EP1472355A1

EP1472355A1 - Method for the production of zymosterol and/or the biosynthetic intermediate and/or subsequent products thereof in transgenic organisms

Info

Publication number: EP1472355A1
Application number: EP03734683A
Authority: EP
Inventors: Christine Lang; Markus Veen
Original assignee: BASF SE
Current assignee: BASF SE
Priority date: 2002-01-29
Filing date: 2003-01-22
Publication date: 2004-11-03
Also published as: US20060088903A1; DE10203346A1; WO2003064652A1

Abstract

The invention relates to a method for the production of zymosterol the biosynthetic intermediate or subsequent products thereof by cultivation of organisms, in particular yeasts, which have an increased lanosterol C14-demethylase activity and an increased HMG-CoA reductase activity, the nucleic acid constructs necessary for the production of the genetically-modified organisms and the genetically modified organisms, in particular the yeasts themselves.

Description

Process for the production of zymosterol and / or its biosynthetic intermediate and / or secondary products in transgenic organisms

description

The present invention relates to a method for producing zymosterol and / or its biosynthetic intermediate and / or secondary products by cultivating

Organisms, especially yeasts, which have an increased lanosterol-C14-demethylase activity and an increased HMG-CoA reductase activity compared to the wild type, the nucleic acid constructs required for the production of the genetically modified organisms, and the genetically modified organisms, in particular yeasts themselves ,

Zymosterol, its biosynthetic intermediates in sterol metabolism, such as farnesol, geraniol, squalene and lanosterol, and its biosynthetic secondary products of sterol metabolism, such as ergosterol (end product of sterol synthesis in yeast and fungi), lathosterol, cholesta-5, 7-dienol (Provitamin D3) and cholesterol (sterol biosynthesis in mammals) are compounds with high economic value.

The economic importance of ergosterol lies on the one hand in the production of vitamin D2 from ergosterol via UV radiation, and on the other hand in the production of steroid hormones via biotransformation, starting from ergosterol.

Squalene is used as a building block for the synthesis of terpenes. In hydrated form, it is used as squalane in dermatology and cosmetics, and in various derivatives as an ingredient in skin and hair care products.

Sterols, such as zymosterol and LxΛos erol, can also be used economically, whereby lanosterol is raw and synthetic pivotal for the chemical synthesis of saponins and steroid hormones. Because of its good skin penetration and spreading properties, Lanosterol serves as an emulsion aid and active ingredient for skin creams.

Cholesta-5, 7-dienol (provitamin D3) serves as the starting material for the production of vitamin D3 by UV radiation and, like cholesterol, is the starting material for other steoid hormones. An economical process for the production of zymosterol and / or its biosynthetic intermediate and / or secondary products is therefore of great importance.

Biotechnological processes are particularly economical

Process using natural organisms or organisms optimized by genetic modification, which produce zymosterol and / or its biosynthetic intermediate and / or secondary products.

The genes of ergosterol metabolism in yeast are widely known and cloned, such as

HMG-CoA reductase (BMG) encoding nucleic acids (Bason ME et al., (1988) Structural and functional conservation between yeast and human 3-hydroxy-3-methylglutaryl coenzyme A reductases, the rate-limiting enzyme of sterol biosynthesis. Mol Cell Biol 8: 3797-3808,

the nucleic acid encoding a truncated HMG-CoA reductase (t-HMG) (Polakowski T, Stahl U, Lang C. (1998) Overexpression of a cytosolic hydroxymethylglutaryl-CoA reductase leads to squalene accumulation in yeast. Appl Microbiol Biotechnol. Jan; 49 (1): 66-71,

the nucleic acid encoding a lanosterol C14 demethylase

(ERG11) (Kalb VF, Loper JC, Dey CR, Woods CW, Sutter TR (1986) Isolation of a cytochrome P-450 structural gene from Saccharomyces cerevisiae. Gene 45 (3).-237-45

and the nucleic acid encoding a squalene epoxidase (ERG1)

(Jandrositz, A., et al (1991) The gene encoding squalene epoxy- dase from Saccharomyces cerevisiae: cloning and characterization. Gene 107: 155-160.

Furthermore, processes are known which aim to increase the content of specific intermediates and end products of the sterol metabolism in yeasts and fungi.

It is known from EP 486 290 that the content of squalene and other specific sterols, such as zymosterol in yeast, can be increased by increasing the expression rate of HMG-CoA reductase and at the same time the metabolic pathway of zymosterol-C24-methyltransferase (ERG6 ) and the Ergosta-5,7,24 (28) -trienol-22-dehydrogenase (ERG5) interrupts. The disadvantage of this process is that sterols which follow the yeast sterol biosynthesis after zymosterol are no longer produced.

From T. Polakowski, Molecular Biological Influence of

Ergosterol metabolism of the yeast Saccharomyces cerevisiae, Shaker Verlag Aachen, 1999, pages 59 to 66, it is known that increasing the expression rate of HMG-CoA reductase alone without interrupting the flowing metabolic flow as in EP 486 290 only leads to a slight increase in the early content Sterols, such as squalene, while the content of later sterols, such as ergosterol, does not change significantly or tends to decrease.

WO 99/16886 describes a process for the production of ergosterol in yeasts which overexpress a combination of the genes tHMG, ERG9, SAT1 and ERG1.

Tainaka et al., J, Ferment. Bioeng. 1995, 79, 64-66, further describe that the overexpression of ERG11 (lanosterol-C14-demethylase) leads to an accumulation of 4, 4-dimethylzymosterol but not of ergosterol. The transformant showed a zymosterol content that was 1.1 to 1.47 times higher than that of the wild type, depending on the fermentation conditions.

The object of the present invention is to provide a further process for the production of zymosterol and / or its biosynthetic intermediates and / or secondary products with advantageous properties, such as a higher product yield.

Accordingly, a process for the production of zymosterol and / or its biosynthetic intermediates and / or secondary products has been found by cultivating organisms which have an increased lanosterol-C14-demethylase activity and an increased HMG-CoA reductase activity compared to the wild type.

Lanosterol-C14-demethylase activity means the enzyme activity of a lanosterol-Cl4-demethylase.

A lanosterol-C14-demethylase means a protein which has the enzymatic activity to convert lanosterol into 4, 4-dimethylcholesta-8, 14,24-trienol. Accordingly, lanosterol-C14-demethylase activity means the amount of lanosterol converted or amount of 4, 4-dimethylcholesta-8, 14, 24-trienol converted by the protein lanosterol-Cl4-demethylase in a certain time.

With an increased lanosterol-C14-demethylase activity compared to the wild type, the converted amount of lanosterol or the amount of 4, 4-dimethylcholesta-8, 14, 24-trienol increased.

This increase in the lanosterol C14 deethylase activity is preferably at least 5%, more preferably at least 20%, more preferably at least 50%, more preferably at least 100%, more preferably at least 300%, even more preferably at least 500%, in particular at least 600% of wild type lanosterol C14 demethylase activity.

HMG-CoA reductase activity is understood to mean the enzyme activity of an HMG-CoA reductase (3-hydroxy-3-methyl-glutaryl-coenzyme A reductase).

An HMG-CoA reductase means a protein which has the enzymatic activity to convert 3-hydroxy-3-methyl-glutaryl-coenzyme-A to mevalonate.

Accordingly, HMG-CoA reductase activity is understood to mean the amount of 3-hydroxy-3-methyl-glutaryl-coenzyme A converted or amount of mevalonate formed in a certain time by the protein HMG-CoA reductase.

If the HMG-CoA reductase activity is increased compared to the wild type, the amount of 3-hydroxy-3-methyl-glutaryl-coenzyme-A or the formed amount of mevalonate increased.

This increase in HMG-CoA reductase activity is preferably at least 5%, more preferably at least 20%, more preferably at least 50%, more preferably at least 100%, more preferably at least 300%, even more preferably at least 500%, in particular at least 600% of the Wild-type HMG-CoA reductase activity.

A wild type is understood to mean the corresponding non-genetically modified organism. The increase in the lanosterol-Cl4-demethylase activity, the HMG-CoA reductase activity and the squalene epoxidase activity described below can be carried out independently of one another in different ways, for example by switching off inhibitory regulatory mechanisms at the expression and protein level or by increasing the gene expression a nucleic acid encoding a lanosterol C14 demethylase, HMG-CoA reductase or squalene epoxidase compared to the wild type, for example by inducing the lanosterol C14 demethylase gene, HMG-CoA reductase gene or squalene epoxidase gene by activators or by introducing one or more nucleic acids encoding a lanosterol-C14-demethylase, HMG-CoA reductase or squalene epoxidase in the organism.

By increasing the gene expression of a nucleic acid encoding a lanosterol C14 demethylase, an HMG-CoA reductase or a squalene epoxidase, the manipulation of the expression of the organism, in particular the yeast endogenous lanosterol C14 demethylases, HMG-CoA reductases or Understand squalene epoxidases. This can be achieved, for example, by changing the promoter DNA sequence for lanosterol C14 demethylases, HMG-CoA reductases or genes coding for squalene epoxidases. Such a change, which results in a changed or preferably increased expression rate of at least one endogenous lanosterol-C14-demethylase, HMG-CoA reductase or squalene epoxidase gene, can be carried out by deleting or inserting DNA sequences.

As described above, it is possible to change the expression of at least one endogenous lanosterol-Cl4-demethylase, HMG-CoA reductase or squalene epoxidase by applying exogenous stimuli. This can take place through special physiological conditions, ie through the application of foreign substances.

Furthermore, an altered or increased expression of at least one endogenous lanosterol-C14-demethylase, HMG-CoA reductase or squalene epoxidase gene can be achieved in that a regulator protein not occurring in the non-transformed organism with the promoter of these genes in Interaction occurs.

Such a regulator can represent a chimeric protein, which consists of a DNA binding domain and a transcriptional activator domain, as described for example in WO 96/06166. In a preferred embodiment, the increase in lanosterol-C14-demethylase activity compared to the wild type is achieved by increasing the gene expression of a nucleic acid encoding a lanosterol-C4-demethylase.

In a further preferred embodiment, the gene expression of a nucleic acid coding for a lanosterol C14 demethylase is increased by introducing one or more nucleic acids coding for a lanosterol C14 demethylase into the organism.

In principle, any lanosterol C14 demethylase gene (ERG11), that is to say any nucleic acids encoding a lanosterol C14 demethylase, can be used for this purpose. In the case of genomic lanosterol-C14-demethylase nucleic acid sequences from eukaryotic sources which contain introns, the corresponding lanosterol-C14-demethylase is in the event that the host organism is unable or cannot be enabled express, preferably to use already processed nucleic acid sequences, such as the corresponding cDNAs.

Examples of lanosterol C14 demethylase genes are nucleic acids encoding a lanosterol C14 demethylase from Saccharomyces cerevisiae (Kalb VF, Loper JC, Dey CR, Woods CW, Sutter TR (1986) Isolation of a cytochrome P-450 structural gene from Saccharomyces cerevisiae, Gene 45 (3): 237-45), Candida albicans (Lamb DC, Kelly DE, Baldwin BC, Gozzo F, Boscott P, Richards WG, Kelly SL (1997) Differential inhibition of Candida albicans CYP51 with azole antifungal stereoisomers FEMS Microbiol Lett 149 (1): 25-30), Homo sapiens (Stromstedt M, Rozman D, Waterman MR. (1996) The ubiquitously expressed human CYP51 encodes lanosterol 14 alpha-demethylase, a cytochrome P450 whose expression is regulated by oxysterols Arch Biochem Biophys 1996 May 1; 329 (1): 73-81c) or Rattus norvegicus, Aoyama Y, Funae Y, Noshiro M, Horiuchi T, Yoshida Y. (1994) Occurrence of a P450 showing high homology to yeast lanosterol 14 -demethylase (P450 (14DM)) in the rat liver. Biochem Biophys Res Commun. Jun 30; 201 (3): 1320-6)

In this preferred embodiment, at least one further lanosterol-Cl4-demethylase gene is thus present in the transgenic organisms according to the invention in comparison with the wild type. The number of lanosterol Cl4 demethylase genes in the transgenic organisms according to the invention is at least two, preferably more than two, particularly preferably more than three, very particularly preferably more than five.

All of the nucleic acids mentioned in the description can be, for example, an RNA, DNA or cDNA sequence.

In the method described above, nucleic acids encoding proteins containing the amino acid sequence SEQ are preferably used. ID. NO. 2 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which has an identity of at least 30%, preferably at least 50%, more preferably at least 70%, still more preferably at least 90%, most preferably at least 95% at the amino acid level with the SEQ sequence. ID. NO. 2, and which have the enzymatic property of a lanosterol C14 demethylase.

The sequence SEQ. ID. NO. 2 shows the amino acid sequence of the Lano-sterol-C14-demethylase from Saccharomyces cerevisiae.

Further examples of lanosterol-C14-demethylases and lanosterol-C14-demethylase genes can be found, for example, from various organisms whose genomic sequence is known by comparing the homology of the amino acid sequences or the corresponding back-translated nucleic acid sequences from databases with the SEQ. ID. NO. 2 easy to find.

Further examples of lanosterol-C14-demethylases and lanosterol-C14-demethylase genes can also be started, for example, from the sequence SEQ. ID. No. 1 from different organisms whose genomic sequence is not known, can be easily found in a manner known per se by hybridization and PCR techniques.

In the description, the term “substitution” is to be understood as meaning the replacement of one or more amino acids by one or more amino acids. So-called conservative exchanges are preferably carried out, in which the replaced amino acid has a similar property to the original amino acid, for example replacement of Glu by Asp, Gin by Asn, Val by Ile, Leu by Ile, Ser by Thr. Deletion is the replacement of an amino acid with a direct link. Preferred positions for deletions are the termini of the polypeptide and the links between the individual protein domains.

Inserts are insertions of amino acids into the polypeptide chain, whereby a direct bond is formally replaced by one or more amino acids.

Identity between two proteins is understood to mean the identity of the amino acids over the respective total protein length, in particular the identity obtained by comparison with the aid of the laser genes software from DNASTAR, ine. Madison, Wisconsin (USA) using the Clustal method (Higgins DG, Sharp PM. Fast and sensitive multiple sequence alignments on a microcomputer. Comput Appl. Biosci. 1989 Apr; 5 (2): 151-1) with the following settings Parameter is calculated:

Multiple alignment parameter: gap penalty 10

Gap length penalty 10

Pairwise alignment parameters:

K-tuple 1 gap penalty 3

Window 5

Diagonal saved 5

Under a protein that has an identity of at least 30% at the amino acid level with the sequence SEQ. ID. NO. 2, is accordingly understood to be a protein which, when its sequence is compared with the sequence SEQ. ID. NO. 2, in particular according to the above program algorithm with the above parameter set, has an identity of at least 30%.

In a further preferred embodiment, nucleic acids are introduced into organisms which encode proteins containing the amino acid sequence of the Lanosterol-C14 demethylase from Saccharomyces cerevisiae (SEQ. ID. NO. 2).

Suitable nucleic acid sequences can be obtained, for example, by back-translating the polypeptide sequence in accordance with the genetic code.

Those codons are preferably used for this which are frequently used in accordance with the organism-specific codon usage. The codon usage can be determined using computer evaluations other known genes of the organisms in question easily.

If the protein is to be expressed, for example, in yeast, it is often advantageous to use the codon usage of the yeast in the back translation.

In a particularly preferred embodiment, a nucleic acid containing the sequence SEQ is brought. ID. NO. 1 in the organism.

The sequence SEQ. ID. NO. 1 represents the genomic DNA from Saccharomyces cerevisiae (ORF S0001049), which contains the lano-sterol-C14-demethylase of the sequence SEQ ID NO. 2 coded.

All of the above-mentioned lanosterol C14 demethylase genes can also be prepared in a manner known per se by chemical synthesis from the nucleotide building blocks, such as, for example, by fragment condensation of individual overlapping, complementary nucleic acid building blocks of the double helix. The chemical

Synthesis of oligonucleotides can be carried out, for example, in a known manner using the phosphoamidite method (Voet, Voet, 2nd edition, Wiley Press New York, pages 896-897). The attachment of synthetic oligonucleotides and the filling of gaps using the Klenow fragment of DNA polymerase and ligation reactions as well as general cloning methods are described in Sambrook et al. (1989) Molecular cloning: A laboratory manual, Cold Spring Harbor Laboratory Press.

In a preferred embodiment, the HMG-CoA reductase activity is increased compared to the wild type by increasing the gene expression of a nucleic acid encoding an HMG-CoA reductase.

In a particularly preferred embodiment of the method according to the invention, the gene expression of a nucleic acid encoding an HMG-CoA reductase is increased by introducing a nucleic acid construct containing a nucleic acid encoding an HMG-CoA reductase into the organism, the expression of which in the organism compared with the wild type, is subject to reduced regulation.

A reduced regulation compared to the wild type means a regulation which is reduced compared to the wild type defined above, preferably no regulation at the expression or protein level. The reduced regulation can preferably be achieved by a promoter which is functionally linked in the nucleic acid construct to the coding sequence and which is subject to a reduced regulation in the organism compared to the wild-type promoter.

For example, the average ADH promoter in yeast is only subject to a reduced regulation and is therefore particularly preferred as a promoter in the nucleic acid construct described above.

This promoter fragment of the ADHl2s promoter, hereinafter also referred to as ÄDHl, shows an approximately constitutive expression (Ruohonen L, Penttila M, Keranen S. (1991) Optimization of Bacillus alpha-amylase production by Saccharomyces cerevisiae. Yeast. May-Jun; 7 (4 ): 337-462; Lang C, LoomanAC. (1995) Efficient expression and secretion of Aspergillus niger RH5344 polygalacturonase in Saccharomyces cerevisiae. Appl Microbiol Bio-technol. Dec; 44 (1-2).-147-56.) , so that the transcriptional regulation no longer takes place via intermediates in ergosterol biosynthesis.

Further preferred promoters with reduced regulation are constitutive promoters such as the TEF1 promoter from yeast, the GPD promoter from yeast or the PGK promoter from yeast (Mumberg D, Muller R, Funk M. (1995) Yeast vectors for the controlled expression of heterologous proteins in different genetic backgrounds. Gene. 1995 Apr 1; 156 (1): 119-22; Chen CY, Oppermann H, Hitzeman RA. (1984) Homologous versus heterologous gene expression in the yeast, Saccharomyces cerevisiae. Nucleic Acids Res Dec 11; 12 (23): 8951-70.).

In a further preferred embodiment, the reduced regulation can be achieved by using an HMG-CoA reductase encoding a nucleic acid as a nucleic acid, the expression of which in the organism is subject to a reduced regulation compared to the organism's own orthologic nucleic acid.

It is particularly preferred to use a nucleic acid which encodes only the catalytic region of the HMG-CoA reductase (truncated (t-) HMG-CoA reductase) as the nucleic acid which encodes an HMG-CoA reductase. This nucleic acid (t-HMG) described in EP 486 290 and WO 99/16886 only codes the catalytically active part of the HMG-CoA reductase, which lacks the membrane domain responsible for regulation at the protein level. This nucleic acid is therefore subject to a reduced one, especially in yeast Regulation and leads to an increase in gene expression of HMG-CoA reductase.

In a particularly preferred embodiment, nucleic acids are introduced, preferably via the nucleic acid construct described above, which encode proteins containing the amino acid sequence SEQ. ID. NO. 4 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which has an identity of at least 30% at the amino acid level with the sequence SEQ. ID. NO. 4, and which have the enzymatic property of an HMG-CoA reductase.

The sequence SEQ. ID. NO. 4 shows the amino acid sequence of the truncated HMG-CoA reductase (t-HMG).

Further examples of HMG-CoA reductases and thus also of the t-HMG-CoA reductases reduced to the catalytic range or the coding genes can be found, for example, from various organisms whose genomic sequence is known by comparing the homology of the amino acid sequences or the corresponding back-translated nucleic acid sequences from databases with the SeQ ID. NO. 4 easy to find.

Further examples of HMG-CoA reductases and thus also for the t-HMG-CoA reductases reduced to the catalytic range or the coding genes can furthermore be started, for example, from the sequence SEQ. ID. No. 3 from different organisms, the genomic sequence of which is not known, can be easily found by hybridization and PCR techniques in a manner known per se.

A nucleic acid containing the sequence SEQ is particularly preferably used. ID. NO. 3 as nucleic acid, encoding a truncated HMG-CoA reductase.

In a particularly preferred embodiment, the reduced regulation is achieved in that an HMG-CoA reductase encoding a nucleic acid is used as a nucleic acid, the expression of which in the organism is subject to reduced regulation compared to the organism's own orthologic nucleic acid, and a promoter is used which is subject to reduced regulation in the organism compared to the wild-type promoter.

A method for the production of zymosterol and / or its intermediate and / or secondary products is particularly preferred, in which an organism is used which, in addition to an increased Lanosterol-C14-demethylase and HMG-CoA reductase activity has an increased squalene epoxidase activity compared to the wild type.

Squalene epoxidase activity means the enzyme activity of a squalene epoxidase.

A squalene epoxidase is understood to mean a protein which has the enzymatic activity to convert squalene into squalene epoxide.

Accordingly, squalene epoxidase activity is understood to mean the amount of squalene converted or amount of squalene epoxide formed in a certain time by the protein squalene epoxidase.

If the squalene epoxidase activity is increased compared to the wild type, the amount of squalene converted or the amount of squalene epoxide formed is increased in a certain time by the protein squalene epoxidase in comparison to the wild type.

This increase in squalene epoxidase activity is preferably at least 5%, more preferably at least 20, more preferably at least 50%, further preferably at least 100%, more preferably at least 300%, more preferably at least 500%, in particular at least 600% of the squalene epoxidase activity of the wild type ,

As mentioned above, a wild type is understood to mean the corresponding non-genetically modified organism.

In a preferred embodiment, the squalene epoxidase activity is increased compared to the wild type by increasing the gene expression of a nucleic acid encoding a squalene epoxidase.

In a further preferred embodiment, the gene expression of a nucleic acid encoding a squalene epoxidase is increased by introducing one or more nucleic acids encoding a squalene epoxidase into the organism.

In principle, any squalene epoxidase gene (ERGl), that is to say any nucleic acids encoding a squalene epoxidase, can be used for this purpose. In the case of genomic squalene epoxidase nucleic acid sequences from eukaryotic sources which contain introns, in the event that the host organism is unable or cannot be enabled, the corresponding squalene To express epoxidase, preferably to use already processed nucleic acid sequences, such as the corresponding cDNAs.

Examples of nucleic acids encoding a squalene epoxidase are nucleic acids encoding a squalene epoxidase from Saccharomyces cerevisiae (Jandrositz, A., et al (1991) The gene encoding squalene epoxidase from Saccharomyces cerevisiae: cloning and characterization. Genes 107: 155-160, from Mus musculus ( Kosuga K, Hata S, Osu i T, Sakakibara J, Ono T. (1995) Nucleotide sequence of a cDNA for mouse squalene epoxidase, Biochim Biophys Acta, Feb 21, -1260 (3): 345-8b), from Rattus norvegicus (Sakakibara J, Watanabe R, Kanai Y, Ono T. (1995) Molecular cloning and expression of rat squalene epoxidase. J Biol Chem Jan 6; 270 (1): 17-20c) or from Homo sapiens (Nakamura Y, Sakakibara J , Izumi T, Shibata A, Ono T. (1996) Transcriptional regulation of squalene epoxidase by sterols and inhibitors in HeLa cells., J. Biol. Chem. 1996, Apr 5; 271 (14): 8053-6).

In this preferred embodiment, at least one further squalene epoxidase is thus present in the transgenic organisms according to the invention compared to the wild type.

The number of squalene epoxidase genes in the transgenic organisms according to the invention is at least two, preferably more than two, particularly preferably more than three, very particularly preferably more than five.

In the method described above, nucleic acids encoding proteins containing the amino acid sequence SEQ are preferably used. ID. NO. 6 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which has an identity of at least 30%, preferably at least 50%, more preferably at least 70%, still more preferably at least 90%, most preferably at least 95% at the amino acid level with the SEQ sequence. ID. NO. 6, and which have the enzymatic property of a squalene epoxidase.

The sequence SEQ. ID. NO. 6 shows the amino acid sequence of squalene epoxidase from Saccharomyces cerevisiae.

Further examples of squalene epoxidases and squalene epoxidase genes can be found, for example, from various organisms whose genomic sequence is known by comparing the homology of the amino acid sequences or the corresponding back-translated nucleic acid sequences from databases with the SeQ ID. NO. 6 easy to find. Further examples of squalene epoxidase and squalene epoxidase genes can also be found, for example, starting from the sequence SEQ. ID. No. 5 from different organisms whose genomic sequence is not known, can easily be found by hybridization and PCR techniques in a manner known per se.

In a further preferred embodiment, nucleic acids are introduced into organisms which encode proteins containing the amino acid sequence of the squalene epoxidase from Saccharomyces cerevisiae) (SEQ. ID. NO. 6).

Those codons are preferably used for this which are frequently used in accordance with the organism-specific codon usage. The codon usage can easily be determined on the basis of computer evaluations of other known genes of the organisms in question.

In a particularly preferred embodiment, a nucleic acid containing the sequence SEQ is brought. ID. NO. 5 in the organism.

The sequence SEQ. ID. NO. 5 displays the genomic DNA

Saccharomyces cerevisiae (ORF S0003407), which contains the squalene epoxidase of the sequence SEQ ID NO. 6 coded.

All of the squalene epoxidase genes mentioned above can also be produced in a manner known per se by chemical synthesis from the nucleotide building blocks, for example by fragment condensation of individual overlapping, complementary nucleic acid building blocks of the double helix. The chemical synthesis of oligonucleotides can, for example, in a known manner, according to the phosphoamidite method (Voet, Voet, 2nd edition, Wiley Press

New York, pages 896-897). The addition of synthetic oligonucleotides and the filling of gaps with the aid of the Klenow fragment of DNA polymerase and ligation reactions as well as general cloning methods are described in Sambrook et al. (1989) Molecular cloning: A laboratory anual, Cold Spring Harbor Laboratory Press. According to the invention, organisms include, for example, bacteria, in particular bacteria of the genus Bacillus, Bscherichia coli, Lactobacillus spec. or Streptomyces spec. .

for example yeasts, in particular yeasts of the genus Saccharomyces cerecisiae, Pichia pastoris or Klyveromyces spec.

for example mushrooms, in particular mushrooms of the genus Aspergillus spec, Penicillium spec. or Dictyostelium spec.

as well as, for example, also insect cell lines that are capable of producing zymosterol and / or its biosynthetic intermediates and / or secondary products as a wild type or through previous genetic modification.

Particularly preferred organisms are yeasts, in particular of the species Saccharomyces cerevisiae, in particular the yeast strains Saccharomyces cerevisiae AH22, Saccharomyces cerevisiae GRF, Saccharomyces cerevisiae DBY747 and Saccharomyces cerevisiae BY4741.

As mentioned above, a wild type is understood to mean the corresponding non-genetically modified organism. In cases in which the organism or the wild type cannot be clearly assigned, preference is given to increasing the lanosterol Cl4 demethylase activity, increasing the HMG-CoA reductase activity, increasing the squalene epoxidase activity or the wild type Content of zymosterol and / or its biosynthetic intermediate and / or secondary products understood a reference organism. This reference organism is preferably the yeast strain Saccharomyces cerevisiae AH22.

The determination of the lanosterol C14 demethylase activity, the HMG-CoA reductase activity and the squalene epoxidase activity of the genetically modified organism according to the invention and of the reference organism is carried out under the following conditions:

The activity of the HMG-CoA reductase is determined as described in Th. Polakowski, Molecular biological influence on the ergo sterol metabolism of the yeast Saccharomyces cerevisiae, Shaker-Verlag, Aachen 1999, ISBN 3-8265-6211-9.

Accordingly, 10 ⁹ yeast cells from a 48 h old culture are harvested by centrifugation (3500 × g, 5 min) and washed in 2 ml of buffer I (100 mM potassium phosphate buffer, pH 7.0). The cell pellet is placed in 500 μl buffer 1 (cytosolic proteins) or 2 (100 mM potassium phosphate buffer pH 7.0; 1% Triton X-100) (total proteins) and 1 μl of 500 mM PMSF in isopropanol is added. 500 μl of glass beads (d = 0.5 mm) are added to the cells, and the cells are disrupted by vortexing 5 times for one minute. The liquid between the glass beads is transferred to a new Eppi. Cell residues or membrane components are separated by centrifugation (14000 xg) for 15 min. The supernatant is transferred to a new Eppi and represents the protein fraction.

The activity of the HMG-CoA activity is determined by measuring the consumption of NADPH + H ⁺ in the reduction of 3-hydroxy-3-methylglutaryl-CoA, which is added as a substrate.

In a test batch of 1000 μl, 20 μl yeast protein isolate with 910 μl buffer I; 50 ul 0.1 M DTT and 10 ul 16 mM NADPH + H + added. The batch is tempered to 30 ° C. and is measured for 7.5 min at 340 nm in the photometer. The decrease in NADPH measured during this period is the degradation rate without substrate addition and is taken into account as a background.

The substrate (10 μl 30 mM HMG-CoA) is then added, and a further 7.5 min are measured. The HMG-CoA reductase activity is calculated by determining the specific NADPH degradation rate.

Determination of the Activity of Lanosterol C14 Demethylase

Activity occurs as in Oura, T and Sato, R. (1964) The carbon monoxide binding pigment in liver microsomes. J. Biol. Chem. 239, 2370-2378. In this test, the amount of P450 enzyme as a holoenzyme with bound heme is semi-quantifiable. The (active) holoenzyme (with heme) can be reduced by CO and only the CO-reduced enzyme has an absorption maximum at 450 nm. The absorption maximum at 450 nm is a measure of the activity of lanosterol C14 demethylase.

To carry out the activity determination, a microsome fraction (4-10 mg / ml protein in 100 mM potassium phosphate buffer) is diluted 1: 4, so that the protein concentration used for the test is 2 mg / ml. The test is carried out directly in a cuvette.

A spatula tip of dithionite (Sθ ₄ a) is added to the microsomes. The baseline is recorded in the range of 380-500 nm with a spectrophotometer. Then about 20-30 bubbles of CO are bubbled through the sample. The absorption is now measured in the same area. The level of absorption at 450 nm corresponds to the compartment of P450 enzyme in the test batch. 5

The activity of squalene epoxidase is determined as in Leber R, Landl K, Zinser E, Ahorn H, Spok A, Kohlwein SD, Turnowsky F, Daum G. (1998) Dual localization of squalene epoxidase, Erglp, in yeast reflects a relationship between the 10 endoplasmic reticulum and lipid particles, Mol. Biol. Cell. 1998, Feb; 9 (2): 375-86.

This method contains 0.35 to 0.7 mg microsomal protein or 3.5 to 75 μg lipid particle protein in 100 mM Tris-HCl, pH 7.5, 15 1 mM EDTA, 0.1 mM FAD, 3 mM NADPH, 0 , 1 mM squalene 2, 3-epoxidase cyclase inhibitor U18666A, 32 μM [ ³ H] squalene dispersed in 0.005% Tween 80 in a total volume of 500 μl.

The test is carried out at 30 ° C. After pretreatment for 20-10 min, the reaction is started by adding squalene and after 15, 30 or 45 min by lipid extraction with 3 ml of chloroform / methanol (2: 1 vol / vol) and 750 μl of 0.035% MgCl.

The lipids are dried under nitrogen and redissolved in 0.5 ml of 25 chloroform / methanol (2: 1 vol / vol). For one

Thin layer chromatography, parts are placed on a silica gel 60 plate (0.2 mm) and separated with chloroform as the eluent. The positions containing [ ³ H] 2, 3-oxidosqualen and [ ³ H] squalenes were scratched out and quantified using a 30 scintillation counter.

The biosynthetic intermediates of zymosterol are understood to mean all compounds which occur as intermediates in the organism used in the biosynthesis of zymosterol, preferably the compounds mevalonate, farnesyl pyrophosphate, geraniol pyrophosphate, squalene epoxide, 4-dimethylcholesta-8, 14,24-trienol , 4.4 dirn thylzymosterol, squalene, farnesol, geraniol, lanosterol and zymosterone.

40 The biosynthetic secondary products of zymosterol are understood to mean all compounds that are derived biosynthetically from zymosterol in the organism used, i.e. , where zymosterol occurs as an intermediate. These can be compounds that the organism used naturally from zymo-

45 sterol, such as 4, 4-dimethylzymosterol, 4-methylzymosterol, fecosterol, ergost-7-enol, episterol, ergosta-5, 7-dienol, in particular sterols with 5,7-diene structure in yeast and mushrooms. However, compounds are also understood which can only be produced from zymosterol in the organism by introducing genes and enzyme activities from other organisms to which the starting organism has no orthological gene.

For example, by introducing mammalian genes into yeast, secondary products can be produced from zymosterol, which naturally only occur in mammals:

The introduction of, for example, human or murine nucleic acids encoding a human or murine sterol delta 8 delta 7 isomerase and a human or murine delta 5 desaturase in yeast leads to the production of cholesta 7, 24-dienol, cholesta - 5,7, 24-trienol, lathosterol and / or cholesta-5, 7-dienol (provitamin D3).

By introducing another human or murine nucleic acid encoding a human or murine delta-7 reductase, the yeast is able to produce cholesterol.

Among the biosynthetic secondary products of zymosterol are therefore in particular fecosterol, episterol, Ergosta-5, 7-dienol, ergosterol, Cholesta-7, 24-dienol, Cholesta-5, 7.24-trienol, lathosterol, Cholesta-5, 7 -dienol (provitamin D3) and / or cholesterol understood.

Preferred biosynthetic secondary products are ergosterol, lathosterol and / or cholesta-5, 7-dienol (provitamin D3).

To further increase the content of secondary products of the zymosterol, it is additionally advantageous to suppress draining metabolic pathways, that is, biosynthetic pathways that do not lead to the desired product.

For example, in the above-described production of mammalian sterols which are derived from zymosterol in yeasts, it is advantageous in addition to the increase in activity according to the invention of lanosterol C14-demethylase and HMG-CoA reductase and, if appropriate, the squalene epoxidase described below, the natural biosynthetic pathway in yeast of zymosterol to suppress or interrupt ergosterol, for example by switching off or deleting ERG6 (C-24-methyltransferase) or ERG5 (Delta22 reductase) in yeast, preferably by switching off or deleting ERG6 and ERG5. The compounds produced in the process according to the invention can be used in biotransformations, chemical reactions and for therapeutic purposes, for example for the production of vitamin D from ergosterol by means of UV radiation, and the production of vitamin D ₃ from cholesta-5, 7-dienol (provitamin D3) UV radiation, or for the production of steroid hormones via biotransformation based on ergosterol.

In the process according to the invention for the production of zymosterol and / or its biosynthetic intermediates and / or secondary products, the cultivation step of the genetically modified organisms, hereinafter also referred to as transgenic organisms, is preferably referred to as harvesting the organisms and isolating zymosterol and / or its biosynthetic intermediates. and / or derived products from the organisms.

The organisms are harvested in a manner known per se in accordance with the respective organism. Microorganisms, such as bacteria, mosses, yeasts and fungi or plant cells, which are cultivated by fermentation in liquid nutrient media, can be separated off, for example, by centrifuging, decanting or filtering.

The isolation of zymosterol and / or its biosynthetic intermediates and / or secondary products from the harvested biomass is carried out jointly or each compound per se in a manner known per se, for example by extraction and optionally further chemical or physical purification processes, such as precipitation methods, crystallography, thermal Separation processes such as rectification processes or physical separation processes such as chromatography.

The transgenic organisms, in particular yeasts, are preferably produced by transforming the starting organisms, in particular yeasts, either with a nucleic acid construct which contains the above-described nucleic acids, a lano-sterol-C14-demethylase and an HMG-CoA reductase with or several regulatory signals are functionally linked, which ensure transcription and translation in organisms, or by combined transformation of the starting organisms, in particular yeasts, with at least two nucleic acid constructs, a nucleic acid construct encoding the above-described nucleic acids a lanosterol C14 demethylase and a second nucleic acid construct the nucleic acids described above encoding an HMG-CoA reductase and each containing one or more regulatory Signals are functionally linked, which ensure transcription and translation in organisms.

Nucleic acid constructs in which the coding nucleic acid sequence is functionally linked to one or more regulatory signals which ensure transcription and translation in organisms, in particular in yeasts, are also called expression cassettes below.

Nucleic acid constructs containing this expression cassette are, for example, vectors or plasmids.

Accordingly, the invention further relates to nucleic acid constructs, in particular nucleic acid constructs functioning as an expression cassette, containing nucleic acids encoding a lanosterol-C14-demethylase and nucleic acids encoding an HMG-CoA reductase, which are functionally linked to one or more regulation signals that transcription and translation in organisms, ensure especially in yeasts.

In a preferred embodiment, this nucleic acid construct additionally comprises nucleic acids encoding a squalene epoxidase which are functionally linked to one or more regulation signals which ensure transcription and translation in organisms, in particular in yeasts.

Alternatively, the transgenic organisms according to the invention can also be produced by transformation with a combination of nucleic acid constructs, the combination

a) a first nucleic acid construct containing nucleic acids encoding a lanosterol-C14-demethylase, which are functionally linked to one or more regulatory signals, which ensure transcription and translation in organisms and

b) second nucleic acid construct, containing nucleic acids encoding an HMG-COA reductase, which are functionally linked to one or more regulatory signals which ensure transcription and translation in organisms. In a preferred embodiment, the combination comprises

c) yet another, third nucleic acid construct, containing nucleic acids encoding a squalene epoxidase, which are functionally linked to one or more regulation signals, which ensure transcription and translation in organisms.

The regulation signals preferably contain one or more promoters which ensure transcription and translation in organisms, in particular in yeasts.

The expression cassettes contain regulatory signals, that is to say regulatory nucleic acid sequences which control the expression of the coding sequence in the host cell. According to a preferred embodiment, an expression cassette comprises upstream, i.e. at the 5 'end of the coding sequence, a promoter and downstream, i.e. at the 3 'end a terminator and, if appropriate, further regulatory elements which are operatively linked to the coding sequence in between for at least one of the genes described above.

An operative link is understood to mean the sequential arrangement of promoter, coding sequence, terminator and, if appropriate, further regulatory elements in such a way that each of the regulatory elements can fulfill its function as intended in the expression of the coding sequence.

The preferred nucleic acid constructs, expression cassettes and plasmids for yeast and

Mushrooms and processes for the production of transgenic yeasts, as well as the transgenic yeasts themselves are described.

In principle, any promoter which can control the expression of foreign genes in organisms, in particular in yeasts, is suitable as promoters of the expression cassette.

A promoter which is subject to reduced regulation in the yeast, such as, for example, the middle ADH promoter, is preferably used in particular.

This promoter fragment of the ADHl2s promoter, also referred to below as ADH1, shows an approximately constitutive expression (Ruohonen L, Penttila M, Keranen S. (1991) Optimization of Bacillus alpha-amylase production by Saccharomyces cerevisiae. Yeast. May-Jun; 7 (4 ): 337-462; Lang C, LoomanAC. (1995) Efficient expression and secretion of Aspergillus niger RH5344 poly- galacturonase in Saccharomyces cerevisiae. Appl Microbiol Biotechnol. Dec; 44 (1-2): 147-56. ), so that the transcriptional regulation no longer takes place via intermediates in ergosterol biosynthesis.

Further preferred promoters with reduced regulation are constitutive promoters such as the TEF1 promoter from yeast, the GPD promoter from yeast or the PGK promoter from yeast (Mumberg D, Muller R, Funk M. (1995) Yeast vectors for the controlled expression of heterologous proteins in different genetic backgrounds. Gene. 1995 Apr 14; 156 (1): 119-22; Chen CY, Oppermann H, Hitzeman RA. (1984) Homologous versus heterologous gene expression in the yeast, Saccharomyces cerevisiae. Nucleic Acids Res Dec 11; 12 (23): 8951-70.).

The expression cassette can also contain inducible promoters, in particular chemically inducible promoters, by means of which the expression of the lanosterol C14 demethylase gene, the HMG-CoA reductase gene or the squalene epoxidase gene in the organism can be controlled at a specific point in time.

Such promoters such as the Cupl promoter from yeast (Etcheverry T. (1990) Induced expression using yeast copper metallothionein promoter. Methods Enzymol. 1990; 185: 319-29.), The Gall-10 promoter from yeast (Ronicke V, Graulich W, Mumberg D, Muller R, Funk M. (1997) Use of conditional promoters for expression of heterologous proteins in Saccharomyces cerevisiae, Methods Enzymol. 283: 313-22) or the Pho5 promoter from yeast (Bajwa W, Rudolph H , Hinnen A. (1987) PH05 upstream sequences confer phosphate control on the constitutive PH03 gene. Yeast. 1987 Mar; 3 (1) -.33-42) can be used, for example.

In principle, any terminator which can control the expression of foreign genes in organisms, in particular in yeasts, is suitable as the terminator of the expression cassette.

The yeast tryptophan terminator (TRPl terminator) is preferred.

An expression cassette is preferably produced by fusing a suitable promoter with the nucleic acids described above, encoding a lanosterol C14 demethylase, an HMG-CoA reductase and / or a squalene epoxidase and a terminator according to common recombination and cloning techniques, as described, for example, in T. Maniatis, EF Fritsch and J. Sambrook, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1989) and in TJ Silhavy, ML Berman and LW Enquist, Experiments with Gene Fusions, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1984) and in Ausubel, FM et al., Current Protocols in Molecular Biology, Greene Publishing Assoc , and Wiley-Interscience (1987).

The nucleic acids according to the invention can be produced synthetically or obtained naturally or contain a mixture of synthetic and natural nucleic acid constituents and consist of different heterologous gene segments from different organisms.

As described above, preference is given to synthetic nucleotide sequences with codons which are preferred by yeasts. These yeast-preferred codons can be determined from the highest protein frequency codons expressed in most interesting yeast species.

When preparing an expression cassette, various DNA fragments can be manipulated in order to obtain a nucleotide sequence which expediently reads in the correct direction and which is equipped with a correct reading frame. To connect the DNA fragments to one another, adapters or linkers can be attached to the fragments.

The promoter and terminator regions can expediently be provided in the transcription direction with a linker or polylinker which contains one or more restriction parts for the insertion of this sequence. As a rule, the linker has 1 to 10, usually 1 to 8, preferably 2 to 6, restriction sites. In general, the linker has a size of less than 100 bp, often less than 60 bp, but at least 5 bp within the regulatory ranges. The promoter can be native or homologous as well as foreign or heterologous to the host organism. The expression cassette preferably contains the promoter, a coding nucleic acid sequence or a nucleic acid construct and a region for the transcriptional termination in the 5 '-3' transcription direction. Different termination areas are interchangeable.

Manipulations which provide suitable restriction sites or which remove superfluous DNA or restriction sites can also be used. Where insertions, deletions or substitutions such as transitions and transversions are possible, in vitro mutagenesis, "primer repair", restriction or ligation can be used. With suitable manipulations, such as restriction, "chewing-back" or filling overhangs for "blunt ends", complementary ends of the fragments can be made available for the ligation.

The invention further relates to the use of the nucleic acids described above, the nucleic acid constructs described above or the proteins described above for the production of transgenic organisms, in particular yeasts.

These transgenic organisms, in particular yeasts, preferably have an increased content of zymosterol and / or its biosynthetic intermediate and / or secondary products compared to the wild type.

The invention therefore further relates to the use of the nucleic acids described above or the nucleic acid constructs according to the invention for increasing the content of zymosterol and / or its biosynthetic intermediate and / or secondary products in organisms which are capable of being wild type or by genetic manipulation, zymosterol and / or to produce its biosynthetic intermediates and / or secondary products.

The proteins and nucleic acids described above can be used in the production of zymosterol and / or its biosynthetic intermediates and / or secondary products in transgenic organisms.

The transfer of foreign genes into the genome of an organism, especially yeast, is called transformation.

Methods known per se for transformation can be used for this, particularly in the case of yeasts.

Suitable methods for transforming yeasts are, for example, the LiAC method, as in Schiestl RH, Gietz RD. (1989) High efficiency transformation of intact yeast cells using Single stranded nucleic acids as a carrier, Curr Genet. Dec, -16 (5-6): 339-46, described electroporation as in Manivasakam P, Schiestl RH. (1993) High efficiency transformation of Saccharomyces cerevisiae by electroporation. Nucleic Acids Res. Sep 11; 21 (18): 4414-5, or the protoplasm as described in Morgan AJ. (1983) Yeast strain improvement by protoplast fusion and transformation, Experientia Suppl. 46: 155-66. The construct to be expressed is preferably cloned into a vector, in particular into plasmids, which are suitable for transforming yeasts, such as, for example, the vector systems Yep24 (Naumovski L, Friedberg EC (1982) Molecular cloning of eucaryotic genes required for excision repair of UV-irradiated DNA: isolation and partial characterization of the RAD3 gene of Saccharomyces cerevisiae. J Bacteriol Oct; 152 (1): 323-31), Yepl3 (Broach JR, Strathern JN, Hicks JB. (1979) Transformation in yeast: development of a hybrid cloning vector and isolation of the CANl gene. Gene. 1979 Dec; 8 (1): 121-33), the pRS series of vectors (Centromer and Episomal) (Sikorski RS, Hieter P. (1989) A System of Shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae. Genetics. May; 122 (1): 19-27) and the vector systems Ycpl9 or pYEXBX.

Accordingly, the invention further relates to vectors, in particular plasmids containing the nucleic acids, nucleic acid constructs or expression cassettes described above.

The invention further relates to a method for producing genetically modified organisms by functionally introducing a nucleic acid or a nucleic acid construct described above into the starting organism.

The invention further relates to the genetically modified organisms, the genetic modification increasing the activity of a lanosterol C14 demethylase and an HMG-CoA reductase compared to a wild type.

Preferably, the increase in lanosterol C14 demethylase activity takes place, as mentioned above, by an increase in the gene expression of a nucleic acid encoding a lanosterol Cl4 demethylase compared to the wild type.

The increase in the gene expression of a nucleic acid encoding a lanosterol C14 demethylase compared to the wild type is preferably carried out by increasing the number of copies of the nucleic acid encoding a lanosterol C14 demethylase in the organism.

Accordingly, the invention preferably relates to a genetically modified organism as described above which contains two or more nucleic acids encoding a lanosterol-Cl4-demethylase. In a preferred embodiment, the HMG-CoA reductase activity is increased compared to the wild type, as mentioned above by increasing the gene expression of a nucleic acid encoding an HMG-CoA reductase.

The invention accordingly relates to a genetically modified organism as described above, which contains a nucleic acid construct containing a nucleic acid encoding an HMG-CoA reductase, the expression of which in the organism is subject to reduced regulation compared to the wild type.

In this preferred embodiment, the invention relates in particular to a genetically modified organism described above, characterized in that the nucleic acid construct contains a promoter which is subject to reduced regulation in the organism compared to the wild type and / or that an HMG-CoA reductase is encoded as the nucleic acid uses a nucleic acid that only encodes the catalytic region of HMG-CoA reductase.

Genetically modified organisms mentioned above are particularly preferred in which the genetic modification additionally increases the squalene epoxidase activity compared to a wild type.

Preferably, the squalene epoxidase activity is increased, as mentioned above by increasing the gene expression of a nucleic acid encoding a squalene epoxidase compared to the wild type.

Preferably, the gene expression of a nucleic acid encoding a squalene epoxidase is increased compared to the wild type by increasing the copy number of the nucleic acid encoding a squalene epoxidase in the organism.

Accordingly, the invention preferably relates to a genetically modified organism as described above which contains two or more nucleic acids encoding a squalene epoxidase. The genetically modified organisms described above have an increased content of zymosterol and / or its biosynthetic intermediate and / or secondary products compared to the wild type.

Accordingly, the invention relates to a genetically modified organism described above, characterized in that the genetically modified organism has an increased content of zymosterol and / or its biosynthetic intermediate and / or secondary products compared to the wild type.

Preferred, genetically modified organisms according to the invention are genetically modified yeasts or fungi, in particular genetically modified yeasts, in particular the genetically modified yeast species according to the invention, Saccharomyces cerevisiae, in particular the genetically modified yeast strains Saccharomyces cerevisiae AH22, Saccharomyces cerevisiae GRF, Saccharomyces cerevisiae477 DB47 ,

In the context of the present invention, increasing the content of zymosterol and / or its biosynthetic intermediates and / or secondary products preferably means the artificially acquired ability to increase the biosynthesis of at least one of the aforementioned compounds in the genetically modified organism compared to the non-genetically modified organism.

Accordingly, as mentioned at the beginning, wild type is preferably understood to mean the genetically unmodified organism, but in particular the reference organism mentioned at the beginning.

An increased content of zymosterol and / or its biosynthetic intermediates and / or secondary products compared to the wild type means in particular an increase in the content of at least one of the above-mentioned compounds in the organism by at least 50%, preferably 100%, more preferably 200%, particularly preferably 400 % understood in comparison to the wild type.

The content of at least one of the compounds mentioned is preferably determined by known analytical methods and preferably relates to the compartments of the organism in which sterols are produced. The present invention has the following advantage over the prior art:

The method according to the invention makes it possible to increase the content of zymosterol and / or its biosynthetic intermediate and / or secondary products in the production organisms without suppressing the route to other secondary products and thus restricting the compound portfolio. If specific compounds are to be produced, the suppression or interruption of undesirable metabolic pathways provides an additional increase in the content of the desired product.

The invention is illustrated by the following examples, but is not limited to these:

General experimental conditions

1. Restriction

The plasmids were restricted (1 to 10 μg) in 30 μl batches. For this, the DNA was in 24 ul

H0 added, mixed with 3 ul of the appropriate buffer, 1 ml of RSA (bovine serum albumin) and 2 ul enzyme. The enzyme concentration was 1 unit / ul or 5 units / ul depending on the amount of DNA. In some cases, 1 μl RNase was added to the mixture to break down the tRA. The

Restriction mixture was incubated at 3 ° C for two hours. The restriction was checked with a mini gel.

2. Gel electrophoresis

The gel electrophoresis was carried out in mini gel or wide mini gel apparatus. The mini gels (approx. 20 ml, 8 pockets) and the wide mini gels (50 ml, 15 or 30 pockets) consisted of 1% agarose in TAE. 1 x TAE was used as the running buffer. The samples (10 μl) were mixed with 3 μl stopper solution and applied. I-DNA cut with HindIII (bands at: 23.1 kb; 9.4 kb; 6.6 kb; 4.4 kb; 2.3 kb; 2.0 kb; 0.6 kb) served as the standard. For the separation, a voltage of 80 V was applied for 45 to 60 min. The gel was then stained in ethidium bromide solution and recorded under UV light with the INTAS video documentation system or photographed with an orange filter. 3. Gel elution

The desired fragments were isolated by gel elution. The restriction mixture was applied to several pockets of a mini gel and separated. Only λ-HindIII and a "sacrificial trace" were stained in ethidium bromide solution, viewed under UV light and the desired fragment was marked. This prevented the DNA of the remaining pockets from being damaged by the ethidium bromide and UV light. By placing the colored and unstained gel pieces together, the desired fragment could be cut out of the unstained gel piece using the marking. The piece of agarose with the fragment to be isolated was placed in a dialysis tube, sealed with a little TAE buffer without air bubbles and placed in the BioRad mini-gel apparatus. The running buffer consisted of 1 x TAE and the voltage was 100 V for 40 min. The current polarity was then changed for 2 min in order to dissolve the DNA sticking to the dialysis tube. The buffer of the dialysis tube containing the DNA fragments was transferred into reaction vessels and an ethanol precipitation was thus carried out. For this, 1/10 volume of 3 M sodium acetate, tRNA (1 μl per 50 μl solution) and 2.5 times the volume of ice-cold 96% ethanol were added to the DNA solution. The mixture was incubated at -20 ° C. for 30 min and then centrifuged off at 12,000 rpm, 30 min, 4 ° C. The DNA pellet was dried and taken up in 10 to 50 μl H0 (depending on the amount of DNA).

4. Klenow treatment

The Klenow treatment fills in protruding ends of DNA fragments, so that "blunt ends" arise. The following batch was pipetted together per 1 μg DNA:

DNA pellet + 11 ul H20

+ 1.5 μl 10 x Klenow buffer

+ 1 ul 0.1 M DTT

+ 1 μl nucleotides (dNTP 2 mM)

25 + 1 μl Klenow polymerase (1 unit / μl)

The DNA should come from an ethanol precipitation to prevent impurities from inhibiting the Klenow polymerase. The incubation was carried out for 30 min at 37 ° C, by a further 5 min at 70 ° C

Reaction stopped. The DNA was out of approach obtained by ethanol precipitation and taken up in 10 μl H ₂ 0.

5. Ligation The DNA fragments to be ligated were combined.

The final volume of 13.1 μl contained approx. 0.5 μl DNA with a vector insert ratio of 1: 5. The sample was incubated at 70 ° C for 45 seconds, cooled to room temperature (approx. 3 min) and then incubated on ice for 10 min. The ligation buffer was then added: 2.6 μl 500 mM TrisHCl pH 7.5 and 1.3 μl 100 mM MgCl and incubated on ice for a further 10 min. After the addition of 1 μl 500 mM DTT and 1 μl 10 mM ATP and a further 10 min on ice, 1 μl ligase (1 unit / pl) was added. The entire treatment should be carried out as vibration-free as possible so as not to separate adjacent DNA ends again. The ligation was carried out overnight at 14 ° C.

6. E. coli transformation

Competent Escherichia coli (E. coli) NM522 cells were transformed with the DNA of the ligation mixture. A batch with 50 μg of the pScL3 plasmid ran as a positive control and a batch without DNA ran as a zero control. For every transformation approach

100 μl 8% PEG solution, 10 μl DNA and 200 μl competent cells (E. coli NM522) pipetted into a table top centrifuge tube. The batches were placed in ice for 30 min and occasionally shaken. Then the heat shock occurred: 1 min at 42 ° C.

For the regeneration, 1 ml LB medium was added to the cells and incubated for 90 min at 37 ° C. on a shaker. 100 μl each of the undiluted batches, a 1:10 dilution and a 1: 100 dilution were plated onto LB + ampicillin plates and overnight at

Incubated at 37 ° C.

7. Plasmid isolation from E. coli (miniprep)

E. coli colonies were placed overnight in 1.5 ml LB + ampicillin medium in table top centrifuge tubes at 37 ° C and

Tightened 120 rpm. The next day, the cells were centrifuged for 5 min at 5000 rpm and 4 ° C. and the pellet was taken up in 50 μl TE buffer. Each batch was mixed with 100 μl of 0.2 N NaOH, 1% SDS solution, mixed and placed on ice for 5 min (lysis of the

Cells). Then 400 μl Na acetate / NaCl solution (230 μl H0, 130 μl 3 M sodium acetate, 40 μl 5M NaCl) added, the mixture mixed and placed on ice for a further 15 min (protein precipitation). After centrifugation at 11,000 rpm for 15 minutes, the supernatant, which contains the plasmid DNA, was transferred to an Eppendorf tube. If the supernatant was not completely clear, centrifugation was carried out again. The supernatant was mixed with 360 μl of ice-cooled isopropanol and incubated for 30 min at -20 ° C. (DNA precipitation). The DNA was centrifuged off (15 min, 12000 rpm, 4 ° C.), the supernatant was discarded, the pellet in 100 μl ice-cooled 96%

Washed ethanol, incubated at -20 ° C for 15 min and centrifuged again (15 min, 12000 rpm, 4 ° C). The pellet was dried in Speed Vac and then taken up in 100 μl H0. The plasmid DNA was characterized by restriction analysis. For this purpose, 10 μl of each batch were restricted and separated by gel electrophoresis in a wide mini gel (see above).

8. Plasmid preparation from E. coli (Maxipräp) In order to isolate larger amounts of plasmid DNA, the Maxipräp method was carried out. Two flasks with 100 ml LB + ampicillin medium were inoculated with a colony or with 100 μl of a freezing culture which carries the plasmid to be isolated and incubated overnight at 37 ° C. and 120 rpm. The next day (200 ml) was transferred to a GSA beaker and centrifuged at 4000 rpm (2600 x g) for 10 min. The cell pellet was taken up in 6 ml of TE buffer. To digest the cell wall, 1.2 ml of lysozyme solution (20 mg / ml TE buffer) were added and incubated for 10 min at room temperature. The cells were then lysed with 12 ml of 0.2N NaOH, 1% SDS solution and a further 5 min of incubation at room temperature. The proteins were raised by the addition of 9 ml of chilled 3 M sodium acetate solution (pH 4.8) and a 15 minute incubation

I like ice cream. After centrifugation (GSA: 13000 rpm (27500 xg), 20 min, 4 ° C), the supernatant, which contained the DNA, was transferred to a new GSA beaker and the DNA with 15 ml ice-cold isopropanol and an incubation of 30 min precipitated at -20 ° C. The DNA pellet was washed in 5 ml of ice-cold ethanol and air-dried (approx. 30 to 60 min). Then it was taken up in 1 ml of H20. The plasmid was checked by restriction analysis. The concentration was determined by applying dilutions on a mini gel. To reduce the salt content was a 30- to 60-minute microdialysis (pore size 0.025 microns).

9. Yeast transformation For the yeast transformation, a preliminary cultivation of the strain Saccharomyces cerevisiae AH22 was set up. A flask with 20 ml of YE medium was inoculated with 100 μl of the freezing culture and incubated overnight at 28 ° C. and 120 rpm. The main cultivation was carried out under the same conditions in flasks with 100 ml of YE medium, which were inoculated with 10 μl, 20 μl or 50 μl of the preliminary cultivation.

9.1 Creation of competent cells The next day, the flasks were counted using the Thomas chamber and the flask, which had a cell count of 3 to 5 x 10 ⁷ cells / ml, was continued. The cells were harvested by centrifugation (GSA: 5000 rpm (4000 xg) 10 min). The cell pellet was taken up in 10 ml of TE buffer and divided into two table centrifuge tubes (5 ml each). The cells were centrifuged at 6000 rpm for 3 min and washed twice with 5 ml of TE buffer each. The cell pellet was then taken up in 330 μl of lithium acetate buffer per 10 ⁹ cells, transferred to a sterile 50 ml Erlenmeyer flask and shaken at 28 ° C. for one hour. As a result, the cells were competent for the transformation.

9.2 transformation

For each transformation batch, 15 μl herring sperm DNA (10 mg / ml), 10 μl DNA to be transformed (approx. 0.5 μg) and 330 μl competent cells were pipetted into a table centrifuge tube and incubated for 30 min at 28 ° C. (without shaking). Then 700 μl 50%

PEG 6000 added and incubated for another hour at 28 ° C without shaking. A heat shock of 5 min at 42 ° C followed. 100 μl of the suspension were plated onto selection medium (YNB, Difco) in order to select for leucine prototrophy. In the case of selection for G418 resistance, the cells are regenerated after the heat shock (see under 9.3 Regeneration phase) 9.3 Regeneration phase

Since the selection marker is resistance to G418, the cells needed time to express the resistance gene. The transformation batches were mixed with 4 ml of YE medium and overnight at 28 ° C on the

Incubator (120 rpm) incubated. The next day, the cells were centrifuged off (6000 rpm, 3 min) in 1 ml of YE medium and 100 μl or 200 μl thereof were plated out on YE + G418 plates. The plates were incubated at 28 ° C for several days.

10. Reaction conditions for the PCR

The reaction conditions for the polymerase chain reaction have to be optimized for the individual case and are not unreservedly valid for every approach. Among other things, the amount of DNA used, the salt concentrations and the melting temperature can be varied. For our problem, it turned out to be beneficial to combine the following substances in an Eppendorf cone, which was suitable for use in a thermal cycler: 5 μl Super Buffer, 8 μl dNTP's (2 μl (= 0.1 U) Super Taq Polymerase ( 0.625 μM each), 5 ′ primer, 3 ′ primer and 0.2 μg template DNA, dissolved in so much water that a total volume of 50 μl results for the PCR mixture. The mixture was centrifuged briefly and covered with a drop of oil. Between 37 and 40 cycles were chosen for amplification.

Examples

example 1

Expression of a truncated HMG-CoA reductase in

S. cerevisiae GRF

The coding nucleic acid sequence for the expression cassette from the ADJϊ promoter-tiϊMC? Trypophan terminator was derived from the vector YepH2 (Polakowski et al. (1998) Overexpression of a cytosolic hydroxymethylglutaryl-CoA reductase leads to squalene accumulation in yeast. Appl. Microbiol Biotechnol ; 49 (1): 66-71) by PCR using standard methods as indicated above under the general reaction conditions.

The primers used here are the DNA oligomers AtHT-5 '(forward: tHMGNotF: 5'- CTGCGGCCGCATCATGGACCAATTG-GTGAAAACTG-3'; SEQ. ID. NO. 7) and AtHT-3 '(reverse: tHMGXhoR: 5 '- AACTCGAGAGACACATGGTGCTGTTGTGCTTC-3'; SEQ. ID. No. 8th) .

After a Klenow treatment, the DNA fragment obtained was cloned into the vector pUG6 in the EcoRV interface blunt-end and gave the vector püG6-tHMG (Figure 8).

After plasmid isolation, an extended fragment from the vector pUG-tHMG was amplified by PCR, so that the resulting fragment consists of the following components:

1 oxP-kanMX-ADH- ^' promoter- tHMG-tryptpnan-terminator-2 oxP. As primers, oligonucleotide sequences were selected which each contain the 5 'or 3' sequence of the ÜRA3 gene on the 5 'and 3' overhangs and the sequences of the loxP regions 5 'and 3' of the vector pUG-tHMG in the annealing region. This ensures that on the one hand the entire fragment including KariR and tHMG are amplified and on the other hand this fragment can subsequently be transformed into yeast and by homologous recombination this entire fragment is integrated into the 7A3 gene locus of yeast.

Resistance to G418 serves as a selection marker. The resulting strain S. cerevisiae GRF-tHlura3 is uracil auxotroph and contains a copy of the tHMG gene under the control of the ADfiT promoter and the tryptophan terminator.

In order to subsequently remove the resistance to G418, the yeast strain formed is treated with the cre recombinase vector pSH47 (Guldener U, Heck S, Fielder T, Beinhauer J, Hegemann JH. (1996) A new efficient gene disruption cassette for repeated use in budding yeast. Nucleic Acids Res. Jul 1; 24 (13): 2519-24.). The cre recombinase is expressed in the yeast by this vector, with the result that the sequence region recombines out within the two loxP sequences. As a result, only one of the two loxP sequences and the ΑDH-tHMG-TRP cassette remains in the URA3 gene locus. The result is that the yeast strain loses G418 resistance again and is therefore suitable for integrating or removing further genes into the yeast strain using this cre-lox system. The vector pSH47 can then be removed by counter-selection on YNB agar plates supplemented with uracil (20 mg / L) and FOA (5-fluoroorotic acid) (Ig / L). For this purpose, the cells carrying this plasmid must first be cultivated under non-selective conditions and then grown on selective plates containing FOA. Under these conditions, only cells can grow that are unable to synthesize uracil itself. In this case, these are cells that no longer contain a plasmid (pSH47).

The yeast strain GRF-tHlura3 and the starting strain GRF were cultivated for 48 hours in WMXIII medium at 28 ° C. and 160 rpm in a 20 ml culture volume. Then 500 μl of this preculture were transferred to a 50 ml main culture of the same medium and cultured in a baffle flask for 4 days at 28 ° C. and 160 rpm.

The sterols were obtained using the method described in Parks LW, Bottema CD, Rodriguez RJ, Lewis TA. (1985) Yeast sterols: yeast mutants as tools for the study of sterol metabolism. Methods Enzymol. 1985; 111: 333-46, extracted after 4 days and analyzed by gas chromatography. The values listed in Table 1 result. The percentages relate to the dry yeast weight.

Table 1

Example 2

Expression of ERGl in S. cerevisiae GRF tHlura3

(t-HMG + ERGl)

The sequence of squalene epoxidase was obtained by PCR from genomic DNA from Saccharomyces cerevisiae S288C. The primers used here are the DNA oligomers ERG1-5 '(forward: ErglNotF: 5' - CTGCGGCCGCATCATGTCTGCTGTTAACGT TGC- 3 '; SEQ. ID. No. 9) and ERG1-3' (revers.- ErglXhoR: 5 '- TTCTCGAGTTAACCAATCAACTCAC -3 '; SEQ. ID. No. 10).

The DNA fragment obtained was treated with the restriction enzymes Notl and Xhol and then into the vector pFlatl (Figure 4), which had also previously been treated with the enzymes Notl and Xhol were treated by means of a ligase reaction integrated.

The resulting vector pFlatl-ERGl (Figure 5) contains the ERG gene under the control of the ADff promoter and the tryptophan terminator.

The expression vector pFlatl-ERGl was then transformed into the yeast strain S. cerevisiae GRF tHlura3. The yeast strain S. cerevisiae GRF tHlura3 / pFlatl-ERG2 obtained in this way was then cultivated for 48 hours in WMXIII medium at 28 ° C. and 160 rpm in a 20 ml culture volume. Then 500 μl of this preculture were transferred to a 50 ml main culture of the same medium and cultured in a baffle flask for 4 days at 28 ° C. and 160 rpm.

After 4 days, the sterols were extracted analogously to Example 1 and analyzed by gas chromatography. The values listed in Table 2 result. The percentages relate to the dry yeast weight.

Table 2

Figures la and lb show the absolute (la) and percentage (lb) increase in the content of individual sterols in S. cerevisae GRF tHlura3 / pFlatl-ERGl compared to the parent strain S. cerevisae GRF tHlura3. Example 3

Expression of ERG11 in S. cerevisiae GRF-tHlura3 {t-HMG + ERG11)

The sequence of lanosterol C14 demethylase (ERG11) was obtained by PCR from genomic DNA from Saccharomyces cerevisiae S288C.

The primers used here are the DNA oligomers ERG11-5 '(forward: ErgllNotF: 5'- CTGCGGCCGCAGGATGTCTGCTAC- CAAGTCAATCG -3'; SEQ. ID. No. 11) and ERGl1-3 '(revers: ErgllXhoR: 5'- ATCTCGTGTGTTATAT -3 '; SEQ ID No. 12).

The DNA fragment obtained was treated with the restriction enzymes NotJ and Xhol and then integrated into the vector pFlat3 (Figure 6), which had also previously been treated with the enzymes Notl and Xhol, by means of a ligase reaction. The resulting vector pFlat3-BRGll (Figure 7) contains the ERG I gene under the control of the ADH promoter and the tryptophan terminator.

The expression vector pFlat3-ERGll was then transformed into the yeast strain S. cerevisiae GRF-tHlura3. The yeast strain S. cerevisiae GRF tHlura3 / pFlat3 -ERG11 obtained in this way was then cultivated for 48 hours in WMXIII medium at 28 ° C. and 160 rpm in a 20 ml culture volume. Then 500 μl of this preculture were transferred to a 50 ml main culture of the same medium and cultivated in a baffle flask for 4 days at 28 ° C. and 160 rpm.

After 4 days, the sterols were extracted analogously to Example 1 and analyzed by means of gas chromatography. The values listed in Table 3 result. The percentages relate to the dry yeast weight.

Table 3

Figures 2a and 2b show the absolute (2a) and percentage (2b) increase in the content of individual sterols in S. cerevisae GRF-tHlura3 / pFlat3-ERGll compared to the original strain S. cerevisae GRF tHlura3.

Example 4

Combined expression of ERGl and ERGll in S. cerevisiae

GRF tHlura3 (t-HMG + ERGl + ERGll)

The two episomal expression vectors pFlatl-ERGl (see

Example 2) and pFlat3-E Gll (see Example 3) were transformed together and simultaneously into the yeast strain S. cerevisiae GRF tHlura3 and the two genes ERGl and ERGll were expressed simultaneously under the control of the ADH promoter and the tryptophan terminator.

The yeast strain S. cerevisiae GRF-tHlura3 / pFlatl-ERGl / pFlat3 -ERGll obtained in this way was then cultivated for 48 hours in WMXIII medium at 28 ° C. and 160 rpm in a 20 ml culture volume. Then 500 μl of this preculture were transferred to a 50 ml main culture of the same medium and cultured in a baffle flask for 4 days at 28 ° C. and 160 rpm.

After 4 days, the sterols were extracted analogously to Example 1 and analyzed by gas chromatography. The values listed in Table 4 result. The percentages relate to the dry yeast weight.

Table 4

Figures 3a and 3b show the absolute (3a) and the percentage (3b) increase in the content of individual sterols in S. cerevisiae GRF tHlura3 / pFlatl-ERGl / pFlat3 -ERGll compared to the parent strain S. cerevisae GRF-tHlura3. Since it is known from the prior art (Tainaka et al., J, Ferment. Bioeng. 1995, 79, 64-66) that the overexpression of ERGII does not lead to a significant increase in the ergosterol content in yeast and can be seen from Example 1 is that the expression of a t-HMG does not lead to a significant increase in the ergosterol content in yeast, it is surprising that the overexpression of both genes leads to an increase in the ergosterol content by 100%.

Claims

claims

1. Process for the preparation of zymosterol and / or its biosynthetic intermediates and / or secondary products

Cultivation of organisms which have an increased lanosterol-C14-demethylase activity and an increased HMG-CoA reductase activity compared to the wild type.

2. The method according to claim 1, characterized in that increasing the gene expression of a nucleic acid encoding a lanosterol C14 demethylase compared to the wild type to increase the lanosterol C14 demethylase activity.

3. The method according to claim 2, characterized in that one or more nucleic acids encoding a lanosterol C14-demethylase is introduced into the organism to increase gene expression.

4. The method according to claim 3, characterized in that introducing nucleic acids encoding proteins containing the amino acid sequence SEQ. ID. NO. 2 or a sequence derived from this sequence by substitution, insertion or deletion of amino acids, which has an identity of at least 30% at the amino acid level with the sequence

SEQ. ID. NO. 2, and which have the enzymatic property of a lanosterol-Cl4-demethylase.

5. The method according to claim 4, characterized in that a nucleic acid containing the sequence SEQ. ID. NO. 1 brings.

6. The method according to any one of claims 1 to 5, characterized in that to increase the HMG-CoA reductase activity, the gene expression of a nucleic acid encoding an HMG-CoA reductase is increased compared to the wild type.

7. The method according to claim 6, characterized in that to increase the gene expression, a nucleic acid construct containing a nucleic acid encoding an HMG-CoA reductase is introduced into the organism, the expression of which in the organism is subject to reduced regulation compared to the wild type.

8. The method according to claim 7, characterized in that the nucleic acid construct contains a promoter which is subject to reduced regulation in the organism, compared to the wild-type promoter.

5

9. The method according to claim 7 or 8, characterized in that a nucleic acid encoding an HMG-CoA reductase is used a nucleic acid, the expression of which in the organism, compared to the organism's own ortholog

10 nucleic acid, is subject to reduced regulation.

10. The method according to claim 9, characterized in that a nucleic acid encoding an HMG-CoA reductase is used a nucleic acid that only the catalytic region

15 of the HMG-CoA reductase encoded.

11. The method according to claim 10, characterized in that introducing nucleic acids encoding proteins containing the amino acid sequence SEQ. ID. NO. 4 or one of these

20 Sequence derived by substitution, insertion or deletion of amino acids, which has an identity of at least 30% at the amino acid level with the sequence SEQ. ID. NO. 4, and which have the enzymatic property of an HMG-CoA reductase.

25

12. The method according to claim 11, characterized in that a nucleic acid containing the sequence SEQ. ID. NO. 3 brings.

13. The method according to any one of claims 1 to 12, characterized in that an organism is used which additionally has an increased squalene epoxidase activity compared to the wild type.

14. The method according to claim 13, characterized in that to increase the squalene epoxidase activity, the gene expression of a nucleic acid encoding a squalene epoxidase is increased compared to the wild type.

15. The method according to claim 14, characterized in that one or more nucleic acids encoding a squalene epoxidase is introduced into the organism to increase gene expression.

45

16. The method according to claim 15, characterized in that introducing nucleic acids encoding proteins containing the amino acid sequence SEQ. ID. NO. 6 or a sequence derived from this sequence by substitution, insertion or deletion of 5 amino acids, which has an identity of at least 30% at the amino acid level with the sequence SEQ. ID. NO. 6, and which have the enzymatic property of a squalene epoxidase.

10. The method according to claim 16, characterized in that a nucleic acid containing the sequence SEQ. ID. NO. 5 brings.

18. The method according to any one of claims 1 to 17, characterized in that 15 yeast is used as the organism.

19. The method according to any one of claims 1 to 18, characterized in that after culturing the organism is harvested and then zymosterol and / or its biosynthetic

20 intermediate and / or secondary products isolated from the organism.

20. Nucleic acid construct containing nucleic acids encoding a lanosterol C14 demethylase and nucleic acids encoding an HMG-CoA reductase, which are functionally linked to one or more regulatory signals that ensure transcription and translation in organisms.

21. A nucleic acid construct according to claim 20, additionally containing nucleic acids which encode a squalene epoxidase. 0

22. Combination of nucleic acid constructs, the combination

a) a first nucleic acid construct containing nucleic acids encoding a lanosterol-Cl4-demethylase, which are functionally linked to one or more regulatory signals, which ensure transcription and translation in organisms and

B) a second nucleic acid construct, containing nucleic acids encoding an HMG-COA reductase, which are functionally linked to one or more regulatory signals which ensure transcription and translation in organisms 5.

23. A combination according to claim 22, characterized in that the combination

c) yet another, third nucleic acid construct, containing 5 nucleic acids encoding a squalene epoxidase, which are functionally linked to one or more regulatory signals which ensure transcription and translation in organisms.

24. Nucleic acid constructs or a combination of nucleic acid constructs according to one of claims 20 to 23, characterized in that the regulation signals contain one or more promoters and one or more terminators which carry out the transcription and translation in organisms

15 ensure.

25. Nucleic acid constructs or a combination of nucleic acid constructs according to claim 24, characterized in that regulation signals are used which ensure transcription and translation in yeasts.

26. Genetically modified organism, the genetic modification increasing the activity of a lanosterol C14 demethylase and an HMG-CoA reductase compared to a wild type. 5

27. Genetically modified organism according to claim 26, characterized in that the increase in lanosterol-Cl4-demethylase activity is caused by an increase in the gene expression of a nucleic acid encoding a lanosterol-C14-demethylase compared to the wild type.

28. Genetically modified organism according to claim 27, characterized in that the organism contains two or more nucleic acids encoding a lanosterol Cl4 demethylase. 5

29. Genetically modified organism according to one of claims 26 to 28, characterized in that the increase in the HMG-CoA reductase activity is caused by an increase in the gene expression of a nucleic acid encoding an HMG-CoA reductase compared to the wild type.

30. Genetically modified organism according to claim 29, characterized in that the organism contains a nucleic acid construct containing a nucleic acid encoding an HMG-CoA-5 reductase, the expression of which in the organism is subject to reduced regulation compared to the wild type.

31. Genetically modified organism according to claim 30, characterized in that the nucleic acid construct contains a promoter which is subject to a reduced regulation in the organism compared to the wild type.

32. Genetically modified organism according to claim 30 or 31, characterized in that a nucleic acid encoding an HMG-CoA reductase is used as a nucleic acid which encodes only the catalytic region of the HMG-CoA reductase.

33. Genetically modified organism according to one of claims 26 to 32, characterized in that the genetic change additionally increases the squalene epoxidase activity compared to a wild type.

34. Genetically modified organism according to claim 33, characterized in that the increase in squalene epoxidase activity is caused by an increase in the gene expression of a nucleic acid encoding a squalene epoxidase activity compared to the wild type.

35. Genetically modified organism according to claim 34, characterized in that the organism contains two or more nucleic acids encoding a squalene epoxidase activity.

36. Genetically modified organism according to one of claims 26 to 35, characterized in that the genetically modified organism has an increased content of zymosterol and / or its biosynthetic intermediate and / or secondary products compared to the wild type.

37. Genetically modified organism according to one of claims 26 to 36, characterized in that yeast is used as the organism.

38. Use of a genetically modified organism according to one of claims 26 to 37 for the production of zymosterol and / or its biosynthetic intermediates and / or secondary products.

39. A process for the production of genetically modified organisms according to one of claims 26 to 37, characterized in that nucleic acids according to one of claims 3 to 5 and nucleic acid constructs according to one of claims 7 to 11 are introduced into the genome of the starting organism.

40. The method according to claim 39, characterized in that nucleic acids according to one of claims 15 to 17 are additionally introduced into the genome of the starting organism.

41. Use of the nucleic acids according to one of claims 3 to 5 or 15 to 17 or the nucleic acid constructs according to one of claims 7 to 11 to increase the content of zymosterol and / or its biosynthetic intermediate and / or secondary products in organisms.