EP1366072A2 - Ets-transcription factor related compound specific promoter and transactivators thereof - Google Patents
Ets-transcription factor related compound specific promoter and transactivators thereofInfo
- Publication number
- EP1366072A2 EP1366072A2 EP01992719A EP01992719A EP1366072A2 EP 1366072 A2 EP1366072 A2 EP 1366072A2 EP 01992719 A EP01992719 A EP 01992719A EP 01992719 A EP01992719 A EP 01992719A EP 1366072 A2 EP1366072 A2 EP 1366072A2
- Authority
- EP
- European Patent Office
- Prior art keywords
- nucleic acid
- gene
- transcription factor
- ets
- fusion protein
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
- C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
- C07K14/4707—Muscular dystrophy
- C07K14/4708—Duchenne dystrophy
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
- C12N2710/00011—Details
- C12N2710/16011—Herpesviridae
- C12N2710/16611—Simplexvirus, e.g. human herpesvirus 1, 2
- C12N2710/16622—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
Definitions
- the present invention relates to nucleic acids capable of controlling the expression of a gene and of being activated by a novel Ets-Transcription Factor Related Compound, methods for recombinant expression using them, and methods for screening of candidate activator compounds. Furthermore, the present invention relates to a fusion protein capable of binding to said nucleic acid and methods for inducing gene expression using said fusion protein. Additionally, the present invention relates to a system for expression of a gene.
- Duchenne Muscular Dystrophy is an inherited muscle-wasting disease caused by the absence of the muscle cytoskeleton protein dystrophin. Young patients experience retardation in the achievement of motor milestones during infancy and early childhood when distal limb muscle mass is lost and replaced by connective and fatty tissue. Most DMD patients become wheelchair-bound as teenagers and die of respiratory or cardiac failure around the early age of 20 to 25. There is currently no effective treatment by medicaments available that would prevent the fatal outcome of this disease or at least contribute to the quality of life of the patient.
- DMD dystrophin gene mutations
- utrophin can be transcribed from two distinct promoters.
- the first described promoter (called UTR-promoter (A)) is located within the CpG island at the 5' end of the locus (Dennis et al., Nucleic Acid Research 24 (1996), 1646-1652).
- the second utrophin promoter which provides an alternative target for therapeutic up-regulation of utrophin is located in the intron 2 of the utrophin gene, driving the expression of a unique first exon that splices into the 13 kb utrophin mRNA (Burton et al., PNAS USA, 96 (1999), 14025- 14030).
- the utrophin protein derived from the second utrophin promoter has an N-terminal sequence that is distinct from utrophin protein derived from the UTR-promoter (A). It has been found that the B-utrophin is the most abundant form in the heart assessed on the basis of mRNA, whereas A-utrophin predominates in the kidney. Approximately, equal amounts of B-utrophin and A-utrophin RNA have been observed both in the brain and in skeletal muscle.
- the present inventors have now concluded that a different organ-specific transcription of utrophin and due to this different transcription of mRNAs a different production of utrophin A versus utrophin B may facilitate the treatment of organ-specific diseases, in particular muscle diseases as e.g. Duchenne Muscle Dystrophy.
- nucleic acid being selectively activated by organ-specific or tissue-specific distributed transcription factors and/or activators would allow a very fine tuned therapy of different diseases allowing the selective expression of genes in a tissue and/or organ-specific manner to affect treatment.
- nucleic acid capable of controlling the expression of a gene and of being activated by an Ets-transcription factor related compound, wherein the nucleic acid is selected from the following:
- nucleic acid molecule being degenerate to any of the nucleic acid molecules of (a) or (b) due to the genetic code;
- nucleic acid molecule being at least 60% homologous to any of the nucleic acid molecules of (a) to c);
- nucleic acid molecule of (a) to (g) comprises at least one Ets-transcription factor binding-site, preferably at least 2, more preferably at least 3 Ets-transcription factor binding-sites.
- an Ets-transcription factor related compound means an Ets-transcription factor and any variant thereof capable of activating the transcription from the nucleic acid according to the present invention.
- the Ets-transcription factor related compound further comprises the Ets-related transcription factor complex GA-binding protein ⁇ / ⁇ , members of the YAN-, ELG-, PEA3-, ERF-, and TCF-subfamilies of the Ets-transcription factor- family (Wasylyk, B. et al., TIBS 23 (1998), 213-216).
- Codoning means any of the cloning methods known in the art and which may be applied in the present context, none of which, however, are outlined in detail because they belong to the common general knowledge of the person skilled in the art.
- recombinant expression in a suitable host cell means any of the expression methods and expression systems known in the art which may be applied in the present context which are, however, not explained in detail, because they belong to common general knowledge of the person skilled in the art.
- inducibility means the increase in the amount of transcription from a given nucleic acid due to the presence of a transcription factor, preferably GABP, more preferably GABP_VP16 (SEQ ID NO:2).
- the inducibility is determined by the ratio of transcriptional activity from a given nucleic acid in the presence versus absence of said transcription factor.
- inducibility is defined by a ratio of at least two.
- the inducibility may be determined by promoter-reporter assay, northern blot, RT-PCR or Real-time PCR analysis.
- the inducibility is determined as follows:
- the promoter/reporter construct may be prepared by insertion of the promoter into firefly luciferase encoding plasmids, e.g. pGL2-basicTM (Promega) such that the firefly luciferase is expressed under the control of the promoter sequence.
- the generated promoter/luciferase-reporter construct is transfected into C2C12 muscle cells.
- the following transfection protocol is used:
- C2C12 myoblasts are seeded at a density of 10,000/well in 24 well-plates that are previously coated with gelatin.
- 24 h after seeding the myoblasts are transfected with 100 ng of the reporter construct, together with 10 ng of the standard pRL-TKTM vector (Promega) encoding Renilla luciferase under the control of the thymidine kinase promoter, and optionally the compound to be tested.
- 24 h later the proliferation medium containing 20 % fetal calf serum is replaced with differentiation medium containing 5 % horse serum.
- differentiation medium containing 5 % horse serum.
- the cells are lysed in 150 ⁇ l/well passive lysis buffer (Promega).
- the firefly and Renilla luciferase reporter activities contained in 20 ⁇ l lysate are then measured using the dual luciferase reporter assay (Promega). Luciferase activity produced by the promoter reporter construct is normalized to the activity derived from the cotransfected pRL-TK vector.
- basal transcriptional activity means the transcription of a gene mediated by the nucleic acid having the nucleotide sequence set forth in SEQ ID NO:1 in the absence of additional or exogenous transcription factors and/or activators.
- the basal transcriptional activity may be determined by promoter-reporter assay, northern blot, RT- PCR or Real-time PCR analysis.
- the basal transcriptional activity is determined as described above for the inducibility in the absence of any compound.
- transcription factor means any compound capable of specifically binding to enhancers and/or promoters, in particular to the nucleic acid having the nucleotide sequence set forth in SEQ ID NO:1.
- transcription activator means in the context of the present invention any substance capable of activating the transcription of a gene, in particular the utrophin gene (Pearce et al., Horn. Mol. Gene (1993), 1765-1772).
- the present inventors were the first to demonstrate the selective activation of utrophin gene transcription from the nucleic acid according to the invention using a member of the Ets-transcription factor family. It was surprisingly found that utrophin gene transcription could selectively be activated via the utrophin B-promoter using the transcription factor according to the invention while no induction could be affected by the use of the same transcription factor and the utrophin A promoter. It should be noted that mere sequence analysis within promoters does not allow the reliable prediction of functional Ets- transcription factor binding sites within a given sequence.
- the nucleic acid according to the present invention may be derived from genomic DNA, cDNA or synthetic DNA, wherein a synthetic DNA-sequence also comprises such and having modified nucleoside bonds. Furthermore, the nucleic acid may be an RNA sequence which may be necessary for the expression in recombinant vector systems.
- the nucleic acid according to (b) may e.g. be obtained by the use of a detectably labeled probe which at least partly corresponds to the sequence according to (a) or a fragment or the opposite strand thereof for screening of cDNA-libraries and genomic DNA-libraries, respectively, from eukaryotes, preferably mammalians, most preferably humans and mice.
- step (b) The identification of positive cDNA and genomic DNA clones, respectively, may be obtained using standard procedures; cf. Maniatis et al., Molecular Cloning (1989), Cold Spring Harbor Laboratory Press.
- the hybridization according to step (b) is carried out under stringent conditions. Stringent hybridization conditions are e.g. incubation at 65 °C overnight in 7% SDS, 1% BSA, 1 mM EDTA, 250 mM sodium phosphate (pH 7.2) and subsequent washing at 65 °C with 2 x SSC; 0.1% SDS.
- nucleic acids are provided which are at least 80% homologous to any of the nucleic acid molecules of (a) to (c), more preferably the nucleic acids are at least 90% and most preferably at least 95% homologous to the nucleic acid according to (a).
- the term "homology” means homology on the DNA level which may be determined using standard procedures, e.g., computer-based sequence alignments (basic local alignment search tool, S.F. Altschul et al., J. Mol. Biol. 215 (1990) 403-410).
- the expression "homology”, well-known to the skilled person, designates the degree of relatedness between two or more nucleic acid molecules, which is determined by the agreement between the sequences.
- the “percentage homology” is obtained from the percentage of identical regions in two or more sequences taking account of gaps or other sequence features.
- the homology of mutually related nucleic acid molecules can be determined by means of known procedures.
- special computer programs with the algorithms taking account of the special requirements are used.
- GCG program package including GAP (Devereux, J., et al., Nucleic Acids Research 12 (12): 387 (1984); Genetics Computer Group University of Wisconsin, Madison, (Wl)); and BLASTP, BLASTN and FASTA (Altschul S., et al., J. Mol. Biol., 215: 403-410 (1990)).
- the BLASTX program can be obtained from the National Center for Biotechnology Information (NCBI) and from other sources (BLAST Handbook, Altschul S., et al., NCB NLM NIH Bethesda MD 20894; Altschul S., et al., J. Mol. Biol., 215: 403-410 (1990)).
- NCBI National Center for Biotechnology Information
- the well-known Smith-Waterman algorithm can also be used for the determination of homologies.
- Preferred parameters for the nucleic acid sequence comparison include the following:
- the GAP program is also suitable for use with the above parameters.
- the above parameters are the default parameters for nucleic acid sequence comparisons.
- gap opening penalties including those named in the program handbook, Wisconsin package, Version 9, September 1997, can be used. The choice will depend on the comparison to be performed and further on whether the comparison is performed between sequence pairs, when GAP or Best Fit are preferred, or between one sequence and a large sequence database, when FASTA or BLAST are preferred.
- the nucleic acid molecule of (d) to (g) exhibits at least 60%, preferably 80%, more preferably 90% of the inducibility of the nucleic acid having SEQ ID NO:1 by the transcription factor GABP and/or at least 60%, preferably 80%, more preferably 90% of the basal transcriptional activity of the nucleic acid having SEQ ID NO:1.
- the Ets-transcription factor related compound is a GABP sequence. It is particularly preferred that the GAPB variant used to determine the inducibility of the nucleic acid is GAPB_VP 16 (SEQ ID NO:2).
- the present invention further provides constructs comprising the nucleic acid according to claim 1 and at least one heterologous gene operably linked to the nucleic acid such that the heterologous gene is expressed under the control of the nucleic acid.
- the heterologous gene may be derived from any source.
- the heterologous gene may be derived from a gene whose gene product has therapeutic potential such as e.g. cytokines, complement factors or hematopoietins.
- said construct may further comprise regulatory regions for transcription and/or replication.
- the above regulatory regions for transcription and/or replication may be derived from a vector selected from bacteriophages such as ⁇ -derivatives, plasmids, adenoviruses, vaccinia viruses, baculoviruses, SV 40 viruses.
- the construct additionally comprises a signal peptide encoding nucleic acid sequence ensuring export of the expressed protein, wherein the signal peptide coding nucleic acid sequence preferably is directly 5' of the heterologous gene to be expressed.
- host cells comprising the nucleic acid molecule and/or the construct and being capable of expressing the heterologous gene.
- the host cells may e.g. be selected from prokaryotic cells such as E. coli or B. subtilis from eukaryotic cells such as yeast cells, insect cells and yeast cells, e.g. CHO-cells, COS-cells or HeLa-cells and derivatives thereof.
- the Ets-transcription factor binding-site is selected from the following consensus sequences: 5' (C/A) GGA (A/T) (A/G) 3' or in the reverse orientation 5' (C/T) (A/T) TCC (T/G) 3'.
- SEQ ID NO:1 human utrophin B promoter
- the promoter sequence of the mouse utrophin gene has also been analyzed where two conserved sequences for the binding of Ets-transcription factors can be identified at equivalent positions.
- the present invention provides a pharmaceutical composition comprising at least one nucleic acid according to the present invention and/or one construct according to the present invention.
- the medical indication for which said pharmaceutical composition is useful depends on the heterologous gene to be expressed under the control of the nucleic acid according to the present invention. It is therefore preferred that the heterologous gene is a gene encoding a protein having therapeutic activity. It is preferred that the heterologous gene encodes cytokine, a complement factor, a hematopoietin or a cytoskeletal protein. More preferably, the gene is utrophin. The usefulness of utrophin has been suggested when utrophin has been experimentally overexpressed in transgenic mice that lack dystrophin but show elevated levels of utrophin message and protein.
- compositions according to the invention are for enteral, oral, subcutaneous, parenteral, or intravenous administration.
- the pharmaceutical composition may further comprise pharmaceutically acceptable excipients, vehicles or carriers, and optionally other ingredients well-known in the art.
- the amount to be administered may be determined on the basis of common general knowledge by the physician and depends on the age and physical conditions of the human and/or animal to be treated.
- the present invention further provides a method for recombinant expression of a gene comprising the following steps:
- the person skilled in the art is aware of numerous methods for recombinant expression of nucleic acids; cf. Recombinant Gene Expression Protocols in Methods in Molecular Biology, volume 62, Humana Press Totowa, New Jersey, (1995).
- the expression may be constitutive or inducible, wherein suitable inducers such as IPTG and Zn 2+ are known to the person skilled in the art.
- the produced gene product may be purified by chromatography methods known in the art such as ion exchange, gel chromatography, hydrophobic chromatography and/or gel filtration chromatography.
- recombinant expression of the gene is effected and/or facilitated by the provision of an Ets-transcription factor related compound to the transfectant.
- the Ets-transcription factor related compound may be administered either by a nucleic acid containing a construct wherein the nucleic acid encodes the Ets-transcription factor related compound or by the administration of the compound as such to the transfected cell.
- the present invention relates to a method for screening and/or providing of candidate compounds being capable of regulating transcription comprising the step of bringing into contact the nucleic acid according to the invention with compounds to be screened and detecting the transcriptional activity in the presence and absence of said compounds and optionally purifying and/or synthesizing the positively tested compound.
- the gene operably linked to the nucleic acid according to the present invention is a reporter gene. Suitable reporter genes are e.g. firefly luciferase or ⁇ -galactosidase. The determination of expression of the reporter gene is well-known in the art.
- the nucleic acid according to the present invention is capable of being selectively activated by an Ets-transcription factor related compound, in particular GABP or a variant thereof (GABP_VP16).
- an Ets-transcription factor related compound in particular GABP or a variant thereof (GABP_VP16).
- GABP_VP16 an Ets-transcription factor related compound
- the nucleic acid according to the present invention should be particularly useful in retrieving novel-compounds being capable of mimicking the effect of GABP.
- the method is useful for the screening of candidate compounds from synthetic libraries or from isolates from natural sources.
- the present invention also encompasses the compounds obtainable by said method.
- the novel compounds obtained by said method may be identified by routine methods such as N-terminal sequencing and/or mass spectrometry well-known in the art.
- the present invention provides a fusion protein capable of binding to a nucleic acid according to the invention, wherein the fusion protein comprises at least a part of a transcription factor domain and at least a part of a viral transcription activator domain.
- the present invention contemplates the use of any transcription factor domain for said fusion protein.
- the transcription factor domain comprises at least a part of a DNA binding domain, a part of a domain required for heterodimerization with a DNA binding protein and/or a part of a domain for nuclear localization, or a combination thereof.
- the transcription factor is selected from a member of the Ets-transcription factor family such as e.g.
- the transcription factor is GABP ⁇ or a fragment thereof.
- the transcription factor is GABP ⁇ or a fragment thereof.
- human GABP ⁇ having amino acids 1 to 330.
- GABP ⁇ comprises a notch/ankyrin repeat motif domain required for heterodimerization with the DNA-binding protein GABP ⁇ , a domain consisting of amino acids 243 to 330 responsible for nuclear localization, a leucine- zipper-like structure domain required for homodimerization and activation of transcription by GABP.
- the transcription activator domain present in the fusion protein has a stretch of at least 4 negatively charged amino acids, wherein said negatively charged amino acids may be consecutive or interrupted by non-negatively charged amino acids. More preferably, the negatively charged amino acids are ordered in the form of a negatively charged amphipathic helix. It has been postulated that a negatively charged amphipathic helix is a common structural theme and a synthetic construction thereof has been found to be active (Giniger and Ptashne, Nature 330 (1987), 670).
- the transcription activator from which the activation domain is derived may be selected from herpes simplex virus I protein VP 16, yeast transcription factors GCN4 and GAL4.
- the transcription activator is herpes simplex virus I protein VP16 or a fragment thereof.
- the minimal transcription activator domain from VP16 useful as a viral transcription activator domain according to the present invention comprises position 436 to 447 of the VP16 sequence (Baron et al., Nucleic Acids Res. 25 (1997), 2723-2729), i.e. the transcription activator domain having the sequence PADALDDFDLDML (SEQ ID NO:3).
- the fusion protein has the amino acid sequence (SEQ ID NO:2).
- Said fusion protein comprises as the N-terminal portion amino acids 1 to 330 of human GABP ⁇ , a 6 amino acid linker followed by the 78 amino acids transactivation domain of VP16, i.e. amino acids 336 to 414 of GABP ⁇ _VP16.
- the GABP ⁇ part thereof maintains the domain required for heterodimerization with GABP ⁇ and the domain required for nuclear localization.
- the fusion protein is capable of activating the expression of a gene under the control of the nucleic acid according to the present invention.
- the fusion protein according to the present invention is capable of specifically activating the expression of genes by binding to Ets- transcription factor binding-sites. Contrary to endogenous GABP ⁇ , the fusion protein according to the present invention exhibits constitutive activity by the transfer of the viral transcription activator domain.
- the present invention further provides a method for inducing gene expression comprising administering a fusion protein according to the present invention to a cell.
- the method represents an in vitro method.
- the method is considered to be useful for the promoter sequence specific activation of gene expression provided that the promoter sequence comprises at least one, preferably two or more Ets-transcription factor binding sites.
- the present invention provides pharmaceutical compositions comprising at least one fusion protein.
- the pharmaceutical composition may further comprise pharmaceutically acceptable excipients, carriers or diluents. Said additives are well-known in the art.
- the pharmaceutical composition may be formulated for intravenous, subcutaneous, intramuscular, peritoneal, perenteral administration. The mode of administration can be determined by the physician.
- the pharmaceutical composition is used for inducing the gene expression of a gene selected from disease-relevant genes selected from cytokines, complement factors, hematopoietins and cytoskeletal proteins.
- the gene is selected from the utrophin gene, IL-2, factor IX, CD18, thrombopoeitin and Apo-1/Fas (CD95).
- GABP thrombopoeitin
- nucleic acid according to the invention being operably linked to a gene such that the gene is expressed under the control of a nucleic acid according to the invention
- an Ets-transcription factor related compound Having regard to the exemplary part it has been demonstrated that the fusion protein according to the present invention being specific for Ets-transcription factor binding sites specifically activated transcription of the utrophin B promoter while transcription from the utrophin A promoter has not been not activated.
- the gene is selected from utrophin, IL-2, factor IX, CD18, TPO and Apo- 1/Fas(CD95).
- the Ets-transcription factor related compound is GABP or a variant thereof. More preferably, the Ets-transcription factor related compound is human GABP ⁇ , most preferably, the fusion protein according to the present invention, comprising a domain of GABP ⁇ and the transactivation domain of VP16.
- the kit is useful for the Ets-transcription factor related compound-controlled expression of a gene in a host cell.
- nucleic acid according to the invention being operably linked to a gene may be comprised in a construct as described above optionally further comprising regulatory regions for transcription and/or replication.
- the Ets-transcription factor related compound is as defined above.
- the Ets- transcription factor related compound is GABP or a variant thereof, particularly preferred, the GABP variant is the fusion protein comprising a domain of GABP ⁇ and the transcription activation domain of herpes simplex Virus I VP16.
- the present invention further provides a method for tissue-specific increase of utrophin- expression comprising the step of providing a fusion protein according to the present invention with said tissue.
- the tissue is selected from skeletal muscle, heart, brain and kidney.
- the fusion protein having SEQ ID NO:2 selectively activates the utrophin promoter (B)
- administration of the fusion protein selectively increases the production of utrophin B-protein which may have potential therapeutic implications.
- Tissue- and/or organ-specification administration by selective vehicles such as viruses, electroporation, perhapsgene-gun" or naked DNA injection allows for site-controlled expression of utrophin B.
- the present invention further relates to a method for affecting the transcriptional activity of a promoter containing an Ets-transcription factor binding-site comprising the step of bringing into contact said promoter with a fusion protein according to the present invention.
- any promoter having at least one Ets-transcription factor binding-site is considered to be useful.
- the promoter may be selected from e.g. the promoter of the acetylcholine receptor ⁇ and ⁇ subunits and IL-2 and CD18.
- the present invention relates to the specific application consensus sequence for the binding of Ets-transcription factors located in the human UTR-promoter (B).
- the consensus sequence is preferably selected from 5' (C/A) GGA (A/T) (A/G) 3' or 5' (C/T) (A/T) TCC (T/G) 3'.
- the consensus sequence is located at positions 32 and 145 and 294 in the human utrophin promoter (B).
- the present invention further relates to the use of the specific application consensus sequence for the binding of Ets-transcription factors according to the present invention for the treatment of muscle diseases.
- the muscle diseases are preferably selected from muscular dystrophy as a consequence of dystrophin deficiency, such as Duchenne- and Becker-Type-Muscular Dystrophy.
- the present invention further relates to the specific application of Ets-transcription factors and transcription factors of Ets-subfamilies for the activation of the UTR-promoter (B).
- the transcription factor is preferably a member of the GABP-family of transcription factors.
- the transcription factor is GABP ⁇ .
- the transcription factor is constitutively activated by any pharmacological or molecular manipulation of the transcription factor itself or the cellular environment. It is preferred that the GABP ⁇ is constitutively active by means of fusing the amino-terminal portion GABP ⁇ to any transcription activation domain.
- the transcription activation domain preferably consists of sequences derived from the herpes simplex virus I transcription factor VP16.
- the activated transcription factors are endogenous components of muscle cells. The activated transcription factors are introduced into the diseased muscle tissue by any means of manipulation.
- the activated transcription factors are introduced in the diseased muscle tissue by means of viral transfection using any form of viral vehicle.
- the viral vehicle may be selected from a retrovirus or an adenovirus, or an adeno-associated virus carrying genetic information including unmodified or activated forms of said transcription factors.
- the present invention further relates to a process for activation of the UTR-promoter (B) by using the constitutively active GABP ⁇ _VP16 factor.
- the present invention further provides a pharmaceutical preparation by using consensus sequences according to the invention for use in a method of treating the human or animal body.
- the pharmaceutical preparation may be used in a method of treating Duchenne- and Becker-type muscular dystrophy and related forms of muscle wasting.
- the present invention also relates to the use of the specific application consensus sequences for the binding of Ets-transcription factors according to the present invention for the manufacture of pharmaceutical preparations for treating Duchenne- and Becker-type muscular dystrophy and related forms of muscle wasting.
- (A,B) Consensus sequence for the binding of Ets-related transcription factors in two possible orientations.
- C Alignment of the human (top) and mouse (bottom) region of the utrophin-promoter (B) region. The relative sequence positions refer to sequences published under GenBank accession number AJ250044 (human) and GenBank accession number AJ250045 (mouse). Gray boxes indicate putative binding sites for Ets-transcription factors. Note that two of these sites are conserved in human and mouse. An arrow indicates the location of the transcription start site. "M” indicated the translation start site.
- the hatched region represents a leucine-zipper-like structure essential for homodimerization and activation of transcription by GABP.
- GABP ⁇ _VP16 constitutively active mutant of GABP ⁇
- the last 52 amino acids of GABP ⁇ were replaced by a 6 amino acids linker followed by the 78 amino acids transactivation domain of VP16.
- C Intracellular anti-myc staining of COS cells transfected with a myc- tagged GABP ⁇ construct (GABP ⁇ -myc). GABP ⁇ is localized in the cytoplasm (left). Upon cotransfection with GABP ⁇ _VP16, GABP ⁇ accumulates in the cell nucleus (right).
- GABP ⁇ _VP16 is capable of inducing target gene transcription that contains Ets- transcription factor binding-sites.
- the UTR-promoter (B) has been analyzed for the presence of sequences related to the consensus sequence for the binding of Ets-transcription factors using the matrix recognition software Matlnspector (Quandt, K.; Freeh, M.J., Karas, H.; Wingender, E.; Werner, T. Nucleic Acid Res. 23: 4878-4884 (1995)).
- Matlnspector Two such consensus sequences were identified in the human sequence of utrophin starting at positions 32, 145, and 294 with reference to the published human utrophin sequence.
- sequence of the mouse utrophin gene has also been analyzed where two conserved sequences for the binding of Ets-transcription factors can be identified at equivalent positions.
- the constitutively active construct of GABP ⁇ (designated as GABP ⁇ -VP16 thereafter) was generated by in-frame fusion of a cDNA fragment encoding the 78 COOH-terminal amino acids of VP16 (Triezenberg, S.J.; Kingsbury, R.C; McKnight, S.L. Genes Dev. 2: 718-729 (1988)), preceded by a 6 amino acids linker, to the 3' end of a cDNA fragment encoding GABP ⁇ DN (Fig. 2).
- the transactivation domain of herpes simplex virus I, transcription factor VP16 was amplified by PCR and inserted into pcDNAI (Invitrogen, Carlsbad, CA).
- the GABP ⁇ DN fragment was amplified by PCR using primers sGABP ⁇ , 5' GGAATTCGAAGCTTTTCCAGATGT 3' (SEQ ID NO:4); asGABP ⁇ DN _EcoRI, 5' GGAATTCTTCTGCACATTCCACCC 3' (SEQ ID NO:5), and a previously described GABP ⁇ construct as a template (Briguet, A.; R ⁇ egg, M.A. J. Neurosci. 20:5989-5996 (2000)).
- GABP ⁇ _VP16 is able to dimerize with GABP ⁇ and is translocated into the cell nucleus.
- the replacement of the Leucine-Zipper-like domain of GABP ⁇ with the VP16 transactivation domain renders the GABP ⁇ _VP16 protein fully functional with regard to the ability to dimerize with GABP ⁇ and the accumulation to the nucleus of cells.
- Fig. 2D shows the ssequence of GABP_VP16.
- GABP ⁇ _VP16 activation of the acetylcholine receptor (AChR) ⁇ -subunit gene promoter is dependent on the Ets-transcription factor binding site present in this promoter region.
- the human AChR ⁇ subunit gene promoter sequence has been deposited under GenBank accession numbers Z84811 and GI1922319. The transcription rate of this AChR ⁇ subunit gene promoter/luciferase reporter construct in cotransfection experiments with the C2C12 myogenic cell line has been compared. In addition to the AChR ⁇ subunit gene promoter/luciferase reporter construct cells were either transfected with GABP ⁇ _VP16 construct or with the NLS-LacF construct for control (Briguet, A.; R ⁇ egg, M.A. J. Neurosci. 20:5989-5996 (2000)).
- C2C12 myoblasts were seeded at a density of 10'000/well in 24-wells plates that were previously coated with gelatin. 24 h after seeding the myoblasts were transfected with 100 ng of either reporter constructs, together with 10 ng of the standard pRL-TK vector (Promega) encoding Renilla luciferase under the control of the thymidine kinase promoter, and 25 ng of NLS-LacF or GABP ⁇ _VP16. 24 h later the proliferation medium containing 20% fetal calf serum was replaced with differentiation medium containing 5% horse serum.
- the cells were lyzed in 150 ⁇ l/well passive lysis buffer (Promega).
- the firefly and Renilla luciferase activities contained in 20 ⁇ l lysate were then measured using the dual luciferase reporter assay (Promega).
- Luciferase activity produced by the promoter reporter constructs was normalized to the activity derived from the cotransfected pRL-TK vector.
- the UTR-promoter (A)-reporter construct was generated by PCR using primers s71mUP, 5' GGTCAGCACCAACACTATTTG 3' (SEQ ID NO:6); as1157 mUP, 5' GTGGAAAGCCCGACAAGATCC 3' (SEQ ID NO:7), and mouse genomic DNA as a template.
- the PCR product was inserted into pGL-2 basic (Promega) opened with Nhel.
- the UTR-promoter (B) reporter construct was generated by PCR using primers sUP2, 5' GATTGTGGTGATGGTTGTAGAA 3' (SEQ ID NO:8 asUP2, 5' GAGATGAGGAAAAAGATGTGGAG 3' (SEQ ID NO:9), and human genomic DNA as a template.
- the PCR product was inserted into pGL3-basic opened with Smal.
- a schematic representation of the UTR-promoter/luciferase-reporter constructs is shown in Fig. 4A.
- the muscle creatine kinase MCK promoter reporter construct was generated by inserting a Hindlll fragment isolated form pBS-MCK construct into the Smal site of pGL3 (Promega).
- the mouse MCK gene promoter sequence has been deposited under GenBank accession number Gl 199087.
- the N-CAM promoter reporter construct (GenBank accession number: GI35004) was generated by PCR using primers NCAMs- 611, 5' CCTCTCGAGAATCGAAATGGAGGGATTT 3' (SEQ ID NO: 10), NCAMas-144, 5' GTAGATCTGTTTCTCGCCAGCCGAG 3' (SEQ ID NO: 11), and human genomic DNA as a template.
- the PCR product was digested with Xhol-Bgll and inserted into pGL3- basic opened with Xhol-Bgll.
- Gly Gin Asp Asp Glu Val Arg lie Leu Met Ala Asn Gly Ala Pro Phe 20 25 30
- Gin Asn Gin lie Asn Thr Asn Pro Glu Ser Pro Asp Thr Val Thr lie 165 170 175
Abstract
Description
Claims
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
EP01992719A EP1366072A2 (en) | 2000-11-02 | 2001-10-31 | Ets-transcription factor related compound specific promoter and transactivators thereof |
Applications Claiming Priority (4)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
EP00123842 | 2000-11-02 | ||
EP00123842 | 2000-11-02 | ||
EP01992719A EP1366072A2 (en) | 2000-11-02 | 2001-10-31 | Ets-transcription factor related compound specific promoter and transactivators thereof |
PCT/EP2001/012662 WO2002036620A2 (en) | 2000-11-02 | 2001-10-31 | Ets-transcription factor related compound specific promoter and transactivators thereof |
Publications (1)
Publication Number | Publication Date |
---|---|
EP1366072A2 true EP1366072A2 (en) | 2003-12-03 |
Family
ID=8170271
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
EP01992719A Withdrawn EP1366072A2 (en) | 2000-11-02 | 2001-10-31 | Ets-transcription factor related compound specific promoter and transactivators thereof |
Country Status (3)
Country | Link |
---|---|
EP (1) | EP1366072A2 (en) |
AU (1) | AU2002219070A1 (en) |
WO (1) | WO2002036620A2 (en) |
Family Cites Families (5)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
DE4340116A1 (en) * | 1993-11-25 | 1995-06-01 | Boehringer Ingelheim Int | New transcription factor mutants and their use |
DE69631041T2 (en) * | 1995-04-24 | 2004-09-02 | Medical Research Council | PROTOTOR OF UTROPHING |
AU4563599A (en) * | 1998-06-16 | 2000-01-05 | Regents Of The University Of California, The | Exons 4 and 7 encode separate transactivating and chromatin localizing domains in esx |
EP1146893A1 (en) * | 1998-12-11 | 2001-10-24 | Tejvir S. Khurana | Neurite derived growth factors for use in the treatment of muscular dystrophy |
GB9923423D0 (en) * | 1999-10-04 | 1999-12-08 | Isis Innovation | Promoting gene expression |
-
2001
- 2001-10-31 AU AU2002219070A patent/AU2002219070A1/en not_active Abandoned
- 2001-10-31 WO PCT/EP2001/012662 patent/WO2002036620A2/en active Application Filing
- 2001-10-31 EP EP01992719A patent/EP1366072A2/en not_active Withdrawn
Non-Patent Citations (1)
Title |
---|
See references of WO0236620A3 * |
Also Published As
Publication number | Publication date |
---|---|
WO2002036620A9 (en) | 2002-09-19 |
WO2002036620A3 (en) | 2003-06-05 |
WO2002036620A2 (en) | 2002-05-10 |
AU2002219070A1 (en) | 2002-05-15 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Nakagawara et al. | Cloning and chromosomal localization of the human TRK-B tyrosine kinase receptor gene (NTRK2) | |
KR20100017494A (en) | Wound and cutaneous injury healing with a nucleic acid encoding a proteoglycan polypeptide | |
CA2326401C (en) | Molecular regulatory circuits to achieve sustained activation of genes of interest by a single stress | |
CN113613668A (en) | Miniaturized dystrophin protein and uses thereof | |
JP2000513571A (en) | DP. DNA encoding 75 and steps for its use | |
EP1163334A1 (en) | Polynucleotide and deduced amino acid sequences from stromal cells | |
US5972609A (en) | Utrophin gene promotor | |
EP1283214B1 (en) | Novel collectins | |
EP1218525B1 (en) | Utrophin gene promoter | |
EP1366072A2 (en) | Ets-transcription factor related compound specific promoter and transactivators thereof | |
JPH10504714A (en) | Human potassium channel 1 and 2 proteins | |
JPH0892289A (en) | Protein related to human machado joseph disease, cdna and gene coding for the same protein, vector containing the same dna or gene, host cell transformed with the same manifestation vector, method for diagnosing machado joseph disease and therapeutic agent therefor | |
EP1194551A1 (en) | G-protein coupled receptor and dna sequences thereof | |
MXPA01013265A (en) | Head trauma induced cytoplasmatic calcium binding protein. | |
JP2003061672A (en) | New human bmcc1 gene | |
JP2002153290A (en) | New unc5h4 gene and protein encoded thereby | |
JP2001321175A (en) | Nucleic acid sequence that is characteristically enhanced in expression of human neuroblastoma of good prognosis, in comparison of human neuroblastoma of good prognosis with those of poor prognosis | |
EP1165777A2 (en) | Genes encoding human potassium channel proteins | |
WO2001030836A1 (en) | Novel human atpases and encoding sequences thereof | |
WO2001030818A1 (en) | A novel polypeptide-rna binding protein 33 and polynucleotide encoding said polypeptide | |
US20040171801A1 (en) | Nk-2 homeobox transcription factor | |
JP2002330771A (en) | Human pem as target for birth control and for treating alzheimer's disease | |
WO2001038372A1 (en) | A novel polypeptide-human paneth cell enhanced expression-like protein and the polynucleotide encoding said polypeptide | |
JP2000228984A (en) | New h per3 gene and protein encoded by the same | |
EP1198569A1 (en) | G-protein coupled receptor and dna sequences thereof |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
17P | Request for examination filed |
Effective date: 20030509 |
|
AK | Designated contracting states |
Kind code of ref document: A2 Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE TR |
|
AX | Request for extension of the european patent |
Extension state: AL LT LV MK RO SI |
|
RAP1 | Party data changed (applicant data changed or rights of an application transferred) |
Owner name: SANTHERA PHARMACEUTICALS (SCHWEIZ) GMBH |
|
RAP1 | Party data changed (applicant data changed or rights of an application transferred) |
Owner name: SANTHERA PHARMACEUTICALS (SCHWEIZ) GMBH |
|
17Q | First examination report despatched |
Effective date: 20050722 |
|
RAP1 | Party data changed (applicant data changed or rights of an application transferred) |
Owner name: SANTHERA PHARMACEUTICALS (SCHWEIZ) AG |
|
STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN |
|
18D | Application deemed to be withdrawn |
Effective date: 20090505 |