EP1492884A2 - Methoden zur diagnoseund behandlung von kolorektalem krebs - Google Patents

Methoden zur diagnoseund behandlung von kolorektalem krebs

Info

Publication number
EP1492884A2
EP1492884A2 EP03715738A EP03715738A EP1492884A2 EP 1492884 A2 EP1492884 A2 EP 1492884A2 EP 03715738 A EP03715738 A EP 03715738A EP 03715738 A EP03715738 A EP 03715738A EP 1492884 A2 EP1492884 A2 EP 1492884A2
Authority
EP
European Patent Office
Prior art keywords
protein
seq
dna
set forth
sequence set
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP03715738A
Other languages
English (en)
French (fr)
Inventor
Yusuke Nakamura
Yoichi Furukawa
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Oncotherapy Science Inc
University of Tokyo NUC
Original Assignee
Oncotherapy Science Inc
University of Tokyo NUC
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Oncotherapy Science Inc, University of Tokyo NUC filed Critical Oncotherapy Science Inc
Publication of EP1492884A2 publication Critical patent/EP1492884A2/de
Withdrawn legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6809Methods for determination or identification of nucleic acids involving differential detection
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/90Isomerases (5.)
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer

Definitions

  • the present invention relates to the field of cancer research. More particularly, the present invention relates to detecting and diagnosing colorectal cancer using the HELADl (helicase, APC down-regulated 1) gene and corresponding protein. The invention further relates to methods of diagnosing colorectal tumors in a subject, methods of screening for therapeutic agents useful in the treatment of colorectal tumors, methods of treating colorectal tumors and method of vaccinating a subject against colorectal tumors.
  • HELADl helicase, APC down-regulated 1
  • Mutations in the APC gene are responsible for familial adenomatous polyposis coli as well as for sporadic colorectal tumors (Nishisho et al, 1991; Kinzler et al. 1991); its normal product functions as a tumor suppressor.
  • wild-type APC acts as a negative regulator of the Wnt/wingless signaling pathway by modulating cytoplasmic and nuclear levels of ,,-catenin (Munemitsu et al, 1995).
  • APC facilitates the phosphorylation of ,,-catenin by glycogen synthase kinase 3 reckon (GSK-3,,), leading to degradation of ,,-catenin via the ubiquitin-proteosome pathway (Behrens et al, 1998; Hamada et al, 1999; Hart et al, 1999; Nakamura et al, 1998).
  • Tcf/LEF T-cell factor/lymphocyte enhancer factor
  • DNA helicases play crucial roles in biological processes including DNA replication, DNA repair, and transcription.
  • a common mechanism for controlling initiation of eukaryotic DNA replication involves minichromosome maintenance protein complex (MCM), which contains helicase activity. Together with DNA polymerases, the MCM complex unwinds duplex DNA at replication origins (Eisen and Lucchesi, 1998; Takisawa et al, 2000).
  • MCM minichromosome maintenance protein complex
  • XPB and XPD helicases responsible for nucleotide excision repair, form a complex with TFHH and play a role in transcription as well as DNA repair (Guzder et al, 1994a; Guzder et al, 1994b).
  • inactivation of helicases has been implicated in human genetic disorders such as xeroderma pigmentosum (Weeda et al, 1990), trichothiodystrophy (Broughton et al, 1994), Bloom syndrome (Ellis et al, 1995), Werner syndrome (Yu et al, 1996), and Rothmund Thomson syndrome (Kitao et al, 1999).
  • colorectal carcinoma is a leading cause of cancer deaths in developed countries. Specifically, more than 130,000 new cases of colorectal cancer in the United States are reported each year. Colorectal cancer represents about 15% of all cancers. Of these, approximately 5% are directly related to inherited genetic defects. Many patients have a diagnosis of pre-cancerous colon or rectal polyps before the onset of cancer. While many small colorectal polyps are benign, some types may progress to cancer.
  • the most widely used screening test for colorectal cancer is colonoscopy. This method is used to visualize a suspicious growth and/or take a tissue biopsy. Typically, the tissue biopsy is histologically examined and a diagnosis delivered based on the microscopic appearance of the biopsied cells. However, this method is limited in that it yields subjective results and can not be used for very early detection of pre-cancerous states. The development of a sensitive, specific and convenient diagnostic system for detecting early-stage colorectal cancers or pre-malignant lesions is highly desirable as it could ultimately eliminate this disease. Summary of the Invention
  • the present invention relates to the use of the HELADl gene and protein as a diagnostic marker for colorectal cancer.
  • the present application provides an isolated gene, HELADl, that is overexpressed in colorectal cancers.
  • the expression of the gene, HELADl is frequently up-regulated in colorectal cancers, and appears to confer an oncogenic activity to cancer cells through its helicase activity and suppression of apoptosis.
  • HELADl serves as a novel molecular target for colorectal cancer.
  • An object of the present invention is to provide methods for using the HELADl gene and protein encoded thereby to diagnose and treat of colorectal cancer.
  • the inventors set out to discover investigate the mechanisms of colorectal carcinogenesis. Accordingly, they analyzed expression profiles of colorectal cancers using a cDNA microarray. Reported herein is the identification of a human gene, HELADl, whose expression is markedly elevated in a great majority of colorectal cancers studies, as compared to corresponding non-cancerous tissues.
  • the HELADl cDNA consists of 10,646 nucleotides (SEQ ID NO: 1) that contain an open reading frame of 7,095 nucleotides (spanning residues 230-7324) encoding a putative 2365 amino acid protein (SEQ ID NO:2).
  • the HELADl cDNA consists of 10,939 nucleotides (SEQ ID NO: 3) that contain an open reading frame of 7,287 nucleotides (spanning residues 331-7617) encoding a putative 2429 amino acid protein (SEQ ID NO: 4).
  • Both embodiments of the HELADl protein comprise both a CH (Calponin homology) domain and an AAA (ATPases associated with various cellular activities) domain showing helicase activity. Consistently, suppression of HELADl expression with antisense S-oligonucleotides induced apoptosis in colorectal cell lines.
  • the present invention relates to the use of HELADl proteins involved in cell proliferation and the genes encoding them. More specifically, the present invention provides the following:
  • the present application provides a method of diagnosing and treating colorectal cancer using a human protein, HELADl, or a functional equivalent thereof.
  • the HELADl protein includes a AAA domain with helicase activity and is encoded by the open reading frame of SEQ ID NO:l or SEQ ID NO: 3.
  • the HELADl protein preferably includes the amino acid sequence set forth in SEQ ID NO:2 or that set forth in SEQ ID NO: 4.
  • the present application also provides an isolated protein encoded from at least a portion of the HELADl polynucleotide sequence, or polynucloetide sequences at least 15%, and more preferably at least 25% complementary to the sequence set forth in SEQ ID NO: 1 or SEQ ID NO: 3.
  • the present invention further provides a methods of using the human gene,
  • the isolated HELADl gene includes a polynucleotide sequence as described in SEQ ID NO: 1 or SEQ ID NO: 3.
  • the present invention further encompasses polynucleotides which hybridize to and which are at least 15%, and more preferably at least 25% complementary to the polynucleotide sequence set forth in SEQ ID NO: 1 or SEQ ID NO: 3, to the extent that they encode a HELADl protein or a functional equivalent thereof. Examples of such polynucleotides are degenerates of SEQ ID NO: 1 or SEQ ID NO: 3.
  • an "isolated HELADl gene” is a polynucleotide the structure of which is not identical to that of any naturally occurring polynucleotide or to that of any fragment of a naturally occurring genomic polynucleotide spanning more than three separate genes.
  • the term therefore includes, for example, (a) a DNA which has the sequence of part of a naturally occurring genomic DNA molecule in the genome of the organism in which it naturally occurs; (b) a polynucleotide incorporated into a vector or into the genomic DNA of a prokaryote or eukaryote in a manner such that the resulting molecule is not identical to any naturally occurring vector or genomic DNA; (c) a separate molecule such as a cDNA, a genomic fragment, a fragment produced by polymerase chain reaction (PCR), or a restriction fragment; and (d) a recombinant nucleotide sequence that is part of a hybrid gene, i.e., a gene encoding a fusion polypeptide.
  • the invention utilizes an isolated polynucleotide that encodes a polypeptide described herein or a fragment thereof.
  • the isolated polypeptide includes a nucleotide sequence that is at least 60% identical to the nucleotide sequence shown in SEQ ID NO: 1 or SEQ ID NO: 3. More preferably, the isolated nucleic acid molecule is at least 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more, identical to the nucleotide sequence shown in SEQ ID NO: 1 or SEQ ID NO: 3.
  • an isolated polynucleotide which is longer than or equivalent in length to the reference sequence e.g., SEQ ID NO: 1 or SEQ ID NO: 3
  • the comparison is made with the full length of the reference sequence.
  • the isolated polynucleotide is shorter than the reference sequence, e.g., shorter than SEQ ID NO: 1 or SEQ ID NO: 3
  • the comparison is made to segment of the reference sequence of the same length (excluding any loop required by the homology calculation).
  • the present application also provides a therapeutic agent for treating a cancer.
  • the therapeutic agent may be described as at least a portion of the antisense S-oligonucleotides of the HELADl polynucleotide sequence shown and described in SEQ ID NO: 1 or SEQ ID NO: 3. Suitable antisense S-oligonucleotides include, but are not limited to, the oligonucleotides set forth in SEQ ID NOs: 16, 17, and 20.
  • the therapeutic agent may be suitably used to treat colorectal cells and tissue.
  • the proposed course of action of the therapeutic agent is desirably to induce apoptosis in colorectal cancer cells.
  • the therapeutic agent may be applied to mammals including humans and domesticated mammals.
  • An antibody that recognizes the HELADl protein is also provided by the present application.
  • an antisense DNA, ribozyme, and RNAi(RNA interference) of the HELADl gene is also provided.
  • the present invention provides a method for diagnosing cancer that includes determining an expression level of a HELADl gene or the level of HELADl protein in biological sample of specimen, comparing the level determined with that in normal sample, and defining a high expression level in the sample as having a cancer.
  • the cancer is suitably a colorectal carcinoma.
  • a method of screening for a candidate compound for an anti-cancer agent includes contacting the HELADl polypeptide with candidate compounds, and selecting compounds that inhibit one or more of its activities.
  • the present invention also provides a method of producing a protein by transfecting or transforming a host cell with a polynucloetide sequence encoding the HELADl protein, and expressing the polynucloetide sequence.
  • Figures IA -1C depict the expression of HELADl in cancer cells and fetal tissues.
  • Figure 1 A depicts the reduced expression of HELADl in response to Ad- APC or Ad-Axin in SW480 cells.
  • Semi-quantitative RT-PCR was carried out with RNAs extracted from cells that were untreated (Mock) or infected for 72 h with adenovirus containing either wild-type AXIN1 , the 20-amino-acid repeat region of the wild-type APC gene, or LacZ.
  • Figure IB depicts the expression of HELADl in colon-cancer tissues (T) and adjacent non- cancerous mucosae (N), examined by semi-quantitative RT-PCR. Expression of GAPDH served as an internal control.
  • Figure 1C depicts the multi- tissue northern-blot analysis of HELADl in human fetal tissues. Molecular sizes are indicated in kb at the left.
  • Figures 2 A - 2C depict the sublocalization of tagged HELADl protein in COS7 cells.
  • Figure 2A depicts the expression of flag-tagged HELADl protein in COS7 cells, detected by anti-Flag antibody on Western blots.
  • Figure 2B depicts the Immunocytochemical staining of flag-tagged HELADl protein (x600). Cells transfected with pFLAG-HELADl were stained with an anti-Flag antibody and visualized by anti- mouse secondary antibody conjugated with rhodamine.
  • Figure 2C depicts the Western blot analysis of nuclear extracts from cells exogeneously expressing flag-tagged HELADl protein.
  • Figures 3 A - 3B demonstrate the helicase activity of HELADl.
  • Figure 3 A demonstrates the 5' to 3' helicase activity analyzed by incubating recombinant GST- HELAD1 protein with radiolabeled partial duplex DNA substrates. Recombinant WRN protein and GST-Axin protein served as controls.
  • Figure 3B depicts analysis of the 3' to 5' helicase activity.
  • Figure 4A - 4D depict the induction of apoptosis by amtisense S-oligonucleotides that suppress expression of HELADl.
  • Figure 4A depicts the expression of HELADl in response to antisense S-oligonucleotides (AS2, AS3) or control S-oligonucleotides (SE2, SE3) in SW480 cells, analyzed by semi-quantitative RT-PCR.
  • Figure 4B depicts the viability of SW480 cells in response to AS2, SE2, AS3 or SE3. After cells were treated with S-oligonucleotides and incubated for seven days, their viability was evaluated by MTT assay.
  • Figure 4C depicts the FACS analysis of cells transfected with either AS3 or SE3.
  • Figure 4D depicts the results of TUNEL staining of the same cells, where cells in yellow or green colors indicate apoptosis.
  • the words “a”, “an”, and “the” as used herein mean “at least one” unless otherwise specifically indicated.
  • HELADl a human gene, HELADl, whose expression is markedly elevated in colorectal cancers compared to corresponding non-cancerous colorectal tissues was isolated and identified.
  • the HELADl cDNA consists of 10,646 nucleotides that contain an open reading frame of 7,095 nucleotides (spanning residues 230-7324) as set forth in SEQ ID NO:l.
  • the open reading frame encodes a putative 2365 amino acid protein as set forth in SEQ ID NO:2.
  • the HELADl cDNA consists of 10,939 nucleotides that contain an open reading frame of 7,287 nucleotides (spanning residues 331-7617) as set forth in SEQ ID NO: 3.
  • the open reading frame encodes a putative 2429 amino acid protein as set forth in SEQ ID NO: 4.
  • the encoded protein has been named HELADl (helicase, APC downregulated 1) in view of characteristics revealed in the experiments described below.
  • the HELADl gene encodes a protein containing a CH domain at the amino- terminus and a consensus motif of AAA (ATPases associated with various cellular activities) at the carboxy-terminus, and demonstrated helicase and endonuclease activities of its product in vitro.
  • AAA ATPases associated with various cellular activities
  • the CH domains are presumed to confer an actin-binding to a variety of cytoskeletal and signalling molecules (Castresana and Saraste, 1995). Proteins containing the CH domain are categorized into three groups, (i) the fimbrin family of monometric actin-cross linking molecules which contain two actin-binding domains, (ii) diametric cross linking proteins and monometric F-actin binding proteins each of which contains one actin- binding domain, and (iii) proteins containing a single amino-terminal CH domain (Stradal et al, 1998).
  • HELADl is classified into the third group that includes calponin, a molecule involved in contraction of smooth muscle, IQGAP, a signaling molecule, and the proto-oncogene Vav.
  • HELADl is the first example that contains both CH and helicase domains, suggesting that proteins having the CH domain may exert a wide range of biological function.
  • Proteins of the AAA family were first categorized as having one or two copies of a well-conserved cassette of 230-250 amino acids encompassing Walker A and B motifs (Neuwald et al, 1999).
  • the AAA family includes regulatory components of proteases, proteasomal subunits, peroxisomal biogenesis proteins, Mg 2+ and CO 2+ chelatases, vesicle synthesis protein, dynein motor protein, and proteins involved in DNA replication, recombination, restriction, and transcription as well as sporulation in bacteria (Patel and Latterich, 1998; Neuwald et al, 1999).
  • RuvBLl a helicase homologous to RuvB of E.
  • MCM proteins which also contain AAA domains, are components of pre-replicative complexes and essential for initiating DNA replication in eukaryotes (Takisawa et al, 2000; Tye and Sawyer, 2000). MCM proteins are down-regulated in cells that are undergoing differentiation or quiescence, and are more abundantly expressed in dysplastic or malignant tissues than in normal tissues (Freeman et al, 1999). Thus, dysplastic cells may be characterized in functional terms as remaining in the cell cycle and/or accelerated DNA replication due to deregulation of normal controls over cellular proliferation.
  • HELADl Since expression of HELADl is also enhanced in colorectal cancers, it may be involved in cell cycle progression and/or DNA replication.
  • proteins containing the AAA consensus motif often possess chaperone-like functions that assist in the assembly, operation, or disassembly of protein complexes (Neuwald et al, 1999) and the hexametric architecture of helicases can provide a hole through which DNA or RNA can be threaded and assembled into DNA-protein complexes (Tye and Sawyer, 2000; Patel and Picha, 2000); hence HELADl may be able to interact with itself or other proteins. Future identification of its binding partner(s) will help us to better understand the physiological roles of this enzyme.
  • the HELADl protein revealed both helicase and exonuclease activities in a fashion similar to WRN, a protein that is more highly expressed in transformed cells and tumor cells than in normal cells (Shiratori et al, 1999). Expression of the WRN and BLM genes was examined and it was found that both were expressed more abundantly in seven of 12 colorectal cancers examined than in corresponding normal tissues (data not shown). These results suggest that colon-cancer cells might require high expression of helicases in order to survive.
  • HELADl has a distribution of HELADl expression levels among normal human tissues. whereas WRN is expressed abundantly in pancreas and placenta, and moderately in heart and skeletal muscle (Yu et al, 1996), expression of HELADl was hardly detectable in any of the adult tissues examined, although it was abundant in fetal tissues. Interestingly, HELADl shares 28% identity with unc-53 of C. elegans, overexpression of which leads to extension of growth cones along the a-p axis (Hedgecock et al, 1987; Hekimi and Kershaw, 1993).
  • HELADl in cancer cells was down-regulated by transduction of APC, whose product is essential for control of axis formation, cellular motility and differentiation (Bienz and Clevers, 2000). This data strongly suggests that expression of HELADl plays a role in morphogenesis and/or differentiation. Although HELADl has not been proven to be a direct target of the transcriptional complex of Tcf/LEF, activated HELADl may facilitate the transcription of the target genes.
  • HELADl is absent in normal colon and other adult tissues, and suppression of HELADl in cancer cells by antisense S-oligonucleotides inhibited growth of cancer cells and induced cell death.
  • HELADl can serve as a molecular marker for diagnosis of colorectal cancer as well as a molecular target for development of effective therapeutic reagents and strategies for patients with colorectal tumors.
  • the present invention encompasses the human gene HELADl, including a polynucleotide sequences as described in SEQ ID NO: 1 and SEQ ID NO:3, as well as degenerates and mutants thereof, to the extent that they encode a HELADl protein, including the amino acid sequence set forth in SEQ ID NO:2, the amino acid sequence set forth in SEQ ID NO:4 and their functional equivalents.
  • proteins functionally equivalent to HELADl include, for example, homologous proteins of other organisms corresponding to the human HELADl protein, as well as mutants of human HELADl proteins.
  • the term "functionally equivalent" means that the subject protein has nuclease activity, helicase activity or apoptosis suppressing activity.
  • nuclease activity may be determined by assaying for the degradation of a target nucleic acid, such as a DNA.
  • a target nucleic acid may be radiolabeled, and incubated with a subject protein. The degradation of the nucleic acid may then be detected by electrophoresis.
  • acid-soluble nucleotides which are released from the nucleic acid may be quantified by a scintillation counter (Sambrook, J. et al, Molecular Cloning 2nd ed. 9.47-9.58, Cold Spring Harbor Lab. Press, 1989).
  • helicase activity may be determined by assaying for the unwinding of a target duplex DNA, for example, by detecting the displacement of a radiolabeled DNA fragment from duplex- DNA substrates, as described by Suzuki et al, (1997) Nucleic Acids Res., 25, 2973-2978.
  • apoptosis suppressing activity may be determined by assaying for the induction of apoptosis or absence thereof. Specifically, apoptosis can be detected by TUNEL staining, DNA ladder detection, microscopic observation, MTT assay, or other conventional methods (Methods in Enzymology : vol. 322 p.3-15).
  • proteins functionally equivalent to a given protein are well known by a person skilled in the art and include known methods of introducing mutations into the protein.
  • one skilled in the art can prepare proteins functionally equivalent to the human HELADl protein by introducing an appropriate mutation in the amino acid sequence of the human HELADl protein by site-directed mutagenesis (Hashimoto-Gotoh, T. et al (1995), Gene 152, 271-275; Zoller, MJ, and Smith, M. (1983), Methods Enzymol. 100, 468-500; Kramer, W. et al. (1984), Nucleic Acids Res. 12, 9441- 9456; Kramer W, and Fritz HJ. (1987) Methods. Enzymol.
  • the protein of the present invention includes those proteins having the amino acid sequences of the human HELADl protein in which one or more amino acids are mutated, provided the resulting mutated proteins are functionally equivalent to the human HELADl protein.
  • the number of amino acids to be mutated in such a mutant is generally 10 amino acids or less, preferably 6 amino acids or less, and more preferably 3 amino acids or less.
  • Mutated or modified proteins proteins having amino acid sequences modified by deleting, adding and/or replacing one or more amino acid residues of a certain amino acid sequence, have been known to retain the original biological activity (Mark, D. F. et ah, Proc. Natl. Acad. Sci. USA (1984) 81, 5662-5666, Zoller, M. J. & Smith, M., Nucleic Acids Research (1982) 10, 6487-6500, Wang, A. et al, Science 224, 1431-1433, Dalbadie- McFarland, G. et al, Proc. Natl. Acad. Sci. USA (1982) 79, 6409-6413).
  • the amino acid residue to be mutated is preferably mutated into a different amino acid in which the properties of the amino acid side-chain are conserved (a process known as conservative amino acid substitution).
  • properties of amino acid side chains are hydrophobic amino acids (A, I, L, M, F, P, W, Y, V), hydrophilic amino acids (R, D, N, C, E, Q, G, H, K, S, T), and side chains having the following functional groups or characteristics in common: an aliphatic side-chain (G, A, V, L, I, P); a hydroxyl group containing side-chain (S, T, Y); a sulfur atom containing side-chain (C, M); a carboxylic acid and amide containing side-chain (D, N, E, Q); a base containing side-chain (R, K, H); and an aromatic containing side-chain (H, F, Y, W).
  • the parenthetic letters indicate the one-letter codes of amino acids.
  • a protein to which one or more amino acids residues are added to the amino acid sequence of human HELADl protein is a fusion protein containing the human HELADl protein.
  • Fusion proteins are, fusions of the human HELADl protein and other peptides or proteins, and are included in the present invention. Fusion proteins can be made by techniques well known to a person skilled in the art, such as by linking the DNA encoding the human HELADl protein of the invention with DNA encoding other peptides or proteins, so that the frames match, inserting the fusion DNA into an expression vector and expressing it in a host. There is no restriction as to the peptides or proteins fused to the protein of the present invention.
  • peptides that can be used as peptides that are fused to the protein of the present invention include, for example, FLAG (Hopp, T. P. et al, Biotechnology (1988) 6, 1204-1210), 6xHis containing six His (histidine) residues, lOxHis, Influenza agglutinin (HA), human c-myc fragment, VSP-GP fragment, pl8HIV fragment, T7-tag, HSV-tag, E- tag, SV40T antigen fragment, lck tag, ,,-tubulin fragment, B-tag, Protein C fragment, and the like.
  • Fusion proteins can be prepared by fusing commercially available DNA, encoding the fusion peptides or proteins discussed above, with the DNA encoding the protein of the present invention and expressing the fused DNA prepared.
  • An alternative method known in the art to isolate functionally equivalent proteins is, for example, the method using a hybridization technique (Sambrook, J. et al., Molecular Cloning 2nd ed. 9.47-9.58, Cold Spring Harbor Lab. Press, 1989).
  • proteins of the present invention include those that are encoded by DNA that hybridize with a whole or part of the DNA sequence encoding the human HELADl protein and are functionally equivalent to the human HELADl protein.
  • proteins include mammal homologues corresponding to the protein derived from human or mouse (for example, a protein encoded by a monkey, rat, rabbit and bovine gene).
  • isolating a cDNA highly homologous to the DNA encoding the human HELADl protein from animals it is particularly preferable to use tissues from fetal brain, fetal kidney, or colorectal tumors.
  • hybridization for isolating a DNA encoding a protein functionally equivalent to the human HELADl protein can be routinely selected by a person skilled in the art.
  • hybridization may be performed by conducting prehybridization at 68°C for 30 min or longer using "Rapid-hyb buffer" (Amersham LIFE SCIENCE), adding a labeled probe, and warming at 68°C for 1 hour or longer.
  • the following washing step can be conducted, for example, in a low stringent condition.
  • a low stringent condition is, for example, 42°C, 2X SSC, 0.1% SDS, or preferably 50°C, 2X SSC, 0.1% SDS. More preferably, high stringent conditions is used.
  • a high stringent condition is, for example, washing 3 times in 2X SSC, 0.01% SDS at room temperature for 20 min, then washing 3 times in lx SSC, 0.1% SDS at 37°C for 20 min, and washing twice in lx SSC, 0.1% SDS at 50°C for 20 min.
  • temperature and salt concentration can influence the stringency of hybridization and one skilled in the art can suitably select the factors to achieved the requisite stringency.
  • a gene amplification method for example, the polymerase chain reaction (PCR) method, can be utilized to isolate a DNA encoding a protein functionally equivalent to the human HELADl protein, using a primer synthesized based on the sequence information of the DNA (SEQ ID NO: 1 or SEQ ID NO: 3) encoding the human HELADl protein (SEQ ID NO: 2 or SEQ ED NO: 4).
  • PCR polymerase chain reaction
  • Proteins that are functionally equivalent to the human HELADl protein encoded by the DNA isolated through the above hybridization techniques or gene amplification techniques normally have a high homology to the amino acid sequence of the human HELADl protein.
  • “High homology” typically refers to a homology of 40% or higher, preferably 60% or higher, more preferably 80% or higher, even more preferably 95% or higher.
  • the homology of a protein can be determined by following the algorithm in "Wilbur, W. J. and Lipman, D. J. Proc. Natl. Acad. Sci. USA (1983) 80, 726-730".
  • a protein useful in the context of the present invention may have variations in amino acid sequence, molecular weight, isoelectric point, the presence or absence of sugar chains, or form, depending on the cell or host used to produce it or the purification method utilized. Nevertheless, so long as it has a function equivalent to that of a human HELADl protein of the present invention (SEQ ID NO: 2 or SEQ ID NO: 4), it is within the scope of the present invention.
  • the proteins useful in the context of the present invention can be prepared as recombinant proteins or natural proteins, by methods well known to those skilled in the art.
  • a recombinant protein can be prepared by inserting a DNA , which encodes the protein of the present invention (for example, the DNA comprising the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 3), into an appropriate expression vector, introducing the vector into an appropriate host cell, obtaining the extract, and purifying the protein by subjecting the extract to chromatography, for example, ion exchange chromatography, reverse phase chromatography, gel filtration, or affinity chromatography utilizing a column to which antibodies against the protein of the present invention is fixed, or by combining more than one of aforementioned columns.
  • chromatography for example, ion exchange chromatography, reverse phase chromatography, gel filtration, or affinity chromatography utilizing a column to which antibodies against the protein of the present invention is fixed, or by combining more than one of aforementioned columns.
  • the protein useful in the context of the present invention is expressed within host cells (for example, animal cells and E. coli) as a fusion protein with glutathione-S-transferase protein or as a recombinant protein supplemented with multiple histidines
  • the expressed recombinant protein can be purified using a glutathione column or nickel column.
  • a natural protein can be isolated by methods known to a person skilled in the art, for example, by contacting the affinity column, in which antibodies binding to the HELADl protein described below are bound, with the extract of tissues or cells expressing the protein of the present invention.
  • the antibodies can be polyclonal antibodies or a monoclonal antibodies.
  • the present invention also encompasses the use of partial peptides of a protein of the present invention.
  • a partial peptide has an amino acid sequence specific to the protein of the present invention and consists of at least 7 amino acids, preferably 8 amino acids or more, and more preferably 9 amino acids or more.
  • the partial peptide can be used, for example, for preparing antibodies against a protein of the present invention, screening for a compound that binds to the protein of the present invention, and screening for accelerators or inhibitors of the protein of the present invention.
  • a partial peptide of the invention can be produced by genetic engineering, by known methods of peptide synthesis, or by digesting the protein of the invention with an appropriate peptidase.
  • peptide synthesis for example, solid phase synthesis or liquid phase synthesis may be used.
  • the isolated HELADl protein includes an AAA domain that shows 3' to 5' helicase activity and exonuclease activity in vitro.
  • helicases are known to play crucial roles in biological processes such as DNA replication, DNA repair, and transcription. Inactivation of helicases has been implicated in many human disorders; likewise, the over-expression of helicases is seen in certain cancers.
  • the AAA domain is significant to the function of HELADl. Therefore, the partial peptide of HELADl preferably includes the AAA domain.
  • the present invention provides DNA encoding proteins useful in the context of the present invention.
  • the DNA provided by the present invention can be used for the in vivo or in vitro production of a protein of the present invention as described above, or can be applied to gene therapy for diseases attributed to genetic abnormality in the gene encoding a protein of the present invention.
  • Any form of a DNA of the present invention can be used, so long as it encodes a protein of the present invention.
  • cDNA synthesized from the mRNA, genomic DNA, and chemically synthesized DNA can be used.
  • the DNA of the present invention include a DNA comprising a given nucleotide sequences as well as its degenerate sequences, so long as the resulting DNA encodes a protein of the present invention.
  • the DNA of the present invention can be prepared by methods known to a person skilled in the art.
  • the DNA of the present invention can be prepared by: preparing a cDNA library from cells which express a protein of the present invention, and conducting hybridization using a partial sequence of the DNA of the present invention (for example, SEQ ID NO: 1 or SEQ ID NO: 3) as a probe.
  • a cDNA library can be prepared, for example, by the method described in Sambrook J. et al, Molecular Cloning, Cold Spring Harbor Laboratory Press (1989); alternatively, commercially available cDNA libraries may be used.
  • a cDNA library can be also prepared by: extracting RNAs from cells expressing the protein of the present invention, synthesizing oligo DNAs based on the sequence of the DNA of the present invention (for example, SEQ ID NO: 1 or SEQ ID NO: 3), conducting PCR by using the oligos as primers, and amplifying cDNAs encoding the protein of the present invention.
  • the translation region encoded by the cDNA can be routinely determined, and the amino acid sequence of a protein of the present invention can be easily obtained.
  • the genomic DNA can be isolated.
  • mRNAs may first be prepared from a cell, tissue, or organ (for example, fetal brain, fetal kidney, or colorectal tumors, etc.) in which a protein of the invention is expressed.
  • a cell, tissue, or organ for example, fetal brain, fetal kidney, or colorectal tumors, etc.
  • Known methods can be used to isolate mRNAs; for instance, total RNA may be prepared by guanidine ultracentrifugation (Chirgwin J. M. et al. Biochemistry 18:5294-5299 (1979)) or AGPC method (Chomczynski P. and Sacchi N. Anal. Biochem. 162:156-159 (1987)).
  • mRNA may be purified from total RNA using mRNA Purification Kit (Pharmacia) and such or, alternatively, mRNA may be directly purified by QuickPrep mRNA Purification Kit (Pharmacia).
  • cDNA may be synthesized by using a commercially available kit, such as the AMV Reverse Transcriptase First-strand cDNA Synthesis Kit (Seikagaku Kogyo).
  • cDNA may be synthesized and amplified following the 5 '-RACE method(Frohman M. A. et al. Proc. Natl. Acad. Sci. U.S.A. 85:8998-9002 (1988); Belyavsky A. et al Nucleic Acids Res. 17:2919-2932 (1989)), which uses a primer and such, described herein, the 5'- Ampli FINDER RACE Kit (Clontech), and polymerase chain reaction (PCR).
  • 5 '-RACE method Frohman M. A. et al. Proc. Natl. Acad. Sci. U.S.A. 85:8998-9002 (1988); Belyavsky A. et al Nucleic Acids Res. 17:29
  • a desired DNA fragment is prepared from the PCR products and ligated with a vector DNA.
  • the recombinant vectors are used to transform E. coli and such, and a desired recombinant vector is prepared from a selected colony.
  • the nucleotide sequence of the desired DNA can be verified by conventional methods, such as dideoxynucleotide chain termination.
  • the nucleotide sequence of a DNA of the invention may be designed to be expressed more efficiently by taking into account the frequency of codon usage in the host to be used for expression (Grantham R. et a Nucleic Acids Res. 9:43-74 (1981)).
  • the DNA of the present invention may be altered by a commercially available kit or a conventional method. For instance, the DNA may be altered by digestion with restriction enzymes, insertion of a synthetic oligonucleotide or an appropriate DNA fragment, addition of a linker, or insertion of the initiation codon (ATG) and/or the stop codon (TAA, TGA, or TAG).
  • a DNA of the present invention preferably encompasses DNA comprising the nucleotide sequence encoding the AAA domain of the protein of SEQ ID NO: 2 or the protein of SEQ ID NO: 4.
  • the AAA ('ATPases 'Associated with diverse cellular 'Activities) domain is an ATP-binding site of a large family of ATPases, which share a conserved region of about 220 amino acids.
  • AAA domains act as ATP-dependent protein clamps (Neuwald AF, et al, Genome Res 9 (1999): 27-43; Lenzen, CU, et al, Cell 94 (1998): 525-36; Patel, S, et al, Trends Cell Biol 8 (1998): 65-71; Confalonieri F, and Duguet M. (1995) Bioessays 17(7):639-50).
  • the AAA domain of the HELADl protein of SEQ ID NO: 2 starts at position 2026 and ends at position 2180 of SEQ ID NO: 2.
  • the AAA domain of HELADl protein of SEQ ID NO: 4 starts at position 2090 and ends at position 2244 of SEQ ID NO:4.
  • the AAA domain can be identified, for example, using Simple Modular Architecture Research Tool (SMART) (Schultz et al (1998) Proc. Natl. Acad. Sci. USA 95, 5857-5864; Letunic et al (2002) Nucleic Acids Res 30, 242-244; Schultz, J. et al (2000) Nucleic Acids Res, 28, 231-234; Copley, R.R. et al (1999) Curr Opin Struct Biol, 9, 408-415; Ponting, C.P.
  • SMART Simple Modular Architecture Research Tool
  • the E-value calculated using Hidden Markov Models for the identified AAA domain may be lxlO "2 or lower, preferably lxlO "3 or lower, even more preferably lxlO "4 or lower.
  • the present invention provides a DNA that hybridizes under stringent conditions with a DNA having a nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 3, and encodes a protein functionally equivalent to a protein useful in the context of the invention as described above.
  • stringent conditions For example, low stringent condition can be used. More preferably, high stringent condition can be used. These conditions are the same as that described above.
  • the hybridizing DNA above is preferably a cDNA or a chromosomal DNA.
  • the present invention also provides a vector into which a DNA of the present invention is inserted.
  • a vector of the present invention is useful to keep a DNA of the present invention in host cell, or to express the protein of the present invention.
  • E. coli is the host cell and the vector is amplified and produced in a large amount in E. coli (e.g., JM109, DH5 suitcase, HB101, or XLlBlue)
  • the vector should have "ori" to be amplified in E. coli and a marker gene for selecting transformed E. coli (e.g., a drug- resistance gene selected by a drug such as ampicillin, tetracycline, kanamycin, chloramphenicol or the like).
  • M13-series vectors for example, M13-series vectors, pUC-series vectors, pBR322, pBluescript, pCR-Script, etc. can be used.
  • pG ⁇ M-T, pDIR ⁇ CT, and pT7 can also be used for subcloning and extracting cDNA as well as the vectors described above.
  • an expression vector is especially useful.
  • an expression vector to be expressed in E. coli should have the above characteristics to be amplified in E. coli.
  • the vector should have a promoter, for example, lacZ promoter (Ward et al., Nature (1989) 341,
  • T7 promoter or the like that can efficiently express the desired gene in E. coli.
  • pG ⁇ X-5X-l Pulacia
  • QIAexpress system Qiagen
  • pEGFP pEGFP
  • pET in this case, the host is preferably BL21 which expresses T7 RNA polymerase,for example, can be used instead of the above vectors.
  • the vector may also contain a signal sequence for polypeptide secretion.
  • An exemplary signal sequence that directs the protein to be secreted to the periplasm of the E. coli is the pelB signal sequence (Lei, S. P. et al J. Bacteriol. (1987) 169, 4379).
  • Means for introducing of the vectors into the target host cells include, for example, the calcium chloride method, and the electroporation method.
  • expression vectors derived from mammals for example, pcDNA3 (Invitrogen) and pEGF-BOS (Nucleic Acids. Res. 1990, 18 (17), p5322), pEF, pCDM8), expression vectors derived from insect cells (for example, "Bac-to- BAC baculovirus expression system” (GIBCO BRL), pBacPAK ⁇ ), expression vectors derived from plants (for example pMHl, pMH2), expression vectors derived from animal viruses (for example, pHSV, pMV, pAdexLcw), expression vectors derived from retroviruses (for example, pZIpneo), expression vector derived from yeast (for example, "Pichia Expression Kit” (Invitrogen), pNVll, SP-Q01), and expression vectors derived from Bacillus subtilis (for example, pPL608, pKTH50) can be used for producing the protein of mammals (for example, pcDNA3 (
  • the vector In order to express the vector in animal cells, such as CHO, COS, or NIH3T3 cells, the vector should have a promoter necessary for expression in such cells, for example, the SV40 promoter (Mulligan et al, Nature (1979) 277, 108), the MMLV-LTR promoter, the EF1 relaxing promoter (Mizushima et al, Nucleic Acids Res. (1990) 18, 5322), the CMV promoter, and the like, and preferably a marker gene for selecting transformants (for example, a drug resistance gene selected by a drug (e.g., neomycin, G418)).
  • a promoter necessary for expression in such cells for example, the SV40 promoter (Mulligan et al, Nature (1979) 277, 108), the MMLV-LTR promoter, the EF1 relaxing promoter (Mizushima et al, Nucleic Acids Res. (1990) 18, 5322), the CMV
  • a vector comprising the complementary DHFR gene may be introduced into CHO cells in which the nucleic acid synthesizing pathway is deleted, and then amplified by methotrexate (MTX).
  • MTX methotrexate
  • the method wherein a vector comprising a replication origin of SV40 (pcD, etc.) is transformed into COS cells comprising the SV40 T antigen expressing gene on the chromosome can be used.
  • a protein useful in the context of the present invention obtained as above may be isolated from inside or outside (such as medium) of host cells, and purified as a substantially pure homogeneous protein.
  • substantially pure as used herein in reference to a given polypeptide means that the polypeptide is substantially free from other biological macromolecules.
  • the substantially pure polypeptide is at least 75% (e.g., at least 80, 85, 95, or 99%) pure by dry weight. Purity can be measured by any appropriate standard method, for example by column chromatography, polyacrylamide gel electrophoresis, or HPLC analysis. The method for protein isolation and purification is not limited to any specific method; in fact, any standard method may be used.
  • column chromatography filter, ultrafiltration, salt precipitation, solvent precipitation, solvent extraction, distillation, immunoprecipitation, SDS- polyacrylamide gel electrophoresis, isoelectric point electrophoresis, dialysis, and recrystallization may be appropriately selected and combined to isolate and purify the protein.
  • chromatography include, for example, affinity chromatography, ion- exchange chromatography, hydrophobic chromatography, gel filtration, reverse phase chromatography, adsorption chromatography, and such (Strategies for Protein Purification and Characterization: A Laboratory Course Manual. Ed. Daniel R. Marshak et al, Cold Spring Harbor Laboratory Press (1996)).
  • chromatographies may be performed by liquid chromatography, such as HPLC and FPLC.
  • the present invention provides for highly purified proteins prepared by the above methods.
  • a protein useful in the context of the present invention may be optionally modified or partially deleted by treating it with an appropriate protein modification enzyme before or after purification.
  • useful protein modification enzymes include, but are not limited to, trypsin, chymotrypsin, lysylendopeptidase, protein kinase, glucosidase and so on.
  • the present invention further provides an antibody that binds to a protein of the present invention.
  • the antibody of the invention can be used in any form, such as monoclonal or polyclonal antibodies, and includes antiserum obtained by immunizing an animal such as a rabbit with the protein of the invention, all classes of polyclonal and monoclonal antibodies, human antibodies, and humanized antibodies produced by genetic recombination.
  • a protein of the invention used as an antigen to obtain an antibody may be derived from any animal species, but preferably is derived from a mammal such as a human, mouse, or rat, more preferably from a human.
  • a human-derived protein may be obtained from the nucleotide or amino acid sequences disclosed herein.
  • a protein to be used as an immunization antigen may be a complete protein or a partial peptide of the protein.
  • a partial peptide may comprise, for example, the amino (N)-terminal or carboxy (C)-terminal fragment of a protein of the present invention.
  • an antibody is defined as a protein that reacts with either the full length or a fragment of a protein of the present invention.
  • a gene encoding a protein of the invention or its fragment may be inserted into a known expression vector, which is then used to transform a host cell as described herein.
  • the desired protein or its fragment may be recovered from the outside or inside of host cells by any standard method, and may subsequently be used as an antigen.
  • whole cells expressing the protein or their lysates, or a chemically synthesized protein may be used as the antigen.
  • Any mammalian animal may be immunized with the antigen, but preferably the compatibility with parental cells used for cell fusion is taken into account.
  • animals of Rodentia, Lagomorpha, or Primates are used.
  • Animals of Rodentia include, for example, mouse, rat, and hamster.
  • Animals of Rodentia include, for example, mouse, rat, and hamster.
  • Lagomorpha include, for example, rabbit.
  • Animals of Primates include, for example, a monkey of Catarrhini (old world monkey) such as Macaca fascicularis , rhesus monkey, sacred baboon, and chimpanzees.
  • antigens may be diluted and suspended in an appropriate amount of phosphate buffered saline (PBS), physiological saline, etc.
  • PBS phosphate buffered saline
  • the antigen suspension may be mixed with an appropriate amount of a standard adjuvant, such as Freund's complete adjuvant, made into emulsion, and then administered to mammalian animals.
  • a standard adjuvant such as Freund's complete adjuvant
  • it is followed by several administrations of antigen mixed with an appropriately amount of Freund's incomplete adjuvant every 4 to 21 days.
  • An appropriate carrier may also be used for immunization. After immunization as above, serum is examined by a standard method for an increase in the amount of desired antibodies.
  • Polyclonal antibodies against proteins of the present invention may be prepared by collecting blood from the immunized mammal examined for the increase of desired antibodies in the serum, and by separating serum from the blood by any conventional method.
  • Polyclonal antibodies include serum containing the polyclonal antibodies, as well as the fraction containing the polyclonal antibodies may be isolated from the serum.
  • Immunoglobulin G or M can be prepared from a fraction which recognizes only the protein of the present invention using, for example, an affinity column coupled with the protein of the present invention, and further purifying this fraction by using protein A or protein G column.
  • immune cells are collected from the mammal immunized with the antigen and checked for the increased level of desired antibodies in the serum as described above, and are subjected to cell fusion.
  • the immune cells used for cell fusion are preferably obtained from spleen.
  • Other preferred parental cells to be fused with the above immunocyte include, for example, myeloma cells of mammalians, and more preferably myeloma cells having an acquired property for the selection of fused cells by drugs.
  • the above immunocyte and myeloma cells can be fused according to known methods, for example, the method of Milstein et al (Galfre, G. and Milstein, C, Methods
  • Resulting hybridomas obtained by the cell fusion may be selected by cultivating them in a standard selection medium, such as HAT medium (hypoxanthine, aminopterin, and thymidine containing medium).
  • HAT medium hyperxanthine, aminopterin, and thymidine containing medium.
  • the cell culture is typically continued in the HAT medium for several days to several weeks, the time being sufficient to allow all the other cells, with the exception of the desired hybridoma (non-fused cells), to die. Then, the standard limiting dilution is performed to screen and clone a hybridoma cell producing the desired antibody.
  • human lymphocytes such as those infected by EB virus may be immunized with a protein, protein expressing cells, or their lysates in vitro. Then, the immunized lymphocytes are fused with human-derived myeloma cells that are capable of indefinitely dividing, such as U266, to yield a hybridoma producing a desired human antibody that is able to bind to the protein can be obtained (Unexamined Published Japanese Patent Application No. (JP-A) Sho 63-17688).
  • JP-A Japanese Patent Application No.
  • the obtained hybridomas are subsequently transplanted into the abdominal cavity of a mouse and the ascites are extracted.
  • the obtained monoclonal antibodies can be purified by, for example, ammonium sulfate precipitation, a protein A or protein G column, DEAE ion exchange chromatography, or an affinity column to which the protein of the present invention is coupled.
  • the antibody of the present invention can be used not only for purification and detection of the protein of the present invention, but also as a candidate for antagonists of the protein of the present invention.
  • this antibody can be applied to the antibody treatment for diseases related to the protein of the present invention.
  • a human antibody or a humanized antibody is preferable for reducing immunogenicity.
  • transgenic animals having a repertory of human antibody genes may be immunized with an antigen selected from a protein, protein expressing cells, or their lysates.
  • Antibody producing cells are then collected from the animals and fused with myeloma cells to obtain hybridoma, from which human antibodies against the protein can be prepared (see WO92-03918, WO93-2227, WO94-02602, WO94-25585, WO96-33735, and WO96-34096).
  • an immune cell such as an immunized lymphocyte
  • producing antibodies may be immortalized by an oncogene and used for preparing monoclonal antibodies.
  • Monoclonal antibodies thus obtained can be also recombinantly prepared using genetic engineering techniques (see, for example, Borrebaeck C. A. K. and Larrick J. W. Therapeutic Monoclonal Antibodies, published in the United Kingdom by MacMillan Publishers LTD (1990)).
  • a DNA encoding an antibody may be cloned from an immune cell, such as a hybridoma or an immunized lymphocyte producing the antibody, inserted into an appropriate vector, and introduced into host cells to prepare a recombinant antibody.
  • the present invention also provides recombinant antibodies prepared as described above.
  • an antibody of the present invention may be a fragment of an antibody or modified antibody, so long as it binds to one or more of the proteins of the invention.
  • the antibody fragment may be Fab, F(ab') 2 , Fv, or single chain Fv (scFv), in which Fv fragments from H and L chains are ligated by an appropriate linker (Huston J. S. et al Proc. Natl. Acad. Sci. U.S.A. 85:5879-5883 (1988)).
  • an antibody fragment may be generated by treating an antibody with an enzyme, such as papain or pepsin.
  • a gene encoding the antibody fragment may be constructed, inserted into an expression vector, and expressed in an appropriate host cell (see, for example, Co M. S. et al. J. Immunol. 152:2968-2976 (1994); Better M. and Horwitz A. H. Methods Enzymol. 178:476-496 (1989); Pluckthun A. and Skerra A. Methods Enzymol. 178:497-515 (1989); Lamoyi E. Methods Enzymol. 121:652-663 (1986); Rousseaux J. et al Methods Enzymol. 121:663-669 (1986); Bird R. E. and Walker B. W. Trends Biotechnol. 9:132-137 (1991)).
  • An antibody may be modified by conjugation with a variety of molecules, such as polyethylene glycol (PEG).
  • PEG polyethylene glycol
  • the present invention provides for such modified antibodies.
  • the modified antibody can be obtained by chemically modifying an antibody. These modification methods are conventional in
  • an antibody of the present invention may be obtained as a chimeric antibody, between a variable region derived from nonhuman antibody and the constant region derived from human antibody, or as a humanized antibody, comprising the complementarity determining region (CDR) derived from nonhuman antibody, the frame work region (FR) derived from human antibody, and the constant region.
  • CDR complementarity determining region
  • FR frame work region
  • Such antibodies can be prepared by using known technology.
  • Antibodies obtained as above may be purified to homogeneity. For example, the separation and purification of the antibody can be performed according to separation and purification methods used for general proteins.
  • the antibody may be separated and isolated by the appropriately selected and combined use of column chromatographies, such as affinity chromatography, filter, ultrafiltration, salting-out, dialysis, SDS polyacrylamide gel electrophoresis, isoelectric focusing, and others (Antibodies: A Laboratory Manual. Ed Harlow and David Lane, Cold Spring Harbor Laboratory, 1988), but are not limited thereto.
  • column chromatographies such as affinity chromatography, filter, ultrafiltration, salting-out, dialysis, SDS polyacrylamide gel electrophoresis, isoelectric focusing, and others
  • a protein A column and protein G column can be used as the affinity column.
  • Exemplary protein A columns to be used include, for example, Hyper D, POROS, and Sepharose F.F. (Pharmacia).
  • Exemplary chromatography with the exception of affinity includes, for example, ion-exchange chromatography, hydrophobic chromatography, gel filtration, reverse-phase chromatography, adsorption chromatography, and the like (Strategies for Protein Purification and Characterization: A Laboratory Course Manual. Ed Daniel R. Marshak et al, Cold Spring Harbor Laboratory Press, 1996).
  • the chromatographic procedures can be carried out by liquid-phase chromatography, such as HPLC, FPLC.
  • ELISA enzyme-linked immunosorbent assay
  • EIA enzyme immunoassay
  • RIA radioimmunoassay
  • immunofiuorescence may be used to measure the antigen binding activity of the antibody of the invention.
  • the antibody of the present invention is immobilized on a plate, protein of the invention is applied to the plate, and then a sample containing a desired antibody, such as culture supernatant of antibody producing cells or purified antibodies, is applied. Then, a secondary antibody that recognizes the primary antibody and is labeled with an enzyme, such as alkaline phosphatase, is applied, and the plate is incubated.
  • a desired antibody such as culture supernatant of antibody producing cells or purified antibodies
  • an enzyme substrate such as >-nitrophenyl phosphate
  • the absorbance is measured to evaluate the antigen binding activity of the sample.
  • a fragment of the protein such as a C-terminal or N-terminal fragment, may be used as a protein.
  • BIAcore Pharmacia
  • the above methods allow for the detection or measurement of the protein of the invention, by exposing the antibody of the invention to a sample assumed to contain the protein of the invention, and detecting or measuring the immune complex formed by the antibody and the protein.
  • the method of detection or measurement of the protein according to the invention can specifically detect or measure a protein, the method may be useful in a variety of experiments in which the protein is used.
  • the present invention also relates to a method of inducing anti-tumor immunity comprising a step of administering HELADl protein or an immunologically active fragment thereof, or nucleic acids encoding any one of the protein and the fragments thereof.
  • the HELADl protein or the immunologically active fragments thereof are useful as vaccines against colon cancers.
  • vaccine against cancer refers to a substance that has the effect of inducing anti-tumor immunity when it is inoculated upon animals.
  • anti-tumor immunity includes immune responses such as the following: induction of cytotoxic lymphocytes against tumors, - induction of antibodies that recognize tumors, and induction of anti-tumor cytokine production.
  • the protein when inoculation of a certain protein into an animal induces any one of these immune responses, the protein is said to have anti-tumor immunity inducing effect.
  • the induction of the anti-tumor immunity by a protein can be detected by observing the response of the immune system in the host against the protein in vivo or in vitro.
  • a method for detecting the induction of cytotoxic T lymphocytes is well known.
  • a foreign substance that enters the living body is presented to T cells and B cells by the action of antigen presenting cells (APCs).
  • T cells that respond to the antigen presented by APC in antigen specific manner differentiate into cytotoxic T cells (or cytotoxic T lymphocytes; CTLs) due to stimulation by the antigen, and then proliferate (this is referred to as activation of T cells). Therefore, CTL induction by a certain peptide can be evaluated by presenting the peptide to T cell by APC, and detecting induction of CTL. Furthermore, APC has the effect of activating CD4+ T cells such as macrophages, eosinophils, and NK cells. Since CD4+ T cells are also important in anti-tumor immunity, the anti-tumor immunity inducing action of the peptide can be evaluated using the activation effect of these cells as indicators.
  • DC dendritic cells
  • APC dendritic cells
  • DC is a representative APC having the strongest CTL inducing action.
  • the test polypeptide is initially contacted with DC, and then this DC is contacted with T cells. Detection of T cells having cytotoxic effects against the cells of interest after contacting with DC shows that the test polypeptide has an activity of inducing the cytotoxic T cells.
  • Activity of CTL against tumors can be detected, for example, using the lysis of 51 Cr-labeled tumor cells as the indicator.
  • the method of evaluating the degree of tumor cell damage using 3 H-thymidine uptake activity or LDH (lactose dehydrogenase)-release as the indicator is also well known.
  • APC is not limited to DC, and peripheral blood mononuclear cells (PBMCs) may be used.
  • PBMCs peripheral blood mononuclear cells
  • CTL has been shown to be induced by culturing PBMC in the presence of keyhole limpet hemocyanin (KLH) and IL-7.
  • KLH keyhole limpet hemocyanin
  • test polypeptides confirmed to possess CTL inducing activity by these methods are polypeptides having DC activation effect and subsequent CTL inducing activity. Therefore, polypeptides that induce CTL against tumor cells are useful as vaccines against tumors. Furthermore, APC that acquired the ability to induce CTL against tumors by contacting with the polypeptides are useful as vaccines against tumors. Furthermore, CTL that acquired cytotoxicity due to presentation of the polypeptide antigens by APC can be also used as vaccines against tumors. Such therapeutic methods for tumors using anti-tumor immunity due to APC and CTL are referred to as cellular immunotherapy.
  • induction of anti-tumor immunity by a polypeptide can be confirmed by observing the induction of antibody production against tumors. For example, when antibodies against a polypeptide are induced in a laboratory animal immunized with the polypeptide, and when growth of tumor cells is suppressed by those antibodies, the polypeptide has the ability to induce anti-tumor immunity.
  • Anti-tumor immunity is induced by administering the vaccine of this invention, and this enables treatment and prevention of colon cancer.
  • Therapy against cancer, or effect of preventing the onset of cancer may be any one of the following steps, such as inhibitory activity against growth of cancerous cells, involution of cancer, and suppression of occurrence of cancer. Otherwise, it may be decrease of mortality of individuals having cancer, decrease of tumor markers in the blood, alleviation of detectable symptoms accompanying cancer, or such.
  • Such effects are preferably statistically significant, for example, observation, at a significance level of 5% or less, of therapeutic effect against colon cancer, or preventive effect against cancer onset compared to a control to which the vaccine was not administered is preferred.
  • Student's t-test, the Mann- Whitney U-test, or ANOVA may be used for statistical analyses.
  • the above-mentioned protein having immunological activity or a vector encoding the protein may be combined with an adjuvant.
  • An adjuvant refers to a compound that enhances the immune response against the protein when administered together (or successively) with the protein having immunological activity.
  • adjuvants include cholera toxin, salmonella toxin, alum, and such, but are not limited thereto.
  • the vaccine of this invention may be combined appropriately with a pharmaceutically acceptable carrier. Examples of such carriers are sterilized water, physiological saline, phosphate buffer, culture fluid, and such. Furthermore, it may contain as necessary, stabilizers, suspensions, preservatives, surfactants, and such.
  • the vaccine is administered systemically or locally. Vaccine administration may be by single administration, or boosted by multiple administrations.
  • tumors can be treated or prevented, for example, by the ex vivo method. More specifically, PBMCs of the subject receiving treatment or prevention are collected, the cells are contacted with the polypeptide ex vivo, and after inducing APC or CTL, the cells can be administered to the subject.
  • APC can be also induced by introducing a vector encoding the polypeptide into PBMCs ex vivo- APC or CTL induced in vitro can be cloned prior to administration. By cloning and growing cells which have high activity of damaging target cells, cellular immunotherapy can be performed more effectively.
  • APC and CTL isolated in this manner may be used for cellular immunotherapy not only against individuals from whom the cells are derived, but also against similar types of tumors from other individuals.
  • the present invention also provides a polynucleotide which hybridizes with the DNA encoding human HELADl protein (SEQ ID NO:l or SEQ ID NO: 3) or the complementary strand thereof, and which comprises at least 15 nucleotides.
  • the polynucleotide of the present invention is preferably a polynucleotide which specifically hybridizes with the DNA encoding the protein of the present invention.
  • the term "specifically hybridize” as used herein, means that cross-hybridization does not occur significantly with DNA encoding other proteins, under the usual hybridizing conditions, preferably under stringent hybridizing conditions.
  • Such polynucleotides include, probes, primers, nucleotides and nucleotide derivatives (for example, antisense oligonucleotides and ribozymes), which specifically hybridize with DNA encoding the protein of the invention or its complementary strand. Moreover, such polynucleotide can be utilized for the preparation of DNA chip.
  • the present invention includes an antisense oligonucleotide that hybridizes with any site within the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 3.
  • This antisense oligonucleotide is preferably against at least 15 continuous nucleotides of the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 3.
  • the above-mentioned antisense oligonucleotide which contains an initiation codon in the above-mentioned at least 15 continuous nucleotides, is even more preferred.
  • An example of an antisense molecule of the present invention is one having at least 15 continuous nucleotides of SEQ ID NO: 20. Further examples are set forth in the EXAMPLES below and include, but are not limited to, the oligonucleotides set forth in SEQ. ID. NOS. 16 and 17.
  • Derivatives or modified products of antisense oligonucleotides can be used as antisense oligonucleotides.
  • modified products include lower alkyl phosphonate modifications such as methyl-phosphonate-type or ethyl-phosphonate-type, phosphorothioate modifications and phosphoroamidate modifications.
  • antisense oligonucleotides means, not only those in which the nucleotides corresponding to those constituting a specified region of a DNA or mRNA are entirely complementary, but also those having a mismatch of one or more nucleotides, as long as the DNA or mRNA and the antisense oligonucleotide can specifically hybridize with the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 3.
  • Such polynucleotides are contained as those having, in the "at least 15 continuous nucleotide sequence region", a homology of at least 70% or higher, preferably at 80% or higher, more preferably 90% or higher, even more preferably 95% or higher.
  • the algorithm stated herein can be used to determine the homology.
  • Such polynucleotides are useful as probes for the isolation or detection of DNA encoding the protein of the invention as stated in a later example or as a primer used for amplifications.
  • the antisense oligonucleotide derivatives of the present invention act upon cells producing the protein of the invention by binding to the DNA or mRNA encoding the protein, inhibiting its transcription or translation, promoting the degradation of the mRNA, and inhibiting the expression of the protein of the invention, thereby resulting in the inhibition of the protein's function.
  • An antisense oligonucleotide derivative of the present invention can be made into an external preparation, such as a liniment or a poultice, by mixing with a suitable base material which is inactive against the derivatives.
  • the derivatives can be formulated into tablets, powders, granules, capsules, liposome capsules, injections, solutions, nose-drops and freeze-drying agents by adding excipients, isotonic agents, solubilizers, stabilizers, preservatives, pain-killers, and such. These can be prepared by following usual methods.
  • the antisense oligonucleotide derivative is given to the patient by directly applying onto the ailing site or by injecting into a blood vessel so that it will reach the site of ailment.
  • An antisense-mounting medium can also be used to increase durability and membrane- permeability. Examples are, liposome, poly-L-lysine, lipid, cholesterol, lipofectin or derivatives of these.
  • the dosage of the antisense oligonucleotide derivative of the present invention can be adjusted suitably according to the patient's condition and used in desired amounts. For example, a dose range of 0.1 to 100 mg/kg, preferably 0.1 to 50 mg/kg can be administered.
  • the antisense oligonucleotide of the invention inhibits the expression of the protein of the invention and is thereby useful for suppressing the biological activity of the protein of the invention.
  • expression-inhibitors, comprising the antisense oligonucleotide of the invention are useful in the point that they can inhibit the biological activity of the protein of the invention. Screening Methods
  • the present invention provides a method of screening for a compound that binds to a protein of the present invention by using a protein of the present invention.
  • This screening method comprises the steps of: (a) contacting a protein of the present invention or a partial peptide thereof with a subject sample, (b) detecting the binding activity between the protein of the present invention or the partial peptide thereof and the subject sample, and (c) selecting a compound that binds to the protein of the present invention or the partial peptide thereof.
  • the protein of the present invention to be used for screening may be a recombinant protein or a protein derived from the nature, or a partial peptide thereof.
  • Any subject sample for example, cell extracts, cell culture supernatant, products of fermenting microorganism, extracts from marine organism, plant extracts, purified or crude proteins, peptides, non-peptide compounds, synthetic micromolecular compounds and natural compounds, can be used.
  • the protein of the present invention to be contacted with a subject sample can be, for example, a purified protein, a soluble protein, a form bound to a carrier, or a fusion protein fused with other proteins.
  • a method of screening for proteins for example, that bind to a protein of the present invention using a protein of the present invention
  • many methods well known by a person skilled in the art can be used.
  • Such a screening can be conducted by, for example, immunoprecipitation method, specifically, in the following manner.
  • the gene encoding the protein of the present invention is expressed in animal cells and so on by inserting the gene to an expression vector for foreign genes, such as pSV2neo, pcDNA I, and pCD8.
  • the promoter to be used for the expression may be any promoter that can be used commonly and include, for example, the SV40 early promoter (Rigby in Williamson (ed.), Genetic Engineering, vol. 3. Academic Press, London, p.
  • the EF-1 gentle promoter (Kim et al, Gene 91, p217-223 (1990)), the CAG promoter (Niwa et al Gene 108, p. 193-200 (1991)), the RSV LTR promoter (Cullen Methods in Enzymology 152, p. 684-704 (1987)) the SR formula promoter (Takebe et al, Mol. Cell. Biol._8, p. 466 (1988), the CMV immediate early promoter (Seed and Aruffo Proc. Natl. Acad. Sci. USA 84, p. 3365- 3369 (1987)), the SV40 late promoter (Gheysen and Fiers J. Mol. Appl.
  • the introduction of the gene into animal cells to express a foreign gene can be performed according to any methods, for example, the electroporation method (Chu G. et al Nucl. Acids Res. 15, 1311-1326 (1987)), the calcium phosphate method (Chen, C and Okayama, H. Mol. Cell. Biol. 7, 2745-2752 (1987)), the DEAE dextran method (Lopata, M. A. et al Nucl. Acids Res.
  • a protein of the present invention can be expressed as a fusion protein comprising a recognition site (epitope) of a monoclonal antibody by introducing the epitope of the monoclonal antibody, whose specificity has been revealed, to the N- or C- terminus of the protein of the present invention.
  • a commercially available epitope-antibody system can be used (Experimental Medicine 13, 85-90 (1995)).
  • Vectors which can express a fusion protein with, for example, ,,-galactosidase, maltose binding protein, glutathione S-transferase, green florescence protein (GFP) and so on by the use of its multiple cloning sites are commercially available.
  • GFP green florescence protein
  • Epitopes such as polyhistidine (His-tag), influenza aggregate HA, human c-myc, FLAG, Vesicular stomatitis virus glycoprotein (VSV-GP), T7 gene 10 protein (T7-tag), human simple herpes virus glycoprotein (HSV- tag), E-tag (an epitope on monoclonal phage), and such, and monoclonal antibodies recognizing them can be used as the epitope-antibody system for screening proteins binding to the protein of the present invention (Experimental Medicine 13, 85-90 (1995)).
  • His-tag polyhistidine
  • influenza aggregate HA human c-myc
  • FLAG Vesicular stomatitis virus glycoprotein
  • VSV-GP Vesicular stomatitis virus glycoprotein
  • T7-tag T7 gene 10 protein
  • HSV-tag human simple herpes virus glycoprotein
  • E-tag an epitope on monoclonal phage
  • an immune complex is formed by adding these antibodies to cell lysate prepared by using an appropriate detergent.
  • the immune complex consists of the protein of the present invention, a protein comprising the binding ability with the protein, and an antibody. Immunoprecipitation can be also conducted by using antibodies against the protein of the present invention, besides using antibodies against the above epitopes.
  • An antibody against the protein of the present invention can be prepared, for example, by introducing a gene encoding the protein of the present invention to an appropriate E. coli expression vector, expressing the gene in E. coli, purifying the expressed protein, and immunizing rabbits, mice, rats, goats, domestic fowls and such against the protein. The antibody can be also prepared by immunizing the above animals against a synthesized partial peptide of a protein of the present invention.
  • An immune complex can be precipitated, for example by Protein A Sepharose or Protein G sepharose when the antibody is a mouse IgG antibody. If the protein of the present invention is prepared as a fusion protein with an epitope, such as GST, an immune complex can be formed in the same manner as in the use of the antibody against the protein of the present invention, by using a substance specifically binding to these epitopes, such as glutathione-Sepharose 4B.
  • Immunoprecipitation can be performed by following or according to, for example, the methods in the literature (Harlow, E. and Lane, D.: Antibodies pp. 511-552, Cold Spring Harbor Laboratory publications, New York (1988)) SDS-PAGE is commonly used for analysis of immunoprecipitated proteins and the bound protein can be analyzed by the molecular weight of the protein by using gels with an appropriate concentration.
  • the detection sensitivity for the protein can be improved by culturing cells in culture medium containing radioactive isotope, 35 S-methionine or 35 S-cystein, labeling proteins in the cells, and detecting the proteins.
  • the target protein can be purified directly from the SDS-polyacrylamide gel and its sequence can be determined, when the molecular weight of a protein has been revealed.
  • As a method for isolating proteins binding to the protein of the present invention by using the protein for example, West- Western blotting analysis (Skolnik, E. Y.
  • a protein binding to the protein of the present invention can be obtained by preparing a cDNA library from cells, tissues, organs (for example, tissues such as ovary, testis, and placenta or cultured cells) expected to express a protein binding to the protein of the present invention by using a phage vector (e.g., ZAP), expressing the protein on LB-agarose, fixing the protein expressed on a filter, reacting the purified and labeled protein of the present invention with the above filter, and detecting the plaques expressing proteins bound to the protein of the present invention according to the label.
  • a phage vector e.g., ZAP
  • the protein of the invention may be labeled by utilizing the binding between biotin and avidin, or by utilizing an antibody that specifically binds to the protein of the present invention, or a peptide or polypeptide (for example, GST) that is fused to the protein of the present invention. Methods using radioisotope or fluorescence and such may be also used.
  • a two-hybrid system utilizing cells may be used ("MATCHMAKER Two- Hybrid system", “Mammalian MATCHMAKER Two-Hybrid Assay Kit”, “MATCHMAKER one-Hybrid system” (Clontech); “HybriZAP Two-Hybrid Vector System” (Stratagene); the references “Dalton S, and Treisman R (1992) Cell 68, 597-612", “Fields S. and Sternglanz R. Trends Genet. (1994) 10:286-292").
  • the protein of the invention is fused to the SRF-binding region or GAL4-binding region and expressed in yeast cells.
  • a cDNA library is prepared from cells expected to express a protein binding to the protein of the invention, such that the library, when expressed, is fused to the VP16 or GAL4 transcriptional activation region.
  • the cDNA library is then introduced into the above yeast cells and the cDNA derived from the library is isolated from the positive clones detected (when a protein binding to the protein of the invention is expressed in yeast cells, the binding of the two activates a reporter gene, making positive clones detectable).
  • a protein encoded by the cDNA can be prepared by introducing the cDNA isolated above to E.coli and expressing the protein.
  • reporter gene for example, Ade2 gene, lacZ gene, CAT gene, luciferase gene and such can be used besides HIS3 gene.
  • a compound binding to the protein of the present invention can be screened using affinity chromatography.
  • the protein of the invention may be immobilized on a carrier of an affinity column, and a test sample, containing a protein capable of binding to the protein of the invention is supposed to be expressed, is applied to the column.
  • a test sample herein may be, for example, cell extracts, cell lysates, etc. After loading the test sample, the column is washed, and proteins bound to the protein of the invention can be prepared.
  • the amino acid sequence of the obtained protein is analyzed, an oligo DNA is synthesized based on the sequence, and cDNA libraries are screened using the oligo DNA as a probe to obtain a DNA encoding the protein.
  • a biosensor using the surface plasmon resonance phenomenon may be used as a mean for detecting or quantifying the bound compound in the present invention.
  • a biosensor When such a biosensor is used, the interaction between the protein of the invention and a test compound can be observed real-time as a surface plasmon resonance signal, using only a minute amount of protein and without labeling (for example, BIAcore, Pharmacia). Therefore, it is possible to evaluate the binding between the protein of the invention and a test compound using a biosensor such as BIAcore.
  • the methods of screening for molecules that bind when the immobilized protein of the present invention is exposed to synthetic chemical compounds, or natural substance banks, or a random phage peptide display library, or the methods of screening using high- throughput based on combinatorial chemistry techniques (Wrighton Nc, Farrel FX, Chang R, Kashyap AK, Barbone FP, Mulcahy LS, Johnson DL, Barret RW, Jolliffe LK, Dower WJ; Small peptides as potent mimetics of the protein hormone erythropoietin, Science (UNITED STATES) Jul 26 1996, 273 p458-64, Verdine GL., The combinatorial chemistry of nature.
  • a compound isolated by the screening is a candidate for drugs which promote or inhibit the activity of the protein of the present invention, for treating or preventing diseases attributed to, for example, diseases such as cancer.
  • the present invention provides a method for screening a compound which promotes or inhibits the activity of the protein of the present invention. Since the HELADl protein of the present invention has nuclease, helicase and apoptosis-suppressing activities, a compound which promotes or inhibits any one of these activities of a HELADl protein of the present invention can be screened using this activity as an index.
  • One embodiment of the screening method includes the steps of: (a) contacting a
  • HELADl protein or partial peptide thereof with a DNA in the presence of the subject sample, (b) detecting the degradation of the DNA, and (c) selecting a compound which promotes or inhibits the degradation in comparison with the degradation detected in the absence of the subject sample.
  • An alternate embodiment of the screening method includes the steps of: (a) contacting a HELADl protein or partial peptide thereof with a duplex DNA in the presence of the subject sample, (b) detecting the unwinding of the DNA, and (c) selecting a compound which promotes or inhibits the unwinding in comparison with the unwinding detected in the absence of the subject sample.
  • a further embodiment of the screening method includes the steps of: (a) culturing cells which express a HELADl protein or partial peptide thereof in the presence of the subject sample, (b) detecting apoptosis of the cells, and (c) selecting a compound which promotes or inhibits the apoptosis in comparison with the apoptosis detected in the absence of the subject sample.
  • HELADl proteins can be used for screening so long as they possess at least one activity selected from the group of helicase, nuclease and apoptosis-suppressing activity.
  • a human HELADl protein can be used and proteins functionally equivalent to these proteins can also be used.
  • HELADl proteins may be expressed endogenously or exogenously by cells. Any subject samples, for example, cell extracts, cell culture supernatant, products of fermenting microorganism, extracts of marine organism, plant extracts, purified or crude proteins, peptides, non-peptide compounds, synthetic micromolecular compounds, natural compounds, can be used.
  • a compound obtained by the above screening for compounds that bind to the protein of the present invention can be also used as the subject compound.
  • the compound isolated by this screening is a candidate for agonists or antagonists of the protein of the present invention.
  • the term "agonist” refers to molecules that activate the function of the protein of the present invention by binding thereto.
  • the term “antagonist” refers to molecules that inhibit the function of the protein of the present invention by binding thereto.
  • a compound isolated by this screening is a candidate for compounds which inhibit the in vivo interaction of the protein of the present invention with molecules (including DNAs and proteins) .
  • Nuclease activity can be detected, for example, by assaying for degradation of nucleic acids, such as DNA.
  • Helicase activity can be detected, for example, by assaying for the unwinding of duplex DNA, such as described in the Examples below.
  • Apoptosis- suppressing or inducing activity can be detected, for example, by assaying for cell death and comparing cell death measured with cell death arising in a control group, such as described in the Examples below.
  • the compound isolated by the screening is a candidate for drugs which inhibit the activity of the protein of the present invention and can be applied to the treatment of diseases associated with the protein of the present invention, for example, cancer, more particularly colorectal cancer.
  • the isolated compound When administrating a compound isolated by a method of the invention as a pharmaceutical for humans and other mammals, such as mice, rats, guinea-pigs, rabbits, chicken, cats, dogs, sheep, pigs, cattle, monkeys, baboons, chimpanzees, the isolated compound can be directly administered or can be formulated into a dosage form using known pharmaceutical preparation methods.
  • the drugs can be taken orally, as sugar-coated tablets, capsules, elixirs and microcapsules, or non- orally, in the form of injections of sterile solutions or suspensions with water or any other pharmaceutically acceptable liquid.
  • the compounds can be mixed with pharmacologically acceptable carriers or medium, specifically, sterilized water, physiological saline, plant-oil, emulsifiers, suspending agents, surfactants, stabilizers, flavoring agents, excipients, vehicles, preservatives, binders and such, in a unit dose form required for generally accepted drug implementation.
  • pharmacologically acceptable carriers or medium specifically, sterilized water, physiological saline, plant-oil, emulsifiers, suspending agents, surfactants, stabilizers, flavoring agents, excipients, vehicles, preservatives, binders and such, in a unit dose form required for generally accepted drug implementation.
  • the amount of active ingredients in these preparations makes a suitable dosage within the indicated range acquirable.
  • additives that can be mixed to tablets and capsules are, binders such as gelatin, corn starch, tragacanth gum and arabic gum; excipients such as crystalline cellulose; swelling agents such as corn starch, gelatin and alginic acid; lubricants such as magnesium stearate; sweeteners such as sucrose, lactose or saccharin; flavoring agents such as peppermint, Gaultheria adenothrix oil and cherry.
  • a liquid carrier such as oil, can also be further included in the above ingredients.
  • Sterile composites for injections can be formulated following normal drug implementations using vehicles such as distilled water used for injections.
  • Physiological saline, glucose, and other isotonic liquids including adjuvants can be used as aqueous solutions for injections.
  • adjuvants such as D-sorbitol, D-mannnose, D-mannitol, and sodium chloride
  • Suitable solubilizers such as alcohol, specifically ethanol, polyalcohols such as propylene glycol and polyethylene glycol, non-ionic surfactants, such as Polysorbate 80 (TM) and HCO-50.
  • Sesame oil or Soy-bean oil can be used as a oleaginous liquid and may be used in conjunction with benzyl benzoate or benzyl alcohol as a solubilizers and may be formulated with a buffer, such as phosphate buffer and sodium acetate buffer; a pain-killer, such as procaine hydrochloride; a stabilizer, such as benzyl alcohol, phenol; and an anti- oxidant.
  • the prepared injection may be filled into a suitable ampule.
  • Methods well known to one skilled in the art may be used to administer the inventive pharmaceutical compound to patients, for example as intraarterial, intravenous, percutaneous injections and also as intranasal, transbronchial, intramuscular or oral administrations.
  • the dosage and method of administration vary according to the body- weight and age of a patient and the administration method; however, one skilled in the art can routinely select them. If said compound is encodable by a DNA, the DNA can be inserted into a vector for gene therapy and the vector administered to perform the therapy.
  • the dosage and method of administration vary according to the body-weight, age, and symptoms of a patient but one skilled in the art can select them suitably.
  • the dose of a compound that binds with the protein of the present invention and regulates its activity is about 0.1 mg to about 100 mg per day, preferably about 1.0 mg to about 50 mg per day and more preferably about 1.0 mg to about 20 mg per day, when administered orally to a normal adult (weight 60 kg).
  • a normal adult weight 60 kg.
  • the present invention further provides a method of diagnosing cancer using a HELADl protein as a diagnostic marker.
  • This diagnosing method comprises the steps of:
  • the expression levels of HELADl. gene in a particular specimen can be estimated by quantifying mRNA corresponding to or protein encoded by the HELADl gene. Quantification methods for mRNA are known to those skilled in the art. For example, the levels of mRNAs corresponding to the HELADl gene can be estimated by Northern blotting or RT-PCR. Since all the nucleotide sequences of the HELADl gene is shown in SEQ ID NO:l and SEQ ID NO: 3, anyone skilled in the art can design the nucleotide sequences for probes or primers to quantify the HELADl gene.
  • the expression level of the HELADl gene can be analyzed based on activity or quantity of protein encoded by the HELADl gene.
  • a method for determining the quantity of the HELADl protein is shown in bellow.
  • immunoasssay method is useful for determination of the protein in biological material. Any biological materials can be used for the determination of the protein or it's activity.
  • colon tissue is analyzed for estimation of the protein encoded by the HELADl gene.
  • a suitable method can be selected for the determination of the activity protein encoded by the HELADl gene according to the activity of each protein to be analyzed.
  • Expression levels of the HELADl gene in a specimen are estimated and compared with those in a nomal sample. When such a comparison shows that the expression level of HELADl gene is higher than those in the nomal sample, the subject is judged to be affected with a cancer.
  • the expression level of HELADl gene in the specimens from the nomal sample and subject may be determined at the same time.
  • normal ranges of the expression levels can be determined by a statistical method based on the results obtained by analyzing the expression level of HELADl gene in specimens previously collected from a control group. A result obtained by examining the sample of a subject is compared with the normal range; when the result does not fall within the normal range, the subject is judged to be affected with the cancer.
  • the cancer to be diagnosed is preferably a colorectal cancer.
  • a diagnostic agent for diagnosing colorectal cancer is also provided.
  • the diagnostic agent of the present invention comprising a compound that binds to the DNA or the protein of the present invention.
  • the oligonucleotide that hybridize to polynucleotide of the present invention, or the antibodies that bind to the protein of the present invention may be used as these compound.
  • Mouse fibroblasts (NIH3T3), monkey fibroblasts (COS7), and human colon-cancer cell lines (SW480, SNUC2A and LoVo) were obtained from the American Type Culture Collection (ATCC, Rockville, MD).
  • Human embryonic kidney cell line HEK293 was purchased from TaKaRa (Tokyo, Japan). All cell lines were grown as monolayers in appropriate media, and maintained at 37°C in a humidified atmosphere with 5% CO 2 (for NHDF, NIH3T3, COS7 and HEK293) or without CO 2 (for SW480). Cancerous and corresponding non-cancerous tissues were obtained with informed consent from 20 patients who underwent colectomy.
  • RNAs were extracted from SW480 cells 72 h after infection with adenovirus constructs expressing either wild-type APC (Ad-APC) or LacZ (Ad-LacZ); T7-based RNA amplification was carried out using polyA RNA purified from the extracts, as described elsewhere (Ono et al, 2000).
  • RNA amplified RNA
  • aRNA amplified RNA
  • the cDNA template was synthesized from human fetal-brain mRNA for amplification and the PCR was carried out using a gene-specific reverse primer (5'- GTATCGGGAGAGAGGCTGAAGAAGAGG-3' (SEQ ID NO: 7)) and the API primer supplied in the kit.
  • the nucleotide sequences were determined with an ABI PRISM 3700 DNA sequencer (PE Applied Biosystems) according to the manufacturer's instructions. 5.
  • GPDH glyceraldehyde-3-phosphate dehydrogenase gene
  • the primer sets for amplification were GAPDHF (5'-ACAACAGCCTCAAGATCATCAG-3'; SEQ ID NO: 8) and GAPDHR (5'-GGTCCACCACTGACA CGTTG-3'; SEQ ID NO: 9) for GAPDH, and HELAD1F (5'- GAATTGCGCCAGTACCTGTCCAA-3'; SEQ ID NO: 10), HELAD1R (5'- GTCATCGTGATGGGTGTTGCTGTT -3'; SEQ ID NO: 11) for HELADl.
  • PCR reaction was carried out in 25 ⁇ l of IX PCR buffer (TAKARA) for 5 min at 94°C for initial denaturing, followed by 20 (for GAPDH) or 32 (for HELADl) cycles of 94°C for 30 s, 58 C C for 30 s and 72°C for 30 s, in the GeneAmp PCR system 9700 (PE Applied Biosystems). 6. Immunocytochemical staining
  • Antibodies were stained with a goat anti-mouse secondary antibody conjugated to rhodamine, and viewed with an ECLIPSE E800 microscope (Nikon). To confirm the expression of flag- tagged HELADl protein in transfected cells, we also performed Western blotting with either whole cell extract or nuclear extract using anti-flag antibody (Sigma), in a manner described previously (Ishiguro et al, 2000). Nuclei from the cells were separated as described previously (Chauveau et al, 1956).
  • Transferase was prepared by cloning an RT-PCR product corresponding to codons 1958- 2234 of HELADl into the appropriate site of a plasmid vector (pGEX-5X; Amersham Pharmacia Biotech). Bacteria harboring pGEX-HELADl were grown in IX LB media overnight and subsequently cultured in fresh media for an additional 3 h, followed by incubation with 0.5 mM isopropyl-beta-D-thiogalactoside (IPTG) for 4 h at 37°C. The bacteria were pelleted and sonicated in lysis buffer (1% Triton-X and 1 mM PMSF in PBS). The recombinant fusion protein was purified from the supernatant with Glutathione Sepharose beads (Amersham Pharmacia Biotech).
  • Helicase activity was measured by displacing a radiolabeled DNA fragment from duplex-DNA substrates, as described elsewhere (Suzuki et al, 1997).
  • Each substrate DNA complex consisting of M13mpl8 (TaKaRa) and a 32 P-labelled complementary oligonucleotide (5'-CAGGGTTTTCCCAGTCAC-3'; SEQ ID NO: 12), was prepared by annealing the two components in 20 mM Tris-HCl (pH 7.5), 10 mM MgCl 2 , 100 mM NaCl, and 1 mM DTT.
  • the substrate to determine 3' to 5' helicase activity was prepared by annealing DR45 (5'-
  • Each DNA substrate (-2.5 pg) was incubated with 1 ⁇ g of GST-HELAD1 protein or recombinant WRN protein in a 20- ⁇ g reaction mixture containing 50 mM Tris-HCl buffer (pH 7.5), 1 mM MgCl 2 , 0.5 mg/ml BSA and 2 mM 2-mercaptoethanol at 37°C for 60 min.
  • Recombinant WRN-protein was kindly provided by Dr. Furuichi (AGENE). 9. Colony-formation assay
  • Plasmids designed to express the sense and anti-sense transcripts of HELADl were constructed by cloning the entire coding region of HELADl cDNA into the appropriate site of pcDNA3.1 vector (Invitrogen).
  • COS7 cells (5X10 5 each) were plated onto 10-cm dishes and transfected with plasmid pcDNA-HELADlS, designed to express the sense strand of HELADl, with pcDNA-HELADlAS, designed to express the anti-sense strand, or with the pcDNA vector, using FuGENE ⁇ (Roche) according to the manufacturer's recommendations.
  • CAGAAACCGATTCCAT-3' SEQ ID NO: 16 HELAD1-AS3 (5'- GACTCAGAAACCGATT-3' SEQ ID NO: 17), and FITC-labeled-AS2 (5'- CAGAAACCGATTCCAT-3' SEQ ID NO: 16), each designed to suppress the expression of HELADl, and control oligonucleotide phosphorothioates HELADl -SE2 (5'- ATGGAATCGGTTTCTG-3'; SEQ ID NO: 18) and HELAD1-SE3 (5'- AATCGGTTTCTGAGTC-3'; SEQ ID NO: 19) were prepared.
  • RNAs extracted from the cells 12 h after transfection were transfected into SW480 cells using Lipofectin reagent (GIBCO-BRL) according to the supplier's protocol. The efficiencies of transfection were the same for all oligonucleotides (data not shown). The cells were maintained for five days at 37 °C, then stained with Giemsa' s solution (MERCK). To confirm suppression of HELADl, semi-quantitative RT-PCR was carried out using as templates RNAs extracted from the cells 12 h after transfection.
  • SW480 cells (1X10 5 ) on 10-cm plates were transfected with antisense oligonucleotides or control oligonucleotides using Lipofectin reagent (GIBCO-BRL) according to the supplier's protocol. Viability of cells was evaluated by MTT assay seven days after the treatment. MTT [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide] (Sigma) was added to each dish at a concentration of 500 ⁇ g/ml, and plates were incubated at 37°C for an additional 4h; then acid-SDS (0.01N HC1/10%SDS) was added to all wells and mixed vigorously. After the plates were incubated overnight at 37°C to dissolve the dark blue crystals, absorbance was measured at 570 nm with a Microplate Reader 550 (BIO-RAD).
  • MTT 3-(4,5-dimethylthiazol-2-yl)-2,5-dipheny
  • SW480 cells (5X10 5 per 10-cm dish) were tranfected with l ⁇ M of each oligonucleotide phosphorothioate using Lipofectin reagent (GIBCO-BRL). The cells were trypsinized and collected at day 7, and cell suspensions were prepared using the Cycle TEST PLUS (Becton Dickinson) according to the manufacturer's protocol. Flow- cytometric analyses were performed on a FACSCalibur (Becton Dickinson). The numbers of nuclei in G0-G1, S, and G2-M phases of the cell cycle, and the sub-Gl population, were determined from at least 20000 ungated cells. Apoptotic cells were detected by TUNEL assay using an ApopTaq-kit (Intergen) according to the manufacturer's protocol.
  • ApopTaq-kit Intergen
  • HELADl Helicase, adenomatous polyposis coli down-regulated 1
  • Example 3 Expression of HELADl in Human Tissues Northern-blot analysis using an RT-PCR product of HELADl as a probe detected an 11-kb transcript in human fetal brain and lung, and a 7.5-kb transcript in fetal kidney and liver ( Figure. 1C). However, these transcripts were undetectable in any adult human tissues examined.
  • Hs.23467 Since the UniGene clone (Hs.23467) was smaller than the transcripts detected by northern analysis, a human fetal brain cDNA library was screened and 5' RACE experiments were carried out. This effort identified two HELADl transcripts with different 5' sequences (GenBank with accession numbers AB063115 (SEQ ID NO: 1) and AB063116 (SEQ ID NO: 3)). A homology search with its deduced amino acid sequence using BLAST program in NCBI indicated 28% identity with unc-53 in C elegans. Comparison of HELADl cDNA sequences with genomic sequences in NCBI using the BLAST program revealed that HELADl consisted of 38 exons and belonged in chromosomal band lip 15.1.
  • HELADl protein was detected with an anti-Flag antibody on western blots ( Figure. 2A), and subsequent microscopic analysis indicated a primarily cytoplasmic and nuclear localization ( Figure. 2B). Nuclei from the cells were then separated and western blotting analysis was carried out with anti-flag antibody; expression of HELADl was identified in the nucleus ( Figure. 2C).
  • Figure. 2A DNA Helicase Activity
  • AAA domain is observed in a number of protein encoding DEAD/DEAH box helicase, as well as ABC transporters, and the A and B motifs of the Walker-type NTP binding domain is commonly observed in helicases
  • a recombinant GST-fusion protein containing the AAA domain of HELADl was prepared. Partially-duplex DNA substrates were mixed with GST-HELADl or with recombinant protein of Werner helicase (WRN) in the presence of ATP (Figure. 3A).
  • Example 6 Induction of Apoptosis by Anti-sense S Oligonucleotides of HELADl
  • AS2 and AS3 anti-sense
  • SE2 and SE3 control
  • S-oligonucleotides corresponding to DNA sequences around the first ATG were synthesized.
  • SW480 cells cells incorporated transfected FITC- labeled S-oligonucleotides into their nuclei (data not shown).
  • the anti-sense, but not the sense, S-oligonucleotides significantly suppressed expression of HELADl within 24 h after transfection (Figure. 4A).
  • HELADl human gene HELADl is markedly elevated in colorectal carcinoma as compared to non-cancerous colorectal tissues. Accordingly, this gene may serve as a diagnostic marker of colorectal cancer and the protein encoded thereby may be used in diagnostic assays therefore.
  • agents that block the expression of HELADl or prevent its activity may find therapeutic utility as anti-cancer agents, particularly anti-cancer agents for the treatment of colorectal cancer.
  • agents include antisense oligonucleotides and antibodies that recognize HELADl.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biochemistry (AREA)
  • Molecular Biology (AREA)
  • Biophysics (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Analytical Chemistry (AREA)
  • Immunology (AREA)
  • Veterinary Medicine (AREA)
  • Biomedical Technology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Physics & Mathematics (AREA)
  • Toxicology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Investigating Or Analysing Biological Materials (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
EP03715738A 2002-04-05 2003-04-02 Methoden zur diagnoseund behandlung von kolorektalem krebs Withdrawn EP1492884A2 (de)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US37060402P 2002-04-05 2002-04-05
US370604P 2002-04-05
PCT/JP2003/004226 WO2003085134A2 (en) 2002-04-05 2003-04-02 Methods of diagnosing and treating colorectal cancer

Publications (1)

Publication Number Publication Date
EP1492884A2 true EP1492884A2 (de) 2005-01-05

Family

ID=28792043

Family Applications (1)

Application Number Title Priority Date Filing Date
EP03715738A Withdrawn EP1492884A2 (de) 2002-04-05 2003-04-02 Methoden zur diagnoseund behandlung von kolorektalem krebs

Country Status (4)

Country Link
EP (1) EP1492884A2 (de)
JP (1) JP2005521421A (de)
AU (1) AU2003219563A1 (de)
WO (1) WO2003085134A2 (de)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CA2669260C (en) 2006-11-09 2019-01-15 The Government Of The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Differential gene expression in physiological and pathological angiogenesis

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB9625283D0 (en) * 1996-12-04 1997-01-22 Janssen Pharmaceutica Nv Vertebrate homologues of unc-53 protein of c.elegans or functional eqivalents thereof and cdna sequences coding for said homologue
DE19908423A1 (de) * 1999-02-26 2000-08-31 Deutsches Krebsforsch An der Entwicklung des ZNS beteiligtes Protein (TP)
DE10042609A1 (de) * 2000-08-30 2002-03-28 Deutsches Krebsforsch Verwendung von T-Proteinen zur differentiellen Charakterisierung und Therapie von Verletzungen und Tumoren des Nervensystems

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO03085134A2 *

Also Published As

Publication number Publication date
JP2005521421A (ja) 2005-07-21
WO2003085134A2 (en) 2003-10-16
AU2003219563A8 (en) 2003-10-20
AU2003219563A1 (en) 2003-10-20
WO2003085134A3 (en) 2004-04-15

Similar Documents

Publication Publication Date Title
US8124341B2 (en) Genes and polypeptides relating to hepatocellular or colorectal carcinoma
CA2488404C (en) Genes and polypeptides relating to human colon cancers
US20120149762A1 (en) Gene and Protein Relating to Hepatocellular Carcinoma and Methods of Use Thereof
US20090197317A1 (en) TSG-Like Gene
WO2003085134A2 (en) Methods of diagnosing and treating colorectal cancer
JP4942127B2 (ja) 新規アルマジロリピート含有蛋白質、alex1
EP1176199B1 (de) Tumorsuppressorgen
EP1241255A1 (de) Menschliche rna-helicase, helicain
EP1298209A1 (de) TRANSKRIPTIONSFAKTOR MIT ZINKFINGERDOMäNE
HK1145853A (en) Genes and polypeptides relating to human colon cancers
HK1083521B (en) Genes and polypeptides relating to human colon cancers

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20041109

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LI LU MC NL PT RO SE SI SK TR

AX Request for extension of the european patent

Extension state: AL LT LV MK

R17P Request for examination filed (corrected)

Effective date: 20041029

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION HAS BEEN WITHDRAWN

18W Application withdrawn

Effective date: 20060322