EP1506296A1 - Systeme de regulation induit par un represseur pour controler l'expression des genes dans les plantes - Google Patents

Systeme de regulation induit par un represseur pour controler l'expression des genes dans les plantes

Info

Publication number
EP1506296A1
EP1506296A1 EP02807468A EP02807468A EP1506296A1 EP 1506296 A1 EP1506296 A1 EP 1506296A1 EP 02807468 A EP02807468 A EP 02807468A EP 02807468 A EP02807468 A EP 02807468A EP 1506296 A1 EP1506296 A1 EP 1506296A1
Authority
EP
European Patent Office
Prior art keywords
ros
plant
nucleic acid
repressor
gene
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP02807468A
Other languages
German (de)
English (en)
Inventor
Abdelali Hannoufa
Dwayne Hegedus
Nicholas Bate
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Agriculture and Agri Food Canada AAFC
Original Assignee
Agriculture and Agri Food Canada AAFC
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from PCT/CA2002/000740 external-priority patent/WO2002095021A2/fr
Application filed by Agriculture and Agri Food Canada AAFC filed Critical Agriculture and Agri Food Canada AAFC
Publication of EP1506296A1 publication Critical patent/EP1506296A1/fr
Withdrawn legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
    • C12N15/8217—Gene switch

Definitions

  • the present invention relates to the regulation of gene expression. More particularly, the present invention pertains to the control of gene expression of one or more nucleotide sequences of interest in transgenic plants using a repressor protein and corresponding operator sequences.
  • Transgenic plants have been an integral component of advances made in agricultural biotechnology. They are necessary tools for the production of plants exhibiting desirable traits (e.g. herbicide and insect resistance, drought and cold tolerance), or producing products of nutritional or pharmaceutical importance. As the applications of transgenic plants become ever more sophisticated, it is becoming increasingly necessary to develop strategies to fine-tune the expression of introduced genes. The ability to tightly regulate the expression of transgenes is important to address many safety, regulatory and practical issues. To this end, it is necessary to develop tools and strategies to regulate the expression of transgenes in a predictable manner.
  • RNA-DNA oligonucleotides have also been used to block the expression of target genes in plants (Beetham et al, 1999, Proc. Natl. Acad. Sci. USA, 96: 8774; Zhu et al., 1999, Proc. Natl. Acad. Sci. USA, 96: 8768).
  • the ROS protein is encoded by the chromosomal gene, ROS, of Agrobacterium tumefaciens. In this organism, the ROS protein acts as a negative regulator for the expression of the Ti-plasmid-encoded NirC, NirD and IPT genes (Cooley et al, J. 1991, Bacteriol.
  • the ROS protein is a D ⁇ A binding protein that is able to bind a ROS operator sequence ( D'Souza-Ault M. R., 1993, J Bacteriol 175: 3486-3490).
  • Zinc finger proteins represent a significant portion of proteins in eukaryotes, but are rare in prokaryotes.
  • the zinc finger of the bacterial ROS protein varies from its counterparts in eukaryotes in that the ROS protein has only one zinc finger motif, while eukaryotic zinc finger proteins have multiple zinc finger motifs.
  • the present invention provides a method for the regulation of gene expression in plants using a nucleic acid sequence, or derivatives of thereof, that encode ROS.
  • the present invention relates to the regulation of gene expression. More particularly, the present invention pertains to the control of gene expression of one or more nucleotide sequences of interest in transgenic plants using a repressor protein and corresponding operator sequences.
  • a method (A) for selectively controlling the transcription of a gene of interest comprising: i) producing a first plant comprising a first genetic construct, the first genetic construct comprising a first regulatory region operatively linked to a gene of interest and at least one repressor operator sequence capable of controlling the activity of the first regulatory region; ii) producing a second plant comprising a second genetic construct, the second genetic construct comprising a second regulatory region in operative association with a nucleic the molecule, or a derivative thereof, encoding a repressor, the repressor exhibiting both repressor operator binding activity and repressor activity; iii) crossing the first plant and the second plant to obtain progeny, the progeny comprising both the first genetic construct and the second genetic construct, and characterized in that the expression of the second genetic construct represses expression of the gene of interest.
  • the gene encoding the repressor is optimized for expression in the plant, and that the gene encodes a nuclear localization signal. Furthermore, it is preferred that the repressor is a ROS repressor, and the repressor operator sequence is a ROS operator sequence.
  • the present invention also embraces the above method (A), wherein the first and second regulatory regions are either the same or different and are selected from the group consisting of a constitutive promoter, an inducible promoter, a tissue specific promoter, and a developmental promoter.
  • the present invention further provides a method (B) for selectively controlling the transcription of a gene of interest in a plant, comprising: i) introducing into the plant either separately, or within the same vector: a) a first genetic construct comprising a nucleic acid molecule comprising a first regulatory region operatively linked to a gene of interest, and at least one ROS operator sequence capable of controlling the activity of the first regulatory region; and b) a second genetic construct comprising a second regulatory region in operative association with a nucleotide sequence encoding a ROS repressor, or a derivative thereof, said ROS repressor exhibiting ROS operator binding activity, ROS repressor activity or both ROS operator binding activity and ROS repressor activity, the second regulatory region comprises an inducible promoter; ii) growing the plant, and iii) inducing the activity of said inducible promoter so that expression of the second genetic construct produces the ROS repressor and represses expression of the gene of interest
  • the gene encoding the repressor is optimized for expression in the plant, and that the gene encodes a nuclear localization signal. Furthermore, it is preferred that the repressor is a ROS repressor, and the repressor operator sequence is a ROS operator sequence.
  • the present invention embraces a method (C) for selectively controlling the transcription of a gene of interest in a plant, comprising: i) introducing into the plant either separately, or within the same vector: : a) a first genetic construct comprising a nucleic acid molecule comprising a first regulatory region operatively linked to a gene of interest, and at least one ROS operator sequence capable of controlling the activity of the first regulatory region; and b) a second genetic construct comprising a second regulatory region in operative association with a nucleotide sequence encoding a ROS repressor, or a derivative thereof, said ROS repressor exhibiting ROS operator binding activity, ROS repressor activity, or both ROS operator binding activity ROS repressor activity; the second regulatory region comprises a tissue specific promoter; and ii) growing said plant, so that expression of said second genetic construct produces said ROS repressor and represses expression of said gene of interest in a tissue specific manner.
  • the gene encoding the repressor is optimized for expression in the plant, and that the gene encodes a nuclear localization signal. Furthermore, it is preferred that the repressor is a ROS repressor, and the repressor operator sequence is a ROS operator sequence.
  • the present invention also provides a method (D) for selectively controlling the transcription of a gene of interest in a plant, comprising: i) introducing into the plant either separately, or within the same vector: a) a first genetic construct comprising a nucleic acid molecule comprising a first regulatory region operatively linked to a gene of interest, and at least one ROS operator sequence capable of controlling the activity of the first regulatory region; and b) a second genetic construct comprising a second regulatory region in operative association with a nucleotide sequence encoding a ROS repressor, or a derivative thereof, said ROS repressor exhibiting ROS operator binding activity, ROS repressor activity, or both ROS operator binding activity ROS repressor activity; second regulatory region comprises a promoter that is active at one or more specific developmental stages within the plant; and ii) growing the plant, so that the activity of the promoter at one or more specific developmental stages within the plant results in expression of the second genetic construct thereby producing said ROS repress
  • the gene encoding the repressor is optimized for expression in the plant, and that the gene encodes a nuclear localization signal. Furthermore, it is preferred that the repressor is a ROS repressor, and the repressor operator sequence is a ROS operator sequence.
  • the present invention is also directed to a nucleic acid molecule, or a derivative thereof, encoding a ROS repressor optimized for plant codon usage and exhibiting both
  • the nucleic acid molecule or a derivative thereof may be characterized as comprising one or more of the following properties: a) comprising greater than 80% similarity with the nucleotide sequence of SEQ ID NO:2 or 3 as determined by use of the BLAST algorithm with the following perameters: blastn; Database: nr; Expect 10; filter: low complexity; Alignment: pairwise; Word Size: 11 ; b) hybridizing under stringent conditions with the nucleotide sequence of SEQ ID NO:2 or 3, comprising hybridizing for 16-20 hrs at 65 °C in 7% SDS, lmM EDTA, 0.5M Na 2 HPO 4 , pH 7.2, followed by washing in 5% SDS, lmM EDTA 40mM Na 2 HPO 4 , pH 7.2 for 30 min, followed by washing in 1% SDS, lmM EDTA 40mM Na 2 HPO 4 , pH 7.2 for 30 min; c)
  • the present invention relates to a genetic construct comprising a regulatory region in operative association with the nucleic acid molecule as defined above, and to a plant, or seed comprising the genetic construct.
  • the present invention also pertains to a nucleic acid molecule as defined above, further comprising a nuclear localization signal fused to the nucleic acid molecule, and to a genetic construct comprising a nuclear localization signal fused to the nucleic acid molecule as defined above.
  • the present invention includes, a plant, or seed comprising the genetic construct as just defined.
  • the present invention further relates to a nucleic acid molecule comprising a regulatory region operatively linked to a gene of interest and at least one ROS operator sequence capable of controlling the activity of the regulatory region, wherein the regulatory region is functional in plants.
  • the at least one ROS operator sequence comprises the nucleotide sequence of SEQ ID NO:8.
  • This invention also provides a genetic construct comprising the nucleic acid molecule as just defined, and to a plant comprising the genetic construct.
  • the present invention also pertains to a plant comprising a first genetic construct comprising a first nucleic acid molecule comprising a first regulatory region operatively linked to a gene of interest, and at least one ROS operator sequence capable of controlling the activity of the first regulatory region, and a second genetic construct comprising a second nucleic acid molecule, or a derivative thereof, encoding a ROS repressor optimized for plant codon usage and exhibiting ROS operator binding activity, ROS repressor activity, or both ROS operator binding activity ROS repressor activity.
  • FIGURE 1 shows the nucleotide and deduced amino acid sequences of wild type ROS and a modified ROS of Agrobacterium tumefaciens.
  • Figure 1(A) shows the amino acid sequence alignment of known ROS repressors (SEQ ID NOs:26,28,29,30), and a synthetic ROS (SEQ ID NO:27). The amino acid sequence 'PKKKRKV at the carboxy end of synthetic ROS is one of several nuclear localization signals.
  • Figure 1(B) shows the nucleotide sequence of a synthetic ROS that had been optimized for plant codon usage containing a nuclear localization signal peptide (in italics). Optional restriction sites at the 5' end of the sequence are underlined (also see SEQ ID NO:2).
  • Figure 1(C) shows the consensus nucleotide (SEQ ID NO: 3) and predicted amino acid sequence, of a composite ROS sequence comprising all possible nucleotide sequences that encode wild type ROS repressor, and the wild type ROS amino acid sequence.
  • the amino acid sequence TE3--KRKV' at the carboxy end represents a nuclear localization signal. Amino acids in bold identify the zinc finger motif.
  • Figure 1(D) shows the nucleotide sequence of the D ⁇ A binding sites (operator sequences) of the virC/virD and ipt genes.
  • Figure 1(E) shows a consensus operator sequence derived from the virC/virD and ipt operator sequences (SEQ ID ⁇ O:20). This sequence comprises 10 nucleotides, however, only the first 9 nucleotides are required for binding ROS.
  • FIGURE 2 displays the structure of various constructs in which the transcription of a modified ROS or wild type ROS nucleotide sequence is placed under control of various regulatory regions.
  • the modified ROS nucleotide sequence is designated as 'synthetic ROS'.
  • Figure 2(A) shows a schematic diagram of the p74-107 nucleotide construct in which a CaMN35 S regulatory region is operatively linked to the wild type ROS protein coding region.
  • Figure 2(B) shows the nucleotide construct p74-313 in which a CaMN35S regulatory region is operatively linked (transcriptionally fused) to the protein coding region of synthetic ROS.
  • Figure 2(C) shows the nucleotide construct p74-108 in which a tms2 regulatory region is transcriptionally fused to the protein coding region of synthetic ROS.
  • Figure 2(C) shows the nucleotide construct p74-108 in which a tms2 regulatory region is transcriptionally fused
  • 2(D) shows the nucleotide construct p74- 101 in which an actin2 regulatory region is operatively linked to the protein coding region of synthetic ROS.
  • FIGURE 3 shows schematic representations of nucleotide constructs that place the expression of a gene of interest under the control a regulatory region, in this case a CaMN35S regulatory region, modified to contain a ROS operator site.
  • FIG. 3(A) shows the nucleotide construct p74-315 in which a CaMV35S regulatory region, modified to contain a ROS operator site downstream of the TATA box, is operatively linked to a gene of interest ( ⁇ -glucuronidase; GUS).
  • Figure 3(B) shows the nucleotide construct p74-316 in which a CaMN35 S regulatory region is modified to contain a ROS operator site upstream of the TATA box is operatively linked to the protein encoding region of GUS.
  • Figure 3(C) shows the nucleotide construct p74-309 in which a CaMN35S regulatory region modified to contain ROS operator sites upstream and downstream of the TATA box is transcriptionally fused (i.e. operatively linked) to the protein encoding region of
  • FIGURE 4 shows a schematic representation of a nucleotide construct that places the expression of a gene of interest gene under the control of a regulatory region, in this case, the tms2 regulatory region that has been modified to contain ROS operator sites.
  • Figure 4(A) shows the nucleotide construct p76-507 in which a tms2 regulatory region is operatively linked to a gene of interest (in this case encoding ⁇ -glucuronidase, GUS).
  • Figure 4(B) shows the nucleotide construct p76-508 in which a tms2 regulatory region modified to contain two tandemly repeated ROS operator sites downstream of the TATA box is transcriptionally fused (i.e. operatively linked) to the protein coding region of GUS.
  • FIGURE 5 shows a schematic representation of a nucleotide construct that places the expression of a gene of interest under the control of a regulatory region, in this case actin 2 regulatory region, that has been modified to contain ROS operator sites.
  • Figure 5(A) shows the nucleotide construct p75-101 in which an actin2 regulatory region is operatively linked to a gene of interest (the ⁇ -glucuronidase
  • FIG. 5(B) shows the nucleotide construct p74-501 in which an actin2 regulatory region modified to contain two tandemly repeated ROS operator sites upstream of the TATA box is transcriptionally fused (operatively linked) to the a gene of interest (GUS).
  • Figure 5C shows construct p74-118 comprising a 35S regulatory region with three ROS operator sites downstream from the TATAbox. The 35S regulatory region is operatively linked to the gene of interest (GUS).
  • FIGURE 6 shows Southern analysis of transgenic Arabidopsis plants.
  • Figure 6(A) shows Southern analysis of aplant comprising a first genetic construct, p74-309
  • FIGURE 7 shows Westerns analysis of ROS expression in transformed Arabidopsis plants.
  • Levels of wild type ROS, p74-107 (35S-WTROS; see Figure 2(A) for map), and synthetic ROS p74-101 (actin2-synROS; see Figure 2(D) for map) produced in transgenic plants were determined by Western analysis using a ROS polyclonal antibody. Arabidopsis var. Columbia, was run as a control.
  • FIGURE 8 shows expression of a gene of interest in plants.
  • Upper panel shows expression of GUS under the control of 35S (pBI121; 35S:GUS).
  • Middle panel shows GUS expression under the control of actin2 coprising ROS operator sequences (p74-501 ; see Figure 5(B) for construct).
  • Lower panel shows the lack of GUS activity in a non-transformed control.
  • FIGURE 9 shows regulation of a gene of interest in progeny plants arising from a cross between a ROS parent plant (expressing p74-101, Figure 2D; and example of a second nucleotide sequence) and a plant expressing a gene of interest under the control of a regulatory region comprising ROS operator sequences (GUS parent expressing p74-118, Figure 5C; and example of a first nucleotide sequence).
  • Figure 9A shows GUS activity in the ROS and GUS parents and the progeny obtained from the cross of the ROS and GUS parents.
  • Figure 9B shows Northern analysis of RNA obtained from ROS and GUS parents and the progeny of the cross between the ROS and GUS parents and probed with either a ROS or GUS probe.
  • Figure 9C shows Southern analysis of the progeny of the cross between the GUS and ROS parent plants, probed with either a GUS or ROS probe.
  • FIGURE 10 shows several non-limiting examples of constructs of the present invention, that and referred to Figure 11.
  • Figure 10 A shows two non-limiting examples of a second nucleotide sequence (repressor construct), p74-101 (Actin2 promoter- synRos) and p74-313 (35S promoter-synRos).
  • Figure 10B shows several non- limiting examples of a first nucleotide sequence ((reporter constructs) including ⁇ 74-316 (35S-lxOS-GUS; the OS is placed prior to the TATA sequence), p74- 118 (35S-3x OS-GUS; all OS's after TATA sequence), p74-117 (35S-3xOS- GUS; one OS placed prior to TATA sequence), p74-501 (Actin 2-lxOS-GUS;
  • OS placed prior to TATA sequence.
  • the operator sequence (OS) is shown as a filled oval.
  • Figure 11 shows Northern analysis and GUS activity of several parental lines, and progeny from crosses of parental lines expressing a first and a second nucleotide sequence.
  • total RNA ⁇ 4.5g was isolated from Arabidopsis parental lines comprising a first nucleotide sequence, expressing a gene of interest, in this case GUS (lanes marked GUS), a second nucleotide sequence, expressing synRos (lanes marked ROS), and crosses between various combinations of parental lines (C1-C5; see Figure 10 for constructs) as follows: Crosses Constucts Parental lines Female X male Female X male parent
  • FIG. 11 A shows the loading of the RNA gel used for Figures 11 A and B.
  • Figure 11D shows quantification of the densities of bands generated by Northern blot analysis of total RNA and probed with GUS as shown in Figure 11 A. Bl andB2 are blank (background) samples. Plant lines are as indicated in the Table above. Band intensity was calculated using Quantity One Software (Biorad).
  • Figure 12 shows non-limiting examples of a first nucleotide sequence and a second nucleotide sequence of the invention.
  • Figure 12A shows the structure of the p74- 101 repressor construct (a second nucleotide sequence also described in Figure 2D) in which an actin2 regulatory region is operatively linked to a protein coding region of synthetic ROS.
  • Figure 12B shows the structure of the p74-l 14 reporter construct (a first nucleotide sequence) in which a CaMV35S regulatory region, modified to contain 4 ROS operator sequences, is operatively linked to a protein encoding region of GUS.
  • An operator sequence (OS) is shown as a filled oval with one OS upstream and three OS downstream of a TATA Box sequence.
  • Figure 13 shows Northern blot analysis of total RNA isolated from Brassica napus reporter/repressor crosses and parental lines.
  • transgenic B. napus plants were crossed and analyzed for expression levels of both GUS and ROS genes. The female parent is indicated first. Crosses performed are as follows: CI and C2 arep74-l 14 x p74-101.
  • P1GUS is GUS parent plant for cross
  • P2GUS is GUS parent plant for cross2.
  • PROS is ROS parent plant for crosses Cl and C2.
  • Figure 13A shows RNA loaded on a gel (approximately 4.5ug of total RNA loaded per lane) prior to probing with GUS and synthetic ROS nucleic acid probes.
  • Figure 13B shows expression levels of crosses and parental lines probed with GUS (top) and synthetic ROS (bottom).
  • Figure 13 e C shows quantification of the densities of bands generated by northern blot analysis as shown in Figure 13B. Plant lines are as indicated in Figure 13A and B. Band intensity was measured using Quantity One Software (Biorad).
  • the present invention relates to the regulation of gene expression. More particularly, the present invention pertains to the control of gene expression of one or more nucleotide sequences of interest in transgenic plants using a repressor protein and corresponding operator sequences.
  • Gene repression can be used in applications such as metabolic engineering to produce plants that accumulate large amounts of certain intermediate compounds. Repression of gene expression can also be used for control of transgenes across generations, or production of FI hybrid plants with seed characteristics that would be undesirable in the parental line, for example but not limited to, hyper-high oil, reduced fiber content, low glucosinolate levels, reduced levels of phytotoxins, and the like. In the latter examples, low glucosinolate levels, or other phytotoxins, may be desired in seeds while higher concentrations of these compounds maybe required elsewhere, for example in the case of glucosinolates, within cotyledons, due to their role in plant defence.
  • a gene of interest may encode a protein used to for plant selection purposes.
  • a gene of interest may encode a protein that is capable of metabolizing a compound from a non-toxic form to a toxic form thereby selectively removing plants that express the gene of interest.
  • the present invention is directed to a method of controlling gene expression using a repressor protein as a regulatory switch to repress the expression of a gene or coding region of interest, or repress the transcription of one, or more than one, selected nucleotide sequences by transforming a plant with one, or more than one, constructs comprising:
  • a first nucleotide sequence comprising a gene(or coding region) of interest operatively linked to a regulatory region comprising at least one repressor operator sequence that interacts with a repressor protein.
  • a second nucleotide sequence comprising a regulatory region in operative association with a nucleotide sequence encoding the repressor protein.
  • the repressor protein is ROS
  • the repressor operator sequence is a ROS repressor operator sequence, for example but not limited to the ROS reporessor encoded by the nucleic acid sequence of SEQ ID NO:3.
  • first and second nucleotide sequences may be placed within the same or within different vectors, genetic constructs, or nucleic acid molecules.
  • the expression of the repressor protein results in the down regulation in the expression of a gene (or coding region) of interest that is in operative association, or operatively linked, with an operator sequence that exhibits an affinity for the repressor protein.
  • operatively association or "operatively linked” it is meant that the particular sequences interact either directly or indirectly to carry out their intended function, such as mediation or modulation of gene expression.
  • the interaction of operatively linked sequences may be mediated by proteins that in turn interact with the sequences, as described herein.
  • a transcriptional regulatory region and a sequence of interest are "operably linked" when the sequences are functionally connected so as to permit transcription of the sequence of interest to be mediated or modulated by the transcriptional regulatory region.
  • RNA By the term “expression” it is meant the production of a functional RNA, protein or both, from a gene or transgene.
  • repression of gene expression it is meant the reduction in the level of mRNA, protein, or both mRNA and protein, encoded by a gene or nucleotide sequence of interest. Repression of gene expression may also arise as a result of the lack of production of full length RNA, for example mRNA, due to blocking migration of polymerase along a nucleic acid during transcription. A repression of gene expression may be a consequence of repressing, blocking or interrupting transcription.
  • repressor'Or “repressor protein” it is meant a protein that exhibits the property of specifically binding to a corresponding operator sequence.
  • An example of repressor protein, which is not to be considered limiting in any manner is the ROS repressor, or an analog or derivative thereof as defined herein.
  • ROS repressor it is meant any ROS repressor as known within the art. These include the ROS repressor as described herein, as well as other microbial ROS repressors, for example but not limited to ROSAR (Agrobacterium radiobacter; Brightwell et al., (1995) Mol. Plant Microbe Interact. 8: 747-754), MucR (Rhizobium meliloti; Keller M et al., (1995) Mol. Plant
  • Plant Microbe Interact. 10 180-186; also see Cooley et al. 1991, J. Bacteriol. 173: 2608-
  • An analog, or a derivative, of a repressor protein maybe any protein that exhibits the property of binding an operator sequence, for example which is not to be considered limiting in any manner, a fusion protein comprising an operator binding sequence fused to a second protein.
  • the second protein may be any protein, including:
  • a protein having an activity that regulates gene expression when bound to the operator sequence for example but not limited to histone deacetylase, histone acetyl transferase, yeast Sin3 protein (which recruits Rpd3 (HDA complex) by binding to the DNA binding protein), Ume6, or transcriptional activators, for example but nit limited to NP16, Gal4, LexA; or • a protein involved in protein-protein interaction, for example but not limited to chromatin remodelling proteins and HAT/HDA recruitment factors (Lusser A., Kolle D., Loidl P., 2001, Trends Pit. Sci. 6: 59-65); or
  • the repressor protein or fusion protein comprises a nuclear localization signal so that the protein or fusion protein is directed to the nucleus.
  • cogniation optimization it is meant the selection of appropriate DNA nucleotides for the synthesis of oligonucleotide building blocks, and their subsequent enzymatic assembly, of a structural gene or fragment thereof in order to approach codon usage within plants.
  • operator sequence it is meant a sequence of DNA that can interact or bind with a DNA binding domain of a protein, for example, a repressor protein.
  • a repressor protein or a DNA binding domain, that exhibits the property of binding to an operator sequence, and which is not to be considered limiting, is a ROS repressor, or the DNA binding domain of the ROS repressor, respectively.
  • the operator sequence is preferably located in proximity of a gene of interest, either upstream of, downstream of, or within, the coding region of a gene, for example within an intron of a gene.
  • the operator sequence is located in the proximity of a regulatory region that is in operative association with a gene of interest.
  • the operator sequence may also be localized elsewhere within a first genetic construct to block migration of polymerase along the nucleic acid.
  • An operator sequence may consist of inverted repeat or palindromic sequences of a specified length.
  • the ROS operator may comprise 9 or more nucleotide base pairs
  • a consensus sequence of a 10 base pair region including the 9 base pair DNA binding site sequence is WATDHWKMAR (SEQ ID NO: 20; Figure 1 (E)).
  • Operator sequences which are not to be considered limiting in any manner, also include, as is the case with the ROS operator sequence from the virC or virD gene promoters, a ROS operator made up of two 1 lbp inverted repeats separated by TTTA:
  • analogs or variants of SEQ ID NO's:8, 19 and 20 may also be used providing they exhibit the property of binding a DNA binding domain, preferably a DNA binding domain of the ROS repressor.
  • the ROS repressor has a DNA binding motif of the C 2 H 2 zinc finger configuration.
  • ROS binds to a 9 bp inverted repeat sequence in an orientation-independent manner (Chou et al., 1998, Proc. Natl. Acad. Sci., 95: 5293).
  • ROS operator sequence in the ipt promoter also consists of a similar sequence to that in the virC/virD except that it does not form an inverted repeat (Chou et al, 1998, Proc. Natl. Acad. Sci. USA, 95: 5293). Only the first 9 bp are homologous to ROS box in virC/virD indicating that the second 9 bp sequence may not be a requisite for ROS binding. Accordingly, the use of ROS operator sequences or variants thereof that retain the ability to interact with ROS, as operator sequences to selectively control the expression of genes or nucleotide sequences of interest, is within the scope of the present invention.
  • regulatory region or “regulatory element” it is meant a portion of nucleic acid typically, but not always, upstream of the protein coding region of a gene, which may be comprised of either DNA or RNA, or both DNA and RNA. When a regulatory region is active, and in operative association with a gene of interest, this may result in expression of the gene of interest.
  • a regulatory element may be capable of mediating organ specificity, or controlling developmental or temporal gene activation.
  • a “regulatory region” includes promoter elements, core promoter elements exhibiting a basal promoter activiy, elements that are inducible in response to an external stimulus, elements that mediate promoter activity such as negative regulatory elements or transcriptional enhancers.
  • regulatory region also includes elements that are active following transcription, for example, regulatory elements that modulate gene expression such as translational and transcriptional enhancers, translational and transcriptional repressors, upstream activating sequences, and mRNA instability determinants. Several of these latter elements may be located proximal to the coding region.
  • regulatory element typically refers to a sequence of DNA, usually, but not always, upstream (5') to the coding sequence of a structural gene, which controls the expression of the coding region by providing the recognition for RNA polymerase and/or other factors required for transcription to start at a particular site.
  • upstream 5'
  • RNA polymerase RNA polymerase
  • regulatory region typically refers to a sequence of DNA, usually, but not always, upstream (5') to the coding sequence of a structural gene, which controls the expression of the coding region by providing the recognition for RNA polymerase and/or other factors required for transcription to start at a particular site.
  • a regulatory element that provides for the recognition for RNA polymerase or other transcriptional factors to ensure initiation at a particular site is a promoter element.
  • eukaryotic promoter elements contain a TATA box, a conserved nucleic acid sequence comprised of adenosine and thymidine nucleotide base pairs usually situated approximately 25 base pairs upstream of a transcriptional start site.
  • a promoter element comprises a basal promoter element, responsible for the initiation of transcription, as well as other regulatory elements (as listed above) that modify gene expression.
  • regulatory regions There are several types of regulatory regions, including those that are developmentally regulated, inducible or constitutive.
  • a regulatory region that is developmentally regulated, or controls the differential expression of a gene under its control, is activated within certain organs or tissues of an organ at specific times during the development of that organ or tissue.
  • some regulatory regions that are developmentally regulated may preferentially be active within certain organs or tissues at specific developmental stages, they may also be active in a developmentally regulated manner, or at a basal level in other organs or tissues within the plant as well.
  • An inducible regulatory region is one that is capable of directly or indirectly activating transcription of one or more DNA sequences or genes in response to an inducer. In the absence of an inducer the DNA sequences or genes will not be transcribed.
  • the protein factor that binds specifically to an inducible regulatory region to activate transcription, maybe present in an inactive form which is then directly or indirectly converted to the active form by the inducer. However, the protein factor may also be absent.
  • the inducer can be a chemical agent such as a protein, metabolite, growth regulator, herbicide or phenolic compound or a physiological stress imposed directly by heat, cold, salt, or toxic elements or indirectly through the action of a pathogen or disease agent such as a virus.
  • a plant cell containing an inducible regulatory region may be exposed to an inducer by externally applying the inducer to the cell or plant such as by spraying, watering, heating or similar methods.
  • Inducible regulatory elements may be derived from either plant or non-plant genes (e.g. Gatz, C. and Lenk, I.R.P.,1998, Trends Plant Sci. 3, 352-358; which is incorporated by reference).
  • Examples, of potential inducible promoters include, but not limited to, teracycline- inducible promoter (Gatz, C.,1997, Ann. Rev. Plant Physiol. PlantMol. Biol.48, 89-108; which is incorporated by reference), steroid inducible promoter (Aoyama, T.
  • a constitutive regulatory region directs the expression of a gene throughout the various parts of a plant and continuously throughout plant development.
  • constitutive regulatory elements include promoters associated with the CaMN 35S transcript. (Odell et al, 1985, Nature, 313: 810-812), the rice actin 1 (Zhang et al, 1991, Plant Cell, 3: 1155-1165), actin 2 (An etal, 1996, Plant J, 10: 107-121), or tins 2 (U.S. 5,428,147, which is incorporated herein by reference), and triosephosphate isomerase 1 (Xu et. al., 1994, Plant Physiol.
  • genes the maize ubiquitin 1 gene (Cornejo et al, 1993, Plant Mol. Biol. 29: 637-646), he Arabidopsis ubiquitin 1 and 6 genes (Holtorf et al, 1995, PlantMol. Biol.29: 637-646), and the tobacco translational initiation factor 4A gene (Mandel et al, 1995 Plant Mol. Biol. 29: 995-1004).
  • the term "constitutive" as used herein does not necessarily indicate that a gene under control of the constitutive regulatory region is expressed at the same level in all cell types, but that the gene is expressed in a wide range of cell types even though variation in abundance is often observed.
  • the regulatory regions of the first and second nucleotide sequences denoted above, may be the same or different.
  • the regulatory elements of the first and second genetic constructs may both be constitutive.
  • each of the first and second nucleotide sequences are maintained in separate plants, a first and a second plant, respectively.
  • the first nucleotide sequence encoding a gene of interest is expressed within the first plant.
  • the second plant expresses the second nucleic acid sequence encoding a repressor protein. Crossing of the first and second plants produces a progeny that expresses the repressor protein but not the gene of interest.
  • either the second regulatory element may be active before, during, or after, the activity of the first regulatory element, thereby either initially repressing expression of the gene of interest followed by permitting the expression of the gene of interest, or, following expression of the gene of interest, the second regulatory element becomes active which results in the repression of the expression of the gene of interest.
  • the first regulatory element maybe active before, during, or after, the activity of the second regulatory element.
  • the second regulatory element being an inducible regulatory element that is activated by an external stimulus so that repression of gene expression may be controlled through the addition of an inducer.
  • the second regulatory element may also be active during a specific developmental stage preceding, during, or following that of the activity of the first regulatory element. In this way the expression of the gene of interest maybe repressed or activated as desired within a plant.
  • the present invention is therefore directed to one or more chimeric genetic constructs comprising a gene of interest operatively linked to a regulatory element where the regulatory element is in operative association with an operator sequence.
  • Any exogenous gene can be used as a gene of interest and manipulated according to the present invention to result in the regulated expression of the exogenous gene.
  • the present invention also pertains to one or more chimeric constructs comprising a regulatory element in operative association with a nucleic acid sequence encoding a repressor protein.
  • nucleotide sequence of interest or “coding region of interest” it is meant any gene, nucleotide sequence, or coding region that is to be expressed within a host organism. These terms are used interchangeably.
  • a nucleotide sequence of interest may include, but is not limited to, a gene or coding region whose product has an effect on plant growth or yield, for example a plant growth regulator such as an auxin or cytokinin and their analogues, or a nucleotide sequence of interest may comprise a herbicide or a pesticide resistance gene, which are well known within the art.
  • a gene or coding region of interest may encode an enzyme involved in the synthesis of, or in the regulation of the synthesis of, a product of interest, for example, but not limited to a protein, or an oil product.
  • a nucleotide sequence of interest may encode an industrial enzyme, protein supplement, nutraceutical, or a value-added product for feed, food, or both feed and food use. Examples of such proteins include, but are not limited to proteases, oxidases, phytases, chitinases, invertases, lipases, cellulases, xylanases, enzymes involved in oil biosynthesis etc.
  • a nucleotide sequence, or coding region of interest may also include a gene that encodes a pharmaceutically active protein, for example growth factors, growth regulators, antibodies, antigens, their derivatives useful for immunization or vaccination and the like.
  • a pharmaceutically active protein for example growth factors, growth regulators, antibodies, antigens, their derivatives useful for immunization or vaccination and the like.
  • proteins include, but are not limited to, interleuldns, insulin, G-CSF, GM-CSF, hPG-CSF, M-CSF or combinations thereof, interferons, for example, interferon- ⁇ , interferon- ⁇ , interferon- ⁇ , blood clotting factors, for example, Factor NIH, Factor IX, or tP A or combinations thereof.
  • the gene of interest encodes a product that is directly or indirectly toxic to the plant, then by using the method of the present invention, such toxicity may be reduced throughout the plant by selectively expressing the gene of interest within a desired tissue or
  • a nucleotide sequence, or coding region of interest may also include a gene that encodes a protein involved in regulation of transcription, for example D ⁇ A-binding proteins that act as enhancers or basal transcription factors, histone deacetylases, or histone acetyl transferases.
  • a nucleotide sequence of interest may be comprised of a partial sequence or a chimeric sequence of any of the above genes, in a sense or antisense orientation.
  • a gene, or coding region of interest may be involved in the expression of a gene expression cascade, for example but not limited to a developmental cascade.
  • the gene of interest is preferably associated • with a gene that is involved at an early stage within the gene cascade, for example homeotic genes.
  • Expression of a gene of interest for example a repressor of homeotic gene expression, represses the expression of a homeotic gene.
  • Expression of the repressor protein within the same plant either via crossing, inducuction, temporal or developmental expression of the regulatory region, as described herein, de-represses the expression of the homeotic gene thereby initiating a gene cascade.
  • Homeotic genes are well known to one of skill in the art, and include but are not limited to, transcription factor proteins and associated regulatory regions, for example controlling sequences that bind AP2 domain containing transcription factors, for example but not limited to, APETALA2 (a regulator of meristem identity, floral organ specification, seedcoat development and floral homeotic gene expression; Jofuku et al, 1994), CCAAT box- binding transcription factors (e.g.
  • a gene, or coding region of interest may also be involved in the control of transgenes across generations, or production of FI hybrid plants with seed characteristics that would be undesirable in the parental line or progeny, for example but not limited to, oil seeds characterized as having reduced levels of sinapine biosynthesis within the oil- free meal.
  • a gene of interest may be any enzyme involved in the synthesis of one or more intermediates in sinipine biosynthesis.
  • An example, which is to be considered non-limiting, is caffeic o-methyltransferase (Acc# AAG51676), which is involved in ferulic acid biosynthesis.
  • genes of interest include genes that encode proteins involved in fiber, or glucosinolate, biosynthesis, or a protein involved in the biosynthesis of a phytotoxin.
  • Phytotoxins may also be used for plant selection purposes.
  • a gene of interest may encode a protein that is capable of metabolizing a compound from a non-toxic form to a toxic form thereby selectively removing plants that express the gene of interest.
  • the phytotoxic compound may be synthesized from endogenous precursors that are metabolized by the gene of interest into a toxic form, for example plant growth regulators, or the phytotoxic compound may be synthesized from an exogenously applied compound that is only metabolized into a toxic compound in the presence of the gene of interest.
  • the gene of interest may comprise indole acetamide hydrolase (IAH), that converts exogenously applied indole acetamide (IAM) or naphthaline acetemide (NAM), to indole acetic acid (LAA), or naphthaline acetic acid (NAA), respectively.
  • IAH indole acetamide hydrolase
  • IAM exogenously applied indole acetamide
  • NAM naphthaline acetemide
  • LAA indole acetic acid
  • NAA naphthaline acetic acid
  • the gene of interest may encode a protein involved in herbicide resistance, for example, but not limited to, phosphinothricin acetyl transferase, wherein, in the absence of the gene encoding the transferase, application of phosphinothricin, the toxic compound (herbicide) results in plant death.
  • phosphinothricin acetyl transferase a protein involved in herbicide resistance
  • Other genes or coding regions of interest that encode lethal or conditionally lethal products may be found in WO 00/37660 (which is incorporated herein by reference).
  • the coding region of interest or the nucleotide sequence of interest may be expressed in suitable plant hosts which are transformed by the nucleotide sequences, or nucleic acid molecules, or genetic constructs, or vectors of the present invention.
  • suitable hosts include, but are not limited to, agricultural crops including canola, Brassica spp., maize, tobacco, alfalfa, potato, ginseng, pea, oat, rice, soybean, wheat, barley, sunflower, and cotton.
  • Any member of the Brassica-family can be transformed with one or more genetic constructs of the present invention including, but not limited to, canola, Brassica napus, B. carinata, B. nigra, B. oleracea, B. chinensis, B. cretica, B. incana, B. insularis, B.japonica, B. atlantica, B. laubeaui, B.narinosa, B. juncea, B. rapa, Arabidopsis.
  • the one or more chimeric genetic constructs of the present invention can further comprise a 3' untranslated region.
  • a 3' untranslated region refers to that portion of a gene comprising a DNA segment that contains a polyadenylation signal and any other regulatory signals capable of effecting mRNA processing or gene expression.
  • the polyadenylation signal is usually characterized by effecting the addition of polyadenylic acid tracks to the 3' end of the mRNA precursor.
  • Polyadenylation signals are commonly recognized by the presence of homology to the canonical form 5' AATAAA-3' although variations are not uncommon.
  • One or more of the chimeric genetic constructs of the present invention can also include further enhancers, either translation or transcription enhancers, as maybe required. These enhancer regions are well known to persons skilled in the art, and can include the ATG initiation codon and adjacent sequences. The initiation codon must be in phase with the reading frame of the coding sequence to ensure translation of the entire sequence.
  • suitable 3' regions are the 3' transcribed non-translated regions containing a polyadenylation signal of Agrobacterium tumor inducing (Ti) plasmid genes, such as the nopaline synthase (Nos gene) and plant genes such as the soybean storage protein genes and the small subunit of the ribulose-1, 5-bisphosphate carboxylase (ssRUBISCO) gene.
  • Ti Agrobacterium tumor inducing
  • Nos gene nopaline synthase
  • ssRUBISCO small subunit of the ribulose-1, 5-bisphosphate carboxylase
  • the constructs of this invention may be further manipulated to include plant selectable markers.
  • Useful selectable markers include enzymes which provide for resistance to chemicals such as an antibiotic for example, gentamycin, hygromycin, kanamycin, or herbicides such as phosphinothrycin, glyphosate, chlorosulfuron, and the like.
  • enzymes providing for production of a compound identifiable by colour change such as GUS ( ⁇ -glucuronidase), or luminescence, such as luciferase or GFP, are useful.
  • transgenic plants containing the chimeric gene construct of the present invention.
  • the chimeric gene constructs of the present invention may also be combined with gene of interest for expression within a range of plant hosts.
  • transformed plant cells are cultured in an appropriate medium, which may contain selective agents such as antibiotics, where selectable markers are used to facilitate identification of transformed plant cells.
  • an appropriate medium which may contain selective agents such as antibiotics, where selectable markers are used to facilitate identification of transformed plant cells.
  • shoot formation can be encouraged by employing the appropriate plant hormones in accordance with known methods and the shoots transferred to rooting medium for regeneration of plants.
  • the plants may then be used to establish repetitive generations, either from seeds or using vegetative propagation techniques.
  • Transgenic plants can also be generated without using tissue cultures (for example, Clough and Bent, 1998)
  • the constructs of the present invention can be introduced into plant cells using Ti plasmids, Ri plasmids, plant virus vectors, direct DNA transformation, micro- injection, electroporation, etc.
  • Ti plasmids Ri plasmids
  • plant virus vectors direct DNA transformation, micro- injection, electroporation, etc.
  • Weissbach and Weissbach Methods for Plant Molecular Biology, Academy Press, New York NHL pp. 421-463 (1988); Geierson and Corey, Plant Molecular Biology, 2d Ed. (1988); and Mild and Iyer, Fundamentals of Gene Transfer in Plants. In Plant Metabolism, 2d Ed. DT. Dennis, DH Turpin, DD Lefebrve, DB Layzell (eds), Addison Wesly, Langmans Ltd. London, pp. 561-579 (1997); Clough and Bent (1998)).
  • the present invention further includes a suitable vector comprising the chimeric gene construct.
  • an "analogue” or “derivative” includes any substitution, deletion, or addition to the nucleotide or amino acid sequence of the repressor protein, for example but not limited to, the ROS repressor, provided that the analogue or derivative thereof, maintains the property of binding or associating with the operator sequence, ROS repressor activity, or both.
  • the repressor protein, or an analogue or derivative thereof exhibits the property of binding an operator sequence, and exhibits the property of repressing the expression of a gene in operative association with the operator sequence.
  • the D ⁇ A sequences of the present invention include the D ⁇ A sequences of SEQ ID NO: 1, 2 and 3 (native or wild-type ROS repressor, synthetic ROS repressor, and a composite or consensus ROS repressor; also see Figures 1(B) and-(C)) derivatives, and fragments thereof, as well as analogues of, or nucleic acid sequences that are substantially homologous to, and that exhibit greater than 80% similarity with, the nucleic acid sequence as defined in SEQ ID NO: 2 or 3. If a fragment of a ROS repressor is used, the fragment is at least of about 54 nucleotides in length in order to cover the zinc finger domain (from 249 to 303).
  • the fragment is from about 54 to about 150 nucleotides in length, more preferably from about 54 to about 80 nucleotides in length.
  • Sequences that exhibit greater than 80%o similarity may be determined by use of the BLAST algorithm (GenBank: www.ncbi.nlm.nih.gov/cgi-bin BLAST/), using default parameters (Program: blastn; Database: nr; Expect 10; filter: low complexity; Alignment: pairwise; Word size: 11).
  • Analogs, or derivatives thereof also include those DNA sequences which hybridize under stringent hybridization conditions (see Maniatis et al., in Molecular Cloning (A Laboratory Manual), Cold Spring Harbor Laboratory, 1982, p.
  • any one of the DNA sequences of SEQ J-D NO: 1, 2 or 3 provided that the sequences exhibit the property of binding an operator sequence (operator binding activity), or maintain the property of repressing the expression of a gene in operative association with the operator sequence.
  • An example of one such stringent hybridization conditions may be hybridization with a suitable probe, for example but not limited to, a [ ⁇ - 32 P]dATP labelled probe for 16-20 hrs at 65°C in 7% SDS, lmM EDTA, 0.5M Na ⁇ PO ⁇ pH 7.2.
  • An example of an analog or a derivative of the ROS repressor which is not to be considered limiting in any manner, includes the ROS operator binding sequence fused to a second protein to produce a fusion protein, providing that the fusion protein exhibits ROS operator sequence binding activity.
  • the second protein that is fused to the DNA binding sequence may be any protein, including a protein having an activity that regulates gene expression when bound to the operator sequence, for example but not limited to histone deacetylase, histone acetyl transferase, a protein involved in protein-protein interaction, or a protein that does not directly interact with transcriptional processes, but that exhibits a characteristic of steric hindrance, for example, interfering with the association of polymerase or other transcription factor within the promoter region, or by blocking migration of polymerase along a nucleic acid.
  • a protein having an activity that regulates gene expression when bound to the operator sequence for example but not limited to histone deacetylase, histone acetyl transferase, a protein involved in protein-protein interaction, or a protein that does not directly interact with transcriptional processes, but that exhibits a characteristic of steric hindrance, for example, interfering with the association of polymerase or other transcription factor within the promoter region, or by blocking migration of polyme
  • the present invention is further directed to one or more nucleotide constructs comprising a nucleotide sequence (coding region) of interest operatively linked to a regulatory region that is modified to contain one or more operator sequences, for example, but not limited to, one or more ROS operator sequences (see Figures 3, 4, or 5).
  • an operator sequence may be placed downstream ( Figure 3(A)), upstream (Figure 3(B)), or upstream and downstream ( Figure 3(C)) of the TATA box within a regulatory region.
  • the operator sequences may be placed within a promoter region as single binding elements or as tandem repeats (see Figure 5(B)).
  • tandem repeats of an operator sequence can be placed downstream of the entire promoter or regulatory region and upstream of the gene or nucleotide sequence of interest.
  • An operator sequence, or repeats of an operator sequence may also be positioned within untranslated or translated leader sequences (if positioned in- frame), introns of a gene, or within an ORF of a gene, if inserted in-frame. Any gene or nucleotide sequence may be used as the gene or nucleotide sequence of interest and be selectively targeted for regulation of gene expression according to the present invention.
  • the repressor protein that is produced from the second nucleotide sequence can bind to operator sequences contained within the regulatory region of the first nucleotide sequence and thereby specifically and selectively repress transcription of the gene of interest.
  • the first nucleotide sequence and the second nucleotide sequence are chromosomally integrated into a plant or plant cell.
  • the two nucleotide sequences maybe integrated into two different genetic loci of a plant or plant cell, or the two nucleotide sequences may be integrated into a singular genetic locus of a plant or plant cell.
  • the ROS transcription factor (ROS repressor, Figure 1(A); SEQ ID NO:3), for example, o ⁇ Agrobacterium tumefaciens (SEQ ID NO' s : 1 and 21 , nucleic acid and amino acid sequence, respectively) has a DNA binding motif (see bolded amino acids, Figure 1(C)) of the C 2 H 2 zinc finger configuration (Chou et al., 1998, Proc. Natl. Acad. Sci., 95: 5293).
  • Zinc finger DNA binding proteins represent a significant portion of transcription factors in eukaryotes, but are rare in prokaryotes.
  • the zinc finger ROS protein varies from its counterparts in eukaryotes in two aspects: 1. Unlike most eukaryotic zinc finger proteins, which contain multiple zinc finger motifs, the ROS repressor has only one such motif.
  • ROS zinc finger motif and possibly, the small size of the ROS repressor (-15.5 kDa) provide structural uniqueness and molecular flexibility and that make the ROS repressor, or analogs thereof, a suitable candidate as a transcription factor for regulation of gene expression in plants.
  • larger size chimeric proteins comprising a ROS operator binding domain may also be used as described herein.
  • the ROS repressor is encoded by a nucleotide sequence of bacterial origin and, as such the nucleotide sequence may be optimised, for example, by changing its codons to favour plant codon usage (e.g. SEQ ID NO:2), by attaching a nucleotide sequence encoding a nuclear localisation signal, for example but not limited to SV40 localization signal (see Robbins et al, 1991, Cell, 64: 615-623; Rizzo,P., Di Resta,L, Powers,A., Ratner,H. and Carbone,M.
  • SV40 localization signal see Robbins et al, 1991, Cell, 64: 615-623; Rizzo,P., Di Resta,L, Powers,A., Ratner,H. and Carbone,M.
  • nuclear localization signals include but are not limited to those listed in Tablel:
  • Glucocorticoid receptor M,R RKclqagmnleaRKtKK 5 (SEQ JX) NO:39) ⁇ receptor H RKclqagmnleaRKtKK 5 (SEQ ID NO:40) ⁇ receptor H RKclqagmnleaRKtKK 5 (SEQ ID NO:41)
  • A Arabidopsis; X, Xenopus; M, mouse; R, rat; Ra, rabbit; H, human; C, chicken; T, tobacco; M, maize; V, potyvirus.
  • a nuclear localization signal to the repressor protein or fusion protein facilitates migration of the repressor, or fusion, protein into the nucleus.
  • reduced levels of repressor or fusion proteins elsewhere within the cell may be important when the repressor or fusion protein may bind analogue operator sequences within other organelles, for example within the mitochondrion or chloroplast.
  • the use of a nuclear localization signal may permit the use of a less active promoter or regulatory region to drive the expression of the repressor, or fusion, protein while ensuring that the concentration of the expressed protein remains at a desired level within the nucleus, and that the concentration of the protein is reduced elsewhere in the cell.
  • the nuclear localization signal may be fused to the N, C, or both the N and C terminus of the ROS protein. Furthermore, the nuclear localization signal maybe fused within the coding region of the gene, provided that the activity of the protien is retained. Preferably, the nuclear localization signal is fused to the carboxy-terminus of the protein or fusion protien.
  • the nucleotide sequence, depicted in Figure 1(B) or SEQ ID NO:2, consisting of the fusion of the modified nucleotide sequence of the protein coding region of ROS with the nucleotide sequence encoding the nuclear localization signal is designated as "synthetic ROS".
  • synthetic ROS analogues of the nucleotide sequence encoding ROS repressor, or the amino acid sequence of the ROS repressor, are within the scope of the present invention.
  • the gene may be assembled enzymatically, within a DNA vector, for example using PCR, or synthesised from chemically synthesized oligonucleotide duplex segments.
  • the synthetic gene is then introduced into a plant using methods known in the art. Expression of the gene maybe determined using methods known within the art, for example Northern analysis, Western analysis, or ELISA.
  • the present invention also pertains to the regulation of gene expression in plants using the ROS repressor protein, whereby the ROS repressor is used as a regulatory switch to repress the expression of selected coding regions or nucleotide sequences of interest.
  • the repression of the expression of a gene of interest maybe accomplished by transforming the plant with two constructs: 1.
  • a first genetic construct comprising a gene or nucleotide sequence of interest operatively associated with a regulatory region containing at least one operator sequence that can interact with the ROS repressor.
  • a second genetic construct comprising an appropriate regulatory region operatively linked to a nucleotide sequence that encodes the ROS repressor.
  • the first and second genetic constructs may be inserted into a plant in separate vectors, each of which maybe introduced into a plant via co-transformation sequentially, or at the same time, or introduced into a plant by crossing plants expressing either the first or second genetic construct, or both genetic constructs may reside within one vector, and be introduced within a plant at the same time.
  • the protein coding region of the nucleotide sequence encoding the ROS repressor is modified to favour plant codon usage.
  • the nucleotide sequence is operatively linked with a nucleotide sequence encoding a nuclear localisation signal. Expression of both constructs within the same plant will result in a repression of the expression of the gene of interest as mediated by an interaction of the ROS repressor with a ROS operator sequence contained within the regulatory region of the first genetic construct.
  • Figure 6 (B) Southern analysis of Arabidopsis plants that are transformed with constructs comprising the second nucleic acid sequence of the present invention, expressing ROS repressor protein, indicates that both the wild type ROS and the synthetic ROS are integrated into the chromosome of Arabidopsis.
  • Western blots shown in Figure 7 demonstrate that both native ROS and synthetic ROS may be expressed within plants.
  • Results of a cross between a transgenic line expressing synthetic ROS (ROS parent) and a nucleotide sequence of interest, for example, but not limited to GUS (GUS parent) are presented in Figure 9 and demonstrate ROS mediated repression of a gene of interest.
  • GUS activity is detected in the GUS parent (expressing p74-l 18; see Figure 5C for construct) but not in the ROS parent (p74-101 ; see Figure 2D for construct), or in the progeny of the cross between the ROS and GUS parents (cross between plant lines expressing p74-101 and p74-l 18).
  • the parent plants each expressed either GUS or ROS RNA as expected ( Figure 9B), yet no GUS RNA was detected in the progeny arising from a cross between the ROS and GUS parents.
  • Southern analysis of the progeny of the cross between the GUS and ROS parents indicates that the progeny plant from the cross between the ROS and GUS parent comprised genes encoding both GUS and ROS ( Figure 9C).
  • Figure 1 ID shows quantification of the data of Figure 11 A (using a GUS probe).
  • progeny of a cross, C2 between a plant line comprising a first nucleotide sequence, p74-316 (35S-lx OS-GUS), and a plant line comprising a second nucleotide sequence, p74-101 (Actin2-synRos) resulted in reduced expression of GUS ( Figure 11 A, lanes C2 A-G) compared to GUS expression in the parent plants, P2 GUS or P2 ROS.
  • Quantification of GUS RNA for this cross is provided in Figure 1 ID (lanes C2A-G, and P2 GUS.
  • Figure 13 provides further evidence for inhibition of expression of a coding region of interest by a repressor protein (as compared to expression of the coding region of interest in a parental cell line that does not produce a repressor) where the coding region of interest is operatively linked to a regulatory region that is able to be controlled by one, or more than one operator sequences that can bind or interact with the repressor.
  • Figure 12A shows the structure of a repressor construct (a non-limiting example of a second genetic construct of the invention) in which an actin2 regulatory region is operatively linked to a protein coding region of synthetic ROS.
  • Figure 12B shows the structure of a construct encoding a GUS reporter (a non-limiting example of a first genetic construct of the invention) in which a CaMN35S regulatory region, modified to contain 4 ROS operator sequences, is operatively linked to a coding region of interest encoding GUS.
  • Parental lines separately comprising a first nucleotide sequence comprising a coding region of interest (for example, a GUS reporter) and a second nucleotide sequence comprising a region coding for a repressor (for example, a ROS repressor) are crossed to produce plants comprising both first and second nucleotide sequences and the expression of the coding region of interest can be analyzed by any standard method.
  • a first nucleotide sequence comprising a coding region of interest
  • a repressor for example, a ROS repressor
  • suitable hosts include, but are not limited to, agricultural crops including canola, Brassica spp., maize, tobacco, alfalfa, potato, ginseng, pea, oat, rice, soybean, wheat, barley, sunflower, and cotton.
  • agricultural crops including canola, Brassica spp., maize, tobacco, alfalfa, potato, ginseng, pea, oat, rice, soybean, wheat, barley, sunflower, and cotton.
  • Any member of the Brassica- family can be transformed with one or more genetic constructs of the present invention including, but not limited to, Arabidopsis, Brassica amplexicaulis, Brassica atlantica, Brassica balearica, Brassica barrelieri, Brassica laubeaui, Brassica carinata (Abyssinian mustard), Brassica chinensis, Brassica cretica, Brassica deflexa, Brassica erucastrum, Brassica hilarionis, Brassica incana, Brassica insularis, Brassica insularis subsp. insularis, Brassica juncea (Indian mustard), Brassica macrocarpa, Brassica maurorum, Brassica montana, Brassica napus (rape), Brassica napus var.
  • napobrassica (Swedish turnip), Brassica napus var. napus (canola), Brassica narinosa, Brassica nigra (black mustard), Brassica oleracea, Brassica oleracea var. acephala (kale), Brassica oleracea var. alboglabra (Chinese kale), Brassica oleracea var. botrytis (cauliflower), Brassica oleracea var. capitata (cabbage), Brassica oleracea var. gemmifera (brussel sprouts), Brassica oleracea var. gongylodes (kohlrabi), Brassica oleracea var.
  • italica (asparagus broccoli), Brassica oleracea var. medullosa (marrow-stem kale), Brassica oleracea var. oleracea, Brassica oleracea var. ramosa (branching bush kale), Brassica oxyrrhina, Brassica rapa (field mustard), Brassica rapa subsp. chinensis (bok-choy), Brassica rapa subsp. oleifera (biennial turnip rape), Brassica rapa subsp. peldnensis (Chinese cabbage), Brassica rapa subsp. rapa (turnip), Brassica rupestris, Brassica soup villosa.
  • Plant transformation was carried out according to the floral dip procedure described in Clough and Bent (1998, Plant J., 16, 735). Essentially, Agrobacterium tumefaciens transformed with the construct of interest (using standard methods as known in the art) was grown overnight in a 100ml Luria-Bertaiii Broth (10 g/L NaCI, 10 g/L tryptone, 5 g/L yeast extract) containing 50 ug/ml kanamycin. The cell suspension , culture was centrifuged at 3000 X g for 15 min. The pellet was resuspended in IL of the transformation buffer (sucrose (5%), Silwet L77 (0.05%)(Loveland Industries, Greeley, Co.)).
  • the above-ground parts of the Arabidopsis plants were dipped into the Agrobacterium suspension for ⁇ 1 min and the plants were then transfened to the greenhouse. The entire transformation process was repeated twice more at two day intervals. Plants were grown to maturity and seeds collected. To select for transformants, seeds were surface sterilized by washing in 0.05% Tween 20 for 5 minutes, with 95% ethanol for 5 min, and then with a solution containing sodium hypochlorite (1.575%) and Tween 20 (0.05%) for 10 min followed by 5 washings in sterile water.
  • Example 1 Optimization of ROS protein coding region.
  • the ros nucleotide sequence is derived from Agrobacterium tumefaciens (SEQ ID NO.T; Figure IA). Analysis of the protein coding region of the ros nucleotide sequence indicates that the codon usage may be altered to better conform to plant translational machinery. The protein coding region of the ros nucleotide sequence was therefore modified to optimize expression in plants (SEQ ID NO:2; Figure IB). The nucleic acid sequence of the ROS repressor was examined and the coding region modified to optimize for expression of the gene in plants, using a procedure similar to that outlined by Sardana et al. (Plant Cell Reports 15:677-681; 1996).
  • the ros gene is cloned from Agrobacterium tumefaciens by PCR.
  • the nucleotide sequence encoding the ROS protein is expressed in, and purified from, E. coli, and the ROS protein used to generate an anti-ROS antiserum in rabbits using standard methods (Maniatis et al.).
  • Example 2 Constructs that express synthetic ROS repressor, or wild type ROS repressor and preparation of repressor lines.
  • the protein coding region of the ros gene is modified to favour Arabidopsis thaliana and Brassica napus codon usage, and in some constructs, to incorporate a nucleotide sequence encoding a nuclear localization signal at its carboxy terminus as described below.
  • a modified ros nucleotide sequence comprising optimized codons and the nuclear localization signal is refened to as "synthetic ROS".
  • the ROS coding portion of the synthetic ROS nucleotide sequence is designed to encode the same protein as the wild type bacterial ros nucleotide sequence, while optimizing codon usage in plants or plant cells.
  • the protein coding region of the wild type ROS gene is amplified by PCR using total genomic D ⁇ A of Agrobacterium tumefaciens 33970 and the following two primers with built-in BamHl (G GAT CC) and Hin MI (A AGC TT) sites:
  • Sense primer 5- GCG GAT CCG ATG ACG GAA ACT GCATAC-3' (SEQ ID ⁇ O:4)
  • Anti-sense primer 5 '-GCA AGC TTC AAC GGT TCG CCT TGC G-3 ' (SEQ ID NO:5).
  • the PCR product which lacks any nuclear localization signal, is cloned into the
  • Ban-fil/Hindi ⁇ sites of the pGEX vector (Pharmacia), excised from pGEX as a
  • p74-313 Construct for The Expression of The Synthetic ROS Driven by The CaMN 35S Promoter ( Figure 2(B)).
  • the ORF of the ROS repressor is re-synthesized to favor plant codon usage as outlined above, and to incorporate a SN40 nuclear localization signal, PKKKRKN, at its carboxy terminus.
  • the re-synthesized ROS is cloned into the BamHI-SacI sites of pUC19, and subcloned into pBI121 as a BamHI/Sstl fragment replacing the GUS ORF in this vector.
  • the tms2 promoter is PCR amplified from genomic D ⁇ A of Agrobacterium tumefaciens 33970 using the following two primers:
  • anti-sense primer 5,'-CGG GGA TCC TTT CAG GGC CAT TTC AG -3' (SEQ ID NO: 5
  • the 352 bp PCR fragment is cloned into the EcoRN site of pBluescript, and excised from pBluescript as a HindlLT/BamHI fragment, and sub-cloned into the HindlD/BamHI sites of p74-313, see below, replacing the CaMN 35S promoter.
  • p74-101 Construct for The Expression of The Synthetic ROS Driven by The Actin2 Promoter ( Figure 2(D)).
  • the Actin2 promoter ( An et al, 1996, Plant J., 10: 107-121) is PCR amplified from genomic DNA of. Arabidopsis thaliana ecotype Columbia as described in 74-501
  • Actin2 promoter is then cloned into p74-313 (see below) as a HindlJI/Xbal fragment replacing the CaMV 35S promoter.
  • FIG. 6(B) show Southern analysis of transgenic plants comprising a second genetic construct, for example, p74-101 (actir ⁇ -synthetic ROS; Figure 2(D)).
  • ROS in the repressor lines is assessed by Western blot analysis using a ROS polyclonal antibody.
  • Several lines show high levels of ROS expression. These included plants expressing both the wild type ROS (without any nuclear loclization signal) as well as those expressing the synthetic ROS nucleic acid sequences.
  • Total plant protein extracts are analyzed for the expression of the ROS protein using a polyclonal rabbit anti-ROS antibody.
  • Chemiluminescent detection of antigen- antibody complexes is carried out with goat anti-rabbit IgG secondary antibody conjugated to horseradish peroxidase-conjugated (from Bio-Rad Laboratories) in conjunction with ECL detection reagent (from Amersham Pharamcia Biotech).
  • ROS protein both wild type ROS (WTROS), for example p74-107 (35S-WTROS; Figure 2(A)), and synthetic ROS, for example p74-101 (actin2-synROS; Figure 2(D)), produced in the transgenic plants is determined by Western blot analysis using a ROS polyclonal antibody ( Figure 7). Representative lines showing various levels of expression were used as a source of pollen for pollination of reporter lines containing single inserts.
  • Example 3 Constructs placing a gene of interest under transcriptional control of regulatory regions that have been modified to contain ROS operator sites, and preparation of reporter lines.
  • p74-315 Construct for The Expression of GUS Gene Driven by a CaMV 35 S Promoter Containing a ROS Operator Downstream of TATA Box ( Figure 3(A)).
  • the BamHI-EcoRV fragment of CaMN 35S promoter in pBI121 is cut out and replaced with a similar synthesized D ⁇ A fragment in which the 25 bp immediately downstream of the TATA box were replaced with the ROS operator sequence:
  • ROS-OPDS SEQ ID NO:9
  • ROS-OPDA SEQ ID NO: 10
  • ROS-OPDS 5'-ATC TCC ACT GAC GTA AGG GAT GAC GCA CAA TCC CAC TAT CCT TCG CAAGAC CCT TCC TCT ATATAATAT ATT TCA
  • ROS-OPDA 5'- GATC CTC TAGAGT CCC CCGTGTTATATTACAATAAAA TTGAAATATATTATATAGAGGAAGGGTCTTGCGAAGGAT AGT GGG ATT GTG CGT CAT CCC TTA CGT CAG TGG AGA T-3' (SEQ ID NO: 10)
  • the p74-315 sequence from the EcoRN site (GAT ATC) to the first codon (ATG) of GUS is shown below (TATA box - lower case in bold; the synthetic ROS sequence - bold caps; a transcription start site - ACA, bold italics; BamHl site - GGA TCC; and the first of GUS, ATG, in italics; are also indicated):
  • p74-316 Construct for The Expression of GUS Driven by a CaMN 35S Promoter Containing a ROS Operator Upstream of TATA Box ( Figure 3 (B)) .
  • the BamHI-EcoRN fragment of CaMN 35S promoter inpBI121 is cut out and replaced with a similar synthesized D ⁇ A fragment in which the 25 bp immediately upstream of the TATA box are replaced with the ROS operator sequence (SEQ J_D NO: 8).
  • ROS-OPUS SEQ ID NO.T 1
  • ROS-OPUA SEQ ID NO: 12
  • ROS-OPUS 5'-ATC TCC ACT GAC GTAAGG GAT GAC GCA CAA TCT ATA TTTCAATTTTATTGT AATATACTATATAAGGAAGTTCAT TTCATTTGGAGAGAACACGGGGGACTCTAGAG-3'(SEQID NO:11)
  • ROS-OPUA 5'- GATC CTC TAGAGT CCC CCGTGTTCT CTC CAAATGAAA TGAACTTCCTTATATAGTATATTACAATAAAATTGAAAT ATA GAT TGT GCG TCA TCC CTT ACG TCA GTG GAG AT-3' (SEQ ID NO:12)
  • the p74-316 sequence from the EcoRN site (GAT ATC) to the first codon (ATG) of GUS is shown below (TATA box - lower case in bold; the synthetic ROS sequence - bold caps; a transcription start site - ACA, bold italics; BamHl site - GGA TCC; the first codon of GUS, ATG -italics, are also indicated):
  • p74-309 Construct for The Expression of GUS Driven by a CaMV 35S Promoter Containing ROS Operators Upstream and Downstream of TATA Box ( Figure 3(C)).
  • the BamHI-EcoRN fragment of CaMN 35S promoter in pBI121 is cut out and replaced with a similar synthesized D ⁇ A fragment in which the 25 bp immediately upstream and downstream of the TATA box were replaced with two ROS operator seqeunces (SEQ LD ⁇ O:8).
  • ROS-OPPS SEQ ED NO: 13
  • ROSOPPA SEQ ID NO: 14
  • ROS-OPPS 5'- TC TCC ACT GAC GTA AGG GAT GAC GCA CAA TCT ATA TTT CAA TTT TAT TGT AAT ATA CTA TAT AAT ATA TTT CAA TTT TAT TGT AAT ATA ACA CGG GGG ACT CTA GAG-3' (SEQ ID NO: 13)
  • ROS-OPPA 5 -G ATC CTC TAG AGT CCC CCG TGT TAT ATT ACA ATA AAA TTG AAA TAT ATT ATA TAG TAT ATT ACA ATA AAA TTG AAA TAT AGA TTG TGC GTC ATC CCT TAC GTC AGT GGA GAT-3' (SEQ ID NO: 14)
  • the p74-309 sequence from the EcoRN site (GAT ATC) to the first codon (ATG) of GUS is shown below (TATA box - lower case in bold; two synthetic ROS sequence - bold caps; a transcription start site - ACA, bold italics; BamHl site - GGA TCC; the first codon of GUS, ATG -italics, are also indicated):
  • p76-508 Construct for The Expression of The GUS Gene Driven by the tms2 Promoter Containing a ROS Operator ( Figure 4(B)).
  • the tms2 promoter is PCR amplified from genomic DNA of Agrobacterium tumefaciens 33970 using the following primers: sense primer: 5 '-TGC GGA TGC ATA AGC TTG CTG ACA TTG CTA GAA AAG- 3' (SEQ JD NO:6) anti-sense primer: 5 '-CGG GGA TCC TTT CAG GGC CAT TTC AG- 3 '(SEQ ID NO: 6
  • the 352 bp PCR fragment is cloned into the EcoRN site of pBluescript, and sub-cloned into pGEM-7Zf(+).
  • Two complementary oligos, ROS-OPl (SEQ ID NO: 15) and ROS- OP2 (SEQ ID NO: 16), containing two ROS operators (in italics, below), are annealed together and cloned into pGEM-7Zf(+) as a BamHI/Clal fragment at the 3' end of the tms2 promoter.
  • This promoter/operator fragment is then sub-cloned into pBI121 as a Hindlll/Xbal fragment, replacing the CaMN 35S promoter fragment.
  • ROS-OPl 5'-GAT CCT ATA TTT CAA TTT TAT TGT AAT ATA GCT ATA TTT CAA TTT TAT TGT AAT ATA AT-3' (SEQ LD NO: 15)
  • ROS-OP2 5'-CGA TTA TAT TAC AAT AAA ATT GAA ATA TAG CTA TAT TAC AAT AAA ATT GAA ATA TAG-T(S ⁇ Q ID ⁇ 0:16).
  • p76-507 comprising a tms2 promoter (without any operator sequence) fused to GUS ( Figure 4(A)), is also prepared.
  • p74-501 Construct for The Expression of The GUS Gene Driven by The Actin2 Promoter Containing a ROS operator ( Figure 5(B)).
  • the Actin2 promoter is PCR amplified from genomic DNA of Arabidopsis thaliana ecotype Columbia using the following primers:
  • the PCR fragment is cloned into pGEM-T-Easy.
  • Two complementary oligos, ROS-OP 1 (SEQ LD NO: 15) and ROS-OP2 (SEQ LD NO: 16), with built-in BamHl and C sites, and containing two ROS operators, are annealed together and inserted into the Actin2 promoter at the BglH Cla I sites replacing the BglH/Clal fragment.
  • This modified promoter is inserted into pBI121vector as a HindmyBamHI fragment.
  • the BamHl-EcoRV fragment of CaMN 35S promoter inpBI121 is cut out and replaced with a similar synthesized D ⁇ A fragment in which a region downstream of the TATA box was replaced with three ROS operator sequences (SEQ LD ⁇ O:25).
  • the first of the three synthetic ROS operator sequences is positioned immediatlely of the TAT box, the other two ROS operator sequence are located downstream of the trasncriptional start site (ACA).
  • ACA trasncriptional start site
  • Two complementary oligos with built-in BamHI-EcoRN ends were prepared as describe above for the other constructs were annealed together and ligated into the BamHI-EcoRN sites of CaMN35S.
  • the p74-l 18 sequence from the EcoRN site (GAT ATC) to the first codon (ATG) of GUS is shown below (TATA box - lower case in bold; three synthetic ROS sequence - bold caps; a transcription start site - ACA, bold italics; BamHl site - GGA TCC; the first codon of GUS, ATG -italics, are also indicated):
  • TCGCAAGAC CCTTCC TCt atataATATATT TCAATT TTATTGTAATAT AAC ACG GGG GAC TCT AGA GGATCC TAT ATT TCAATT TTA TTGTAA
  • p75-101 comprising an actin2 promoter (without any operator sequence) fused to GUS ( Figure 5(A)), is also prepared.
  • FIG. 6(A) show Southern analysis of transgenic plants comprising a first genetic construct, for example, p74-309 (35S-operator sequence-GUS, Figure 3(C)). GUS expression assays on reporter transgenic lines
  • Leaf tissues (approximately 10 mg) from putative positive transformants are placed into a microtitre plate containing 100 ul of GUS staining buffer (lOOmM KPO 4 , lmM EDTA, 0.5 mM K-ferricyanide, 0.5 mM K- fenocyanide, 0.1% Triton X-100, 1 mM 5-bromo-4-chloro-3-indolyl glucuronide), and vacuum-infiltrated for one hour. The plate is covered and incubated at 37°C overnight. Tissues are destained when necessary using 95% > ethanol and color reaction is evaluated either visually or with a microscope.
  • GUS staining buffer lOOmM KPO 4 , lmM EDTA, 0.5 mM K-ferricyanide, 0.5 mM K- fenocyanide, 0.1% Triton X-100, 1 mM 5-bromo-4-chloro-3-indolyl
  • Example 4 Crossing of transgenic lines containing ROS repressor constructs with transgenic lines containing GUS reporter constructs.
  • Transgenic Arabidopsis lines containing repressor constructs are crossed with lines containing appropriate reporter (GUS) constructs (first genetic constructs).
  • GUS reporter
  • Figures 1 A-D shows results of the crosses described in Table 5, between a range of repressor and reporter plants (plants expressing Tag protein). Maps of the constructs listed in Table 5 are shown in Figures 10A and B.
  • FIG. 11 A-D The results of GUS expression using GUS as a probe for crosses CI -C5 are shown in Figure 11 A. Results of ROS expression, using ROS as a probe for crosses C1-C5 are shown in Figure 11B.
  • Figure 11C shows the loading of the RNA gel
  • Figure 11D shows quantification of the densities of the bands generated in the Northern analysis of Figure 11 A using a GUS probe.
  • GUS maximal expression is observed in parental lines expressing the reporter construct (GUS P1-P3 andP5), however, a range of reduced GUS activity is observed in plants that were crossed (lanes marked C1-C5) with a plants expressing a repressor construct.
  • the range of reduced GUS activity varied with reduction of the maximal GUS activity observed in lines C2D and C2G.
  • lanes Pl GUS, P2 GUS, P3 GUS, P4 GUS, P5 GUS exhibit GUS expression of the parent expressing the first nucleotide sequence (i.e.p74-316, p74-l 17, p74- 118, p74- 117 and p74-501 , respectively) . These plants exhibit maximum expression of GUS RNA. Lanes Pl ROS, P2 ROS, P3 ROS, P4 ROS (comprising p74-101 or p74- 313) exhibit background levels of GUS RNA, as these plants do not comprise any sequence resulting in GUS expression.
  • Progeny of all crosses between plants expressing the first nucleotide sequence (p74-316, p74-117, ⁇ 74-118, p74-117 and p74-501) and plants expressing the second nucleotide sequence (p74-101 or p74-313) resulted in reduced expression of GUS (the first coding region, 30) of from about 30%> (e.g. for CIA) to about 90% (for C2G).
  • Figure 13 represents a northern analysis of plants obtained from crossing transgenic Brassica lines containing repressor constructs (second genetic constructs) with lines containing appropriate reporter (GUS) constructs (first genetic constructs), ⁇ grob ⁇ cterram-mediated transformation of B. napus was canied out as described in Moloney et al., Plant Cell Rep. 8:238-242 (1989) with modifications. Seeds were sterilized and then plated on Vi strength hormone- free MS medium (Sigma) with 1% sucrose in 15X60 mm petri dishes. Seeds were then transfened, with the lid removed, into Magenta GA-7 vessels (temperature of 25 degrees C, with 16 h light/8 h dark and a light intensity of 70-80 microE.
  • Magenta GA-7 vessels temperature of 25 degrees C, with 16 h light/8 h dark and a light intensity of 70-80 microE.
  • Cotyledons were excised from 4-day old seedlings and soaked in BASE solution
  • the dishes containing the cotyledons were then transfened to 4 degrees C for 3-4 days in the dark.
  • Cotyledons were transfened to plates containing MS B5 selection medium (4.3 g/L MS, 10 ml 100X B5 Vitamins, 3%o sucrose, 4 mg/L benzyl adenine (BA) ph 5.8; timentin (300 Fg/ml) and kanamycin (20 Fg/ml) were added after autoclaving) and left at 25 degrees C, 16 h light/8 dark with lighting to 70-100 microE.
  • Shoots were transfened to Magenta GA-7 vessels containing MS B5 selection medium without B A. When shoots were sufficiently big they were transfened to Magenta GA-7 vessels containing rooting medium and upon development of a good root system plantlets were removed from the vessels and transfened to moist potting soil.
  • p74-l 14 is a construct comprising a region encoding GUS operatively linked to a CaMN 35S regulatory region containing one ROS operator sequence upstream and three ROS operator sequences downstream of TATA Box.
  • CaMV 35S promoter in pBI121 is cut out and replaced with a similar synthesized D ⁇ A fragment in which a region upstream and downstream of the TATA box was replaced with four ROS operator sequences (SEQ ID ⁇ O:8).
  • the first of the four synthetic ROS operator sequences is positioned 25 bp immediately upstream of the TATA box.
  • the second of the four synthetic ROS operator sequences is positioned 25 bp immediately downstream of the TATA box.
  • the other two ROS operator sequences are located downstream of the transcriptional start site (ACA).
  • Two complementary oligos (SEQ ID NO: 13 and 14) with built-in BamHI-EcoRV ends were prepared as described above for the other constructs, were annealed together and ligated into the BamHI-EcoRV sites of CaMV 35S.
  • the p74-l 14 sequence from the EcoRV site (GAT ATC) to the first codon (ATG) of GUS is shown below (SEQ ID NO:45); TATA box- lower case in bold: the synthetic ROS sequence - bold caps; a transcription start site -ACA, bold italics: BamHl site -GGA TCC; the first codon of GUS, ATG - italics, are also indicated);
  • Parental Brassica napus lines separately comprising p74-101 or p74-114 are crossed to produce hybrid lines comprising bothp74-l 01 an p4- 114. Crosses performed are as follows: CI and C2 are p74-114 x p74-101.
  • P1GUS is the GUS parent plant for
  • P2GUS is GUS parent plant for C2.
  • PROS is ROS parent plant for crosses CI and
  • FIG. 13 demonstrates that high GUS expression, greater than 100, only occurs in the GUS parental line Pl GUS, while no GUS expression was observed in the ROS parent PROS, and GUS expression is reduced in progeny arising from a cross between the ROS and GUS parents, CI and C2.

Landscapes

  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biochemistry (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Biophysics (AREA)
  • Biomedical Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Cell Biology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

L'invention porte sur un procédé de régulation sélective de la transcription d'un gène, ce procédé consistant à produire une ou plusieurs plantes qui expriment un premier ou un second produit de recombinaison génétique ou les deux. Le premier produit de recombinaison génétique comprend une première région régulatrice liée de manière fonctionnelle à un gène concerné et au moins une séquence opératrice du répresseur capable de réguler l'activité de la première région régulatrice. Le second produit de recombinaison génétique comprend une seconde région régulatrice en association fonctionnelle avec une molécule d'acide nucléique ou un dérivé de celui-ci, codant une protéine de répresseur qui présente une activité de liaison de la séquence opératrice du répresseur et une activité du répresseur. Les premier et second produits de recombinaison génétique peuvent résider sur des vecteurs séparés ou le vecteur peut comprendre les premier et second produits de recombinaison génétique tels que définis. Si les premier et second produits de recombinaison résident dans des plantes séparées, la première et la seconde plante étant croisées pour obtenir une descendance de sorte qu'elles comportent les premier et second produits de recombinaison génétique. La descendance de ce croisement est caractérisée en ce que l'expression du second produit de recombinaison génétique réprime l'expression du gène concerné. Les première et seconde régions régulatrices peuvent être identiques ou différentes et peuvent être sélectionnées dans le groupe comprenant un promoteur constitutif, un promoteur inductible, un promoteur spécifique d'un tissu et un promoteur de développement. Si la plante comprend le vecteur comportant les premier et second produits de recombinaison génétique ou si une plante a été co-transformée par ces premier et second produits de recombinaison génétique de sorte que ceux-ci puissent être exprimés dans la même plante, il est alors préférable que les première et seconde régions régulatrices soient différentes. La première région régulatrice peut comprendre un promoteur constitutif, un promoteur inductible, un promoteur d'un tissu spécifique ou un promoteur de développement. La seconde région régulatrice peut comprendre un promoteur inductible, un promoteur spécifique d'un tissu ou un promoteur de développement.
EP02807468A 2002-05-23 2002-11-21 Systeme de regulation induit par un represseur pour controler l'expression des genes dans les plantes Withdrawn EP1506296A1 (fr)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
WOPCT/CA02/00740 2002-05-23
PCT/CA2002/000740 WO2002095021A2 (fr) 2001-05-23 2002-05-23 Systeme de regulation a mediation par represseur pour la commande de l'expression genique dans des plantes
PCT/CA2002/001807 WO2003100063A1 (fr) 2002-05-23 2002-11-21 Systeme de regulation induit par un represseur pour controler l'expression des genes dans les plantes

Publications (1)

Publication Number Publication Date
EP1506296A1 true EP1506296A1 (fr) 2005-02-16

Family

ID=29554883

Family Applications (1)

Application Number Title Priority Date Filing Date
EP02807468A Withdrawn EP1506296A1 (fr) 2002-05-23 2002-11-21 Systeme de regulation induit par un represseur pour controler l'expression des genes dans les plantes

Country Status (3)

Country Link
EP (1) EP1506296A1 (fr)
AU (1) AU2002367981A1 (fr)
WO (1) WO2003100063A1 (fr)

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP4642239B2 (ja) * 1998-12-22 2011-03-02 ダウ・アグロサイエンス・エル・エル・シー 作物植物での異系交雑および望ましくない遺伝子拡散を制限するための方法および遺伝子組成物

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO03100063A1 *

Also Published As

Publication number Publication date
WO2003100063A1 (fr) 2003-12-04
AU2002367981A1 (en) 2003-12-12

Similar Documents

Publication Publication Date Title
AU621195B2 (en) Hybrid seed production
JP5519192B2 (ja) 種子のタンパク質含量を増産させる遺伝子及びその利用方法
US7553667B2 (en) Regulation of gene expression using chromatin remodelling factors
US7521595B2 (en) Repressor-mediated regulation system for control of gene expression in plants
Yang et al. Structural and functional characterization of two wheat histone H2B promoters
AU2002305014A1 (en) A repressor-mediated regulation system for control of gene expression in plants
WO1999031258A1 (fr) Promoteurs vegetaux constitutifs
EP1506296A1 (fr) Systeme de regulation induit par un represseur pour controler l'expression des genes dans les plantes
US7582807B2 (en) Regulation of gene expression using chromatin remodelling factors
US20010047091A1 (en) Cryptic regulatory elements obtained from plants
JP2006055125A (ja) 遺伝子の転写抑制機能を有する新規ペプチドおよびこれをコードするポリヌクレオチド、並びにその利用
US20040148649A1 (en) Repressor-mediated selection strategies
CA2487040A1 (fr) Systeme de regulation induit par un represseur pour controler l'expression des genes dans les plantes
JP5907483B2 (ja) 脱分化または再分化が促進されるように改変された植物体の生産方法、形質転換体、ならびにその方法に用いられる、キメラタンパク質、キメラ遺伝子、ｄｎａ、組換え発現ベクタおよびキット
US6784289B2 (en) Translational regulatory elements
WO1999067389A2 (fr) Elements regulateurs cryptiques obtenus a partir de plantes
KR20160041082A (ko) 식물체의 꽃밥 특이적 발현 특성을 갖는 프로모터 및 그의 용도
CA2331842C (fr) Elements regulateurs cryptiques obtenus a partir de plantes
KR101510252B1 (ko) 배추 유래 광 파장 특이적 ＢｒＥＸＰＡ１ 프로모터 및 이의 용도
JP5850079B2 (ja) 種子のタンパク質含量を減少させる遺伝子及びその利用方法
JP5850078B2 (ja) 種子のタンパク質含量を減少させる遺伝子及びその利用方法
JP5845306B2 (ja) 種子のタンパク質含量を増産させる遺伝子及びその利用方法
JPS63119680A (ja) アシル担体タンパク質−ｄｎａ配列及び合成
CA2535696A1 (fr) Regulation de l'expression genetique au moyen de facteurs de remodelage de la chromatine

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20041125

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR IE IT LI LU MC NL PT SE SK TR

AX Request for extension of the european patent

Extension state: AL LT LV MK RO SI

DAX Request for extension of the european patent (deleted)
17Q First examination report despatched

Effective date: 20060629

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20080907