cannot bind to modified cancer proteins.
  • the structure ofthe cancer protein is modeled and used in rational drug design to synthesize agents that interact with that site, agents which generally do not bind to site-modified proteins.
  • drug candidates that affect the activity of a native cancer protein are also identified by screening drugs for the ability to either enhance or reduce the activity of such proteins.
  • Positive controls and negative controls can be used in the assays.
  • control and test samples are performed in at least triplicate to obtain statistically significant results. Incubation of all samples occurs for a time sufficient to allow for the binding of the agent to the protein. Following incubation, samples are washed free of non-specifically bound
  • the ⁇ samples can be counted in a scintillation counter to determine the amount of bound compound.
  • reagents can be included in the screening assays. These include reagents like salts, neutral proteins, e.g. albumin, detergents, etc. which are used to facilitate optimal protein-protein binding and/or reduce non-specific reagents.
  • reagents like salts, neutral proteins, e.g. albumin, detergents, etc. which are used to facilitate optimal protein-protein binding and/or reduce non-specific reagents.
  • reagents that otherwise improve the efficiency of the assay such as protease inhibitors, nuclease inhibitors, anti-microbial agents, etc, can be used.
  • the mixture of components is added in an order that provides for the requisite binding.
  • Polynucleotide modulators of cancer can be introduced into a cell containing the target nucleotide sequence by .formation of a conjugate with a ligand-binding molecule, as described in WO 91/04753.
  • Suitable ligand-binding molecules include, but are not limited to, cell surface receptors, growth factors, other cytokines, or other ligands that bind to cell surface receptors:
  • conjugation of the ligand binding molecule does not substantially interfere with the ability of the ligand • : binding molecule to bind to its corresponding molecule or receptor, or block entry ofthe sense or antisense oligonucleotide or its conjugated version into the cell.
  • a polynucleotide modulator of cancer can be introduced into a cell containing the target nucleic acid sequence, e.g, by formation of a polynucleotide-lipid complex, as described in WO 90/10448. It is understood that the use of antisense molecules or knock out and knock in models may also be used in screening assays as discussed above, in addition to methods of treatment.
  • the activity of a cancer-associated protein is down-regulated, or entirely inhibited, by the use of antisense- polynucleotide or inhibitory small nuclear RNA (snRNA), i.e., a nucleic acid complementary to, and which can preferably hybridize specifically to, a coding mRNA nucleic acid sequence, e.g., a cancer protein of the invention, mRNA, or a subsequence thereof. Binding of the antisense polynucleotide to the mRNA reduces the translation and/or stability of the mRNA.
  • snRNA inhibitory small nuclear RNA
  • antisense polynucleotides can comprise naturally occurring nucleotides, or synthetic species formed from naturally occurring subunits or their close ho ologs. Antisense polynucleotides may also have altered sugar moieties or inter-sugar linkages. Exemplary among these are the phosphorothioate and other sulfur containing species which are known for use in the art. Analogs are comprised by this invention so long as they function effectively to hybridize with nucleotides of the invention. See, e.g, Isis Pharmaceuticals, Carlsbad, CA; Sequitor, Inc, Natick, MA.
  • antisense polynucleotides can readily be synthesized using recombinant means, or can be synthesized in vitro. Equipment for such synthesis is sold by several vendors, including Applied Biosystems. The preparation of other oligonucleotides such as phosphorothioates and alkylated derivatives is also well known to those of skill in the art.
  • Antisense molecules as used herein include antisense or sense oligonucleotides. Sense oligonucleotides can, e.g, be employed to block transcription by binding to the anti-sense strand.
  • the antisense and sense oligonucleotide comprise a single stranded nucleic acid sequence (either RNA or DNA) capable of binding to target mRNA (sense) or DNA (antisense) sequences for cancer molecules.
  • Antisense or sense oligonucleotides comprise a fragment generally at least about 12 nucleotides, preferably from about 12 to 30 nucleotides.
  • Stein &Cohen Cancer Res.48:2659 (1988 and van der Krol et al. (BioTechniques 6:958 (1988)).
  • ribozymes can be used to target and inhibit transcription of cancer- associated nucleotide sequences.
  • a ribozyme is an RNA molecule that catalytically cleaves other RNA molecules.
  • Different kinds of ribozymes have been described, including group I ribozymes, hammerhead ribozymes, hairpin ribozymes, RNase P, and axhead ribozymes (see, e.g, Castanotto et al. Adv. in Pharmacology 25: 289-317 (1994) for a general review ofthe properties of different ribozymes).
  • hairpin ribozymes are described, e.g, in Hampel et al, Nucl. Acids Res. 18:299-304 (1990); European Patent Publication No.0360257; U.S. Patent No.5,254,678.
  • Methods of preparing are well known to those of skill in the art (see, e.g, WO 94/26877; qwang et al, Proc. Natl. Acad. Sci. USA 90:6340-6344 (1993); Yamada et al. Human Gene Therapy 1 :39-45 (1994); Leavitt et al. Prop. Natl. Acad Sci. USA 92:699- 703 (1995); Leavitt et al. Human Gene Therapy 5: 1151-120 (1994); and Yamada et al. Virology 205: 121-126 (1994)).
  • a test compound is administered to a population of cancer cells, which have an associated cancer expression profile.
  • administration or “contacting” herein is meant that the modulator is added to the cells in such a manner as to allow the modulator to act upon the cell, whether by uptake and intracellular action, or by action at the cell surface.
  • a nucleic acid encoding a proteinaceous agent i.e., a peptide
  • a viral construct such as an adenoviral or retroviral construct
  • expression ofthe peptide agent is accomplished, e.g, PCT US97/01019.
  • Regulatable gene therapy systems can also be used.
  • the celis are washed if desired and are allowed to incubate under preferably physiological conditions for some period.
  • the cells are then harvested and a new gene expression profile is generated.
  • cancer tissue is screened for agents that modulate, e.g, induce or suppress, the cancer phenotype.
  • a change in at least one gene, preferably many, of the expression profile indicates that the agent has an effect on cancer activity.
  • altering a biological function or a signaling pathway is indicative of modulator activity.
  • screens are done to assess genes or gene products. That is, having identified a particular differentially expressed gene as important in a particular state, screening of modulators of either the expression of the gene or the gene product itself is performed.
  • Measurements of cancer polypeptide activity, or of the cancer phenotype are performed using a variety of assays. For example, the effects of modulators upon the function of a cancer polypeptide(s) are measured by examining parameters described above. A physiological change that affects activity is used to assess the influence of a test compound on the polypeptides of this invention.
  • a variety of effects can be assesses such as, in the case of a cancer associated with solid tumors, tumor growth, tumor metastasis, neovascularization, hormone release, transcriptional changes to both known and uncharacterized genetic markers (e.g, by Northern blots), changes in cell metabolism such as cell growth or pH changes, and changes in intracellular second messengers such as cGNIP.
  • the invention provides methods for identifying cells containing variant cancer genes, e.g, determining the presence of, all or part, the sequence of at least one endogenous cancer gene in a cell. This is accomplished using any number of sequencing techniques.
  • the invention comprises methods of identifying the cancer genotype of an individual, e.g, determining all or part of the sequence of at least one gene of the invention in the individual. This is generally done in at least one tissue of the individual, e.g, a tissue set forth in Table I, and may include the evaluation of a number of tissues or different samples of .the same tissue.
  • the method may include comparing the sequence ofthe sequenced gene to a known cancer gene, i.e, a wild-type gene to determine the presence of family members, ho ologies, mutations or variants.
  • the sequence of all or part of the gene can then be compared to the sequence of a known cancer gene to determine if any differences exist. This is done using any number of known homology programs, such as BLAST, Bestfit, etc.
  • the presence of a difference in the sequence between the cancer gene of the patient and the known cancer gene correlates with a disease state or a propensity for a disease state, as outlined herein.
  • the cancer genes are used as probes to determine the number of copies of the cancer gene in the genome.
  • the cancer genes are used as probes to determine the chromosomal localization of the cancer genes.
  • Information such as chromosomal localization finds use in providing a diagnosis or prognosis in particular when chromosomal abnormalities such as translocations, and the like are identified in the cancer gene locus.
  • kits are also within the scope of the invention.
  • Such kits can comprise a carrier, package or container that is compartmentalized to receive one or more , containers such as vials, tubes, and the like, each ofthe containers) comprising one of the separate elements to be used in . the method.
  • the container(s) can comprise a probe that is or can be detectably labeled.
  • probe can be an antibody or polynucleotide specific for a Figure 2-related protein or a Figure 2 gene or message, respectively.
  • the kit can also have containers containing nucleotide(s) for amplification ofthe target nucleic acid sequence and/or a container comprising a reporter-means, such as a biotin-binding protein, such as avidin or streptavidin, bound to a reporter molecule, such as an enzymatic, florescent, or radioisotope label.
  • a reporter-means such as a biotin-binding protein, such as avidin or streptavidin
  • the kit can include all or part of the amino acid sequences in Figure 2 or Figure 3 or analogs thereof, or a nucleic acid molecules that encodes such amino acid sequences.
  • the kit of the invention will typically comprise the container described above and one or more other containers comprising materials desirable from a commercial and user standpoint, including buffers, diluents, filters, needles, syringes; carrier, package, container, vial and/or tube labels listing contents and/or instructions for use, and package inserts with instructions for use.
  • a label can be present on the container to indicate that the composition is used for a specific therapy or non-therapeutic application, such as a diagnostic or laboratory application, and can also indicate directions for either in vivo or in vitro use, such as those described herein. Directions and or other information can also be included on an insertfs) or label(s) which is included with or on the kit.
  • an article(s) of manufacture containing compositions, such as amino acid. sequence(s), small molecule(s), nucleic acid sequence(s), and/or antibody(s), e.g, materials useful for the diagnosis, prognosis, prophylaxis and/or treatment of neoplasias of tissues such as those set forth in Table I is provided.
  • the article of manufacture typically comprises at least one container and at least one label. Suitable containers include, for example, bottles, vials, syringes, and test tubes. The containers can be formed from a variety of materials such as glass or plastic.
  • the container can hold amino acid sequence(s), small molecule(s), nucleic acid sequence(s), and/or antibody(s), in one embodiment the container holds a polynucleotide for use in examining the mRNA expression profile of a cell,, together with •
  • the container can alternatively hold a composition which is effective for treating, diagnosis, prognosing or prophylaxing a condition and can have a sterile access port (for example the container can be an intravenous solution bag or a vial having a stopper pierceable by a hypodermic injection needle).
  • the active agents in the composition can be an
  • the label can be on or associated with the container.
  • a label a can be on a container when letters, numbers or ' other characters forming the label are molded or etched into the container itself; a label can be associated with a container when it is present within a receptacle or carrier that also holds the container, e.g, as a package insert.
  • the label can indicate that the composition is used for diagnosing, treating, prophylaxing or prognosing a condition, such as a neoplasia of a tissue set forth in Table I.
  • the article of manufacture can further comprise a second container comprising a pharmaceutically-acceptable buffer, such as phosphate-buffered saline, Ringer's solution and/ordextrose solution. It can - further include other materials desirable from a commercial and user standpoint, including other buffers, diluents, filters, stirrers, needles, syringes, and/or package inserts with indications and/or instructions for use.
  • LAPC-9AD xenograft was obtained from Dr. Charles Sawyers (UCLA) and was generated as described (Klein et al, 1997, Nature Med.3:402-408; Craft et al, 1999, Cancer Res. 59:5030-5036).
  • LAPC-9AD 2 was generated from LAPC-9AD xenograft by growing LAPC-9AD xenograft tissues within a piece of human bone implanted in SCID mice. Tumors were then harvested and subsequently passaged subcutaneously into other SCID animals to generate LAPC-9AD 2 .
  • the 193P1 E1 B SSH cDNA sequence was derived from a subtraction consisting of a prostate cancer xenograft LAPC-9AD 2 minus prostate cancer xenograft LAPC-9AD.
  • the 193P1E1B cDNA was identified as highly expressed in the prostate cancer xenograft pool (LAPC4-AD, LAPC4-AI, LAPC9-AD, LAPC9-AI), bladder cancer pool, kidney cancer pool, colon cancer pool, lung cancer pool, ovary cancer pool, breast cancer pool, metastasis cancer pool, pancreas cancer pool, with low expression observed in the prostate cancer pool, and no expression observed in vital pool 1 (kidney, liver, lung), and in vital pool 2 (stomach, colon, pancreas) ( Figure 14).
  • the 193P1 E1 B SSH cDNA of 227 bp is listed in Figure 1.
  • the full length 193P1 E1 B cDNAs and ORFs are described in Figure 2 with the protein sequences listed in Figure 3.
  • 193P1E1B v.1, v.2, v.3, v.4, v.5, v.6, v.7, v.8, v.11, v.12 and v.13 are novel proteins and have not been previously described.
  • 193P1E1B v.9 shows 99% identity to a hypothetical protein, MGC4832.
  • 193P1E1B v.10 shows 100% identity to a novel unnamed protein BAC03484.1.
  • Tumor tissues were homogenized in Trizol reagent (Life Technologies, Gibco BRL) using 10 ml/ g tissue or 10 ml/ 10 8 cells to isolate total RNA.
  • Poly A RNA was purified from, total RNA using Qiagen's Oligotex mRNA Mini and Midi kits. Total and mRNA were quantified by spectrophotometric analysis (O.D. 260/280 nm) and analyzed by gel electrophoresis.
  • DPNCDN (cDNA synthesis primer): 5TTTTGATCAAGCTT303' (SEQ ID NO: 52)
  • Adaptor 1 ' ⁇ . 5'CTAATACGACTCACTATAGGGCTCGAGCGGCCGCCCGGGCAG3' (SEQ ID NO: 53) 3'GGCCCGTCCTAG5' (SEQ ID NO: 54)
  • Adaptor 2 • 5'GTAATACGACTCACTATAGGGCAGCGTGGTCGCGCGGCCGAG3' (SEQ ID NO: 55) 3OGGCTCCTAG5' (SEQ ID NO: 56)
  • Nested primer (NP)2 5 ⁇ GCGTGGTCGCGGCCGAGGA3' (SEQ ID NO: 59)
  • SSH Suppression Subtractive Hybridization
  • the cDNA derived from prostate cancer xenograft LAPC-9AD tissue was used as the source of the "driver” cDNA, while the cDNA from prostate cancer xenograft LAPC-9AD 2 was used as the source of the "tester” cDNA.
  • Double stranded cDNAs corresponding to tester and driver cDNAs were synthesized from 2 ⁇ g of poly(A) + RNA isolated from the relevant tissue, as described above, using CLONTECH's PCR-Select cDNA Subtraction Kit and 1 ng of oligonucleotide DPNCDN as primer. First- and second-strand synthesis were carried out as described in the Kit's user manual protocol (CLONTECH Protocol No. PT1117-1, Catalog No. K1804-1). The resulting cDNA was digested with Dpn II for 3 hrs at 37°C. Digested cDNA was extracted with phenol/chloroform (1:1) and ethanol precipitated.
  • Tester cDNA was generated by diluting 1 ⁇ l of Dpn II digested cDNA from the relevant tissue source (see above) (400 ng) in 5 ⁇ l of water. The diluted cDNA (2 ⁇ l, 160 ng) was then ligated to 2 ⁇ l of Adaptor 1 and Adaptor 2 (10 ⁇ M), in separate ligation reactions, in a total volume of 10 ⁇ l at 16°C overnight, using 400 u of T4 DNA ligase (CLONTECH). Ligation was terminated with 1 ⁇ l of 0.2 M EDTA and heating at 72°C for 5 min.
  • the first hybridization was performed by adding 1.5 ⁇ l (600 ng) of driver cDNA to each of two tubes containing 1.5 ⁇ l (20 ng) Adaptor 1- and Adaptor 2- ligated tester cDNA. In a final volume of 4 ⁇ l, the samples were overlaid with mineral oil, denatured in an MJ Research thermal cycler at 98°C for 1.5 minutes, and then were allowed to hybridize for 8 hrs at 68°C. The two hybridizations were then mixed together with an additional 1 ⁇ l of fresh denatured driver cDNA and were allowed to hybridize overnight at 68°C. The second hybridization was then diluted in 200 ⁇ l of 20 mM Hepes, pH 8.3, 50 mM NaCl, 0.2 mM EDTA, heated at 70°C for 7 min. and stored at -20°C.
  • PCR 1 was conducted using the following conditions: 75°C for 5 min, 94°C for 25 sec, then 27 cycles of 94°C for 10 sec, 66°C for 30 sec, 72°C for 1.5 min. Five separate primary PCR reactions were performed for each experiment.
  • PCR 2 was performed using 10-12 cycles of 94°C for 10 sec, 68°C for 30 sec, and 72°C for 1.5 minutes. The PCR products were analyzed using 2% agarose gel electrophoresis.
  • PCR products were inserted into pCR2.1 using the T/A vector cloning kit (Invitrogen). Transformed £ coli were subjected to blue/white and ampicillin selection. White colonies were picked and arrayed into 96 well plates and were grown in liquid culture overnight. To identify inserts, PCR amplification was performed on 1 ml of bacterial culture using the conditions of PCR1 and NP1 and NP2 as primers. PCR products were analyzed using 2% agarose gel electrophoresis.
  • Bacterial clones were stored in 20% glycerol in a 96 well format. Plasmid DNA was prepared, sequenced, and subjected to nucleic acid homology searches of the GenBank, dBest, and NCI-CGAP databases.
  • First strand cDNAs can be generated from 1 ⁇ g of mRNA with oligo (dT)12-18 priming using the Gibco-BRL Superscript Preamplification system. The manufacturer's protocol was used which included an incubation for 50 min at42°C with reverse transcriptase followed by RNAse H treatment at 37°C for 20 min. After completing the reaction, the volume can be increased to 200 ⁇ l with water prior to normalization. First strand cDNAs from 16 different normal human tissues can be obtained from Clontech.
  • Normalization of the first strand cDNAs from multiple tissues was performed by using the primers 5'atatcgccgcgctcgtcgtcgacaa3' (SEQ ID NO: 60) and 5'agccacacgcagctcattgtagaagg 3' (SEQ ID NO: 61) to amplify ⁇ -actin.
  • First strand cDNA (5 ⁇ !) were amplified in a total volume of 50 ⁇ l containing 0.4 ⁇ M primers, 0.2 ⁇ M each dNTPs, 1XPCR buffer (Clontech, 10 mM Tris-HCL, 1.5 mM MgCb, 50 mM KCI, pH8.3) and 1X Klentaq DNA polymerase (Clontech). Five ⁇ ! ofthe PCR reaction can be removed at 18, 20, and 22 cycles and used for agarose gel electrophoresis.
  • PCR was performed using an MJ Research thermal cyder under the following conditions: Initial denaturation can be at 94°C for 15 sec, followed by a 18, 20, and 22 cycles of 94°C for 15, 65°C for 2 min, 72°C for 5 sec. A final extension at 72°C was carried out for 2 min. After agarose gel electrophoresis, the band intensities ofthe 283 bp ⁇ -actin bands from multiple tissues were compared by visual inspection. Dilution factors for the first strand cDNAs were calculated to result in equal ⁇ -actin band intensities in all tissues after 22 cycles of PCR. Three rounds of normalization can be required to achieve equal band intensities in all tissues after 22 cycles of PCR.
  • RT-PCR expression analysis was performed on first strand cDNA generated using pools of tissues from multiple samples. The cDNA samples were shown to be normalized using beta-actin PCR. Strong expression of 193P1 E1 B was observed in prostate cancer xenograft pool, bladder cancer pool, kidney cancer pool, colon cancer pool , lung cancer pool, ovary cancer pool, breast cancer pool, and metastasis pool. Low expression was observed in prostate cancer pool, but no expression was detected in VP1 and VP2.
  • the gene 193P1 E1 B was derived from a subtraction consisting of a prostate cancer xenograft LAPC- 9AD 2 minus prostate cancer xenograft LAPC-9AD.
  • the SSH DNA sequence ( Figure 1 ) was designated 193P1 E1 B.
  • Thirteen variants of 193P1E1B were identified ( Figures 2 and 3).
  • cDNA clone 193P1E1B v.1 and 193P1E1B v.5 were cloned from bladder cancer pool cDNA.
  • 193P1 E1 B v.9 was cloned from LAPC-4AD cDNA library. All other variants were identified by bioi ⁇ formatic analysis.
  • 193P1 E1 B v.1 through v.8 differ from each other by one nucleic acid substitution.
  • 193P1 E1 B v.1 , v.2, v.4 v.7 and ⁇ v.8 code for the same protein, whereas 193P1 E1 B v.5 and v.6 contain one amino acid substitution as shown in Figure 12.
  • 193P1 E1 B v.1 , v.2, v.3, v.4, v.5, v.6, v.7, v.8, v.11 , v.12 and v.13 are novel proteins and have not been previously described.
  • 193P1E1B v.9 shows 99% identity to a hypothetical protein, MGC4832.
  • 193P1E1B v.10 shows 100% identity to a novel unnamed protein BAC03484.1.
  • Chromosomal localization can implicate genes in disease pathogenesis.
  • chromosome mapping approaches include fluorescent in situ hybridization (FISH), human/hamster radiation hybrid (RH) panels (Walter et al, 1994; Nature Genetics 7:22; Research Genetics, Huntsville Al), human-rodent somatic cell hybrid panels such as is available from the Coriell Institute (Ca den, New Jersey), and genomic viewers utilizing BLAST homologies to sequenced and mapped genomic clones (NCBI, Bethesda, Maryland).
  • This 13q11 region has been previously implicated in bladder cancer (Wada T, Louhelainen J, Hemminki K, Adolfsson J, Wijkstrom H, Norming U, Borgstrom E, Hansson J, Sandstedt B, Steineck G.
  • Bladder cancer allelic deletions at and around the reti ⁇ oblastoma tumor suppressor gene in relation to stage and grade. Clin Cancer Res. 2000 Feb;6(2):610-5.).
  • Example 4 Expression Analysis of 193P1E1B
  • First strand cDNA was prepared from vital pool 1 (VP1: liver, lung and kidney), vital pool 2 (VP2, pancreas, colon and stomach), prostate xenograft pool (LAPC-4AD, LAPC-4AI, LAPC-9AD, LAPC-9AI), normal thymus, prostate cancer pool, bladder cancer pool , kidney cancer pool, colon cancer pool , lung cancer pool, ovary cancer pool, breast cancer pool, metastasis cancer pool, pancreas cancer pool, and from prostate cancer metastasis to lymph node from .2 different patients. Normalization was performed by PCR using primers to actin and GAPDH.
  • Primer Set B detected a PCR product of 239 bp from 193P1 E1 B v.1 through v.8, and of 177 bp from 193P1 E1 B v.9 (Figure 14C).
  • Figure 14C shows that the transcipt encoding encoding 193P1 E1B v.1 through v.8, is expressed " ate higher levels that the transcript encoding 193P1E1B v.9. But both transcripts are expressed at similar proportion in all tissues tested.
  • Figure 16 shows expression of 193P1 E1 B in prostate cancer xenografts.
  • RNA was extracted from normal prostate, and from prostate cancer xenografts, LAPC-4AD, LAPC-4AI, LAPC-9AD, and LAPC-9AI.
  • Northern blot with 10 ug of total RNA/lane was probed with 193P1E1B SSH sequence.
  • Northern blot analysis shows expression of 193P1E1B in all 4 tissues, LAPC-4AD, LAPC4AI, LAPC-9AD, LAPC-9AI, with the lowest expression detected in the LAPC-9AD tissue, but not in normal prostate.
  • Figure 19 shows expression of 193P1 E1 B in cancer metastasis patient specimens.
  • RNA was extracted from the following cancer metastasis tissues, colon metastasis to lung, lung metastasis to lymph node, lung metastasis to skin, and breast metastasis to lymph node, as well as from normal bladder (NB), normal lung (NL), normal breast (NBr), and normal ovary (NO).
  • Northern blots with 10 ug of total RNA/lane were probed with 193P1E1B sequence. Size standards in kilobases (kb) are indicated on the side. The results show expression of 193P1 E1 B in all four different cancer metastasis samples but not in the normal tissues tested.
  • Figure 20 shows expression of 193P1 E1 B in pancreatic, ovarian and testicular cancer patient specimens.
  • RNA was extracted from pancreatic cancer (P1), ovarian cancer (P2, P3), and testicular cancer (P4, P5) isolated from cancer patients, as well as from normal pancreas (NPa).
  • Northern blots with 10 ug of total RNA/lane were probed with 193P1E1B sequence. Size standards in kilobases (kb) are indicated on the side.
  • the results show expression of 193P1 E1 B in pancreatic, ovarian and testicular cancer specimens but not in normal pancreas.
  • Figure 21 shows expression of 193P1 E1 B in normal compared to patient cancer specimens.
  • First strand cDNA was prepared from a panel of normal tissues (stomach, brain, heart, liver, spleen, skeletal muscle, testis prostate, bladder, kidney, colon, lung and pancreas) and from a panel of patient cancer pools (prostate cancer pool, bladder cancer pool , kidney cancer pool, colon cancer pool , lung cancer pool, pancreas cancer pool, ovary cancer pool, breast cancer pool, metastasis cancer pool, LAPC prostate xenograft pool (XP), and from prostate cancer metastasis to lymph node from 2 different patients (PMLN2). Normalization was performed by PCR using primers to actin.
  • 193P1 E1 B was also shown to be expressed in uterus, melanoma and bone cancer patient specimens.
  • First strand cDNA was prepared from a panel of uterus patient cancer specimens (A), melanoma and bone cancer specimens (B).
  • 193P1 E1 B expression is reminiscent of a cancer-testis gene. Its restricted normal tissue expression to normal testis, and the upregulation detected in prostate cancer, bladder cancer, kidney cancer, colon cancer, lung cancer, ovary cancer, breast cancer and pancreatic cancer suggest that 193P1 E1 B is a potential therapeutic target and a diagnostic marker for human cancers.
  • Transcript variants are variants of mature mRNA from the same gene which arise by alternative transcription or alternative splicing.
  • Alternative transcripts are transcripts from the same gene but start transcription at different points.
  • Splice variants are mRNA variants spliced differently from the same transcript.
  • a given gene can have zero to many alternative transcripts and each transcript can have zero to many splice variants.
  • Each transcript variant has a unique exon makeup, and can have different coding and/or non-coding (5' or 3' end) portions, from the original transcript.
  • Transcript variants can code for similar or different proteins with the same or a similar function or can encode proteins with different functions, and can be expressed in the same tissue at the same time, or in different tissues at the same time, or in the same tissue at different times, or in different tissues at different times. Proteins encoded by transcript variants can have similar or different cellular or extracellular localizations, e.g, secreted versus intracellular.
  • Transcript variants are identified by a variety of art-accepted methods. For example, alternative transcripts and splice variants are identified by full-length cloning experiment, or by use of full-length transcript and EST sequences. First, all human ESTs were grouped into clusters which show direct or indirect identity with each other. Second, ESTs in the same cluster were further grouped into sub-clusters and assembled into a consensus sequence. The original gene sequence is compared to the consensus sequence(s) or other full-length sequences. Each consensus sequence is a potential splice variant for that gene. Even when a variant is identified that is not a full-length clone, that portion of the variant is very useful for antigen generation and for further cloning of the full-length splice variant, using techniques known in the art.
  • Genomic-based transcript variant identification programs indude FgenesH (A. Salamov and V. Solovyev, "Ab initio gene finding in Drosophila genomic DNA,” Genome Research.2000 April; 10(4):516-22); Grail (URL compbio.ornl.gov/Grail-bin/EmptyGrailForm) and GenScan (URL genes.mit.edu/GENSCAN.html).
  • FgenesH A. Salamov and V. Solovyev, "Ab initio gene finding in Drosophila genomic DNA," Genome Research.2000 April; 10(4):516-22
  • Grail URL compbio.ornl.gov/Grail-bin/EmptyGrailForm
  • GenScan URL genes.mit.edu/GENSCAN.html
  • PCR-based Validation Wellmann S, ef al, Specific reverse transcription-PCR quantification of vascular endothelial growth factor (VEGF) splice variants by LightCycler technology, Clin Chem.- 2001 Apr;47(4):654-60; Jia, H.P, ef a/. Discovery of new human beta- defensins using a genomics-based approach, Gene.2001 Jan 24; 263(1-2):211-8.
  • PCR-based and 5' RACE Validation Brigle, K.E, ef al, Organization ofthe murine reduced folate carrier gene and identification of variant splice forms, Biochem Biophys Acta. 1997 Aug 7; 1353(2): 191-8).
  • genomic regions are modulated in cancers.
  • the alternative transcripts or splice variants of the gene are modulated as well.
  • 193P1 E1 B has a particular expression profile related to cancer.
  • Alternative transcripts and splice variants of 193P1 E1 B may also be involved in cancers in the same or different tissues, thus serving as tumor-associated markers/antigens.
  • transcript variant 193P1E1B v.7 has spliced out exons 10 and 11 from variant 193P1E1B, v.1, as shown in Figure 12.
  • Variant 193P1E1B v.8 inserted 36 bp in between 1931 and 1932 of variant 193P1E1B v.1 and variant 193P1E1B v.9 replaced with 36 bp the segment 1136-1163 of variant 193P1E1B v.1.
  • each different combination of exons in spatial order is a potential splice variant.
  • Tables LI through LXX are set forth on a variant-by-variant bases.
  • Tables LI, LV, LIX, LXIII, and LXVII show the nucleotide . sequence of the transcript variant.
  • Tables UI, LVI, LX, LXIV, and LXVIII show the alignment ofthe transcript variant with nucleic acid sequence of 193P1 E1B v.1.
  • Tables Llll, LVII, LXI, LXV, and LXIX show the amino acid translation ofthe transcript variant for the identified reading frame orientation.
  • Tables LIV, LVIll, LXII, LXVI, and LXX display alignments ofthe amino acid sequence encoded by the splice variant with that of 193P1 E1 B v.1.
  • a Single Nucleotide Polymorphism is a single base pair variation in a nucleotide sequence at a specific location.
  • SNP Single Nucleotide Polymorphism
  • Genotype refers to the. specific base pair sequence of one or more locations in the genome of an individual.
  • Haplotype refers to the base pair sequence of more than one location on the same DNA molecule (or the same chromosome in higher organisms), often in the context of one gene or in the context of several tightly linked genes.
  • SNPs that occur on a cDNA are called cSNPs. These cSNPs may change amino acids of the protein encoded by the gene and thus change the functions of the protein.
  • SNPs and/or combinations of alleles have many applications, including diagnosis of inherited diseases, determination of drug reactions and dosage, identification of genes responsible for diseases, and analysis ofthe genetic relationship between individuals (P. Nowotny, J. M. Kwo ⁇ and A. M. Goate, ' SNP analysis to dissect human traits," Curr. Opin. Neurobiol. 2001 Oct; 11(5):637-641; M. Pirmohamed and B. K. Park, "Genetic susceptibility to adverse drug reactions," Trends Pharmacol. Sci.2001 Jun; 22(6):298- 305; J. H.
  • SNPs are identified by a variety of art-accepted methods (P. Bean, "The promising voyage of SNP target discovery,” Am. Clin. Lab. 2001 Oct-Nov; 20(9):18-20; K. M. Weiss, "In search of human variation,” Genome Res. 1998 Jul; 8(7):691-697; M. M. She, “Enabling large-scale pharmacogenetic studies by high-throughput mutation detection and • genotyping technologies," Clin. Chem. 2001 Feb; 47(2):164-172).
  • SNPs are identified by sequencing DNA ⁇ fragments that show polymorphism by gel-based methods such as restriction fragment length polymorphism (RFLP) and denaturing gradient gel electrophoresis (DGGE).
  • RFLP restriction fragment length polymorphism
  • DGGE denaturing gradient gel electrophoresis
  • seven SNPs were identified in the original transcript, 193P1E1B v.1, at positions 57 (A/G), 792 (C/G), 804 (C/A), 1253 (G/A), 1564 (A/G), 2268 (C/T) and 2387 (C/T).
  • the transcripts or proteins with alternative alleles were designated as variants 193P1E1B v.2, v.3, v.4, v.5 and v.6, respectively.
  • Figure 10 shows the schematic alignment of the SNP variants.
  • Figure 11 shows the schematic alignment of protein variants, corresponding to nucleotide variants. Nucleotide variants that code for the same amino acid sequence as variant 1 are not shown in Figure 11.
  • These alleles ofthe SNPs though shown separately here, can occur in different combinations (haplotypes) and in any one ofthe transcript variants (such as 193P1 E1B v.9) that contains the sequence context of the SNPs.
  • the full or partial length 193P1 E1 B cDNA sequences can be cloned into any one of a variety of expression vectors known in the art.
  • One or more of the following regions of 193P1E1B are expressed in these constructs, amino acids 1 to 412 of variant 5 or variant 2; or amino acids 1 to 388 of variant 10, or any 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more contiguous amino acids from 193P1E1B, variants, or analogs thereof.
  • a region of 193P1E1B is expressed that encodes an amino acid not shared amongst at least variants.
  • pCRII In vitro transcription and translation constructs: pCRII: To generate 193P1E1B sense and anti-sense RNA probes for RNA in situ investigations, pCRII constructs (Invitrogen, Carlsbad CA) are generated encoding either all or fragments of a 193P1 E1 B cDNA. The pCRII vector has Sp6 and T7 promoters flanking the insert to drive the transcription of 193P1E1 B RNA for use as probes in RNA in situ hybridization experiments. These probes are used to analyze the cell and tissue expression of 193P1 E1 B at the RNA level.
  • Transcribed 193P1E1B RNA representing the cDNA amino acid coding region of the 193P1E1B gene is used in in vitro translation systems such as the TnTTM Coupled Reticulolysate System (Promega, Corp, Madison, Wl) to synthesize 193P1E1B protein.
  • TnTTM Coupled Reticulolysate System Promega, Corp, Madison, Wl
  • pGEX Constructs To generate recombinant 193P1 E1 B proteins in bacteria that are fused to the Glutathione S- transferase (GST) protein, all or parts of a 193P1 E1 B cDNA protein coding sequence are fused to the GST gene by cloning into pGEX-6P-1 or any other GST- fusion vector of the pGEX family (Amersham Pharmacia Biotech, Piscataway, NJ). These constructs allow controlled expression of recombinant 193P1 E1 B protein sequences with GST fused at the amino-terminus and a six histidine epitope (6X His) at the carboxyl-terminus.
  • GST Glutathione S- transferase
  • the GST and 6X His tags permit purification ofthe recombinant fusion protein from induced bacteria with the appropriate affinity matrix and allow recognition ofthe fusion protein with anti- GST and anti-His antibodies.
  • the 6X His tag is generated by adding 6 histidine codons to the cloning primer at the 3' end, e.g, ofthe open reading frame (ORF).
  • a proteolytic cleavage site such as the PreScissionTM recognition site in pGEX-6P-1, . may be employed such that it permits cleavage ofthe GST tag from 193P1E1 B-related protein.
  • the ampicillin resistance . gene and pBR322 origin permits selection and maintenance of the pGEX plasmids in £ coli.
  • pMAL Constructs To generate, in bacteria, recombinant 193P1E1B proteins that are fused to maltose-binding
  • ⁇ protein all or parts of a 193P1 E1 B cDNA protein coding sequence are fused to the MBP gene by cloning into the pMAL-c2X and pMAL-p2X vectors (New England Biolabs, Beverly, MA). These constructs allow controlled expression of recombinant 193P1 E1 B protein sequences with MBP fused at the amino-terminus and a 6X His epitope tag at the carboxyl- terminus.
  • the MBP and 6X His tags permit purification of the recombinant protein from induced bacteria with the. appropriate affinity matrix and allow recognition of the fusion protein with anti-MBP and anti-His antibodies.
  • the 6X His epitope tag is generated by adding 6 histidine codons to the 3' cloning primer.
  • a Factor Xa recognition site permits cleavage of the pMAL tag from 193P1E1B.
  • the pMAL-c2X and pMAL-p2X vectors are optimized to express the recombinant protein in the cytoplasm or periplasm respectively. Periplasm expression enhances folding of proteins with disulfide bonds.
  • pET.Coristructs To express 193P1 E1 B in bacterial cells, all or parts of a 193P1 E1 B cDNA protein coding sequence are cloned into the pET family of vectors (Novagen, Madison, Wl). These vectors allow tightly controlled ' expression of recombinant 193P1E1 B protein in bacteria with and without fusion to proteins that enhance solubility, such as
  • NusA and thioredoxin (Trx) ⁇ NusA and thioredoxin (Trx), and epitope tags, such as 6X His and S-Tag TM that aid purification and detection of the recombinant protein.
  • constructs are made utilizing pET NusA fusion system 43.1 such that regions of a , 193P1E1B protein are expressed as amino-terminal fusions to NusA.
  • Yeast Constructs To express 193P1 E1 B in the yeast species Saccharomyces cerevisiae for generation of recombinant protein and functional studies, all or parts of a 193P1 E1 B cDNA protein coding sequence are cloned into the pESC family of vectors each of which contain 1 of 4 selectable markers, HIS3, TRP1, LEU2, and URA3 (Stratagene, La Jolla, CA). These vectors allow controlled expression from the same plasmid of up to 2 different genes or cloned sequences containing either FlagTM or Myc epitope tags in the same yeast cell. This system is useful to confirm protein-protein interactions of 193P1 E1 B.
  • pESP Constructs To express 193P1 E1 B in the yeast species Saccharomyces po be, all or parts of a 193P1 E1 B cDNA protein coding sequence are cloned into the pESP family of vectors. These vectors allow controlled high level of expression of a 193P1 E1 B protein sequence that is fused at either the amino terminus or at the carboxyl terminus to GST which aids purification of the recombinant protein. A FlagTM epitope tag allows detection of the recombinant protein with anti- FlagTM antibody. • Example 8: Production of Recombinant 193P1 El B in Higher Eukaryotic Systems A. Mammalian Constructs:
  • the full or partial length 193P1 E1 B cDNA sequences can be cloned into any one of a variety of expression vectors known in the art.
  • One or more of the following regions of 193P1E1B are expressed in these constructs, amino acids 1 to 412; or any 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30 or more contiguous amino acids from 193P1 E1 B, variants, or analogs thereof.
  • the constructs can be transfected into any one of a wide variety of mammalian cells such as 293T cells.
  • Transfected 293T cell lysates can be probed with the anti-193P1 E1 B polyclonal serum, described herein.
  • pcDNA4/HisMax Constructs To express 193P1E1B in mammalian cells, the 193P1E1B ORF, or portions thereof, of 193P1E1B are cloned into pcDNA4/HisMax Version A (Invitrogen, Carlsbad, CA). Protein expression is driven from the cytomegalovirus (CMV) promoter and the SP16. translational enhancer. The recombinant protein has XpressTM and six histidine (6X His) epitopes fused to the amino-terminus.
  • CMV cytomegalovirus
  • the pcDNA4/HisMax vector also contains the bovine growth hormone (BGH) polyadenylation signal and transcription termination sequence to enhance mRNA stability along with the SV40 origin for episomal replication and simple vector rescue in cell lines expressing the large T antigen.
  • BGH bovine growth hormone
  • the Zeocin resistance gene allows for selection of mammalian cells expressing the protein and the ampicillin resistance gene and ColE1 origin permits selection and maintenance of the plasmid in E. coli.
  • pcDNA3.1/MvcHis Constructs To express 193P1E1B in mammalian cells, the 193P1E1B ORF.
  • pcDNA3.1/MycHis Version A (Invitrogen, Carlsbad, CA). Protein expression is driven from the cytomegalovirus (CMV) promoter. The recombinant proteins have the myc epitope and 6X His epitope fused to the carboxyl-terminus.
  • CMV cytomegalovirus
  • the pcDNA3.1/MycHis vector also contains the bovine growth hormone (BGH) polyadenylation signal and transcription termination sequence to enhance mRNA stability, along with the SV40 origin for episomal replication and simple vector rescue in cell lines expressing the large T antigen.
  • BGH bovine growth hormone
  • the Neomycin resistance gene can be used, as it allows for selection of mammalian cells expressing the protein and the ampicillin resistance gene and ColE1 origin permits selection and maintenance of the plasmid in £ coli.
  • PCDNA3.1/CT-GFP-TOPO Construct To express 193P1 E1 B in mammalian cells and to allow detection of the recombinant proteins using fluorescence, the 193P1 E1 B ORF, or portions thereof, of 193P1 E1 B with a consensus Kozak translation initiation site are cloned into pcDNA3.1/CT-GFP-TOPO (Invitrogen, CA). Protein expression is driven from the • cytomegalovirus (CMV) promoter. The recombinant proteins have the Green Fluorescent Protein (GFP) fused to the carboxyl-terminus facilitating non-invasive, in vivo detection and cell biology studies.
  • GFP Green Fluorescent Protein
  • the pcDNA3.1CT-GFP-TOPO vector also contains the bovine growth hormone (BGH) polyadenylation signal and transcription termination sequence to enhance mRNA stability along with the SV40 origin for episomal replication and simple vector rescue in cell lines expressing the large T antigen.
  • BGH bovine growth hormone
  • the Neomycin resistance gene allows for selection of mammalian cells that express the protein, and the ampidllin resistance gene and ColE1 origin permits selection and maintenance ofthe plasmid in £ coli. Additional constructs with an amino-terminal GFP fusion are made in pcDNA3.1/NT-GFP-T0PO spanning the entire length ofthe 193P1E1B proteins.
  • PAPtag The 193P1E1B ORF, or portions thereof, of 193P1E1B are cloned into pAPtag-5 (GenHunter Corp. Nashville, TN). This construct generates an alkaline phosphatase fusion at the carboxyl-terminus ofthe 193P1E1B proteins while fusing the lgG ⁇ signal sequence to the amino-terminus. Constructs are also generated in which alkaline phosphatase with an amino-terminal lgG ⁇ signal sequence is fused to the amino-terminus of 193P1E1B proteins.
  • the resulting recombinant 193P1 E1 B proteins are optimized for secretion into the media of transfected mammalian cells and can be used to identify proteins such as ligands or receptors that interact with the 193P1 E1 B proteins.
  • Protein expression is driven from the CMV promoter and the recombinant proteins also contain myc and 6X His epitopes fused at the carboxyl-terminus that facilitates detection and purification.
  • the Zeocin resistance gene present in the vector allows for selection of mammalian cells expressing the recombinant protein and the ampicillin resistance gene permits selection ofthe plasmid in £ coli.
  • the 193P1 E1 B ORF, or portions thereof, of 193P1 E1 B are cloned into pTag-5.
  • This vector is similar to pAPtag but without the alkaline phosphatase fusion.
  • This construct generates 193P1 E1 B protein with an amino-terminal lgG signal sequence and myc and 6X His epitope tags at the carboxyl-terminus that facilitate detection and affinity purification.
  • the resulting recombinant 193P1E1B protein is optimized for secretion into the media of transfected mammalian cells, and is used as immunogen or ligand to identify proteins such as ligands or receptors that interact with the 193P1 E1 B proteins. Protein expression is driven from the CMV promoter.
  • the Zeocin resistance gene present in the vector allows for selection of mammalian cells expressing the protein, and the ampicillin resistance gene permits selection ofthe plasmid in £ coli.
  • PsecFc The 193P1 E1 B ORF, or portions thereof, of 193P1 E1 B are also cloned into psecFc.
  • the psecFc vector was assembled by cloning the human immunoglobulin G1 (IgG) Fc (hinge, CH2, CH3 regions) into pSecTag2 (Invitrogen, California). This construct generates an lgG1 Fc fusion at the carboxyl-terminus of the 193P1 E1 B proteins, while fusing the IgGK signal sequence to N-terminus.
  • 193P1E1B fusions utilizing the murine lgG1 Fc region are also used.
  • the resulting recombinant 193P1 E1 B proteins are optimized for secretion into the media of transfected mammalian cells, and can be used as immunogens or to identify proteins such as ligands or receptors that interact with the 193P1 E1 B protein. Protein expression is driven from the CMV promoter.
  • the hygromycin resistance gene present in the vector allows for selection of mammalian cells that express the recombinant protein, and the ampicillin resistance gene permits selection of the plasmid in £ coli.
  • pSR ⁇ Constructs To generate mammalian cell lines that express 193P1E1B constitutively, 193P1E1B ORF, or portions thereof, of 193P1E1 B are cloned into pSR ⁇ constructs. Amphotropic and ecotropic retroviruses are generated by transfection of pSR constructs into the 293T-10A1 packaging line or co-transfection of pSR ⁇ and a helper plasmid (containing deleted packaging sequences) into the 293 cells, respectively. The retrovirus is used to infect a variety of mammalian cell lines, resulting in the integration ofthe cloned gene, 193P1E1B, into the host cell-lines. Protein expression is driven from a long terminal repeat (LTR).
  • LTR long terminal repeat
  • Neomycin resistance gene present in the vector allows for selection of mammalian cells ' that express the protein, and the ampicillin resistance gene and ColE1 origin permit selection and maintenance of the plasmid in £ coli.
  • the retroviral vectors can thereafter be used for infection and generation of various cell lines using, for example, PC3, NIH 3T3, TsuPrl , 293 or rat-1 cells.
  • Additional pSR ⁇ constructs are made that fuse an epitope tag such as the FLAGTM tag to the carboxyl-terminus of 193P1 E1 B sequences to allow detection using anti-Flag antibodies.
  • the FLAGTM sequence 5' gat tac aag gat gac gac gat aag 3' (SEQ ID NO: 62) is added to cloning primer at the 3' end of the ORF.
  • Additional pSR ⁇ constructs are made to produce both amino-terminal and carboxyl-terminai GFP and myc/6X His fusion proteins of the full-length 193P1 E1 B proteins.
  • Additional Viral Vectors Additional constructs are made for viral-mediated delivery and expression of 193P1 E1 B.
  • High virus titer leading to high level expression of 193P1 E1 B is achieved in viral delivery systems such as adenoviral vectors and herpes amplicon vectors.
  • the 193P1E1B coding sequences or fragments thereof are amplified by PCR and subcloned into the AdEasy shuttle vector (Stratagene). Recombination and virus packaging are performed according to the manufacturer's instructions to generate adenoviral vectors.
  • 193P1 E1 B coding sequences or fragments thereof are cloned into the HSV-1 vector (Imgenex) to generate herpes viral vectors.
  • the viral vectors are thereafter used for infection of various cell lines such as PC3, NIH 3T3, 293 or rat-1 cells.
  • Regulated Expression Systems To control expression of 193P1 E1 B in mammalian cells, coding sequences of 193P1 E1 B, or portions thereof, are cloned into regulated mammalian expression systems such as the T-Rex System (invitrogen), the GeneSwitch System (Invitrogen) and the tightly-regulated Ecdysone System (Sratagene). These systems allow the study ofthe temporal and concentration dependent effects of recombinant 193P1E1B. These vectors are thereafter used to control expression of 193P1 E1 B in various cell lines such as PC3, NIH 3T3, 293 or rat-1 cells.
  • 193P1E1B ORF To generate recombinant 193P1E1B proteins in a baculovirus expression system, 193P1E1B ORF, or portions thereof, are cloned into the baculovirus transfer vector pBlueBac 4.5 (Invitrogen), which provides a His-tag at the N-terminus.
  • pBlueBac-193P1 E1 B is co-transfected with helper plasmid pBac-N-Blue (lnvitrogen).into SF9 (Spodoptera frugiperda) insect cells to generate recombinant baculovirus (see Invitrogen instruction manual for details). Baculovirus is then collected from cell supernatant and purified by plaque assay.
  • Recombinant 193P1 E1 B protein is then generated by infection of HighFive insect cells (Invitrogen) with purified baculovirus.
  • Recombinant 193P1 E1 B protein can be detected using anti-193P1 E1 B or anti-His-tag antibody.
  • 193P1 E1 B protein can be purified and used in various cell-based assays or as immunogen to generate polyclonal and monoclonal antibodies specific for 193P1 E1 B,
  • Figure 5 Figure 6, Figure 7, Figure 8, and Figure 9 depict graphically five amino acid profiles ofthe 193P1E1 B amino acid sequence (variant 1 ), each assessment is available by accessing the ProtScale website (URL www.expasy.ch/cgi-bin/protscale.pl) on the ExPasy molecular biology server.
  • ProtScale website URL www.expasy.ch/cgi-bin/protscale.pl
  • Hydrophilicity (Figure 5), Hydropathicity ( Figure 6) and Percentage Accessible Residues ( Figure 7) profiles were used to determine stretches of hydrophilic amino acids (i.e., values greater than 0.5 on the Hydrophilicity and Percentage Accessible Residues profiles, and values less than 0.5 on the Hydropathicity profile). Such regions are likely to be exposed to the aqueous environment, be present on the surface of the protein, and thus available for immune recognition, such as by antibodies.
  • Average Flexibility ( Figure 8) and Beta-turn ( Figure 9) profiles determine stretches of amino acids (i.e., values greater than 0.5 on the Beta-turn profile and the Average Flexibility profile) that ' are not constrained in secondary structures such as beta sheets and alpha helices. Such regions are also more likely to be exposed on the protein and thus accessible to immune recognition, such as by antibodies.
  • Antigenic sequences ofthe full length 193P1E1B protein (variant 1) indicated, e.g, by the profiles set forth in Figure 5, Figure 6, Figure 7, Figure 8, and/or Figure 9 are used to prepare immunogens, either peptides or nucleic acids that encode them, to generate therapeutic and diagnostic anti-193P1E1B antibodies.
  • the immunogen can be any 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50 or more than 50 contiguous amino acids, or the corresponding nucleic acids that encode them, from 193P1E1B protein.
  • peptide immunogens ofthe invention can comprise, a peptide region of at least 5 amino acids of Figure 2 in any whole number increment up to 412 that includes an amino acid position having a value greater than 0.5 in the Hydrophilicity profile of Figure 5; a peptide region of at least 5 amino acids of Figure 2 in any whole number increment up to 412 that includes an amino acid position having a value less than 0.5 in the Hydropathicity profile of Figure 6; a peptide region of at least 5 amino acids of Figure 2 in any whole number increment up to 412 that includes an amino acid position having a value greater than 0.5 in the Percent Accessible Residues profile of Figure 7; a peptide region of at least 5 amino acids of Figure 2 in any whole number increment up to 412 that includes an amino acid position having a value greater than 0.5 in the Average Flexibility profile on Figure 8; and, a peptide region of at least 5 amino acids of Figure 2 in any whole number increment up to 412 that includes an amino acid position having a value greater than 0.5 in the Hydro
  • All immunogens of the invention, peptide or nucleic acid can be embodied in human unit dose form, or comprised by a composition that includes a pharmaceutical excipient compatible with human physiology.
  • the analysis indicates that 193P1E1B is composed 29.13% alpha helix, 9.95% extended strand, and 60.92% random coil (Figure 13).
  • Polyclonal antibodies can be raised in a mammal, for example, by one or more injections of an immunizing agent and, if desired, an adjuvant.
  • the immunizing agent and/or adjuvant will be injected in the mammal by multiple subcutaneous or intraperitoneal injections.
  • computer algorithms are employed in design of immunogens that, based on amino acid sequence analysis contain characteristics of being antigenic and available for recognition by the immune system ofthe immunized host (see Example 9 entitled "Antigenicity Profiles and Secondary Structure"). Such regions would be predicted to be hydrophilic, flexible, in beta-turn conformations, and be exposed on the surface ofthe protein (see, e.g. Figure 5, Figure 6, Figure 7, Figure 8, or Figure 9 for amino acid profiles that indicate such regions of 193P1E1B).
  • 193P1 E1 B recombinant bacterial fusion proteins or peptides containing hydrophilic, flexible, beta-turn regions of 193P1 E1 B are used as antigens to generate polyclonal antibodies in New Zealand White rabbits.
  • ' such regions include, but are not limited to, amino acids 20-43, amino acids 100-164, amino acids 241-261, or amino acids 310-331.
  • immunogenic proteins include, but are not limited to, keyhole limpet hemocyanin (KLH), serum albumin, bovine thyroglobulin, and soybean trypsin inhibitor.
  • a peptide encoding amino acids 241-261 of 193P1E1B is conjugated to KLH and used to immunize the rabbit.
  • the immunizing agent may include all or portions of a 193P1 E1 B protein, analogs or fusion proteins thereof.
  • a 193P1 E1 B amino acid sequence can be fused using recombinant DNA techniques to any one of a variety of fusion protein partners that are well known in the art, such as glutathio ⁇ e-S-transferase (GST) and HIS tagged fusion proteins.
  • GST glutathio ⁇ e-S-transferase
  • HIS HIS tagged fusion proteins
  • a GST-fusion protein containing an entire 193P1E1B coding sequence is produced and purified and used as immunogen.
  • Other recombinant bacterial fusion proteins that can be employed include maltose binding protein, LacZ, thioredoxin, NusA, or an immunoglobulin constant region (see the section entitied "Production of 193P1 E1 B in Prokaryotic Systems" and Current Protocols ln Molecular Biology, Volume 2, Unit 16, Frederick M. Ausubul ef al. eds, 1995; Linsley, P.S., Brady, W, Urnes, M, Grosmaire, L, Damle, N, and Ledbetter, L.(1991) J.Exp. Med. 174, 561-566).
  • mammalian-expressed protein antigens are also used. These antigens are expressed from mammalian expression vectors such as the Tag5 and Fc-fusion vectors (see Example 8 entitled "Production of Recombinant 193P1E1B in Eukaryotic Systems"), and retain post-translational modifications such as glycosylations found in native protein.
  • an entire 193P1 E1 B coding sequence is cloned into the Tag5 mammalian secretion vector.
  • the recombinant protein is purified by metal chelate chromatography from tissue culture supernatants of 293T cells stably expressing the recombinant vector.
  • the purified Tag5193P1 E1 B protein is then used as immunogen.
  • adjuvants include, but are not limited to, complete Freund's adjuvant (CFA) and MPL-TDM adjuvant (monophosphoryl Lipid A, synthetic trehalose dicorynomycolate).
  • CFA complete Freund's adjuvant
  • MPL-TDM adjuvant monophosphoryl Lipid A, synthetic trehalose dicorynomycolate
  • rabbits are initially immunized subcutaneously with up to 200 ⁇ g, typically 100-200 ⁇ g, of fusion protein or peptide conjugated to KLH mixed in complete Freund's adjuvant (CFA). Rabbits are then injected subcutaneously every two eeks with up to 200 ⁇ g, typically 100-200 ⁇ g, of the immunogen in incomplete Freund's adjuvant (IFA). Test bleeds are taken approximately 7-10 days following each immunization and used to monitor the liter of the antiserum by ELISA.
  • CFA complete Freund's adjuvant
  • the anti-serum from the Tag5 193P1E1B immunized rabbit is affinity purified by passage over a column composed ofthe Tag5 antigen covalently coupled to Affigel matrix (BioRad, Hercules, Calif.). The serum is then further purified by protein G affinity chromatography to isolate the IgG fraction. Serum from rabbits immunized with fusion proteins, such as GST and MBP fusion proteins, are purified by depletion of antibodies reactive to the fusion partner sequence by passage over an affinity column containing the fusion partner either alone or in the context of an irrelevant fusion protein.
  • fusion proteins such as GST and MBP fusion proteins
  • therapeutic mAbs to 193P1 E1 B comprise those that react with epitopes of the protein that would disrupt or modulate the biological function of 193P1 E1 B, for example those that would disrupt its interaction with ligands, proteins, or substrates that mediate its biological activity.
  • Immunogens for generation of such mAbs include those designed to encode or contain an entire 193P1E1B protein or its variants or regions of a193P1E1B protein predicted to be antigenic from computer analysis ofthe amino acid sequence (see, e.g. Figure 5, Figure 6, Figure 7, Figure 8, or Figure 9, and Example 9 entitled "Antigenicity Profiles and Secondary Structure").
  • Immunogens include peptides, recombinant bacterial proteins, and mammalian expressed Tag 5 proteins and human and murine IgG FC fusion proteins.
  • cells expressing high levels of 193P1E1B are used to immunize mice.
  • mice are first immunized intraperitoneally (IP) with, typically, 10-50 ⁇ g of protein immunogen or 10 7 193P1E1B-expressing cells mixed in complete Freund's adjuvant. Mice are then subsequently immunized IP every 2-4 weeks with, typically, 10-50 ⁇ g of protein immunogen or 10 7 cells mixed in incomplete Freund's adjuvant.
  • IP intraperitoneally
  • MPL-TDM adjuvant is used in immunizations.
  • a DNA-based immunization protocol is employed in which a mammalian expression vector encoding 193P1 E1 B sequence is used to immunize mice by direct injection of the plasmid DNA.
  • a mammalian expression vector encoding 193P1 E1 B sequence is used to immunize mice by direct injection of the plasmid DNA.
  • an entire coding sequence of 193P1E1B e.g, amino acids 1-412 of 193P1E1B variant 1
  • the recombinant vector is used as immunogen.
  • amino acids are cloned into an Fc-fusion secretion vector in which a 193P1E1B sequence is fused at the amino-terminus to an IgK leader sequence and at the carboxyl-terminus to the coding sequence of the human or murine IgG Fc region.
  • This recombinant vector is then used as . immunogen.
  • the plasmid immunization protocols are used in combination with purified proteins expressed from the same vector and with cells expressing 193P1E1B.
  • test bleeds are taken 7-10 days following an injection to monitor titer and specificity of the immune response.
  • appropriate reactivity and specifidty is obtained as determined by ELISA, Western blotting, immunoprecipitation, fluorescence microscopy, and flow cytometric analyses, fusion and hybridoma generation is . then carried out with established procedures well known in the art (see, e.g, Hariow and Lane, 1988).
  • monoclonal antibodies are derived that distinguish between, e.g, the various 193P1E1B variants, e.g, the amino terminal truncated splice variant 3, encoding amino acids 83-412 and the full length protein encoding amino acids 1-412.
  • two different Fc-fusion proteins are derived, one encoding amino acids 1-82, and the other encoding amino acids 83412. These are expressed and purified from stably transfected 293T cells.
  • Balb C mice are initially immunized intraperitoneally with 25 ⁇ g of the Tag5-193P1 E1 B protein mixed in complete Freund's adjuvant.
  • mice are subsequently immunized every two weeks with 25 ⁇ g ofthe antigen mixed in incomplete Freund's adjuvant for a total of three immunizations.
  • ELISA using the Tag5 antigen determines the titer of serum from immunized mice.
  • Reactivity - and specificity of serum to the full length 193P1E1B protein and to amino terminal truncated variant 3 is monitored by Western blotting, immunoprecipitation and flow cytometry using 293T cells transfected with an expression vector encoding each ofthe respective 193P1E1B cDNAs (see e.g, the Example entitled "Production of Recombinant 193P1E1B in Eukaryotic Systems").

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Immunology (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Biochemistry (AREA)
  • General Chemical & Material Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Molecular Biology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Pathology (AREA)
  • Oncology (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Biophysics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Cell Biology (AREA)
  • Biotechnology (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Hospice & Palliative Care (AREA)
  • General Engineering & Computer Science (AREA)
  • Hematology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Peptides Or Proteins (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

L'invention concerne un nouveau gène 0193P1E1B (également appelé 193P1E1B) et sa protéine codée, ainsi que des variants de celle-ci. 193P1E1B fait preuve d'une expression tissulaire spécifique dans un tissu adulte normal, et est exprimé de façon aberrante dans les cancers répertoriés dans le Tableau I. En conséquence, 193P1E1B permet d'obtenir une cible diagnostique, pronostique, prophylactique et/ou thérapeutique pour le cancer. Le gène 193P1E1B ou un fragment de celui-ci, ou sa protéine codée, ou des variants de celle-ci, ou un fragment de celle-ci peuvent être utilisés pour induire une réponse immunitaire humorale ou cellulaire. Des anticorps ou des lymphocytes T réagissant avec 193P1E1B peuvent être utilisés pour une immunisation active ou passive.
EP02797238A 2001-12-07 2002-12-06 Acide nucleique et proteine correspondante appelee 193p1e1b utile dans le traitement et la detection du cancer Withdrawn EP1517606A4 (fr)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US13312 1996-03-08
US10/013,312 US7449548B2 (en) 2001-12-07 2001-12-07 Nucleic acid and corresponding protein entitled 193P1E1B useful in treatment and detection of cancer
PCT/US2002/039274 WO2003050255A2 (fr) 2001-12-07 2002-12-06 Acide nucleique et proteine correspondante appelee 193p1e1b utile dans le traitement et la detection du cancer

Publications (2)

Publication Number Publication Date
EP1517606A2 true EP1517606A2 (fr) 2005-03-30
EP1517606A4 EP1517606A4 (fr) 2007-11-14

Family

ID=21759312

Family Applications (1)

Application Number Title Priority Date Filing Date
EP02797238A Withdrawn EP1517606A4 (fr) 2001-12-07 2002-12-06 Acide nucleique et proteine correspondante appelee 193p1e1b utile dans le traitement et la detection du cancer

Country Status (7)

Country Link
US (7) US7449548B2 (fr)
EP (1) EP1517606A4 (fr)
JP (2) JP2005516593A (fr)
AU (1) AU2002362105B2 (fr)
CA (1) CA2469161A1 (fr)
IL (4) IL162274A0 (fr)
WO (1) WO2003050255A2 (fr)

Families Citing this family (26)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7449548B2 (en) * 2001-12-07 2008-11-11 Agensys, Inc. Nucleic acid and corresponding protein entitled 193P1E1B useful in treatment and detection of cancer
US20080058272A1 (en) * 2006-08-29 2008-03-06 Juergen Becker Nonamer Peptides for Cancer Treatment
US8449512B2 (en) 2010-04-09 2013-05-28 Davinci Biomedical Research Products Inc. Stoma stabilitating device and method
HK1212237A1 (en) 2012-08-31 2016-06-10 University Of Virginia Patent Foundation Target peptides for immunotherapy and diagnostics
EP2892544A4 (fr) * 2012-09-05 2016-11-02 Univ Virginia Patent Found Peptides cibles pour la thérapie et les diagnostics du cancer colorectal
WO2015160928A2 (fr) 2014-04-15 2015-10-22 University Of Virginia Patent Foundation Récepteurs des lymphocytes t isolés et leurs procédés d'utilisation
EP3371811B1 (fr) * 2015-11-06 2022-11-23 Carver Scientific, Inc. Dispositif de mémoire électro-entropique
US11250328B2 (en) 2016-10-26 2022-02-15 Cognizant Technology Solutions U.S. Corporation Cooperative evolution of deep neural network structures
US11507844B2 (en) 2017-03-07 2022-11-22 Cognizant Technology Solutions U.S. Corporation Asynchronous evaluation strategy for evolution of deep neural networks
US11250314B2 (en) 2017-10-27 2022-02-15 Cognizant Technology Solutions U.S. Corporation Beyond shared hierarchies: deep multitask learning through soft layer ordering
US11182677B2 (en) 2017-12-13 2021-11-23 Cognizant Technology Solutions U.S. Corporation Evolving recurrent networks using genetic programming
CA3085897C (fr) 2017-12-13 2023-03-14 Cognizant Technology Solutions U.S. Corporation Architectures evolutives pour l'evolution de reseaux neuronaux profonds
US11527308B2 (en) 2018-02-06 2022-12-13 Cognizant Technology Solutions U.S. Corporation Enhanced optimization with composite objectives and novelty-diversity selection
US12033079B2 (en) 2018-02-08 2024-07-09 Cognizant Technology Solutions U.S. Corporation System and method for pseudo-task augmentation in deep multitask learning
US12282845B2 (en) 2018-11-01 2025-04-22 Cognizant Technology Solutions US Corp. Multiobjective coevolution of deep neural network architectures
US11481639B2 (en) 2019-02-26 2022-10-25 Cognizant Technology Solutions U.S. Corporation Enhanced optimization with composite objectives and novelty pulsation
EP3938898A4 (fr) 2019-03-13 2023-03-29 Cognizant Technology Solutions U.S. Corporation Système et procédé permettant de mettre en oeuvre un reparamétrage universel modulaire pour un apprentissage multitâche profond à travers divers domaines
CA3131688A1 (fr) 2019-03-27 2020-10-01 Olivier Francon Processus et systeme contenant un moteur d'optimisation a prescriptions assistees par substitut evolutives
US12026624B2 (en) 2019-05-23 2024-07-02 Cognizant Technology Solutions U.S. Corporation System and method for loss function metalearning for faster, more accurate training, and smaller datasets
US12292944B2 (en) 2019-09-19 2025-05-06 Cognizant Technology Solutions U.S. Corp. Loss function optimization using Taylor series expansion
US12099934B2 (en) 2020-04-07 2024-09-24 Cognizant Technology Solutions U.S. Corporation Framework for interactive exploration, evaluation, and improvement of AI-generated solutions
US11775841B2 (en) 2020-06-15 2023-10-03 Cognizant Technology Solutions U.S. Corporation Process and system including explainable prescriptions through surrogate-assisted evolution
US12424335B2 (en) 2020-07-08 2025-09-23 Cognizant Technology Solutions U.S. Corporation AI based optimized decision making for epidemiological modeling
EP4352659A4 (fr) 2021-06-08 2025-04-09 Cognizant Technology Solutions U.S. Corporation Système et procédé de génération de prescripteurs améliorés
US20260015387A1 (en) * 2022-07-08 2026-01-15 University Of Vermont And State Agricultural College Mitochondrial antioxidant peptides
CN117924413B (zh) * 2024-02-08 2025-07-08 邵阳学院 酱香型轮次基酒多肽及其在影响酒体风味中的应用

Family Cites Families (24)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5643778A (en) * 1994-02-17 1997-07-01 The Wistar Institute Of Anatomy & Biology RNA editing enzyme and methods of use thereof
US5840839A (en) * 1996-02-09 1998-11-24 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Alternative open reading frame DNA of a normal gene and a novel human cancer antigen encoded therein
WO1998039446A2 (fr) 1997-03-07 1998-09-11 Human Genome Sciences, Inc. 70 proteines humaines secretees
EP0973898A2 (fr) 1997-04-10 2000-01-26 Genetics Institute, Inc. MARQUEURS SECRETES DE SEQUENCE EXPRIMEE (sEST)
PT1000146E (pt) 1997-08-01 2006-10-31 Serono Genetics Inst Sa Ests 5' para proteinas secretadas sem especificidade tecidular
WO1999031236A2 (fr) 1997-12-17 1999-06-24 Genset ADNc PROLONGES POUR PROTEINES SECRETEES
JP2002519000A (ja) 1998-01-28 2002-07-02 カイロン コーポレイション ヒト遺伝子および遺伝子発現産物ii
US20020102604A1 (en) 1999-12-08 2002-08-01 Milne Edwards Jean-Baptiste Dumas Full-length human cDNAs encoding potentially secreted proteins
AU4187499A (en) 1998-05-14 1999-11-29 Chiron Corporation Human genes and gene expression products v
AU6263999A (en) 1998-09-28 2000-04-17 Chiron Corporation Human genes and gene expression products
WO2000021991A1 (fr) 1998-10-15 2000-04-20 Genetics Institute, Inc. ETIQUETTES DE SEQUENCES EXPRIMEES SECRETEES (sESTs)
ATE420175T1 (de) 1999-08-12 2009-01-15 Agensys Inc C-typ lektin transmembranantigen, das in menschlichen prostatkrebs exprimiert wird, und deren verwendungen
AU7721500A (en) 1999-09-29 2001-04-30 Human Genome Sciences, Inc. Colon and colon cancer associated polynucleotides and polypeptides
US20030144475A1 (en) 1999-12-06 2003-07-31 Seishi Kato Human protein and cdna
WO2001060860A2 (fr) 2000-02-17 2001-08-23 Millennium Predictive Medicine, Inc. Genes, compositions, kits, et procedes d'identification, d'evaluation, de prevention, et de traitement du cancer de la prostate
US20020068345A1 (en) 2000-05-24 2002-06-06 Challita-Eid Pia M. 98P7C3: homeodomain protein highly expressed in various cancers
AU2001294943A1 (en) 2000-10-02 2002-04-15 Bayer Corporation Nucleic acid sequences differentially expressed in cancer tissue
WO2002040718A2 (fr) 2000-11-14 2002-05-23 Regents Of The University Of Minnesota Methode d'identification de genes associes a la leucemie myeloide chronique
WO2002048337A2 (fr) 2000-12-13 2002-06-20 Incyte Genomics, Inc. Proteines secretees
EP1368475A4 (fr) 2001-03-15 2004-10-20 Nuvelo Inc Nouveaux acides nucleiques et nouveaux polypeptides
US20030215805A1 (en) 2001-04-20 2003-11-20 Millennium Pharmaceutical, Inc. Novel genes, compositions, kits, and methods for identification, assessment prevention, and therapy of breast cancer
EP1308459A3 (fr) 2001-11-05 2003-07-09 Research Association for Biotechnology Séquences d'ADN complementaires pleine longueur
US7449548B2 (en) * 2001-12-07 2008-11-11 Agensys, Inc. Nucleic acid and corresponding protein entitled 193P1E1B useful in treatment and detection of cancer
AU2003279084A1 (en) 2002-09-25 2004-04-19 Genentech, Inc. Novel compositions and methods for the treatment of psoriasis

Also Published As

Publication number Publication date
US7732584B2 (en) 2010-06-08
US7615379B2 (en) 2009-11-10
IL200608A0 (en) 2011-07-31
US20090275041A1 (en) 2009-11-05
AU2002362105B2 (en) 2007-11-29
AU2002362105A1 (en) 2003-06-23
US8188228B2 (en) 2012-05-29
US7968099B2 (en) 2011-06-28
CA2469161A1 (fr) 2003-06-19
US7449548B2 (en) 2008-11-11
IL162274A0 (en) 2005-11-20
IL200608A (en) 2011-11-30
IL206243A (en) 2012-09-24
US20090249502A1 (en) 2009-10-01
US7659377B2 (en) 2010-02-09
EP1517606A4 (fr) 2007-11-14
US20120202208A1 (en) 2012-08-09
JP2005516593A (ja) 2005-06-09
IL162274A (en) 2010-04-15
US20040102407A1 (en) 2004-05-27
JP2010110325A (ja) 2010-05-20
WO2003050255A2 (fr) 2003-06-19
US20100111991A1 (en) 2010-05-06
WO2003050255A3 (fr) 2005-01-06
US20030223990A1 (en) 2003-12-04
US20100297650A1 (en) 2010-11-25

Similar Documents

Publication Publication Date Title
US8188228B2 (en) Nucleic acid and corresponding protein entitled 193P1E1B useful in treatment and detection of cancer
US8846043B2 (en) Nucleic acid and corresponding protein entitled 161P2F10B useful in treatment and detection of cancer
US8426571B2 (en) Nucleic acids and corresponding proteins entitled 202P5A5 useful in treatment and detection of cancer
US7968090B2 (en) Nucleic acids and corresponding proteins entitled 191P4D12(b) useful in treatment and detection of cancer
AU2002361610A1 (en) Nucleic acid and corresponding protein entitled 161P2F10B useful in treatment and detection of cancer
CA2481503A1 (fr) Acide nucleique et proteine correspondante 98p4b6 utilises dans le traitement et la detection du cancer
US20110008393A1 (en) Nucleic acids and corresponding proteins entitled 58p1d12 useful in treatment and detection of cancer
EP2302041A1 (fr) Acide nucléique et protéine correspondante intitulée 161P2F10B utile pour le traitement et la détection du cancer
CA2503346A1 (fr) Acide nucleique 24p4c12 et proteine correspondante utilises dans le traitement et la detection du cancer
AU2008200920B2 (en) Nucleic acid and corresponding protein entitled 193P1E1B useful in treatment and detection of cancer
CA2496566A1 (fr) Acide nucleique et proteine correspondante denommes 98p4b6, pour traitement et detection du cancer

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20040621

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR IE IT LI LU MC NL PT SE SI SK TR

A4 Supplementary search report drawn up and despatched

Effective date: 20071012

17Q First examination report despatched

Effective date: 20080613

RAP1 Party data changed (applicant data changed or rights of an application transferred)

Owner name: AGENSYS, INC.

GRAP Despatch of communication of intention to grant a patent

Free format text: ORIGINAL CODE: EPIDOSNIGR1

INTG Intention to grant announced

Effective date: 20140108

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20140520