EP1432816A2 - Verwendung von wirksubstanzen zur prophylaxe und/oder therapie von erkrankungen, die mit zellwachstumsstörungen einhergehen, und testsystem zum auffinden solcher wirksubstanzen - Google Patents

Verwendung von wirksubstanzen zur prophylaxe und/oder therapie von erkrankungen, die mit zellwachstumsstörungen einhergehen, und testsystem zum auffinden solcher wirksubstanzen

Info

Publication number
EP1432816A2
EP1432816A2 EP02781109A EP02781109A EP1432816A2 EP 1432816 A2 EP1432816 A2 EP 1432816A2 EP 02781109 A EP02781109 A EP 02781109A EP 02781109 A EP02781109 A EP 02781109A EP 1432816 A2 EP1432816 A2 EP 1432816A2
Authority
EP
European Patent Office
Prior art keywords
nlk
kinase
activity
complex
cop9
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP02781109A
Other languages
English (en)
French (fr)
Inventor
Wilfried Rossoll
Michael Anton Sendtner
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Julius Maximilians Universitaet Wuerzburg
Original Assignee
Medinnova Gesellschaft fuer Medizinische Innovationen aus Akademischer Forschung mbH,
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Medinnova Gesellschaft fuer Medizinische Innovationen aus Akademischer Forschung mbH, filed Critical Medinnova Gesellschaft fuer Medizinische Innovationen aus Akademischer Forschung mbH,
Publication of EP1432816A2 publication Critical patent/EP1432816A2/de
Withdrawn legal-status Critical Current

Links

Classifications

    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6803—General methods of protein analysis not limited to specific proteins or families of proteins
    • G01N33/6842—Proteomic analysis of subsets of protein mixtures with reduced complexity, e.g. membrane proteins, phosphoproteins, organelle proteins
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/48—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving transferase
    • C12Q1/485—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving transferase involving kinase
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2500/00—Screening for compounds of potential therapeutic value

Definitions

  • the invention relates to the use of at least one active substance which modulates at least one kinase of the C0P9 / signalosome complex for the therapy and / or prophylaxis of diseases which are associated with cell growth disorders and a test system for finding such active substances.
  • kinases represent the essential components of the different signal transmission paths from the cell membrane to the cell nucleus and furthermore initiate the inactivation of proteins, their removal from the cell nucleus and their proteolytic degradation in the proteasomes of the cytoplasm and the cell nucleus.
  • Nemo-like kinase (Nlk), for example, is known as such a kinase that intervenes in the regulatory processes.
  • the Nlk has been described as part of the TAKl-Nlk-MAPK signaling pathway (Brott et al., PNAS USA 95, 963-968, 1998).
  • TAK1 transforming growth sector activated kinase 1
  • TCF T-cell factor
  • LEF Lyphoid Enhancer Factor
  • Nlk for the transcription activity of the TCF / LIF complex of the TAKl-Nlk-MAPK signal transmission path is thus known (Ishitani et al., Nature 399, 798-802, 1999). Furthermore, the Nlk inhibits the signal transmission path induced by Wnt. Inactivation can take place here by the proteolytic degradation of the proteins phosphorylated by Nlk in the proteasomes. Due to the increased degradation of these phosphorylated proteins (transcription factors), differentiation processes in the cell can be modulated depending on their promoter specificity.
  • the COP9 / signalosome of the mammalian cell is a protein complex that interferes in such signal transmission paths in different ways.
  • a special function of the C0P9 / signalosome complex appears to be its participation in the cellular degradation of proteins (Schwechheimer and Deng Semin., Cell Dev. Biol. 11, 495-503, 2000).
  • the COP9 / signalosom complex consists of at least 8 subunits (CSN1-CSN8) and has kinase activity (Seeger et al., FASEB J, 12, 469-478, 1998). The functions of some of these subunits have been described.
  • the overexpression of the subunit CSN1 inhibits the kinase activity of JNK and the activity of the Jun / Fos (AP-1) transcription complex (Tsuge et al., JMB 305, 1-9, 2001).
  • Overexpression of the CSN2 subunit enhances the transcriptional activity of AP-1 by phosphorylation and activation of c-Jun (Naumann et al., J Biol Chem, 274 (50), 35297-35300, 1999), enhances the function of the free (non-hormone) -bound) thyroid hormone recipe as a repressor of transcription (Lee et al., Mol. Endocrinol. 9, 243254, 1995).
  • the subunit CSN2 presumably represents the thyroid hormone receptorinteracting protein 15 (Trip 15), which binds to the interferon consensus sequence binding protein (ICSBP) and phosphorylates it. This phosphorylation is necessary for the binding of the ICSBP to the interferon regulatory factor-1 (IRF-1) and the repression of transcriptional activity caused thereby (Cohen et al., J Biol Chem, 275 (50), 39081-39089, 2000).
  • the CSN5 subunit has a variety of functions: as "Jun-activation domain-binding protein-1" (JAB-1), CSN5 stabilizes the interaction of the c-Jun protein in AP-1 with the AP-I- 5 promoter element. It also associates with the cytoplasmic domain of Intergrin LFA-1. When this integrin binds to components of the extracellular matrix, CSN5 is released and is given the opportunity to penetrate into the none in order to increase the AP-1 promoter activity here
  • CSN5 is involved in the phosphorylation and translocation of the p27 protein into the cytoplasm and the proteolytic degradation there in the proteasomes.
  • P27 inhibits the complexes of Cycline EA with cdk2 and cdkl. A decrease in p27
  • CSN5 acts on the progesterone receptor and the steroid receptor coactivator-1 (SRC-1), stabilizes the complexes between the two and their DNA binding (Chaochereao et el., J Biol Chem 275, 8540-8548, 2000). CSN5 potentiates the activity
  • CSN5 is involved in the protein degradation of the choriogonadotropin receptor. CSN5 is involved in the complex formation between Bcl-3 and NFkB and
  • CSN5 binds to p53, induces its phosphorylation and proteolytic degradation (Bech-Otschir et al., Embo J 20, 1630-1639, 2001).
  • the CSN6 subunit is identical to the human HIV-1 Vpr interacting protein (VIP) (Mahalingam et al., PNAS 95,
  • Vpr causes a redistribution of the CSN6 from the nucleus to the nucleus periphery and a blockage of the cell division at the G2 / M phase transition. It is not yet known whether the respective CSN proteins perform the function assigned to them alone or in combination.
  • Such diseases can be related, for example, to uncontrolled or undesired cell proliferation, for example in the case of tumor diseases, leukaemias, autoimmune diseases, rheumatoid diseases, skin diseases, in particular psoriasis, organ rejection or immune reactions, or uncontrolled cell death, for example in the case of viral and bacterial infectious diseases, Alzheimer's , Creutzfeld-Jakob syndrome, multiple sclerosis, Parkinson's disease, spinal muscular atrophies, diabetic neuropathies, amyotrophic lateral sclerosis or cerebral ischemia. It is also of particular interest to answer the question of which building blocks of the
  • the invention is therefore based on the technical problem of specifying a method for identifying substances which modulate the C0P9 / signalosome complex. Furthermore, the invention is based on the technical problem of specifying substances and medicaments which are suitable for the treatment of the above diseases.
  • a molecule which is naturally dependent on a further member of the COP9 / signalosome complex, ie not Nlk, is a substance in a cell, in particular a wild-type cell, the is modulated directly or indirectly by the further member, for example induced, activated or inhibited (for example phosphorylated). These are in particular substances modulated by CSN1 to CSN8, as described above.
  • the invention is based on a number of surprising findings. It was found that the Nlk, which was previously described as part of the TAKl-Nlk-MAPK signal transmission path, is also part of the C0P9 / Signallosom complex.
  • the Nlk also has an inhibitory kinase activity for the COP9 / signalosome, which consists in the phosphorylation of a number of transcription factors, for example c-Jun, and results in inactivation of these transcription factors. Furthermore, it was found that Nlk phosphorylates those serines of c-Jun which are located at positions other than those serines which are phosphorylated by the kinases JNK or ERK (Guerrini et al., J Neurosci 17, 6057-6063, 1997; Schmidt -Ullrich et al., Development 122, 2117-2128, 1996).
  • Nlk in the C0P9 / signalosome significantly reduced the activity of the transcription factor complex AP-1. This repression of transcription activity by Nlk was not limited to AP-1, but could also be proven for other transcription factors such as NFkB. Furthermore, it was found with the present invention that Nlk is connected to the subunits CSN7a and CSN7b of the COP9 / signalosome, 5 but does not have a direct connection to the CSN5 subunit. The surprising finding of the present invention that COP9 / signalosomes as well as the associated Nlk play a decisive role in the modulation of the activity of proteins which promote cell proliferation, cell differentiation
  • control cell death for example NFkBAP-1
  • TCF / LEF, p27, p53, Vpr, ICSBP and SRC-1 has led to the technical teaching of the invention, which possibilities for the use of active substances for the prophylaxis and / or therapy of diseases associated with cell
  • Nlk is particularly strongly expressed in brain tissue (Brott et al., PNAS USA 95 @
  • the invention therefore relates to the use of at least
  • the active substance for the prophylaxis and / or therapy of diseases which are associated with cell growth disorders, the active substance (s) modulating the activity of at least one kinase of the COP9 / signalosome complex.
  • the modulation of at least one kinase is according to the present
  • the 30 invention is an inhibition or enhancement of the activity of the kinase.
  • the modulated kinase is the Nlk kinase.
  • Active substances in the sense of the present invention are substances which are capable of at least one kinase of
  • 35 C0P9 / signalosome complex to modulate can be are active substances which inhibit or enhance the activity of kinases, for example by phosphorylation or dephosphorylation.
  • active substances in the sense of this invention are derivatives of the active substances which are converted into an active substance according to the invention, for example by enzymatic cleavage, and also precursors of active substances which are metabolically converted into a substance which is active according to the invention.
  • the active substance (s) used is or are preferably selected from
  • Phosphokinase inhibitors for example 70H-staurosporins and their phosphokinase inhibiting derivatives, butyrolactones, Roscovitine, Purvalanol A, Emodin, anilinoquin azolines (PD-168393 and PD 169414), PD 184352
  • Antisense oligonucleotides which attach themselves specifically to the DNA sequence or RNA sequence coding for Nlk and inhibit their transcription or translation; Antibody or antibody fragments specific for Nlk; Fusion proteins containing at least one antibody fragment, for example an Fv fragment, which inhibit the kinase activity of the Nlk; Gene for Nlk, inserted into a plasmid and mixed with a substance that supports cell transfection, for example cationic lipids or cationic polymers; Gene for Nlk inserted into a vector; Gene for Nlk with inserted negative dominant mutation; Antisense oligonucleotides that attach specifically to the DNA sequence or M-RNA sequence and code for Nlk and inhibit their transcription or translation, antibody or antibody fragments
  • the invention further relates to a test system for finding active substances which modulate the activity of at least one kinase of the COP9 / signalosome complex, comprising: a. at least one sample containing at least one COP9 / signalosome complex and b. at least a means for determining the activity of at least one kinase of the COP9 / signalosome complex.
  • a sample is preferably, for example, at least one cell containing at least one COP9 / signalosome complex, the activity of the respective kinase (s), preferably Nlk, being modulated.
  • the cells include, for example, pro- and eukaryotic cells, in particular cells which, as wild-type cells, express at least one active kinase of the COP9 / signalosome, preferably Nlk. In cells which do not or only to a lesser extent express the respective active kinase (s) of the COP9 / signalosome as wild-type cells, expression can be achieved by methods known to the person skilled in the art.
  • Such methods include, for example, infection, transfection or transformation of cells with vectors which contain nucleic acids which code for the respective active kinase (s) of the COP9 / signalosome, preferably Nlk, or parts thereof.
  • Cells in the sense of the present invention are cells from different organs and tissues, for example cells of the blood and lymph vessels or cells that line the body cavities.
  • cell cultures in particular eukaryotic cell cultures, for example 293, 293T and 293T7 cell cultures from Homo sapiens, B82, NIH3T3, L929 cell cultures from Mus musculus, BHK cell cultures from Cricetus cricetus, CHO cell cultures from Cricetulus griseus, MDCK cell cultures from Canis familiaris, Vero, COS-1 and COS-7 cell cultures from Cercopithecus aethiops and / or primary embryo fibroblasts from Gallus gallus (CEF cells).
  • a sample can also be at least one cell extract, at least one protein mixture and / or at least one mixture containing at least one COP9 / signalosome complex, preferably Nlk.
  • sample also includes cell extracts which can be obtained, for example, from one of the cells listed above using standard methods known to the person skilled in the art. Methods suitable for this include, but are not limited to, “freeze thawing", “sonification” or “French pressing". If necessary, such a cell extract can be worked up or purified in further steps. Preferred steps include, for example, precipitation or filtration processes and / or chromatographic process steps. Suitable chromatographic methods are known to the person skilled in the art and include, for example, anion or cation exchange chromatography, affinity chromatography and / or size exclusion chromatography.
  • the sample can also be a mixture of purified or recombinant proteins containing at least one COP9 / signalosome complex, preferably Nlk, and / or a protein mixture which additionally contains further components, for example agents which are used to determine the activity of the kinase ( n), preferably Nlk, of the C0P9 / signalosome complex can be used.
  • a sample is preferably an isolated C0P9 / signalosome complex, the activity of the respective kinase (s), preferably Nlk, being modulated.
  • Means for determining the activity of at least one kinase, preferably the Nlk, of the COP9 / signalosome complex are, for example, substrates of the kinase (s), buffers, detergents, protease inhibitors, NTPs and / or suitable metal ions.
  • a preferred embodiment relates to a test system in which the sample a. at least one gene coding for at least one negative mutant of at least one kinase and / or b. contains at least one negative mutant of at least one kinase.
  • a sample used in this embodiment is, for example, a cell that has reduced or no activity of a kinase, preferably Nlk activity, of the COP9 / signalosome complex. This can be achieved, for example, by introducing a negative, especially a dominant negative, mutation.
  • Another object of this invention relates to a method for finding at least one active substance for the prophylaxis and / or therapy of cell growth disorders, which acts on at least one kinase of the COP9 / signalosome complex in such a way that the cell growth is modulated, comprising the following steps: a , Bringing at least one sample into contact with at least one potential active substance, and b. Determine the activity of at least one kinase of the COP9 / signalosome complex. Contacting in the sense of the present invention can be done, for example, by adding the
  • Active substances in the nutrient medium of a cell culture or by local or systemic administration of the active substances into an organism also includes, for example, any form of mixing, it being possible for both the sample to be added to the potential active substance and the potential active substance to the sample.
  • the sample and / or the potential active substance can each be present as a solid, solution, suspension, slurry or bound to a solid phase. If the sample that is brought into contact with potential active substance (s) is a cell, the contacting step also includes methods known in the art which allow the introduction of substances into intact cells, such as, for example Infection, transfection and / or transformation.
  • the potential active substance is naked DNA, viruses, viroids, virosomes and / or liposomes, the liposomes or virosomes also being suitable, in addition to a potentially active nucleic acid molecule, further potential active substances with the sample to bring in contact.
  • a number of further methods are known to the person skilled in the art which serve to introduce potential active substances into cells.
  • Determining the activity of at least one kinase, preferably Nlk, of the COP9 / signalosome complex in the sample is possible through a number of direct and indirect detection methods. The appropriate methods depend on the nature of the sample. In cells, the activity of the kinase (s), preferably Nlk, is determined on the one hand by the amount of kinase (s) expressed in the cell and on the other hand by the amount of activated kinase (s). The transcription of the genes encoding the kinase (s), in particular Nlk, can be activated, for example, by determining the amount of the kinase mRNA.
  • Standard methods known in the prior art for determining the amount of RNA include, for example, DNA chip hybridization, RT-PCR, "pri er” extension and “RNA protection”.
  • the kinase activity which is based on the induction or repression of the transcription of the respective kinase gene (s) can also be determined by coupling the kinase promoter to suitable reporter gene constructs.
  • the increase in the expression of the kinases can also be detected at the protein level, in which case the amount of the protein is detected, for example, by antibodies directed against the kinase (s).
  • the change in the activity of the kinase (s) can, however, also be attributed to increased or decreased phosphorylation or dephosphorylation of the kinase (s).
  • the change in the phosphorylation of the kinase (s) can be detected, for example, by antibodies which are directed against phosphorylated amino acids.
  • the present invention further relates to a medicament for the prophylaxis and / or therapy of line growth disorders, comprising at least one active substance according to the invention and, if appropriate, suitable auxiliaries and additives.
  • the active substance according to the present invention is preferably prepared for local or systemic administration into an organism with the aid of the methods and auxiliaries and / or additives known to the person skilled in the art to give a medicament.
  • a medicament of the present invention is preferably used for diseases which are associated with Cell growth disorders are used.
  • Suitable auxiliaries and additives which serve, for example, to stabilize or preserve the drug or diagnostic agent, are generally known to the person skilled in the art (see, for example, Sucker H et al. (1991) Pharmaceutical Technology, 2nd edition, Georg Thieme Verlag, Stuttgart).
  • auxiliaries and / or additives are physiological saline solutions, Ringer's dextrose, dextrose, Ringer's lactate, demineralized water, stabilizers, antioxidants, complexing agents, antimicrobial compounds, proteinase inhibitors and / or inert gases.
  • Local administration can take place, for example, on the skin, on the mucous membrane, in a body cavity, in an organ, in a joint or in the connective or supporting tissue.
  • Systemic administration is preferably carried out in the bloodstream, in the peritoneal cavity or in the abdominal cavity.
  • the pharmaceutical preparation containing the active substance according to the invention depends on the type of active substance and the way in which it is administered and can be, for example, a solution, a suspension, an ointment, a powder, a spray form or another inhalation preparation.
  • Nucleotide sequences are preferably inserted into a viral vector or a plasmid using methods known to the person skilled in the art and auxiliary substances for cell transfection are added.
  • auxiliaries include, for example, cationic polymers or cationic lipids.
  • Antisense oligonucleotides are derivatized using the methods familiar to the person skilled in the art in order to protect them from enzymatic degradation by DNAsen or RNAsen.
  • the active substance according to the invention can be in the form of a salt, ester, amide or as a precursor, preference being given to using only modifications of the active substance which do not trigger excessive toxicity, irritation or allergic reactions in the patient.
  • the active substance is made under sterile conditions, with a physiologically acceptable carrier known to the person skilled in the art and possible Preservatives, buffers or propellants mixed as required.
  • the active substance according to the invention is preferably administered in a single dose, particularly preferably in several doses, the individual doses not exceeding the maximum tolerable dose (MTD) of the respective active substance for humans.
  • a dose is preferably chosen which is half the MTD.
  • the MTD in the tumor patient is 50 mg / ml / dx3 (Senderowicz et al J Clin Oncol 16 (9):
  • flavopiridol is thus to be administered in a daily dose of 0.1-50 mg / m 2 , preferably 5-30 mg / m 2 , particularly preferably 25 mg / m 2 .
  • the daily dose can be taken once a day or in several portions
  • the administration can be either local or systemic, only on one day or over several days daily or on every second or third day over several weeks.
  • Another object of this invention relates to a method for producing a medicament according to the invention for the prophylaxis and / or therapy of cell growth disorders, which promotes cell growth or
  • Nlk associated with the C0P9 / signalosome complex play an important role in the coordination of the signaling pathways of Wnt, NFkB, API, thyroid hormone receptor and probably also of cell cycle regulators in neurons and glial cells.
  • a cDNA clone for the entire CSN7a as well as for the related CSN7b and for Csn5 was isolated from RNA extracts from mouse brain using RT-PCR (Wei et al., Curr Biol 8, 919-922, 1998).
  • HA Haemagglutinin
  • Nlk FLAG labeled Nlk
  • Csn7a Csn7b and Csn5 proteins were cloned using RT-PCR and the use of the following primers: HA-CSN 7a Hin: ATAGGTACCACCATGTACCCCTACGACGTGCCCGACTACGCCATGAGTGCGGAGGTG AAGGTG, scaffold: ATAGAATTCAGTTCGATCTTGGACCAA
  • HA-CSN7b Hin ATAGGATCCACCATGTACCCCTACGACGTGCCCGACTACGCCATGGCAGGTGAACAG AAACCCTCAAG, scaffold: ATAGAATTCCTAGTGGCGGCTGGAGACCAG FLAG-Nlk
  • CAACAGC re: ATAGGATCCACAGTCACTCCCACACCAGAGG
  • Example 2 Activity of the Nlk in the C0P9 / signalosome complex on transcription factors To characterize the kinase activity of
  • COP9 / signalosomes, immune complex kinase assays were performed with Nlk.
  • HEK293 cells were transfected with expression vectors coding for the FLAG-labeled wild-type Nlk and for the FLAG-labeled enzyme-deficient K84R Nlk mutant.
  • the expressed proteins were in anti-CSNl Immunoprecipitates detected.
  • Such immunoprecipitates of the transfected cells as well as of control cells were incubated with the protein substrates c-jun (from Promega, Madison, USA) or GST-c-jun (from Santa Cruz, Santa Cruz, USA).
  • Reporter gene assays were carried out to demonstrate the activity of Nlk on different signaling pathways.
  • wild type or the negative mutant of Nlk was co-expressed in HEK293 cells with different reporter gene constructs.
  • Both the reporter gene for the transcription factors TCF / LEF induced by Wnt and the reporter genes for AP-1 and NFkB and the thyroid hormone receptor showed an inhibitory effect due to the active Nlk.
  • the kinase-negative mutant K84R Nlk did not reduce the AP-1, TCF / LEF and NFkB inducible reporter gene expression and instead had a strongly stimulating effect especially with AP-1 and NFkB reporter gene constructs.
  • Example 3 Non-cellular and cellular test system containing COP9 / signalosome complexes with active Nlk or with negatively imitated Nlk.
  • the sample contains cells, cell extracts or protein mixtures which Nlk, also parts thereof or as a control, negative mutated Nlk. Examples of the production of such cells, cell extracts or protein mixtures have already been described in detail in Example 1.
  • An example of negatively mutated Nlk is the K84R mutant of Nlk already described in Example 1, which no longer has any kinase activity.
  • Such cells, cell extracts or protein mixtures are mixed with the substance to be tested in any concentration. After an incubation period of 10 seconds to 24 hours, the activity of the Nlk is determined.
  • the activity of Nlk is determined by the phosphorylation of suitable substrates, for example c-Jun.
  • the activity of Nlk is determined indirectly by measuring the activation of target genes via reporter gene assays.
  • Suitable reporter genes for example luciferase, SEAP or GFP, are under the control of promoters which are subject to regulation by transcription factors which are regulated directly or indirectly by Nlk. These include AP-1, NFkB, thyroid hormone receptor and TCF / LEF.
  • the activity of Nlk can be determined by changing the differentiation of cells, in particular neuronal cells, glial cells, their precursors or also neural stem cells, for example morphologically in cell culture and under the microscope.
  • the activity of Nlk can be determined by changing the survival rate of cells.
  • Example 4 Test system consisting of cells in which the gene for Nlk was removed or extracts therefrom
  • the test system consists of cells in which the gene for Nlk has been removed or inhibited.
  • This enables the testing of active substances that can prevent or reduce diseases in mammals.
  • the removal of the gene for Nlk in embryonic cells or in tissue cells is carried out, for example, with the aid of the introduction of anti-sense oligonucleotides for Nlk and the resulting blockade of the transcription and / or translation of the gene for Nlk.
  • An example of the inhibition of cellular Nlk is the introduction and overexpression of kinase negative mutants of the Nlk gene.
  • Example 5 Test system for measuring the kinase activity of Nlk with the substrate c-Jun.
  • a cell line (HEK 293) is transient with an Nlk clone provided with an N-terminal with the FLAG epitope tag (Sigma) (accession no .: NM_008702: Brott et al., 1998) transfected in the expression vector pcDNA3 (Invitrogen).
  • a mutated Nlk clone with greatly reduced kinase activity is used as a control of the specificity (preferably a negatively mutated Nlk protein, such as, for example, with a mutation of lysine at position 155 to arginine).
  • the FLAG-labeled proteins are purified by immunoprecipitation.
  • 1 mg of the extract are incubated with 1.0 ⁇ g of anti-flag antibodies (anti-flag M2 agarose, Sigma) for 1 hour at + 4 ° C. with constant mixing.
  • the immunoprecipitates are washed five times by centrifuging and resuspending in lysis buffer.
  • 0.5 ⁇ g c-Jun protein Promega
  • l ⁇ Ci [ ⁇ - 32 P] ATP Amers
  • the proteins are then blotted (Fastblot, Biometra) on nitrocellulose membranes (Protran BA 83; Schleicher & Schüll) and, depending on the intensity of the signal, exposed for several hours to days in X-ray film cassettes with imaging plates (BAS SR Imaging Plates, Fuji) ,
  • the evaluation is carried out by scanning in the phosphor imager (BAS2500, Fuji) and quantifying the signals caused by radio-labeled c-jun using analysis software (AIDA, Raytest).
  • Example 6 Test system for measuring the Nlk-modulated reporter gene activity A cell line (HEK 293) is transiently transfected with two expression plasmids: 5 1.) an N-terminal clone provided with the FLAG epitope tag in the expression vector pcDNA3. In a further transfection, a mutated Nlk clone with greatly reduced kinase activity is used as a control of the specificity (preferably a mutated Nlk protein with a muta-
  • reporter gene construct in which a reporter gene (for example Luciferase, de Wet et al., 1987) under the control of, for example, the AP-1-dependent collagenase promoter (van Dam et al., 1993), an NFkB-dependent pro
  • a reporter gene for example Luciferase, de Wet et al., 1987
  • AP-1-dependent collagenase promoter van Dam et al., 1993
  • Another reporter gene construct in which another reporter gene (for example ⁇ -galactosidase (Hall et al., 1983) or Renilla-Luciferase, Lorenz et al., 1991) is expressed by another promoter not influenced by Nlk
  • the Nlk inhibitor to be tested is added to the cells in concentrations of InMol to 100 ⁇ mol. 48 hours after transfection (lipofectamine
  • EXAMPLE 7 Test System for Measuring the Modulation of the Neddulation of Cellular Proteins by Nlk
  • a cell line (HEK 293) is transiently transfected with two expression plasmids: 1.) an Nlk clone provided with the FLAG epitope tag in the expression vector pcDNA3.
  • a mutated Nlk clone with greatly reduced kinase activity is used as a control of the specificity (preferably a mutated Nlk protein with a mutation of lysine at position 155 to arginine)
  • the Nlk inhibitor to be tested is added to the cells in concentrations of InMol to lOO ⁇ Mol.
  • 48 hours after the transfection (Lipofectamin 2000, Life Technologies), the cells are washed with PBS and lysed in lysis buffer (see above).
  • the protein extract is centrifuged off, the supernatant mixed with 2x Laemmli buffer (see above) in a ratio of 1: 1, briefly boiled and cooled on ice.
  • polyacrylamide gel electrophoresis polyacrylamide with gradient gels of 5-20%
  • they are blotted onto nitrocellulose ambrane (Protran BA 83; Schleicher & Schüll) (Biometra Fastblot).
  • Western membranes are used to analyze the membranes 5% dry milk in TBS-T (20mM Tris-HCl pH7.6, 137mM NaCl, 0.1% Tween 20) blocked for 30 minutes, incubated for 1 hour in TBS-T with the anti-HA antibody (HA.11, Babco) and washed three times for 15 minutes with TBS-T. Then the membrane is incubated with a peroxidase-coupled anti-mouse secondary antibody (Rockland) for 30 minutes and washed three times for 15 minutes with TBS-T.
  • TBS-T 20mM Tris-HCl pH7.6, 137mM NaCl, 0.1% Tween 20
  • the membranes are incubated for 1 minute in detection reagent (ECL, Amersham), placed on X-ray films (Super RX, Fuji) in a dark room and, depending on the signal intensity, exposed for 1 second to 1 hour.
  • the Nedd8-conjugated proteins labeled with the HA antibody appear as blackening on the films and can be quantified by densitometric analyzes. Results: The amount of Nedd ⁇ -conjugated proteins is reduced after transfection of wild-type Nlk and increased of negatively mutated Nlk. Adding an Nlk inhibitor to cells transfected with wild-type Nlk increases the amount of detectable Nedd ⁇ -conjugated proteins.
  • Example 8 Test system for measuring the modulation of the ubiquitination of cellular proteins by Nlk:
  • a cell line (HEK 293) is transiently transfected with two expression plasmids: 1.) an Nlk clone in the N-terminal provided with the FLAG epitope tag Expression vector pcDNA3.
  • a mutated Nlk clone with greatly reduced kinase activity is used as a control of the specificity (preferably a mutated Nlk protein with a mutation of lysine at position 155 to arginine)
  • the Nlk inhibitor to be tested is added to the cells in concentrations of InMol to 100 ⁇ mol.
  • the cells are washed with PBS (Life Technologies and guanidine-HCl buffer (6M guanidine-HCl, 0.1M Na-phosphate pH-8, 5mM imidazole).
  • PBS Life Technologies
  • guanidine-HCl buffer 6M guanidine-HCl, 0.1M Na-phosphate pH-8, 5mM imidazole.
  • the extracts are incubated in 1.5 ml reaction vessels with 50 ⁇ l nickel chelate agarose (Ni 2+ -NTA, Qiagen) for 1 hour at + 4 ° C.
  • the Ni-NTA agarose is incubated with protein buffer containing 250 mM I idazol (Sigma) at room temperature for 30 minutes and centrifuged. The supernatant is mixed with 2x Laemmlibuffer, boiled and separated by electrophoresis as described above in the "Test system for measuring the modulation of the neddylation of cellular proteins by N1K" and the proteins conjugated with HA-ubiquitin are detected by Western blot analysis.
  • results The amount of proteins conjugated with HA-ubiquitin is reduced after transfection of wild-type Nlk and increased of negatively mutated Nlk. Adding an Nlk inhibitor to cells which have been transfected with wild-type Nlk, increases the amount of detectable proteins conjugated to HA-Ubiquitin.
  • Example 9 Substances which have a modulating effect in test systems according to the invention
  • the choice is made according to whether unwanted proliferation is to be prevented or uncontrolled cell death is to be prevented. This can easily be tested in a correspondingly selected cellular or animal model system for the respective disease.
  • Nlk is a murine protein kinase related to Erk / MAP kinases and localized in the nucleus.
  • Murine polyubiquitin mRNA sequence Nucl ei • c Aci • ds Res. 18 (7), 1907
  • Wilson IA Niman HL, Houghten RA, Cherenson AR, Connolly ML

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Molecular Biology (AREA)
  • Physics & Mathematics (AREA)
  • Immunology (AREA)
  • Hematology (AREA)
  • General Health & Medical Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biomedical Technology (AREA)
  • Urology & Nephrology (AREA)
  • Medicinal Chemistry (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Analytical Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Computational Biology (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Food Science & Technology (AREA)
  • Cell Biology (AREA)
  • Zoology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Genetics & Genomics (AREA)
  • General Engineering & Computer Science (AREA)
  • Epidemiology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Investigating Or Analysing Biological Materials (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

Die Erfindung betrifft ein Verfahren zum Screenen nach Substanzen, welche die Interaktion von Nlk in dem COP9/Signalosom-Kom- plex modulieren, a) wobei ein Testsystem enthaltend ein von Nlk verschiedenes weiteres Mitglied bis alle weiteren Mitglieder des COP9/Signalosom-Komplexes, sowie, optional, eines oder mehrere von zumindest einem der weiteren Mitglieder des COP9/Signalosom-Komplexes natürlicherweise abhängige Moleküle, mit einer prospektiv modulierenden Substanz oder einer Mischung solcher Substanzen inkubiert wird, wobei zugleich mit Nlk inkubiert wird, wenn Nlk nicht im Testsystem enthalten ist, b) wobei, optional nach einer Waschverfahrensstufe zur Entfernung von nicht an Nlk gebundenen weiteren Mitgliedern des COP9/Signalosom-Komplexes, die Aktivität oder Konzentration zumindest eines Mitgliedes des COP9/Signalosom-Komplexes, oder eines hiervon natürlicherweise abhängigen Moleküls bestimmt wird, nicht jedoch von Nlk, c) wobei eine Substanz oder eine Mischung von Substanzen selektiert wird, wenn die in Stufe b) gemessene Aktivität oder Konzentration erhöht oder erniedrigt ist gegenüber einer Durchführung der Stufen a) und b), jedoch ohne Nlk oder mit mutiertem Nlk.

Description

Verwendung von Wirksubstanzen zur Prophylaxe und/oder Therapie von Erkrankungen, die mit Zeilwachstumsstörungen einhergehen und Testsystem zum Auffinden solcher Wirksubstanzen
Gebiet der Erfindung
Die Erfindung betrifft die Verwendung mindestens einer Wirksubstanz, die mindestens eine Kinase des C0P9/Signalosom-Komplexes moduliert, zur Therapie und/oder Prophylaxe von Erkrankungen, die mit Zeilwachstumsstörungen einhergehen sowie ein Testsystem zum Auffinden solcher Wirksubstanzen.
Hintergrund der Erfindung und Stand der Technik
Differenzierungs-, Teilungs- und Aktivierungsprozesse in einer Zelle werden gesteuert über die Aktivierung und Inaktivierung regulatorischer Proteine. Ein wesentlicher Mechanismus der Aktivierung und Inaktivierung solcher Proteine ist deren Phosphorylierung und Dephosphorylierung durch Kinasen und Phosphatasen. Kinasen stellen die wesentlichen Komponen- ten der unterschiedlichen Signalübertragungswege von der Zellmembran zum Zellkern dar und leiten des weiteren die Inaktivierung von Proteinen, ihre Ausschleusung aus dem Zellkern und ihren proteolytischen Abbau in den Proteasomen des Zytoplas as und des Zellkerns ein. Als eine solche in die Regulierungsprozesse eingreifende Kinase ist beispielsweise die Nemo-like Kinase (Nlk) bekannt. Die Nlk ist als Bestandteil des TAKl-Nlk-MAPK-Signalübertragungsweg beschrieben worden (Brott et al., PNAS USA 95, 963-968, 1998). In diesem Signalübertragungsweg aktiviert die Transforming Growth Sec- tor Activated Kinase 1 (TAK1) die Nlk, welche wiederum den T-Cell-Factor (TCF) /Ly phoid Enhancer Factor (LEF) phospho- ryliert. Durch diese Phosphorylierung wird eine Komplexbildung von TCF mit ß-Catinin inhibiert und die Bindung von TCF/ß-Catininkomplexe an die DNA sowie deren Transkription- saktivität gehemmt. Eine inhibitorische Wirkung der Nlk für die Transkriptionsaktivität des TCF/LIF-Komplexes des TAKl-Nlk-MAPK-Signal- Übertragungsweges ist damit bekannt (Ishitani et al . , Nature 399, 798-802, 1999). Desweiteren erfolgt durch die Nlk eine Hemmung des durch Wnt induzierten Signalübertragungsweges. Eine Inaktivierung kann hierbei durch den proteolytischen Abbau der durch Nlk phosphorylier- ten Proteine in den Proteasomen erfolgen. Durch den verstärkten Abbau dieser phosphorylierten Proteine (Transkriptionsfaktoren) können je nach deren Promotorspezifität Differen- zierungsprozesse in der Zelle moduliert werden.
Das COP9/Signalosom der Säugetierzelle stellt einen Proteinkomplex dar, der in solche Signalübertragungswege auf unterschiedliche Weise eingreift. Eine besondere Funktion des C0P9/Signalosom-Komplexes scheint seine Beteiligung am zel- lulären Abbau von Proteinen zu sein (Schwechheimer und Deng Semin., Cell Dev. Biol. 11, 495-503, 2000). Der COP9/Signalo- som-Komplex besteht aus mindestens 8 Untereinheiten (CSN1-CSN8) und besitzt Kinaseaktivität (Seeger et al . , FASEB J, 12, 469-478, 1998). Die Funktionen einiger dieser Untere- inheiten sind beschrieben worden. Die Überexpression der Untereinheit CSN1 inhibiert die Kinaseaktivität von JNK und die Aktivität des Jun/Fos (AP-1) Transkriptionskomplexes (Tsuge et al., JMB 305, 1-9, 2001). Die Überexpression der Untereinheit CSN2 verstärkt die Transkriptionsaktivität von AP-1 durch Phosphorylierung und Aktivierung von c-Jun (Naumann et al . , J Biol Chem, 274 (50), 35297-35300, 1999), verstärkt die Funktion des freien (nicht hormon-gebundenen) Thyroidhormonrezep- tus als Repressor der Transkription (Lee et al . , Mol. Endocrinol. 9, 243254, 1995). Weiterhin stellt die Unterein- heit CSN2 vermutlich das Thyroid hormone receptorinteracting protein 15 (Trip 15) dar, welches an das Interferon consensus sequencebinding protein (ICSBP) bindet und dieses phospho- ryliert. Diese Phosphorylierung ist notwendig für die Bindung des ICSBP an den Interferon Regulatory Factor-1 (IRF-1) und die dadurch bewirkte Repression der Trankriptionsaktivität (Cohen et al . , J Biol Chem, 275 (50), 39081-39089, 2000). Die Untereinheit CSN5 besitzt vielfältige Funktionen: als "Jun- activation domain-binding protein-1" (JAB-1) stabilisiert CSN5 die Interaktion des c-Jun-Proteins im AP-1 mit dem AP-I- 5 Promoter-Element. Es assoziiert zugleich mit der zytoplasma- tischen Domäne des Intergrins LFA-1. Wenn dieses Intergrin an Komponenten der extrazellulären Matrix bindet, wird CSN5 freigesetzt und erhält die Möglichkeit, in den Kein zu pene- trieren, um hier die AP-1-Promoteraktivität zu verstärken
10 (Blanschi et al . , Nature 401, 617-621, 2000). CSN5 ist mitbeteiligt an der Phosphorylierung und Translokation des p27-Proteins in das Zytoplasma und dem dortigen proteoly- tischen Abbau in den Proteasomen. P27 inhibiert die Komplexe der Cycline EA mit cdk2 und cdkl . Eine Verminderung von p27
15 fährt zu Aktivierung des Zellzyklusses in der Gl-Phase. CSN5 wirkt auf den Progesteron-Rezeptor und den Steroid Receptor Coactivator-1 (SRC-1), stabilisiert die Komplexe zwischen beiden sowie deren DNA-Bindung (Chaochereao et el., J Biol Chem 275, 8540-8548, 2000) . CSN5 potenziert die Aktivität
20 einer Reihe von Transkriptionsfaktoren, von denen bekannt ist, dass sie mit SRC-1 assoziieren (Chaochereao et el., J Biol Chem 275, 8540-8548, 2000) . CSN5 ist beteiligt an dem Proteinabbau des Choriogonadotropin-Rezeptors . CSN5 ist beteiligt an der Komplexbildung zwischen Bcl-3 und NFkB und
25 damit an der Modulation der NFkB-Funktion. CSN5 bindet an p53, induziert dessen Phosphorylierung und proteolytischen Abbau (Bech-Otschir et al., Embo J 20, 1630-1639, 2001). Die Untereinheit CSN6 ist identisch mit dem menschlichen HIV-1 Vpr interacting protein (VIP) (Mahalingam et al . , PNAS 95,
30 3419-i424) . Eine Überexpression des Vpr verursacht eine Rückverteilung des CSN6 vom Kern in die Kernperipherie und eine Blockade der Zellteilung am G2-/M-Phasenübergang. Bislang ist nicht bekannt, ob die jeweiligen CSN- Proteine die ihnen zugesprochene Funktion allein oder im Kom-
35 plex als C0P9/Signalosom ausüben. Beobachtet wurde, dass die Untereinheiten CSN1 und CSN8 in Säugetierzellen lediglich komplexiert im C0P9/Signalosom vorliegen, während die Untereinheiten CSN4 und CSN5 sowohl als Monomere als auch komplexiert im C0P9/Signalosom vorliegen (Wei und Deng, Trends in Genetics 15, 98-103, 1999; Karniol et al . , FEBS Lett. 439, 173-179, 1998) . Weiterhin ist zum großen Teil unbekannt, wie die CSN-Proteine ihre Funktion im einzelnen ausüben. Elektronenmikroskopische und biochemische Untersuchungen zeigten, dass die Untereinheiten CSN2 und CSN7 in phosphorylierter Form vorliegen, dass diese Phosphorylierung jedoch nicht für die Kinaseaktivität des C0P9/Signalosonikomplexes erforderlich ist (Kapelari et al., J Mol Biol 300, 1169-1178, 2000). Aufgrund der zahlreichen offenen Fragen, die die Funktion sowie Funktionsmechanismen der CSN-Proteinen sowie des C0P9/Signalosom-Komplexes insgesamt betreffen, besteht ein großer Bedarf, Kenntnisse über weitere Einzelheiten zu erlangen, um mit geeigneten Wirksubstanzen unterschiedlichste Erkrankungen, die mit Zeilwachstumsstörungen einhergehen, behandeln zu können. Solche Erkrankungen können beispiel- sweise im Zusammenhang stehen mit unkontrollierter bzw. unerwünschter Zellproliferation, beispielsweise bei Tumorerkrankungen, Leukämien, Autoimunerkrankungen, Rheuma- toide Erkrankungen, Hauterkrankungen, insbesondere Psoriasis, Organabstoßungen oder Immunreaktionen, oder unkontrolliertem Zelltod, beispielsweise bei viralen und bakteriellen Infektionserkrankungen, Alzheimer, Creutzfeld-Jakob-Syndro , Multiple Sklerose, Morbus Parkinson, Spinale Muskelatrophien, Diabetische Neuropathien, Amyotrophe Lateralsklerose oder Cerebrale Ischaemie. Von besonderem Interesse ist auch die Beantwortung der Frage, welche Bausteine des
C0P9/Signalosom-Komplexes über welche biochemischen Mechanismen die Funktion regulatorischer Proteine modulieren und ihren Abbau verursachen oder verhindern.
Technisches Problem der Erfindung Der Erfindung liegt daher das technische Problem zu Grunde, ein Verfahren zur Identifizierung von Substanzen anzugeben, welche den C0P9/Signalosom-Komplex modulieren. Desweiteren liegt der Erfindung das technische Problem zu Grunde, Substanzen und Arzneimittel anzugeben, welche zur Behandlung der vorstehenden Krankheiten geeignet sind.
Grundzüge der Erfindung und Ausführungsformen.
Zur Lösung dieses technischen Problems lehrt die Er- findung die Gegenstände der Patentansprüche 1 bis 19. Ein von einem weiteren Mitglied des COP9/Signalosom-Komplex, i.e. nicht Nlk, natürlicherweise abhängiges Molekül ist eine Substanz in einer Zelle, insbesondere einer wildtyp Zelle, die direkt oder indirekt von dem weiteren Mitglied moduliert, beispielsweise induziert, aktiviert oder inhibiert (z.B. phosphoryliert) , wird. Dies sind insbesondere von CSN1 bis CSN8 modulierte Substanzen, wie vorstehend beschrieben. Die Erfindung beruht auf einer Mehrzahl von überraschenden Erkenntnissen. Es wurde gefunden, dass die vorab bereits als Bestandteil des TAKl-Nlk-MAPK-Signalübertragungs- weges beschriebene Nlk, auch Bestandteil des C0P9/Signa- losom-Komplexes ist. Es wurde weiterhin gefunden, dass die Nlk auch für das COP9/Signalosom eine inhibitorische Kinaseaktivität aufweist, die in der Phosphorylierung einer Reihe von Transkriptionsfaktoren, beispielsweise c-Jun, besteht und eine Inaktivierung dieser Transkriptionsfaktoren zur Folge hat. Ferner wurde gefunden, dass Nlk solche Serine des c-Jun phosphoryliert, die sich an anderen Positionen befinden als diejenigen Serine, die durch die Kinasen JNK oder ERK phosphoryliert werden (Guerrini et al . , J Neurosci 17, 6057-6063, 1997; Schmidt-Ullrich et al . , Development 122, 2117-2128, 1996) . Es wurde weiterhin gefunden, dass Nlk im C0P9/Signalosom die Aktivität des Transkriptionsfaktorkomplexes AP-1 deutlich vermindert. Diese Repression der Tran- skriptionsaktivität durch Nlk war nicht auf AP-1 beschränkt, sondern konnte ebenfalls für andere Transkriptionsfaktoren, beispielsweise NFkB, bewiesen werden. Weiterhin wurde mit vorliegender Erfindung gefunden, dass Nlk mit den Untereinheiten CSN7a und CSN7b des COP9/Signalosoms verbunden ist, 5 jedoch keine direkte Verbindung mit der CSN5-Untereinheit eingeht. Die überraschende Erkenntnis der vorliegenden Erfindung, dass COP9/Signalosome sowie die daran assoziierte Nlk entscheidend an der Modulierung der Aktivität von Proteinen, welche die Zeilproliferation, die Zelldifferenzierung
10 sowie den Zelltod kontrollieren, beispielsweise NFkBAP-1,
TCF/LEF, p27, p53, Vpr, ICSBP und SRC-1, beteiligt sind, hat zu der technischen Lehre der Erfindung geführt, welche Möglichkeiten für den Einsatz von Wirksubstanzen zur Prophylaxe und/oder Therapie von Erkrankungen, die mit Zell-
15 wachstumsstörungen, wie sie bereits vorangehend beispielsweise aufgeführt worden sind, einhergehen, eröffnen.
Ein weiterer Hinweis insbesondere auf Erkrankungen des Nervensystems besteht darin, dass Nlk besonders stark im Hirngewebe exprimiert wird (Brott et al . , PNAS USA 95@
20 963-968, 1998) . Es ist daher anzunehmen, dass Veränderungen von Nlk in C0P9/Signalosome der Nervenzellen zu einer erheblichen Beeinflussung der Funktion, Differenzierung und des Überlebens von Nervenzellen führt.
Gegenstand der Erfindung ist daher die Verwendung minde-
25 stens einer Wirksubstanz zur Prophylaxe und/oder Therapie von Erkrankungen, die mit Zellwachstumsstörungen einhergehen, wobei die Wirksubstanz (en) die Aktivität mindestens einer Kinase des COP9/Signalosom-Komplexes modulieren. Die Modulation mindestens einer Kinase stellt gemäß der vorliegenden
30 Erfindung eine Hemmung oder Verstärkung der Aktivität der Kinase dar. Vorzugsweise handelt es sich bei der modulierten Kinase um die Nlk-Kinase.
Wirksubstanzen im Sinne der vorliegenden Erfindung sind Substanzen, die in der Lage sind, mindestens eine Kinase des
35 C0P9/Signalosom-Komplexes zu modulieren. Hierbei kann es sich um Wirksubstanzen handeln, die Kinasen in ihrer Aktivität hemmen oder verstärken, beispielsweise durch Phosphorylierung oder Dephosphorylierung. Weiterhin sind als Wirksubstanzen im Sinne dieser Erfindung Derivate der Wirksubstanzen zu verste- 5 hen, die beispielsweise durch enzymatische Spaltung, in eine erfindungsgemäße aktive Wirksubstanz umgewandelt werden sowie auch Vorstufen von Wirksubstanzen, die metabolisch in eine erfindungsgemäß aktive Substanz umgewandelt werden. Bevorzugt ist bzw. sind die verwendete Wirksubstanz (en) ausgewählt aus
10 nachfolgenden Wirksubstanzen: Kinase-inhibierende Derivate des 4H-l-Benzopyran, beispielsweise in EP 0 137 193 und EP 366 061 offenbart, die Struktur-Wirkungsbeziehung für diese Derivate wurde beispielsweise von Sedlacek et al. (Int. J Oncol 9:1143-1168, 1996) beschrieben; Flavopiridolderivate,
15 beispielsweise Kim et al., (J Med Chem 43(22): 4126-4134, 2000) , offenbart, insbesondere Thio-Flavopiridol und Oxy- Flavopiridol; 2- (2-Amino-3-methoxyphenyl) -4-oxo-4H- (1) ben- zopyran, beispielsweise von Ebendal (WO 00/50030) offenbart; 7,12-Dihydro-indolo (3,2-d)(l) Benzazepin-6 (5H) -one (NSC
20 664704 Sausville et al . Phannacol . Ther . 82(2-3), 285-292,. 1999) ; Phosphokinaseinhibitoren, beispielsweise 70H-Staurosporine und ihre Phosphokinase inhibierenden Derivate, Butyrolactone, Roscovitine, Purvalanol A, Emodin, Anilinoquin-azoline (PD-168393 und PD 169414), PD 184352
25 (Duesbery et al . , Nature Medicine 5(7), 1-16-131 , 1999) und Phenylamino-pyrimidine (STI 571, CGP 78850, CP 358774, CP59326 und CGP 60474)), Trioylimidazole (1-779450) (Meijer et al., Parmacol.Ther.82 (2-3) , 297-284, 1999; Sedlacek et al., Int J Oncol 9, 1143-1168, 1996; Sedlacek Drug 59(3),
30 435-476, 2000); Paullone (Zaharevitz et al . , Cancer Res.59, 2566-2569, 1999); SB203580 [4- (4-Fluorophenyl) -2- (4-methyl- sulfinylphenyl) -5- (4-pyridyl) lH-imidazol, (Ishikawa et al., J Neurochem 75(2), 494-502, 2000, Harada und Sugimoto, Jpn J Phannacol 79(3), 369-378, 1999)]; U0126 [1, 4-Diamino-2, 3-di-
35 cyano-1, 4-bis (2aminophenylthio) butadien] (Favata et al . , J Biol Chem 273(29), 18623-18632. 1998; DeSilva et al . , J Immu- nol 160, 4175-4181, 1998)]; PD098059 [2-2 ' -amino-3 ' -methoxy- phenyl) -oxanaphtalen-4-on) ] , (Dudley et al . , PNAS USA 92, 7686-7686, 1995); PD184352 [2- (2-chlor-4-jod-phenylamino) -N- cyclopropylmethoxy-3, 4-difluorbenzamid] , (Sebolt-Leopold et al., Nature Med 5, 810-816, 1999); 3-Aminomethylen-indolin- Derivate (Heckel et al .. DE 92 4401, Eberlein et al . , DE 84 4003; WO 00/018734); CEP-1347 (KT7515) bis-ethylthiomethyl (Maroney et al., J Neurochem 73(5), 1901-1912, 1999); Tetrapyrrolische Makrocyclen, beispielsweise
5, 10, 15,20-Tetraarylporphyrin und 5, 10, 15-Triarylcorrol (Aviezer et al . , WO 00/27379); Pyrimidonderivate (Ando et al . , WO 00/018758); Antisense-Oligonukleotide, welche sich spezifisch an die DNA-Sequenz oder -RNA Sequenz kodierend für Nlk anlagern und deren Transkription oder Translation inhibieren; Antikörper- oder Antikörperfragmente, spezifisch für Nlk; Fusionsproteine, enthaltend mindestens ein Antikörperfragment, beispielsweise ein Fv-Fragment, welche die Kinaseaktivität der Nlk inhibieren; Gen für Nlk, eingefügt in ein Plasmid und vermischt mit einer die Zelltransfektion unterstützenden Substanz, beispielsweise kationische Lipide oder kationische Polymere; Gen für Nlk, eingefügt in einen Vektor; Gen für Nlk mit eingefügter negativ dominanter Mutation; Antisense-Oligonukleotide, welche sich spezifisch an die DNA-Sequenz oder M-RNA Sequenz kodierend für Nlk anlagern und deren Transkription oder Translation inhibieren, Antikörper- oder Antikörperfragmente, spezifisch für Nlk und/oder Fusionsproteine, enthaltend mindestens ein Antikörperfragment, beispielsweise ein Fv-Fragment, welche die Kinaseaktivität der Nlk inhibieren.
Ein weiterer Gegenstand der Erfindung betrifft ein Testsystem zum Auffinden von Wirksubstanzen, welche die Aktivität mindestens einer Kinase des COP9/Signalosom-Komplexes modulieren, enthaltend: a. mindestens eine Probe, enthaltend mindestens einen COP9/signalosom-Komplex und b. mindestens ein Mittel zur Bestimmung der Aktivität mindestens einer Kinase des COP9/Signalosom-Komplexes .
Bevorzugt ist eine Probe im Sinne der vorliegenden Erfindung beispielsweise mindestens eine Zelle enthaltend mindestens einen COP9/Signalosom-Komplex, wobei die Aktivität der jeweiligen Kinase (n) , vorzugsweise Nlk, moduliert wird. Die Zellen umfassen beispielsweise pro- und eukaryotische Zellen, insbesondere Zellen, die als Wildtyp-Zellen mindestens eine aktive Kinase des COP9/Signalosoms, vorzugsweise Nlk, exprimieren. In Zellen, die als Wildtyp-Zellen nicht oder nur in geringerem Maße die jeweilige (n) aktive (n) Kinase (n) des COP9/Signalosoms exprimieren, kann durch dem Fachmann bekannte Methoden eine Expression erreicht werden. Solche Methode umfassen beispielsweise Infektion, Transfek- tion oder Transformation von Zellen mit Vektoren, die Nukleinsäuren enthalten, die für die jeweilige (n) aktive (n) Kinase (n) des COP9/Signalosoms, vorzugsweise Nlk, oder Teile davon kodieren. Zellen im Sinne der vorliegenden Erfindung sind Zellen aus unterschiedlichen Organen und Geweben, beispielsweise Zellen der Blut- und Lymphgefäße oder Zellen, die Körperhöhlen auskleiden. Ebenfalls umfasst sind Zellkulturen, insbesondere eukaryotische Zellkulturen, beispielsweise 293-, 293T- und 293T7-Zellkulturen aus Homo sapiens, B82-, NIH3T3-, L929-Zellkulturen aus Mus musculus, BHK- Zellkulturen aus Cricetus cricetus, CHO-Zellkulturen aus Cricetulus griseus, MDCK-Zellkulturen aus Canis familiaris, Vero-, COS-1- und COS-7-Zellkulturen aus Cercopithecus aethiops und/oder primäre Embryo-Fibroblasten aus Gallus gal- lus (CEF cells) . Eine Probe kann ebenfalls mindestens ein Zellextrakt, mindestens eine Proteinmischung und/oder mindestens eine Mischung, enthaltend mindestens einen C0P9/Signalosom-Komplex, vorzugsweise Nlk, sein. Desweiteren umfaßt der Begriff Probe auch Zellextrakte, die beispielsweise aus einer der vorangehend aufgeΘen Zellen mit dem Fachmann bekannten Standardverfahren gewonnen werden können. Hierfür geeignete Verfahren umfassen, sind aber nicht darauf beschränkt, "freeze thawing", "sonification" oder "French- pressing". Gegebenenfalls kann ein solcher Zellextrakt in weiteren Schritten aufgearbeitet bzw. aufgereinigt werden. Bevorzugte Schritte umfassen beispielsweise Präzipitations- oder Filtrationsverfahren und/oder chromatographische Ver- fahrensschritte . Geeignete chromatographische Verfahren sind dem Fachmann bekannt und umfassen beispielsweise Anionen- bzw. Kationenaustauschchromatographie, Affinitätschromoa- tographie und/oder Größenausschlußchromatographie. Desweiteren kann die Probe auch eine Mischung gereinigter oder rekombinanter Proteine enthaltend mindestens einen COP9/Signalosom-Komplex, vorzugsweise Nlk, und/oder eine Proteinmischung sein, die zusätzlich weitere Komponenten en- thält, beispielsweise Mittel, die für die Bestimmung der Aktivität der Kinase (n), vorzugsweise Nlk, des C0P9/Signalosom-Komplexes verwendet werden können. Vorzugsweise ist eine Probe im Sinne der vorliegenden Erfindung ein isolierter C0P9/Signalosom-Komplex, wobei die Aktivität der jeweiligen Kinase (n) , vorzugsweise Nlk, moduliert wird.
Mittel zur Bestimmung der Aktivität von mindestens einer Kinase, vorzugsweise der Nlk, des COP9/Signalosom-Komplexes sind beispielsweise Substrate der Kinase (n), Puffer, Deter- gentien, Proteaseinhibitoren, NTPs und/oder geeignete Metallionen.
Eine bevorzugte Ausführungsform betrifft ein Testsystem wobei die Probe a. mindestens ein Gen, kodierend für mindestens eine negative Mutante mindestens einer Kinase und/oder b. mindestens eine negative Mutante mindestens einer Kinase enthält. Eine in dieser Ausführungsform verwendete Probe ist beispielsweise eine Zelle, die eine reduzierte oder keine Aktivität einer Kinase, vorzugsweise Nlk-Aktivität, des COP9/Signalosom-Komplexes aufweist. Dies kann beispielsweise erreicht werden, durch das Einführen einer negativen, insbe- sondere einer dominant negativen, Mutation. Ein weiterer Gegenstand dieser Erfindung betrifft ein Verfahren zum Auffinden von mindestens einer Wirksubstanz zur Prophylaxe und/oder Therapie von Zellwachstumsstörungen, die auf mindestens eine Kinase des COP9/Signalosom-Komplexes der- art einwirkt, dass das Zellwachstum moduliert wird, enthaltend folgende Schritte: a. Inkontaktbringen mindestens einer Probe mit mindestens einer potentiellen Wirksubstanz, und b. Bestimmen der Aktivität mindestens einer Kinase des COP9/SignalosomKomplexes . Inkontaktbringen im Sinne der vor- liegenden Erfindung kann beispielsweise durch Zugabe der
Wirksubstanzen in das Nährinedium einer Zellkultur oder durch lokale oder systemische Verabreichung der Wirksubstanzen in einen Organismus erfolgen. Das Inkontaktbringen einer Probe mit mindestens einer potentiellen Wirkssubstanz umfaßt ferner beispielsweise jede Form des Mischens, wobei sowohl die Probe zu der potentiellen Wirksubstanz hinzugefügt werden kann als auch die potentielle Wirksubstanz zur Probe. Die Probe und/oder die potentielle Wirksubstanz können dabei jeweils als Feststoff, Lösung, Suspension, Aufschlämmung oder an eine feste Phase gebunden vorliegen. Wenn es sich bei der Probe, die mit potentiellen Wirksubstanz (en) in Kontakt gebracht werden, um Zellen handelt, umfaßt der Schritt des Inkon- taktbringens auch im Stand der Technik bekannte Verfahren, die das Einführen von Substanzen in intakte Zellen erlauben, wie beispielsweise Infektion, Transfektion und/oder Transformation. Diese Verfahren sind besonders bevorzugt, wenn es sich bei der potentiellen Wirksubstanz um nackte DNA, Viren, Viroide, Virosomen und/oder Liposomen handelt, wobei die Liposomen oder Virosomen auch geeignet sind, neben einem po- tentiell wirksamen Nukleinsäuremolekül weitere potentielle Wirksubstanzen mit der Probe in Kontakt zu bringen. Dem Fachmann sind eine Reihe weiterer Methoden bekannt, die dazu dienen, potentielle Wirksubstanzen in Zellen einzufahren.
Das Bestimmen der Aktivität mindestens einer Kinase, vorzugsweise Nlk, des COP9/Signalosom-Komplexes in der Probe ist durch eine Reihe direkter und indirekter Nachweisverfahren möglich. Die jeweils geeigneten Verfahren hängen von der Natur der Probe ab. In Zellen wird die Aktivität der Kinase (n) , vorzugsweise Nlk, zum einem durch die Menge der in der Zelle exprimierten Kinase (n) bestimmt und zum anderen durch die Menge der aktivierten Kinase (n) . Die Aktivierung der Transkription der die Kinase (n) , insbesondere Nlk, kodierenden Gene kann beispielsweise durch die Bestimmung der Menge der Kinasen-mRNA erfolgen. Im Stand der Technik bekan- nte Standardverfahren zur Bestimmung der RNA Menge umfassen beispielsweise DNA-Chip-Hybridisierung, RT-PCR, "Pri er"- Extension und "RNA-Protection" . Desweiteren kann die Bestimmung der Kinase-Aktivität, die auf der Induktion oder Repression der Transkription des (der) jeweiligen Kinase-Gens (e) beruht, auch durch die Kopplung des Kinase-Promotors an geeignete Reportergenkonstrukte erfolgen. Der Nachweis der Steigerung der Expression der Kinasen kann jedoch auch auf Proteinebene erfolgen, wobei in diesem Fall die Menge des Proteins beispielsweise durch gegen die Kinase (n) gerichtete Antikörper nachgewiesen wird. Die Änderung der Aktivität der Kinase (n) kann jedoch auch auf verstärkte oder erniedrigte Phosphorylierung bzw. Dephosphorylierung der Kinase (n) zurückgeführt werden. Die Änderung der Phosphorylierung der Kinase (n) kann beispielsweise durch Antikörper nachgewiesen werden, die gegen phosphorylierte Aminosäuren gerichtet sind. Ein weiterer Gegenstand der vorliegenden Erfindung betrifft ein Arzneimittel zur Prophylaxe und/oder Therapie von Zeilwachstumsstörungen, enthaltend mindestens eine erfindungsgemäße Wirksubstanz und gegebenenfalls geeignete Hilfs- und Zusatzstoffe. Vorzugsweise wird die Wirksubstanz gemäß vorliegender Erfindung für die lokale oder systemische Verabreichung in einen Organismus mit Hilfe der dem Fachmann geläufigen Methoden und Hilfs- und/oder Zusatzstoffen zu einem Arzneimittel zubereitet. Ein Arzneimittel der vorlieg- enden Erfindung wird vorzugsweise bei Erkrankungen, die mit Zellwachstumsstörungen einhergehen, verwendet. Geeignete Hilfs- und Zusatzstoffe, die beispielsweise der Stabilisierung oder Konservierung des Arzneimittels oder Diag- nostikums dienen, sind dem Fachmann allgemein bekannt (siehe z. B. Sucker H et al . (1991) Pharmazeutische Technologie, 2. Auflage, Georg Thieme Verlag, Stuttgart) . Beispiele für solche Hilfs- und/oder Zusatzstoffe sind physiologische Kochsalzlösungen, Ringer-Dextrose, Dextrose, Ringer-Laktat, entmineralisiertes Wasser, Stabilisatoren, Antioxidantien, Komplexbildner, antimikrobielle Verbindungen, Proteinasein- hibitoren und/oder inerte Gase. Die lokale Verabreichung kann beispielsweise auf die Haut, auf die Schleimhaut, in eine Körperhöhle, in ein Organ, in ein Gelenk oder in das Bindeoder Stützgewebe erfolgen. Die systemische Verabreichung er- folgt vorzugsweise in den Blutkreislauf, in die Peritoneal- höhle oder in die Bauchhöhle. Die Arzneimittelzubereitung enthaltend die erfindungsgemäße Wirksubstanz richtet sich nach der Art der Wirksubstanz und der Art ihrer Verabreichung und kann beispielsweise eine Lösung, eine Suspension, eine Salbe, ein Puder, eine Sprayform oder eine andere Inhalationszubereitung darstellen. Vorzugsweise werden Nukleotidsequen- zen mit dem Fachmann bekannten Methoden in einen viralen Vektor oder ein Plasmid eingefügt und mit Hilfsstoffen für die Zelltransfektion versetzt. Zu diesen Hilfsstoffen gehören beispielsweise kationische Polymere oder kationische Lipide. Antisense-Oligonukleotide werden mit den dem Fachmann geläufigen Methoden derivatisiert, um sie vor dem enzyma- tischen Abbau durch DNAsen oder RNAsen zu schützen. Die Wirksubstanz gemäß der Erfindung kann in Form eines Salzes, Esters, Amids oder als eine Vorstufe vorliegen, wobei vorzugsweise nur Modifikationen der Wirksubstanz verwendet werden, die keine übermäßige Toxizität, Irritationen oder allergische Reaktionen am Patienten auslösen. Die Wirksubstanz wird unter sterilen Bedingungen, mit einem dem Fachmann bekanntem, physiologisch akzeptablen Trägerstoff und möglichen Preservativen, Puffern oder Treibmitteln, je nach Bedarf, vermischt. Bevorzugt wird die erfindungsgemäße Wirksubstanz in einer einmaligen Dosis, besonders bevorzugt in mehreren Dosen verabreicht, wobei die einzelnen Dosen die maximal tol- 5 erable Dosis (MTD) der jeweiligen Wirksubstanz für den Menschen nicht übersteigt. Vorzugsweise wird eine Dosis gewählt, welche die Hälfte der MTD beträgt. Beispielsweise liegt für die Infusion von Flavopiridol die MTD beim Tumorpatienten bei 50 mg/ml/dx3 (Senderowicz et al J Clin Oncol 16(9) :
10 2986-2999,1998) . Für die Anwendung am Menschen im Sinne der vorliegenden Erfindung ist Flavopiridol somit in einer täglichen Dosis von 0,1- 50 mg/m2, vorzugsweise von 5-30 mg/m2 , besonders bevorzugt von 25 mg/m2 zu verabreichen. Die Tagesdosis kann einmalig am Tag oder in mehreren Teilportionen
15 aufgeteilt über den Tag hinweg, vorzugsweise in etwa gleichen Zeitabständen verabreicht werden. Gemäß der vorliegenden Erfindung kann die Verabreichung entweder lokal oder sys- temisch, nur an einem Tag oder über mehrere Tage täglich oder an jedem zweiten oder dritten Tag über mehrere Wochen erfol-
20 gen, bis eine therapeutische Wirkung sichtbar wird.
Ein weiterer Gegenstand dieser Erfindung betrifft ein Verfahren zum Herstellen eines erfindungsgemäßen Arzneimittels zur Prophylaxe und/oder Therapie von Zell- wachstumsstörungen, welches das Zellwachstum fördert oder
25 hemmt, wobei zumindest ein erfindungsgemäßer Wirkstoff in physiologisch wirksamer Dosis mit Hilfs- und/oder Trägerstoffen nach Maßgabe der gewünschten galenischen Darreichungsform gemischt und zur Darreichungsform verarbeitet wird.
Die nachfolgenden Beispiele zu dieser Erfindung zeigen,
30 dass Nlk assoziiert mit dem C0P9/Signalosom-Komplex eine wichtige Rolle bei der Koordination der Signalübertragungswege von Wnt, NFkB, API, Thyroid Hormon Rezeptor und wahrscheinlich auch von Zellzyklus-Regulatoren in Neuronen und Gliazellen spielen.
35 Beispiel 1: Nachweis von Nlk im COP9/Signalosom-Komplex
In einem Hefe 2-Hybrid-Screen (GAL 4 based Matchmaker 2 Hybrid 2 system, (Fa. Clontech, Erembodegen, Belgien) mit Nlk wurde die Signalosom-Untereinheit CSN7a als Interaktionspart- ner von Nlk identifiziert. Hierzu wurde eine Genbibliothek, isoliert aus postnatalem Mäusehirn (Fa. Clontech, Erembodegen, Belgien), nach Bindungspartnern von Nlk untersucht. Dazu wurde eine Nlk splicing-Variante verwendet, der die Region fehlte, welche für die Alaninreichen N-terminalen 101 Ami- nosäuren kodiert (Garcia-Femandez et al . , Biochem Biophys Res Commun 196, 396-401, 1993) . Die cDNA für diese Nlk-Variante wurde mit der GAL4 DNA- Bindedomäne fusioniert und diente als Köder. 50 mM 3-AT wurde LEU-TRP-HIS-Medium zugesetzt um die Reportergenaktivierung durch den Köder zu hemmen. In diesem 2-Hybrid-Screen konnte CSN7a als Bindeprotein für Nlk isoliert und identifiziert werden.
Ein cDNA-Klon für das gesamte CSN7a wie auch für das verwandte CSN7b und für Csn5 wurde mit Hilfe der RT-PCR aus RNA-Extrakten von Mäusehirn isoliert (Wei et al . , Curr Biol 8, 919-922, 1998) .
Haemagglutinin (HA) oder FLAG markierte Nlk, Csn7a. Csn7b und Csn5 Proteine wurden mit Hilfe der RT-PCR und der Verwendung folgender Primer kloniert: HA-CSN 7a Hin:ATAGGTACCACCATGTACCCCTACGACGTGCCCGACTACGCCATGAGTGCGGAGGTG AAGGTG, Rück:ATAGAATTCAGTTCGACTTGGACCAAATCTTG
HA-CSN7b Hin :ATAGGATCCACCATGTACCCCTACGACGTGCCCGACTACGCCATGGCAGGTGAACAG AAACCCTCAAG, Rück :ATAGAATTCCTAGTGGCGGCTGGAGACCAG FLAG-Nlk
Hin: CTCGGATCCACCATGGACTACAΆGGACGACGACGACAAGATGTTAAACCCTGGGCAΆ
CAACAGC, Rück:ATAGGATCCACAGTCACTCCCACACCAGAGG
CSN5 Hin:ATATGGATCCACCATGTACCCCTACGACGTGCCCGACTACGCCATGGCAGCTTCCGG GAG, RÜck:CTATGAATTCGTACTTGGTGGTAACTAAGCAACG Für die Klonierung einer Kinase-negativen Nlk-Mutante, bei welcher das ATP-bindende Lysin (K84R) gegen Arginin ausgetauscht wurde, wurden folgende Primer verwendet: Hin : ATGGAAAGAGAGTAGCACTCAGAAAGATGCCCAACGTCTTCCAGAAT Rück: CTGGAAGACGTTGGGCATCTTTCTGAGTGCTACTCTCTTTCCATCTC cDNA, kodierend für FLAG-markierte Wildtyp-Nlk, FLAG- markierte K84R mutierte Nlk, und HA-markierte CN7a, CSN7b, und CSN5 wurden in pcDNA3 Expressionsvektoren (Fa. Invitro- gen, Karlsruhe, Deutschland) eingefügt und HEK293-Zellen mit diesen Expressionsvektoren mit Hilfe von Lipofectamin 2000 (Fa. Life Technologies, Burlington, Kanada) cotransfiziert . Co-Immunpräzipitationsexperimente mit Hilfe von monok- lonalen Antikörpern spezifisch für FLAG (Fa. Sig a, Deisen- hofen, Deutschland) und nachfolgende Westem Blot Analysen zum Nachweis von HA-markierten COP9/Signalosom-Komponenten zeigten, dass in HEK293-Zellen sowohl das Wildtyp-Nlk als auch die K84R mutierte Nlk mit den Untereinheiten CSN7a und CSN7b, jedoch nicht mit der Untereinheit CSN5 interagieren. Mit einem polyklonalem Antikörper gegen die COP9/Signalosom-Untereinheit CSNl, der den gesamten Komplex präzipitiert (Fa. Affiniti Mamhead, Exeter, UK; Staub et al . , Plant Cell 8, 2047-2056, 1996; Kamiol et al . , FEBS Lett. 439, 173-179, 1998) konnte die aktive Nlk co-immunpräzipitiert werden. Da CSNl nur im Komplex und nicht frei in der Zelle vorkommt, zeigte dies eine direkte Assoziation von Nlk mit dem COP9/Signalosom.
Beispiel 2: Aktivität der Nlk im C0P9/Signalosom-Komplex auf Transkriptionsfaktoren Zur Charakterisierung der Kinaseaktivität von
COP9/Signalosomen wurden Immunkomplex-Kinase-Assays mit Nlk durchgeführt. HEK293-Zellen wurden mit Expressionsvektoren, kodierend für die FLAG-markierte Wildtyp-Nlk und für die FLAG-markierte Enzy -defiziente K84R Nlk-Mutante trans- fiziert. Die exprimierten Proteine wurden in anti-CSNl Immunpräzipitaten nachgewiesen. Derartige Immunpräzipitate der transfizierten Zellen wie auch von Kontrollzellen wurden mit den Proteinsubstraten c-jun (Fa. Promega, Madison, USA) oder GST-c-jun (Fa. Santa Cruz, Santa Cruz, USA) inkubiert. Nach Inhibition der Enzymreaktion durch Zugabe von SDS Puffer und sofortiger Erhitzung wurden die Proteine mit Hilfe der SDS-PAGE abgetrennt, auf Nitrozellulosemembrane aufgetragen und dort mit Hilfe von polyklonalen Antikörpern gegen c-jun (Ser 63), gegen c-jun (Ser 73) (Fa. NEB, Beverlv, USA) und gegen CSNl und monoklonale Antikörper gegen FLAG präzipitiert und mit einem Peroxydase markierten Zweitantikörper (Fa. Jackson) oder mit dem ECL Chemiluminescence Reagenz (Fa. Am- ersham, Buckinghamshire, UK) nachgewiesen. Bei diesen Untersuchungen ergab sich, dass Nlk die c-Jun (jedoch nicht deren N-terminales Fragment, Aminosäuren 1-79) phosphorylieren kann. Die Westernblot-Experimente mit den Phospho- spezifischen Antikörpern zeigten, dass die Phosphorylierung nicht die Aminosäuren Serin 63 und Serin 73 betreffen, welche vorwiegend durch JNK zur Aktivierung phosphoryliert werden (Guerrini et al . , J. Neurosci 17, 6057-6063, 1997; Schmidt- Ullrich et al., Development 122, 21172128, 1996).
Zum Nachweis der Aktivität von Nlk auf verschiedene Signalwege wurden Reportergen-Assays durchgeführt. Dazu wurde Wildtyp oder die negative Mutante von Nlk mit unterschiedli- chen Reportergenkonstrukten in HEK293-Zellen coexprimiert . Sowohl bei einem Reportergen für die durch Wnt induzierten Transkriptionsfaktoren TCF/LEF als auch bei Reportergenen für AP-1 und NFkB und den Thyroidhormon-Rezeptor, zeigte sich eine inhibitorische Wirkung durch die aktive Nlk. Im Gegen- satz hierzu reduzierte die Kinase-negative Mutante K84R Nlk nicht die AP-1, TCF/LEF und NFkB induzierbare Reportergenexpression und hatte statt dessen besonders bei AP-1 und NFkB- Reportergenkonstrukten eine stark stimulierende Wirkung. Beispiel 3: Nichtzelluläres und zelluläres Testsystem, enthaltend COP9/Signalosom-Komplexe mit aktiver Nlk oder mit negativ imitierter Nlk In einer Ausführungsform des erfindungsgemäßen Ver- fahrens enthält die Probe Zellen, Zellextrakte oder Pro- teimnischungen welche Nlk, auch Teile davon oder zur Kontrolle negativ mutierte Nlk, beinhalten. Beispiele für die Herstellung derartiger Zellen, Zellextrakte oder Proteinmischungen sind bereits in Beispiel 1 ausführlich beschrieben worden. Ein Beispiel für negativ mutiertes Nlk ist die im Beispiel 1 bereits beschriebene K84R-Mutante des Nlk, welche keine Kinaseaktivität mehr aufweist. Derartige Zellen, Zellextrakte oder Proteirαischungen werden mit der zu prüfenden Substanz in beliebigen Konzentrationen vermischt. Nach einer Inkubationszeit von 10 Sekunden bis zu 24 Stunden wird die Aktivität der Nlk bestimmt.
In einer Ausführungsform wird die Aktivität von Nlk durch die Phosphorylierung von geeigneten Substraten, beispielsweise c-Jun, bestimmt. In einer weiteren Aus- führungsforrn des erfindungsgemäßen Verfahrens wird die Aktivität von Nlk indirekt durch die Messung der Aktivierung von Zielgenen über Reportergen-Assays bestimmt. Dabei befinden sich geeignete Reportergene, beispielsweise Luciferase, SEAP oder GFP, unter der Kontrolle von Promotoren, die der Regulation durch Transkriptionsfaktoren unterliegen, welche direkt oder indirekt durch Nlk reguliert werden. Hierzu gehören AP-1, NFkB, Thyroidhormon-Rezeptor und TCF/LEF. In einer weiteren Ausführungsform des erfindungsgemäßen Verfahrens kann die Aktivität von Nlk durch Veränderung der Dif- ferenzierung von Zellen, insbesondere von neuronalen Zellen Gliazellen, deren Vorläufer oder auch neuralen Stammzellen, beispielsweise morphologisch in der Zellkultur und unter dem Mikroskop bestimmt werden. In einer weiteren Ausführungsform des erfindungsgemäßen Verfahrens kann die Aktivität von Nlk durch Veränderung der Überlebensrate von Zellen bestimmt werden.
Beispiel 4 : Testsystem bestehend aus Zellen, in welchen das Gen für Nlk entfernt wurde oder Extrakten daraus
In einer Ausführungsform des erfindungsgemäßen Verfahrens besteht das Testsystem aus Zellen, in welchen das Gen für Nlk entfernt oder inhibiert wurde. Dies ermöglicht die Prüfung von Wirksubstanzen, welche Erkrankungen von Säuget- ieren verhindern oder vermindern können. Die Entfernung des Gens für Nlk in embryonalen Zellen oder in Gewebezellen wird beispielsweise mit Hilfe der Einführung von Anti-sense Oli- gonukleotiden für Nlk und der hierdurch bedingten Blockade der Transskription und/oder Translation des Genes für Nlk durchgeführt. Ein Beispiel für die Hemmung der zellulären Nlk ist die Einführung und Überexpression von Kinase negativen Mutanten des Nlk Genes.
Beispiele 5-8: Testsysteme zur Ermittlung von Inhibitoren der Aktivität von Nlk auf COP9/Signalosom-Komplexe
Beispiel 5: Testsystem zur Messung der Kinaseaktivität von Nlk mit dem Substrat c-Jun Eine Zelllinie (HEK 293) wird transient mit einem ein N-terminal mit dem FLAG-Epitop-Tag (Sigma) versehener Nlk Klon (Accession Nr.: NM_008702: Brott et al . , 1998) im Expressionsvektor pcDNA3 (Invitrogen) transfiziert . Als Kontrolle der Spezifität wird in einer weiteren Transfektion ein mutierter Nlk-Klon mit stark reduzierter Kinaseaktivität ver- wendet (vorzugsweise ein negativ mutiertes Nlk Protein, wie z.B. mit einer Mutation von Lysin an der Position 155 zu Arginin) .
48 Stunden nach der Transfektion (Lipofectamin 2000, Invitrogen) in 6-Well Kultur-Schalen (Nunc) werden die Zellen mit PBS (Dulbecco's PBS, Invitrogen) gewaschen und in Lyse- Buffer (25mM Tris-HCl pH 8.0, 137mM NaCl, 2mM EGTA, 2mM EDTA, 25mM Na-Pyrophosphat, 50mM ß-Glycerophosphat, 10% Glycerol, 1% Triton X-100, 0,1% ß-Mercaptoethanol, 50mM NaF, ImM Na3V04 und 1 "Complete Mini, EDTA free" Proteaseinhibitor Tablette von Röche /10ml Buffer) lysiert. Die FLAG-markierten Proteine werden durch Immunpräzipitation aufgereinigt . Dazu werden jeweils 1mg des Extraktes mit 1,0 μg Anti-Flag Antikörpern (Anti-Flag M2-Agarose, Sigma) für 1 Stunde bei +4°C unter ständigem Mischen inkubiert. Die Immunpräzipitate werden fünfmal durch Abzentrifugieren und Resuspendieren in Lyse- Buffer gewaschen. Danach werden die Immunpräzipitate mit der Prüfsubstanz in Konzentrationen von InMol bis lOOμMol gelöst in 30μl Kinase-Buffer (25mM Hepes pH=7.5, 25mM ß-Glycerophosphat, 1.5mM EGTA, 5% Glycerol, ImM DTT, lOmM MgCl2, lOOuM ATP) mit 0.5μg c-Jun Protein (Promega) und lμCi [γ- 32P]ATP (Amersham) bei 30°C für 20 Minuten inkubiert. Danach werden die Reaktionen durch Zugabe von je 30μl 2xLaemmli-Buffer (4% SDS, 20% Glycerol, 10% ß-Mercaptoethanol, 0.004% Bromphenolblau and 125mM Tris HC1, pH= 6.8) und kurzem Aufkochen ges- toppt und auf Eis gestellt. Nach kurzem Abzentrifugieren werden die Proben auf ein 10%iges SDS-Polyacylamidgel geladen und die Proteine elektrophoretisch aufgetrennt (Multigel, Biometra) . Danach werden die Proteine auf Nitrozellulose- Membrane (Protran BA 83; Schleicher & Schüll) geblottet (Fastblot, Biometra) und je nach Intensität des Signals mehrere Stunden bis Tage in Röntgenfilm-Kassetten mit Imaging- Platten (BAS SR Imaging Plates, Fuji) exponiert. Die Auswertung erfolgt durch Einscannen am Phosphorimager (BAS2500, Fuji) und der Quantifizierung der durch radioaktiv marki- ertes c-jun hervorgerufenen Signale mittels Analyse-Software (AIDA, Raytest) .
Ergebnisse: Nur das Wildtyp-Nlk, nicht jedoch das negativ-mutierte Nlk führte zu einer Phosphorylierung von c-Jun. Zugabe von einem Inhibitor für Nlk führt zu einer In- hibition der Phosphorylierung von c-Jun. Beispiel 6: Testsystem zur Messung der durch Nlk modulierten Reportergenaktivitat Eine Zelllinie (HEK 293) wird transient mit zwei Expres- sionsplasmiden transfiziert : 5 1. ) ein N-terminal mit dem FLAG-Epitop-Tag versehener Nlk Klon im Expressionsvektor pcDNA3. Als Kontrolle der Spezifität wird in einer weiteren Transfektion ein mutierter Nlk-Klon mit stark reduzierter Kinaseaktivität verwendet werden (vorzugsweise ein mutiertes Nlk-Protein mit einer Muta-
10 tion von Lysin an der Position 155 zu Arginin)
2. ) ein Reportergen-Konstrukt bei dem ein Reportergen (beispielsweise Luciferase, de Wet et al., 1987) unter Kontrolle beispielsweise des AP-1 abhängigen Collagenase- Promoters (van Dam et al . , 1993), eines NFkB-abhängigen Pro-
15 moters exprimiert wird.
3.) ein weiteres Reportergenkonstrukt, in dem ein weiteres Reportergen (beispielsweise ß-Galactosidase (Hall et al . , 1983) oder Renilla-Luciferase, Lorenz et al . , 1991) von einem anderen von Nlk nicht beeinflussten Promoter exprimiert
20 wird (z.B. pRSV-lacZ, Lucibello and Müller 1989 oder pRL-TK, Promega) zum Ableich der Transfektionseffizien.
Nach der Transfektion wird den Zellen der zu prüfenden Nlk-Inhibitor in Konzentrationen von InMol bis lOOμMol hinzugegeben. 48 Stunden nach der Transfektion (Lipofectamin
25 2000, Invitrogen) in 48-Well Kultur-Schalen (Nunc) werden die Zellen mit PBS gewaschen und in 50μl Reporter-Lysebuffer (Promega) lysiert. Die Extrakte werden abzentrifugiert und der Überstand wird zur Bestimmung der Reportergenaktivitäten verwendet. lOμl des Überstandes werden mit lOOμl Luciferase-
30 Assay-Reagent (Promega) vermischt und gemessen (Viktor2, Wal- lac) . Diese Werte werden durch die Messergebnisse des zweiten Reportergenkonstruktesdividiert, um Unterschiede verursacht durch ungleiche Transfektionsraten auszugleichen. Zur Bestimmung der ß-Galactosidase Aktivität werden je nach Aktivität
35 bis zu 50μl Zellextrakt in 96-Well Schalen mit 50μl 2xAssay-Buffer (Promega) gemischt und bei 37 °C inkubiert, bis sich eine Gelbfärbung entwickelt. Durch Zugabe von 150μl IM NaC03 wid die Reaktion gestoppt. Die Absorption bei 42nm Wellenlänge wird im gemessen (Victor2, Wallac) um die relative Reportergenaktivität zu bestimmen.
Ergebnisse: Die Expression des Reportergenes ist bei Wildtyp-Nlk erniedrigt und bei dem negativ-mutiertem Nlk erhöht. Nach Zugabe eines Nlk-Inhibitors ist die Expression des Reportergenes bei Wildtyp-Nlk erhöht.
Beispiel 7: Testsystem zur Messung der Modulierung der Neddy- lierung zellulärer Proteine durch Nlk Eine Zelllinie (HEK 293) wird transient mit zwei Expres- sionsplasmiden transfiziert : 1.) ein N-terminal mit dem FLAG-Epitop-Tag versehener Nlk Klon im Expressionsvektor pcDNA3. Als Kontrolle der Spezifität wird in einer weiteren Transfektion ein mutierter Nlk-Klon mit stark reduzierter Kinaseaktivität verwendet (vorzugsweise ein mutiertes Nlk-Protein mit einer Mutation von Lysin an der Position 155 zu Arginin)
2.) ein N-terminal mit drei HA-Epitop-Tags (Wilson et al., 1984) versehener Nedd8 Klon (Kumar et al . , 1993; Accession Nr.: NM_008683) IM Expressionsvektor pcDNA3
Nach der Transfektion wird den Zellen der zu prüfende Nlk-Inhibitor in Konzentrationen von InMol bis lOOμMol hinzugegeben. 48 Stunden nach der Transfektion (Lipofectamin 2000, Life Technologies) werden die Zellen mit PBS gewaschen und in Lyse-Buffer (siehe oben) lysiert. Der Proteinextrakt wird abzentrifugiert, der Überstand mit 2x Laemmli-Buffer (siehe oben) im Verhältnis 1:1 gemischt, kurz aufgekocht und auf Eis abgekühlt. Nach der Auftrennung der Proteinextrakte mittels Polyacrylamid Gelelektrophorese (Polyacrylamit Gradientengele von 5-20%) werden diese auf Nitrozellulose am- brane (Protran BA 83; Schleicher & Schüll) geblottet Biometra Fastblot) . Durch Westernblotanalyse werden die Membranen mit 5% Trockenmilch in TBS-T (20mM Tris-HCl pH7.6, 137mM NaCl, 0.1% Tween 20) für 30 Minuten geblockt, 1 Stunde in TBS-T mit dem Anti-HA Antikörper (HA.11, Babco) inkubiert und dreimal 15 Minuten lang mit TBS-T gewaschen. Danach werden die Mem- brane mit einem Peroxidase-gekoppelten Anti-Maus Sekundärantikörper (Rockland) für 30 Minuten inkubiert und dreimal 15 Minuten lang mit TBS-T gewaschen. Zur Detektion der Nedd8-konjugierten Proteine werden die Membrane 1 Minute lang in Detektionsreagenz (ECL, Amersham) inkubiert, in einer Dunkelkammer auf Röntgenfilme (Super RX, Fuji) aufgelegt und je nach Signalintensität für 1 Sekunde bis 1 Stunde exponiert. Die mit dem HA-Antikörper markierten Nedd8-konjugier- ten Proteine erscheinen auf den Filmen als Schwärzungen und können durch densitometrische Analysen quantifiziert werden. Ergebnisse: Die Menge der Neddδ-konjugierten Proteine ist nach Transfektion von Wildtyp-Nlk erniedrigt und von negativ-mutiertem Nlk erhöht. Zugabe eines Nlk-Inhibitors zu Zellen, welche mit Wildtyp-Nlk transfiziert wurden, erhöht die Menge der nachweisbaren Neddδ-konjugierten Proteine.
Beispiel 8: Testsystem zur Messung der Modulierung der Ubiq- uitinierung zellulärer Proteine durch Nlk: Eine Zelllinie (HEK 293) wird transient mit zwei Expres- sionsplasmiden transfiziert: 1.) ein N-terminal mit dem FLAG-Epitop-Tag versehener Nlk Klon im Expressionsvektor pcDNA3. Als Kontrolle der Spezifität wird in einer weiteren Transfektion ein mutierter Nlk-Klon mit stark reduzierter Kinaseaktivität verwendet (vorzugsweise ein mutiertes Nlk Protein mit einer Mutation von Lysin an der Position 155 zu Arginin)
2.) ein N-terminal mit einem HA-Epitop-Tag versehener Ubiquitin-Klon (Accession Nr. NP.035794, Finch et al . , 1990) im Expressionsvektor pcDNA3
3.) ein N-terminal mit einem 6-Histidin-Tag (Stüber et al., 1990) versehener DNA Klon (z.B. in pcDNA3.1 His C, Invitrogen) von einem Substrat der durch Nedd8 modulierten Ubiquitinierung (vorzugsweise c-Jun oder p27 κipl ) .
Nach der Transfektion wird den Zellen der zu prüfende Nlk-Inhibitor in Konzentrationen von InMol bis 100 μMol hinzugegeben.
48 Stunden nach der Transfektion (Lipofectamin 2000, Life Technologies) werden die Zellen mit PBS (Life Technologies gewaschen und Guanidin-HCl-Buffer ( 6M Guanidin-HCl, 0,1M Na-Phosphat pH-8, 5mM Imidazol) lysiert. Die Extrakte werden kurz soniziert um die Viskosität zu reduzieren. Die Extrakte werden in 1,5ml Reaktionsgefäßen mit 50μl Nickel-Chelat- Agarose (Ni2+-NTA, Qiagen) für 1 Stunde bei +4°C unter ständigen Mischen inkubiert. Zur Affinitätsreinigung der 6-Histidin-markierten Substratproteine wird die Nickel- Chelat-Agarose mehrfach durch Abzentrifugieren, Verwerfen des Überstandes und Resuspension in neuem Puffer gewaschen. Folgende Waschpuffer werden verwendet: 1.) Guanidin-HCl-Puffer, 2.) Guanidin-HCl-Puffer und Protein-Puffer im Verhältnis 3:1 gemischt, 3.) Guanidin-HCl-Puffer und Protein-Puffer im Verhältnis 1:1 gemischt, 4.) Guanidin-HCl-Puffer und Protein- Puffer im Verhältnis 1:3 gemischt, 5.) Protein-Puffer (50mM Na-Phosphat pH=δ.0, lOOmM KC1, 20% Glycerol, 0,2 % NP-40) . Danach wird zum Eluieren der gebundenen 6-His-markierten Proteine die Ni-NTA-Agarose mit Protein-Puffer, der 250mM I ida- zol (Sigma) enthält, bei Raumtemperatur für 30 Minuten inkubiert und abzentrifugiert . Der Überstand wird mit 2x Laemmlibuffer vermischt, aufgekocht und wie oben im "Testsystem zur Messung der Modulierung der Neddylierung zellulärer Proteine durch N1K" beschrieben durch Elektrophorese auf- getrennt und die mit HA-Ubiquitin konjugierten Proteine durch Westernblot-Analyse detektiert.
Ergebnisse: Die Menge der mit HA-Ubiquitin konjugierten Proteine ist nach Transfektion von Wildtyp-Nlk erniedrigt und von negativ-mutiertem Nlk erhöht. Zugabe eines Nlk-Inhibitors zu Zellen, welche mit Wildtyp-Nlk transfiziert worden sind, erhöht die Menge der nachweisbaren mit HA-Ubiquitin konjugierten Proteine.
Beispiel 9: Substanzen, welche in erfindungsgemäßen Testsys- temen modulierend wirken
Die im allgemeinen Teil der Beschreibung angegebenen Substanzen erhöhen oder erniedrigen die Menge der in den vorstehenden Beispielen angegebenen Proteine, wirken also modulierend. Sie sind folglich geeignet, in vorstehend angegebenen Indikationen eingesetzt zu werden, wobei die
Auswahl nach der Maßgabe erfolgt, ob unerwünschte Proliferation zu unterbinden oder unkontrollierter Zelltod zu verhindern ist. Dies läßt sich unschwer in einem entsprechend ausgewählten zellulären oder tierischen Modelsystem für die jeweilige Krankheit erproben.
Literaturangaben :
Annweiler,A. , Zwilling, S., and Wirth,T. (1994). Functional differences between the Oct2 transactivation domains deter- mine the transactivation potential of individual Oct2 iso- for s. Nucl eic Acids Res . 22, 4250-4258.
Brott BK, Pinsky BA, Erikson RL. (1998) . Nlk is a murine pro- teine kinase related to Erk/MAP kinases and localized in the nucleus. Proc Na tl Acad Sei USA 95(3): 963-8 de Wet JR, Wood KV, DeLuca M, Helinski DR, Subramani S (1987) Firefly luciferase gene: strueture and expression in mammalian cells. MoL Cell Biol . 7 (2): 725-37 Finch, JS., Bonham,K., Krieg, P. and Bowden,G.T. (1990). Murine polyubiquitin mRNA sequence. Nucl ei•c Aci•ds Res . 18 (7), 1907
Hall CV, Jacob PE, Ringold GM, Lee F. (1983) . Expression and regulation of Escherichia coli lacZ gene fusions in mammalian cells. J. Mol Appl Geriet ; 2(1); 101-9
Kumar,S., Tomooka, Y. and Noda,M. (1992). Identification of a set of genes with developmentally down-regulated expression in the mouse brain. Bi ochem . Bi ophys . Res . Commun . 185 (3) : 1155-1161 Lorenz WW, McCann RO, Longiaru M, Cormier MJ. (1991) Isolation and expression of a cDNA encoding Renilla reniformis luciferase. Proc . Natl . Acad. Sei USA 88: 443δ-42. Stüber, D., Matile, H. and Garotta, G. (1990). System for high level produetion in E. coli and rapid purification of recombinant proteins: application to epitope mapping, prepa- ration of antibodies and structure funetion analysis.
Im unological Methods (Letkoves, I. and Pernis, B., eds . ) , pp. 121-152. Academic Press, New York.
Wilson IA, Niman HL, Houghten RA, Cherenson AR, Connolly ML,
Lerner RA. (1984) . The structure of an antigenic determinant in a protein. Cell 37(3): 767-78
Lucibello F.C. and Müller, R (1989) . Sensitive microscale assay for the analysis of promoter activity m eukaryotic cells. Methods Mol . Cell . Bi ol . 1,9.

Claims

Patentansprüche
1. Verfahren zum Screenen nach Substanzen, welche die In- teraktion von Nlk in dem COP9/Signalosom-Komplex modulieren,
a) wobei ein Testsystem enthaltend ein von Nlk verschiedenes weiteres Mitglied bis alle weiteren Mitglieder des C0P9/Signalosom-Komplexes, sowie, optional, eines oder me- hrere von zumindest einem der weiteren Mitglieder des C0P9/Signalosom-Komplexes natürlicherweise abhängige Moleküle, mit einer prospektiv modulierenden Substanz oder einer Mischung solcher Substanzen inkubiert wird, wobei zugleich mit Nlk inkubiert wird, wenn Nlk nicht im Testsystem enthalten ist,
b) wobei, optional nach einer Waschverfahrensstufe zur Entfernung von nicht an Nlk gebundenen weiteren Mitgliedern des C0P9/Signaolsom-Komplexes, die Aktivität oder Konzentration zumindest eines der weiteren Mitglieder des COP9/Signalosom- Ko plexes, oder eines hiervon natürlicherweise abhängigen Moleküls bestimmt wird, nicht jedoch von Nlk,
c) wobei eine Substanz oder eine Mischung von Substanzen se- lektiert wird, wenn die in Stufe b) gemessene Aktivität oder
Konzentration erhöht oder erniedrigt ist gegenüber einer Durchführung der Stufen a) und b) , jedoch ohne Nlk oder mit imitiertem Nlk.
2. Verfahren nach Anspruch 1 oder 2, wobei das weitere Mitglied des COP9/Signalosom-Komplexes oder das hiervon natürlicherweise abhängigen Moleküls ausgewählt ist aus der Gruppe bestehend aus "JNK, Jun/Fos-Transkriptionskomplex, AP-1, NFkB, Bcl-3, Thyroidhor on-Rezeptor, c-Jun, Neddδ, HA- Ubiquitin, Tripl5, ICSBP, IRF-1, JAB-1, LFA-1, p27, p53, Cycline EA, cdk2, cdkl, SRC-1, SRC-1-assoziierte Transkriptionsfaktoren, Choriogonadotropin-Rezeptor, und VPR".
3. Verfahren nach Anspruch 1 oder 2, wobei das mutierte Nlk ausgewählt ist aus der Gruppe bestehend aus "Mutation Kδ4R,
Mutation K155R, kinaseinaktives Nlk, und Nlk mit reduzierter Kinaseaktivität" .
4. Verfahren nach einem der Ansprüche 1 bis 3, wobei in Stufe a) markiertes, beispielsweise γ-32P markiertes, energiereiches
Phopsphat, insbesondere ATP, eingesetzt wird und wobei die Aktivität durch Messung der Konzentration des mit markiertem energiereichem Phosphat phosphorylierten weiteren Mitgliedes des COP9/Signalosom-Komplexes bestimmt wird.
5. Verfahren nach einem der Ansprüche 1 bis 3, wobei in Stufe a) ein Zellsystem mit einem unter der Kontrolle eines Promotors eines weiteren C0P9/Signalosom-Komplex Mitgliedes oder eines hiervon abhängigen Moleküls stehenden Reportergen eingesetzt wird, wobei die Aktivität des weiteren Mitgliedes oder des Moleküls durch Messung der Konzentration des Reportergenproduktes bestimmt wird.
6. Verfahren nach einem der Ansprüche 1 bis 3, wobei in Stufe a) ein Zellsystem eingesetzt wird, dessen Zellen mit einem
Tag-Klon für eines der weiteren Mitglieder des COP9/Signalosom-Komplexes oder hiervon abhängigen Moleküls transfiziert ist, wobei die Aktivität des weiteren Mitgliedes oder des Moleküls durch Messung der Konzentration eines mit dem Tag reagierten Detektormoleküls, insbesondere eines konjugierten Proteins, bestimmt wird.
7. Verfahren nach einem der Ansprüche 1 bis 6, wobei eine selektierte Substanz oder eine Mischung solcher Substanzen in einem Testsystem enthaltend Nlk und TCF/LEF und/oder eines oder mehrere Mitglieder des Wnt induzierten Signalübertragungsweges eingesetzt wird und wobei solche Substanzen feinselektiert werden, welche in einem solchen Testsystem eine Wechselwirkung Nlk mit TCF/LEF und/oder mit einem Mitglied 5 des Wnt induzierten Signalübertragungsweges nicht modulieren.
8. Verwendung mindestens einer die Aktivität mindestens einer Kinase des COP9/Signalosom Komplexes modulierenden Substanz, insbesondere in einem Verfahren nach einem der Ansprüche 1
10 bis 7 selektierten Substanz, zur Herstellung einer pharmazeutischen Zusammensetzung zur Prophylaxe und/oder Therapie von Erkrankungen, die mit Zellwachstumsstörungen einhergehen
9. Verwendung nach Anspruch δ, wobei die Modulation eine Hem- 15 mung oder Verstärkung ist.
10. Verwendung nach Anspruch 8 oder 9, wobei es sich bei der Substanz um die Nlk-Kinase handelt.
20 11. Verwendung nach einem der Ansprüche δ bis 10 oder Verfahren nach einem der Ansprüche 1 bis 7, wobei die Substanz ausgewählt ist aus der Gruppe bestehend aus "Kinase- inhibierende Derivate des 4H-l-Benzopyran, Fla- vopiridolderivate, 2- (2-Amino-3-methoxyphenyl) -4-oxo-
25 4H- (1) -benzopyran, 7, 12-Dihydro-indolo (3, 2-d) (l)Benz- azepin-6- (5H) -on, OH-Staurosporine und/oder ihre Phosphokinase-inhibierenden Derivate, Butyrolacton, Rosco- vitin, Purvalanol A, Emodin, Anilino-quinazolin, Pheny- laminopyrimidin, Trioylimidazole, Paullon, 4-(4-Fluor-
30 phenyl) -2- (4-methylsulfinylphenyl) -5- (pyridyl) -IH-imiaazol, 1, 4-Diamino-2, 3-dicyano-l, 4-bis22-aminophenylthio) -butadien, 2- (2-amino-3 ' -methoxyphenyl) -oxanaphtalen-4-on, 2- (2-chlor-4-jod-phenylamino) -N-cyclopropyl- methoxy-3, 4-difluor-benzamid, bis-ethylthiomethyl,
35 Tetrapyrrolische Makrocyclen, Pyrimidonderivate, Gen für Nlk, eingefügt in ein Plasmid oder einen Vektor, Gen für Nlk mit eingefügter negativ dominanter Mutation, Antisense-Oligonukleotide, welche sich spezifisch an die DNA-Sequenz oder m-RNA Sequenz kodierend für Nlk anlagern und deren Transkrip- tion oder Translation inhibieren, und Antikörper- oder Antikörperfragmente, spezifisch für Nlk und/oder Fusionsproteine, enthaltend mindestens ein Antikörperfragment, welche (s) die Kinaseaktivität der Nlk inhibiert bzw. inhibieren" .
12. Testsystem zur Auffindung von Wirksubstanzen, welche die Aktivität mindestens einer Kinase des C0P9/Signalosom-Kom- plexes modulieren, insbesondere zur Durchführung eines Verfahrens nach einem der Ansprüche 1 bis 7, enthaltend: a. mindestens eine Probe, enthaltend mindestens einen
COP9/Signalosom-Komplex bzw. zumindest 2 Mitglieder des Komplexes einschließlich Nlk und b. mindestens ein Mittel zur Bestimmung der Aktivität mindestens einer Kinase bzw. Mitgliedes des C0P9/Signalosom-Komplexes, insbesondere en- thaltend die in einem der Ansprüche 1 bis 7 genannten Komponenten.
13. Testsystem nach Anspruch 12, wobei die Probe eine Zelle ist, enthaltend mindestens einen COP9/Signalosom-Komplex bzw. zumindest zwei Mitglieder des Komplexes einschließlich Nlk, wobei die Aktivität der jeweiligen Kinase (n) moduliert wird.
14. Testsystem nach Anspruch 12, wobei die Probe ein isolierter C0P9/Signalosom-Komplex bzw. zwei Mitglieder des Komplexes einschließlich Nlk ist, wobei die Aktivität der jeweiligen Kinase (n) moduliert wird.
15. Testsystem nach einem der Ansprüche 12 bis 14, wobei es sich bei der Kinase um die Nlk-Kinase handelt.
16. Testsystem nach einem der Ansprüche 12 bis 15, dadurch gekennzeichnet, dass die Probe a. mindestens ein Gen, kodierend für mindestens eine negative Mutante mindestens einer Kinase und/oder b. mindestens eine negative Mutante minde- stens einer Kinase enthält.
17. Verfahren zum Auffinden von mindestens einer Wirksubstanz zur Prophylaxe und/oder Therapie von Zellwachstumsstörungen, die auf mindestens eine Kinase des C0P9/Signalosom-Komplexes derart einwirkt, dass das Zellwachstum moduliert wird, enthaltend folgende Schritte: a. Inkontaktbringen mindestens einer Probe nach einem der Ansprüche 12 bis 16 mit mindestens einer potentiellen Wirksubstanz, und b. Bestimmen der Aktivität mindestens einer Kinase des COP9/Signalosom-Komplexes .
18. Arzneimittel zur Prophylaxe und/oder Therapie von Zellwachstumsstörungen, enthaltend mindestens eine Wirksubstanz nach Anspruch 11 und gegebenenfalls geeignete Hilfs- und Zusatzstoffe.
19. Verfahren zum Herstellen eines Arzneimittels nach Anspruch 18 zur Prophylaxe und/oder Therapie von Zellwachstumsstörungen, welches das Zellwachstum fördert oder hemmt, wobei ein Wirkstoff nach Anspruch 11 galenisch zur Gabe an einen Patienten hergerichtet und dosiert wird.
EP02781109A 2001-09-25 2002-09-19 Verwendung von wirksubstanzen zur prophylaxe und/oder therapie von erkrankungen, die mit zellwachstumsstörungen einhergehen, und testsystem zum auffinden solcher wirksubstanzen Withdrawn EP1432816A2 (de)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
DE10147088 2001-09-25
DE2001147088 DE10147088A1 (de) 2001-09-25 2001-09-25 Verwendung von Wirksubstanzen zur Prophylaxe und/oder Therapie von Erkrankungen, die mit Zellwachstumsstörungen einhergehen und Testsystem zum Auffinden solcher Wirksubstanzen
PCT/DE2002/003576 WO2003027317A2 (de) 2001-09-25 2002-09-19 Verwendung von wirksubstanzen zur prophylaxe und/oder therapie von erkrankungen, die mit zellwachstumsstörungen einhergehen und testsystem zum auffinden solcher wirksubstanzen

Publications (1)

Publication Number Publication Date
EP1432816A2 true EP1432816A2 (de) 2004-06-30

Family

ID=7700131

Family Applications (1)

Application Number Title Priority Date Filing Date
EP02781109A Withdrawn EP1432816A2 (de) 2001-09-25 2002-09-19 Verwendung von wirksubstanzen zur prophylaxe und/oder therapie von erkrankungen, die mit zellwachstumsstörungen einhergehen, und testsystem zum auffinden solcher wirksubstanzen

Country Status (4)

Country Link
EP (1) EP1432816A2 (de)
AU (1) AU2002349271A1 (de)
DE (1) DE10147088A1 (de)
WO (1) WO2003027317A2 (de)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107828814A (zh) * 2017-09-08 2018-03-23 信雅生物科技（苏州）有限公司 一种表达重组人nlk基因的质粒及构建方法

Family Cites Families (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE19844003A1 (de) * 1998-09-25 2000-03-30 Boehringer Ingelheim Pharma Neue substituierte Indolinone, ihre Herstellung und ihre Verwendung als Arzneimittel
DE19924401A1 (de) * 1999-05-27 2000-11-30 Boehringer Ingelheim Pharma Neue substituierte Indolinone, ihre Herstellung und ihre Verwendung als Arzneimittel
GB2375172A (en) * 2000-02-07 2002-11-06 Quark Biotech Inc Fas pathway genes
ES2327815T3 (es) * 2000-02-11 2009-11-04 Millennium Pharmaceuticals, Inc. 18477, proteina quinasa humana y usos de la misma.
WO2002066027A1 (de) * 2001-02-22 2002-08-29 Universitätsklinikum Charite Medizinische Fakultät Der Humboldt-Universität Zu Berlin, Akademische Verwaltung - Forschung Mittel zur hemmung von tumorzellen

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO03027317A3 *

Also Published As

Publication number Publication date
AU2002349271A1 (en) 2003-04-07
WO2003027317A2 (de) 2003-04-03
WO2003027317A3 (de) 2003-05-22
DE10147088A1 (de) 2003-04-17

Similar Documents

Publication Publication Date Title
Chotiner et al. Adenylyl cyclase-dependent form of chemical long-term potentiation triggers translational regulation at the elongation step
Lee et al. 6-Gingerol inhibits ROS and iNOS through the suppression of PKC-α and NF-κB pathways in lipopolysaccharide-stimulated mouse macrophages
Villard et al. Antiamnesic and neuroprotective effects of the aminotetrahydrofuran derivative ANAVEX1-41 against amyloid β25–35-induced toxicity in mice
Muchir et al. Inhibition of extracellular signal-regulated kinase 1/2 signaling has beneficial effects on skeletal muscle in a mouse model of Emery-Dreifuss muscular dystrophy caused by lamin A/C gene mutation
Yao et al. Gastrodin attenuates proliferation and inflammatory responses in activated microglia through Wnt/β-catenin signaling pathway
He et al. Asiaticoside, a component of Centella asiatica attenuates RANKL‐induced osteoclastogenesis via NFATc1 and NF‐κB signaling pathways
Ishimoto et al. Carnitine/organic cation transporter OCTN1 negatively regulates activation in murine cultured microglial cells
Min et al. Withaferin A down-regulates lipopolysaccharide-induced cyclooxygenase-2 expression and PGE2 production through the inhibition of STAT1/3 activation in microglial cells
Xiao et al. Inhibition of PDE4 attenuates TNF-α-triggered cell death through suppressing NF-κB and JNK activation in HT-22 neuronal cells
Shi et al. Endoplasmic reticulum stress-induced cell death as a potential mechanism for targeted therapy in glioblastoma
Jain et al. Role of F-actin-mediated endocytosis and exercise in mitochondrial transplantation in an experimental Parkinson's disease mouse model
Kalluri et al. Ethanol-mediated inhibition of mitogen-activated protein kinase phosphorylation in mouse brain
DE69937159T2 (de) Verfahren zur Aktivierung von SGK durch Phosphorylierung.
Hwang et al. Psoralidin stimulates expression of immediate-early genes and synapse development in primary cortical neurons
Zhang et al. Deguelin inhibits RANKL‐induced osteoclastogenesis in vitro and prevents inflammation‐mediated bone loss in vivo
Martin et al. Theobroma cacao improves bone growth by modulating defective ciliogenesis in a mouse model of achondroplasia
Wang et al. Antioxidant enzyme Prdx1 inhibits osteoclastogenesis via suppressing ROS and NFATc1 signaling pathways
Poorgholam et al. Artemisin and human endometrial-derived stem cells improve cognitive function and synaptic plasticity in a rat model of Alzheimer disease and diabetes
Kalluri et al. Effect of ethanol on phosphorylation of the NMDAR2B subunit in mouse cortical neurons
RS55696B1 (sr) Farmaceutske smeše sa velikom dozom biotina
Nakagawa-Yagi et al. Discovery of a novel compound: insight into mechanisms for acrylamide-induced axonopathy and colchicine-induced apoptotic neuronal cell death
EP1432816A2 (de) Verwendung von wirksubstanzen zur prophylaxe und/oder therapie von erkrankungen, die mit zellwachstumsstörungen einhergehen, und testsystem zum auffinden solcher wirksubstanzen
Noël et al. Lithium chloride and staurosporine potentiate the accumulation of phosphorylated glycogen synthase kinase 3β/Tyr216, resulting in glycogen synthase kinase 3β activation in SH‐SY5Y human neuroblastoma cell lines
Ko et al. 116 kDa glycoprotein isolated from Ulmus davidiana Nakai (UDN) inhibits glucose/glucose oxidase (G/GO)-induced apoptosis in BNL CL. 2 cells
Nan et al. Effects of Gualou Guizhi Decoction Aqueous Extract on Axonal Regeneration in Organotypic Cortical Slice Culture after Oxygen‐Glucose Deprivation

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20040426

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR IE IT LI LU MC NL PT SE SK TR

AX Request for extension of the european patent

Extension state: AL LT LV MK RO SI

19U Interruption of proceedings before grant

Effective date: 20040816

19W Proceedings resumed before grant after interruption of proceedings

Effective date: 20050201

RAP1 Party data changed (applicant data changed or rights of an application transferred)

Owner name: JULIUS-MAXIMILIANS-UNIVERSITAET WUERZBURG

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20070401