EP1346057A2

EP1346057A2 - Method for producing heterologous proteins in a homothallic fungus of the sordariaceae family

Info

Publication number: EP1346057A2
Application number: EP01988083A
Authority: EP
Inventors: Ulrich Kück; Stefanie PÖGGELER; Sandra Masloff; Minou Nowrousian; Oliver Bartelsen; Gerd Gellissen; Michael Pfeil
Original assignee: Gellissen Gerd Prof Dr; Rhein Biotech GmbH
Current assignee: Gellissen Gerd Prof Dr; Dynavax GmbH
Priority date: 2000-12-29
Filing date: 2001-12-28
Publication date: 2003-09-24
Also published as: AU2002240882A1; WO2002053758A2; CA2433430A1; US20040077047A1; WO2002053758A3

Abstract

The invention relates to a method for producing a heterologous protein in a filamentous fungus and to suitable promoters therefor. The invention also relates to vectors and host cells and to a kit and the use thereof. The aim of the invention is to provide a method for producing a heterologous protein in a filamentous fungus, which allows the efficient production of heterologous proteins and in which a contamination of the created protein by vegetative spores is prevented. To achieve this, the invention discloses a method for producing a heterologous protein in a filamentous fungus, which comprises (a) the cultivation of a homothallic fungus of the Sordariaceae family, which contains an expression cassette with the following elements in a functional combination: a promoter that is active in the fungus of the Sordariaceae family; a heterologous gene and a terminator that is active in the fungus of the Sordariaceae family and (b) the harvesting of the created protein in a manner known per se.

Description

Process for the production of heterologous proteins in a homothallic fungus of the Sordariaceae family

The present invention relates to methods for producing heterologous protein in a filamentous fungus and to promoters suitable therefor. The present invention further relates to vectors and host cells and to a kit and their use.

Genetic engineering methods allow the establishment of expression systems for the production of recombinant proteins. In the 20-year tradition of industrial genetic engineering, different microorganisms or cell lines were developed and used as host systems. A host was determined according to the criteria of availability, the economy of a production process based on it, the area of application and the properties of the protein to be produced. Various Gram-positive and Gram-negative bacteria, mammalian cells and various types of fungi, including yeasts and filamentous fungi, served as expression systems.

The production of mammalian proteins and in particular human proteins, which are used in pharmaceutical products, is of particular economic importance. Bacterial expression systems such as E. coli are often unsuitable for the production of such proteins, which often have a complex glycosylation pattern, because bacteria neither secrete such heterologous proteins nor the modifications of polypeptides associated with the secretion pathway of higher (eukaryotic) organisms such as that Can form glycosylation. The deposition of recombinant products in inclusion bodies very often leads to the formation of insoluble and biologically inactive protein aggregates. A heterologous product therefore often has to be converted into a biologically active form in a complex de-and renaturation process.

Mammalian cells are therefore used to produce proteins that require complex mammalian glycosylation. However, mammalian cell systems are very expensive; the cells are also a potential target for pathogenic viruses. Yeasts and filamentous fungi, on the other hand, have a glycosylation pattern that differs from the complex mammalian type, but they can be used for a large number of products. As eukaryotic microorganisms, they are capable of secretion and can act like bacteria fermented on inexpensive media in large cell densities. Since the culture media contain neither serum nor other potential contaminants, the heterologous protein produced can be purified easily and inexpensively. Examples of established expression systems are yeasts such as S. cerevisiae and the methylotrophic yeast Hansenula polymorpha.

Within the group of filamentous fungi, which are considered to be better "secreteers", various Aspergillus-Aiϊer and Neurospora crassa were used for heterologous gene expression. However, these fungi have so far been used almost exclusively for the industrial production of technical enzymes because the presence of vegetative spores, which occur in large quantities in the culture and are difficult to remove, prevented their use for the production of pharmaceutical products, since spore-free preparations are prevented can only be produced with great effort. This applies in particular to the frequently used species Aspergillus nidulans, which can reproduce sexually (through ascospores) and especially asexually (through conidiospores).

Another problem in the production of heterologous proteins in filamentous fungi are the inactivation systems for heterologous DNA, which are particularly effective when heterologous DNA is inserted into the genome of the fungus. The gene inactivation, e.g. Very well described for Neurospora crassa or Ascobolus immersus, it can take place at different levels, i.e. the transcriptional or the posttranscriptional level. Similar phenomena have also been described in transgenic plants. An overview of this can be found in Cogoni and Macino (1999).

In Neurospora crassa, the so-called RIP phenomenon was observed after DNA transformation (Singer et al., 1995; Selker, 1997), in which multiple copies of heterologous DNA are inactivated by point mutations or DNA modifications (e.g. methylation). As a result, foreign genes cannot be efficiently expressed in Neurospora crassa after meiotic crossing.

The object of the present invention is therefore to provide a method for producing heterologous protein in a filamentous fungus, which allows efficient production of heterologous proteins and in which contamination of the protein produced by vegetative spores is avoided. According to the invention, this object is achieved by a method for producing heterologous protein in a filamentous fungus, which comprises cultivating a homothallic fungus of the Sordariaceae family which contains an expression cassette which contains the following elements in functional combination:

a promoter active in the fungus of the Sordariaceae family,

- a heterologous gene and

a terminator active in the fungus of the Sordariaceae family,

and harvesting the protein produced in a manner known per se.

For the purposes of the invention, a “heterologous gene” denotes a coding nucleic acid sequence that comes from a different gene than the promoter contained in the expression cassette.

In contrast to heterothallic species of this family or other filamentous fungi such as Aspergillus nidulans or Podospora anserina, homothallic fungi of the Sordariaceae family do not develop macroconidia or microconidia, since they reproduce exclusively sexually. Athrospores, which are formed by the decay of the hyphae, are also not to be found. Contamination of the protein produced with vegetative spores, which is a major problem in the production of pharmaceutically relevant proteins with filamentous fungi, is thus avoided.

Furthermore, it has surprisingly been found that the RIP phenomenon observed in Neurospora crassa and other filamentous fungi does not occur after DNA transformations in homothallic fungi of the Sordariaceae family and in particular in Sordaria macrospora. Sordaria macrospora has no genetic mechanisms to repetitive sequences z. B. inactivate by methylation or point mutation. As a result, heterologous DNA, which is present in multiple copies after transformation into the genome of the fungus, is not inactivated unlike Neurospora crassa and other filamentous fungi. Post-transcriptional gene inactivation is not known in homothallic fungi of the Sordariaceae family.

The Sordariaceae family belongs to the class of Ascomycetes (hose fungi), which according to Strasburger (textbook of botany) is classified in the order of the Sphaeriales (Sordaria- les). As an example of the life cycle of homothallic fungi of the Sordariaceae family, the life cycle of Sordaria macrospora can be described as follows write: This mushroom is a haplo-dikaryote that only reproduces sexually. Vegetative spores, eg conidiospores, are not formed by this fungus. The fungus is homothallic, that is, it has a monocia that is not overlaid by incompatibility and can therefore reproduce sexually through selfing (K. Esser, Kriptogamen I, 2000). The fertilization process that precedes sexual reproduction is referred to as autogamous. The haploid nuclei in the ascogon conjugate and initiate the dikaryotic phase. The sexual ascospores are formed in asci (tubes). Several asci (approx. 100) ripen simultaneously in fruiting bodies, the so-called perithecia. This type of fruiting body is typical of the representatives of the Sordariales. After ripening, the ascospores are actively thrown out of the perithecia. In nature, the ascospores are absorbed by the food of herbivores and are released after a gastrointestinal passage. The gastrointestinal passage is a prerequisite for the subsequent germination of the spores on the herbivore manure.

The homothallic fungus of the Sordariaceae family which is used in the method according to the invention is preferably a fungus of the genus Sordaria. Homothallic fungi of the Sordariaceae family which are particularly preferred for carrying out the invention are Sordaria macrospora or Sordaria fimicola; other homothallic fungi of the same family which are suitable for carrying out the method according to the invention are Neurospora linoleata, Neurospora africana, Neurospora dodgei, Neurospora galapagosensis, Neurospora pannonica and Neurospora terricola.

Sordaria macrospora, like Sordaria fimicola, is a coprophilic saprophyte that grows on herbivore manure. The hyphae is taxonomically classified in the department of Eumycota and is therefore one of the higher fungi that have chitin walls. The entire life cycle of Sordaria macrospora is completed within seven days under laboratory conditions. The life cycle is therefore considerably shorter than the four-week cycle of Neurospora crassa. Molecular biological work on the strain development of S. macrospora can therefore be carried out in a considerably shorter time.

For S. macrospora, both formal genetic and molecular genetic analysis are well developed. Formal genetic analysis takes advantage of the fact that sterile mutants of S. macrospora cannot form a self-aggression, but that two mutants with different defects are sexually crossed are reproducible. This means that meiosis takes place in so-called ascogenic hyphae, which leads to the formation of tetrads. The result is Asci with eight linearly arranged spores, two of which are genetically identical. The size of the spores (18 x 28 μm) and the non-linearity of the arrangement make formal genetics technically easy due to the orderly tetrads. In addition, a large number of mutants have been described which affect both the physiological and morphological properties of the fungus (Esser and Straub, 1958; Nowrousian et al., 1999; Masloff et al., 1999; Le Chevanton and Lebion, 1989). An indexed cosmid library, which enables the gene isolation of S. macrospora, was developed by Pöggeler et al. (1997).

Codon use in the host organism is crucial for optimal expression of heterologous genes. The list of the most common amino acid codons within protein-coding genes in Table 1 shows that there is an astonishing match between the most frequently used amino acid codons in Sordaria macrospora, Drosophila melanogaster and primates. In contrast, there are clear differences to E. coli and Saccharomyces cerevisiae. Due to the similarity of codon usage, S. macrospora is an excellent host system for the production of heterologous proteins of human origin.

Homothali mushrooms of the Sordariaceae family can be grown easily and inexpensively in laboratory cultures. As eukaryotic microorganisms, they are also able to make post-translational modifications to recombinant eukaryotic proteins. Another argument in favor of the biotechnical use of homothallic fungi from the Sordariaceae family is that they are not organisms that are pathogenic to humans, animals or plants. Furthermore, recombinant strains of Sordaria macrospora can be produced by genetic engineering methods in combination with classic (conventional) crosses, a considerable advantage over imperfect fungi of the genus Aspergillus.

The only spores that are formed by homothallic fungi of the Sordariaceae family, and in particular by S. macrospora or S. fimicola, are so-called ascospores that occur in fruiting bodies and perithecia during sexual reproduction. Such ascospores are much larger, heavier than conidiospores and are formed in a significantly smaller number. They therefore have a very low dissemination ability. Ascospores are generally not formed in submerged cultures or in shake cultures. Should the heterologous protein produced absolutely to be free of renals, a sterile mutant of the homothallic fungus of the Sordariaceae family is used in a particularly preferred embodiment of the process according to the invention for producing heterologous protein. Sterile mutant strains, which can be obtained, for example, by mutagenizing protoplasts with EMS or by irradiation with UV light, have no propagation structures and therefore do not produce ascospores. For example, sterile mutants of S. macrospora (Esser and Straub, 1958; Masloff et al., 1999; Nowrosian et al., 1999) can be used in the method according to the invention for producing heterologous protein.

The cultivation of the homothallic fungus used to produce heterologous protein preferably takes place at a temperature of 27 ± 2 ° C. This growth optimum is significantly lower than that of Neurospora crassa, which is above 30 ° C. As an important safety-relevant aspect, it should be noted that S. macrospora dies at temperatures of more than 32 ° C.

According to a preferred embodiment of the invention, the promoter active in the fungus of the Sordariaceae family, under whose control the heterologous gene is expressed, comes from a filamentous fungus. This promoter can be, for example, the gpd promoter from Aspergillus nidulans, but the promoter is preferably a promoter from Sordaria macrospora. Particularly preferred promoters are the cpc2 promoter, the nc / Zcf promoter, the ac / promoter or the ppσ / v promoter from Sordaria macrospora. The S. macrospora cpc2 promoter and td / c7 promoter are described below. The ac / 7 gene from S. macrospora was developed by Nowrousian et al. (1999). The ppgl gene from S. macrospora was described by Pöggeler (2000).

The terminator active in the fungus of the Sordariaceae family preferably comes from a filamentous fungus. The terminator can be, for example, the f / pC terminator from Aspergillus nidulans (Mullaney et al., 1985) or a terminator from Sordaria macrospora. Particularly preferred terminators from S. macrospora are the cpc2 and t7c./7 terminators described here, the ac / 7 terminator (Nowrosian et al., 1999) and the ppgf terminator (Pöggeler, 2000).

The heterologous gene preferably codes for a protein glycosylated after expression in eukaryotes. The heterologous gene can be, for example, a growth factor, a cytokine, a coagulation factor, an industrial protein or a act technical enzyme. The heterologous gene particularly preferably codes for one of the following proteins: G-CSF, GM-CSF, IL-1, IL-2, IL-4, IL-6, IL-1ra, IFN-, IFN-ß, IFN-γ , Erythropoietin, glucoamylase, coagulation factor VIII, coagulation factor XII, coagulation factor XIII, human serum albumin.

In a further embodiment of the method according to the invention, a sequence is arranged between the promoter and the heterologous gene in reading frame with the heterologous gene, which encodes a signal sequence that functions in the fungus of the Sordariaceae family. The signal sequence is preferably a signal sequence derived from a filamentous fungus, for example the signal sequence of Aspergillus niger glucoamylase (Gordon et al. 2000; Gouka et al. 1997). Signal sequences from Sordaria macrospora, e.g. the signal sequence of the S. macrospora ppgl gene are particularly preferred.

Another object of the invention is to provide promoters which can be used in the method according to the invention for the production of heterologous protein.

This task is accomplished by a nucleic acid molecule that:

(1) a promoter active in a homothallic fungus of the Sordariaceae family, which is selected from the following nucleic acids:

(a) a nucleic acid with the sequence given in SEQ ID NO: 1;

(b) a nucleic acid with the sequence given in SEQ ID NO: 2;

(c) a nucleic acid with a sequence which is at least 50% identical to one of the sequences given in (a) or (b);

(d) a nucleic acid which hybridizes with the counter strand of one of the nucleic acids specified in (a) or (b);

(e) a derivative of one of the nucleic acids given in (a) or (b) obtained by substitution, addition and / or deletion of one or more nucleotides;

(f) a fragment of one of the nucleic acids specified in (a) to (e), the maintains the function of the promoter active in the fungus of the Sordariaceae family;

(g) a combination of several of the nucleic acids specified in (a) to (f), it being possible for the sequences of the nucleic acids to be the same or different;

or

(2) a nucleic acid with a sequence which is complementary to the sequence of one of the nucleic acids specified in (a) to (g),

includes.

For the purposes of the invention, the term "% identity" refers to identity at the DNA level, which according to known methods, e.g. of computer-aided sequence comparisons (Altschui et al., 1990) can be determined.

The term "identity" known to those skilled in the art denotes the degree of relationship between two or more DNA molecules, which is determined by the match between the sequences. The percentage of "identity" results from the percentage of identical regions in two or more sequences below Consideration of gaps or other sequence peculiarities.

The identity of related DNA molecules can be determined using known methods. As a rule, special computer programs with algorithms that take account of the special requirements are used. Preferred methods for determining identity initially produce the greatest agreement between the sequences examined. Computer programs for determining identity between two sequences include, but are not limited to, the GCG program package, including GAP (Devereux et al., 1984; Genetics Computer Group University of Wisconsin, Madison, (WI)); BLASTP, BLASTN and FASTA (Altschul at al., 1990). The BLAST X program can be obtained from the National Center for Biotechnology Information (NCBI) and from other sources (BLAST Handbuch, Altschul S. et al., NCB NLM NIH Bethesda MD 20894; Altschul et al., 1990). The well-known Smith Waterman algorithm can also be used to determine identity. Preferred parameters for sequence comparison include the following:

Algorithm: Needleman and Wunsch, J. Mol. Biol 48: 443-453 (1970)

Comparison matrix: agreement (matches) = + 10,

Mismatch = 0 gap penalty: 15

Gap length penalty: 1

The GAP program is also suitable for use with the above parameters. The above parameters are the default parameters for nucleic acid sequence comparisons.

Further exemplary algorithms, gap opening penalties, gap extension penalties, comparison matrices including those mentioned in the program manual, Wisconsin package, version 9, September 1997, can be used. The selection will depend on the comparison to be performed and also on whether the comparison is carried out between pairs of sequences, GAP or Best Fit being preferred, or between a sequence and an extensive sequence database, with FASTA or BLAST being preferred.

The feature "sequence which hybridizes with the counter strand of a sequence according to (a) or (b)" indicates a sequence which hybridizes under stringent conditions with the counter strand of a sequence with the features specified under (a) or (b). For example, the hybridizations can be carried out at 68 ° C. in 2 × SSC. Examples of stringent conditions are described in Sambrook et al. (1989).

The sequences given in SEQ ID NO: 1 and SEQ ID NO: 2 correspond to the promoter sequence of the ndkl or cpc2 gene isolated from S. macrospora. The nucleic acid specified in (c) can also have at least 60%, 70%, 80% or 90% identity with one of the sequences specified in (a) or (b). It particularly preferably has 95% identity with one of these sequences.

The invention further provides a vector for transforming a homothallic fungus of the Sordariaceae family, which contains the following elements in functional connection with one another: a promoter active in the fungus of the Sordariaceae family,

- a heterologous gene,

- a terminator active in the fungus of the Sordariaceae family and

- a selection marker.

The promoter of the vector according to the invention active in the fungus of the Sordariaceae family can be the grpc / promoter from Aspergillus nidulans. However, the nucleic acids described in (1) above are particularly preferred as promoters. The Sordaria macrospora ac / 7 and ppα / f promoters are also preferred.

The terminator contained in the vector according to the invention can be the f / pC terminator from Aspergillus nidulans, but the cpc2 terminator, the nd / fZ terminator, the ac / 7 terminator or the ppgv terminator from Sordaria macrospora are special prefers. Suitable selection markers are, for example, the ura5 gene from Sordaria macrospora (Le Chevanton and Lebion, 1989) or Podospora anserina (Turcq and Begueret, 1987). A hygromycin B resistance gene (see e.g. Kaster et al., 1983) is preferably used as the selection marker.

The invention also provides a host organism. This host organism is a homothallic fungus of the Sordariaceae family which contains a vector according to the invention. The host organism preferably belongs to the genus Sordaria; the host organism Sordaria macrospora or Sordaria fimicola is particularly preferred. In a particularly preferred embodiment, the host organism is a sterile strain which does not form asexual mitospores or sexual meiospores.

The invention further provides a kit that:

(a) a vector according to the invention and

(b) a homothallic fungus of the Sordariaceae family suitable for producing heterologous protein

includes.

The nucleic acid molecule, the vector, the host organism and the kit according to the invention can be used to express a heterologous gene under the control of the promoter or used to make one or more proteins.

The following figures and examples illustrate the invention.

Figure 1 shows the autoradiogram of a Northem hybridization. In the individual lanes, 5 μg of S. macrospora mRNA was applied, in the odd lanes from the wild-type strain, in the even lanes from the sterile mutant inf. The acll gene (lane 1, 2), the cpc2 gene (lane 3, 4), the ndk1 gene (lane 5, 6) and the ppg 7 gene (lane 7, 8) were used as the probe. In tracks 1, 2 there is an ac / 7 transcript of the size 2.7 kb, in tracks 3, 4 a cpc2 transcript of 1.7 kb, in tracks 5, 6 a πd / d transcript of 1 , 5 kb and in lanes 7, 8 a ppg 7 transcript of 0.65 kb.

FIG. 2 shows the nucleotide sequence of the r? C./c1 gene (partial fragment) from S. macrospora, including the promoter region of approx. 1.4 Kb.

FIG. 3 shows the nucleotide sequence of the cpc2 gene from Sordaria macrospora and the amino acid sequences derived therefrom. The intron sequences (4) are marked by underlining, the promoter is located in the section of nucleotide 1-2611, the termination sequence can be found in the area between nucleotide 4258 and nucleotide 4539.

Figure 4 shows the cloning scheme for the expression vector pMN110.

FIG. 5 shows the nucleotide sequence (promoter and terminator) of the plasmid pMN110. The sequences are derived from the S. macrospora ac / 1 gene.

Figure 6 shows the cloning scheme for the expression vector pMN112.

FIG. 7 shows the physical-genetic map of the plasmid pMN112.

FIG. 8 shows the physical-genetic map of the plasmid pSMY1-1.

FIG. 9 shows the nucleotide sequence in the vicinity of the ATG start codon of the / acZ gene of the plasmid pSMYL

Figure 10 shows the physical-genetic map of the plasmid pSMY4-1.

Figure 11 shows the cloning scheme for the expression vector pSMY3. Figure 12 shows the physical-genetic map of the plasmid pPROM

Figure 13 shows the physical-genetic map of the plasmid pTERMI.

FIG. 14 shows the physical-genetic map of the plasmid pSMY2.

FIG. 15 shows the physical-genetic map of the plasmid pSMY3.

FIG. 16 shows the nucleotide sequence of the insert fragment of the plasmid pSMY3.

FIG. 17 shows the physical-genetic map of the plasmid pSE40-6.

Figure 18 shows the physical-genetic map of the plasmid pSE43-2.

FIG. 19 shows microscopic images of transgenic S. macrospora strains (T1p40-6, T1p43-2) which carry the plasmids pSE40-6 and pSE43-2, (a) interference microscopic and (b) fluorescence microscopic images.

Figure 20 shows the physical-genetic map of the plasmid pSMY5-1.

Figure 21 shows the physical-genetic map of the plasmid GV-MCS.

Figure 22 shows the physical-genetic map of the plasmid GV-ndk1-MCS-acl1.

Figure 23 shows the physical-genetic map of the plasmid GV-cpc2-MCS-acl1.

FIG. 24 shows the plasmid pEGFP / gpd / tel, which served as the starting plasmid for the cloning of the plasmids pSM1 and pSM2.

Figure 25 shows the cloning scheme of the plasmid pSM1.

Figure 26 shows the cloning scheme of the plasmid pSM2.

FIG. 27 shows the fluorescence microscopic analysis of Asci with ascospores of S. macrospora transformants which carry the plasmid pEGFP / gpd / tel. The strain shown comes from a cross between the S. macrospora Transformande T-EG2 and the color-saving mutant of S. macrospora FUS1. The latter carries no g p gene. To interpret the fluorescence microscope image (bottom), the corresponding light microscope image is shown above. FIG. 28 shows microscopic images of a transgenic S. macrospora strain which expresses the EGFP gene under the control of the rttf / cf promoter. (a) interference microscopic and (b) fluorescence microscopic image.

Examples of materials and methods

The molecular biological and microbiological work was carried out using standard methods according to the state of the art (see e.g. Sambrook et al., 1989).

A. Cultivation of S. macrospora

1) Culture media

- BMM (fructification medium): 0.8% organic salt in maize flour extract, pH 6.5

- BMM + NaAc (spore germ medium): BMM + 0.5% NaAc, pH 6.0

CCM: 0.3% sucrose, 0.05% NaCl, 0.5% K ₂ HPO ₄ , 0.05% MgSO ₄ , 0.001% FeSO _4,

0.5% Tryptic Soy Broth, 0.1% yeast extract, 0.1% meat extract, 1, 5% dextrin pH 7.0

GM (minimal medium): 2% glucose, 0.7% Bacto Yeast Nitrogen Base, 0.4 μM biotin,

25 μl / L mineral concentrate (5% ascorbic acid, 5% ZnSO x 7H ₂ O, 1% Fe (NH ₄ ) ₂ (SO ₄ ) ₂ x 6H ₂ O, 0.25% CuSO ₄ x 5H ₂ O, 0.05 % MnSO ₄ x 1H ₂ O, 0.05% H ₃ BO ₄ , 0.05% Na ₂ MoO ₄ , 1% chloroform, pH 6.0 - GMU: G with 10 mM uridine

- GMS: GM with 10% sucrose

- LB: 1% Bacto-Trypton, 0.5% yeast extract, 0.5% NaCI, pH 7.2

- CM: 0.15% KH ₂ PO ₄ , 0.05% KCI, 0.05% MgSO ₄ , 0.37% NH ₄ CI, 1% glucose, 0.2% tryptone, 0.2% yeast extract, trace elements , pH 6.4 - 6.6

- CMS: CM medium with 10.8% sucrose

MM (minimal medium): 55.5 mM glucose, 1.8 mM KH ₂ _{PO, 1.7} mM K ₂ HPO _4l 8.3 mM

Urea, 1 mM MgSO ₎ 5 μM biotin, 0.1 ml / l mineral concentrate (see GM medium) - MMU: MM with 10 mM uridine

- Solid media: 1.5% agar each, GM top agar: 0.4% agar

2. Cultivation conditions

As a rule, cultivation takes place at 27 ° C. S. macrospora is grown on solid media for fructification; The fructification can be observed after only 7 days of culture become. S. macrospora is grown on liquid media for nucleic acid preparations, usually in stand cultures in Fernbach flasks.

B. Production of sterile S. macrosoora strains

1) UV mutagenesis

For UV mutagenesis, a protoplast suspension (1.5 x 10 ⁸ protoplasts per ml protoplast buffer) from the Sordaria macrospora wild-type strain ATCC MYA-334 is prepared. The suspension is exposed to UV light (0.05 μW / cm ² ) when shaken gently. The times vary between 10 and 20 minutes. The protoplasts are then placed on CMS solid medium (0.15% KH ₂ PO ₄ , 0.05% KCI, 0.05% MgSO _4l 0.37% NH ₄ CI, 1% glucose, 0.2% trypton, 0, 2% yeast extract, trace elements, pH 6.4-6.6, 10.8% sucrose, 1.5% agar) and plated and incubated for approx. 48 hours at 27 ° C. The regenerated protoplasts are then inoculated onto MB solid medium (0.8% organic salt in maize flour extract, pH 6.5, 1.5% agar). After 1-4 weeks, the clones are phenotypically characterized to identify sterile mutants. These are usually characterized by changes in the formation of fruiting bodies. In order to distinguish mutants from variants, the mitotic stability of the strains is tested by inoculation on MB medium. After a growth distance of approx. 7 cm, the mycelium is transferred again to fresh nutrient medium. This process is repeated three times. After this test of mitotic stability, the sterile strains are genetically checked in cross-over experiments to isolate ascospores. This creates homokaryotic strains.

2) EMS mutaqenese

In EMS mutagenesis, ethyl methyl sulfonate is used as a mutagenic agent. For mutagenesis, 5 × 10 ⁶ protoplasts of the wild-type strain of Sordaria macrospora (see above) in a total volume of 500 μl are treated with EMS. The final concentration of EMS (σM-0880) is 34.1 mg / ml. The mutagenesis is carried out at 27 ° C. for 45 minutes. The protoplasts are then plated out on CMS solid medium as described under 1) above and treated further as described there.

The strains generated are identified below by "inf" (infertile).

C. Transformation of sterile S. macrospora strains

S. macrospora mutants are transformed after Walz and Kück (1995). Fungal mycelium of the strain to be transformed is 2 days at 27 ° C in CM liquid medium (0.15% KH ₂ P0, 0.05% KCI, 0.05% MgSO ₄ , 0.37% NH ₄ CI, 1% Glucose, 0.2% tryptone, 0.2% yeast extract, trace elements, pH 6.4 - 6.6, 10.8% sucrose, 1.5% agar) was grown as a stand culture. After a washing step of the mycelium in protoplast buffer (13 mM Na ₂ HPO ₄ , 45 mM KH ₂ PO ₄ , 600 mM KCL, pH 6.0) and subsequent filtration, the mycelium is dissolved in Novozym solution (10 mg Novozym 234 (Novo Nor disk) / ml protoplast buffer). After 45 minutes of incubation at 100 rpm and 27 ° C., the protoplasts are separated from the residual mycelium using a glass frit (pore size 1, Schott). After pelleting the protoplasts by centrifugation, the cells are washed twice in protoplast buffer and again sedimented. The protoplasts are then taken up in transformation buffer (1 M sorbitol, 80 mM CaCl ₂ , pH 7.5), so that the protoplast titer is 2 × 10 ⁸ / ml. For the transformation, 2 × 10 ⁷ / ml protoplasts are mixed with 20 μg plasmid DNA or 20 μl cosmid DNA and incubated on ice for 10 min. After the addition of 200 μl of 25% PEG (in transformation buffer), an incubation for 20 min at RT follows. From the transformation batch, 100-200 μl of each batch are plated directly onto the CMS medium. After a maximum of 12 hours of incubation at 27 ° C., the regenerating protoplasts are covered with top agar containing hygromycin B (0.8 M NaCl, 0.8% agar). The hygromycin B concentration in the top agar is selected so that a final concentration of 110 U / ml is present in the entire medium. Transformants appear after 2 to 4 days and are inoculated on BMM medium (0.8% biomalt in maize flour extract, pH 6.5) which contains 100 U / ml hygromycin B. The phenotypic studies of the mutants are carried out on BMM medium without selection pressure.

D. Heterologous gene expression in Sordaria macrospora

To demonstrate heterologous gene expression in Sordaria macrospora, transformants from Sordaria macrospora and the corresponding wild-type control are transferred to CM medium and incubated at 27 ° C. Media or fungal mycelium are harvested by centrifugation or filtration.

Example 1 Comparison of the transcriptional expression of the ndkl, cpc2, ppgl and ach genes in Sordaria macrospora

For comparison of the transcriptional expression of the ndkl, cpc2, ppgl and ac / 7 genes in Sordaria macrospora, the different transcript frequencies for different strains were determined in a Northern hybridization. For this purpose, 5 μg mRNA from the wild-type strain or from the sterile mutant inf were applied and hybridized with the respective probes that were specific for the above-mentioned genes. In the autoradiogram shown in FIG. 1, it can be seen that the ppg1 gene gives the weakest signals, but in comparison to so-called “house-keeping” genes (such as, for example, α- or β-tubulin genes), the ppg7 gene is The signal for the acl1 gene is significantly stronger, the strongest signals were found for the cpc2 and ndkl genes.The autoradiogram shows that the four genes are suitable for the construction of expression vectors due to their high transcriptional expression are.

Example 2 Cloning of the regulatory sequences of the cpc2 and ncMcf genes from

S. macrospora

For the cloning of the cpc2 and ndkl genes from S. macrospora, a set of oligonucleotides was synthesized (see Table 2), which enable PCR amplifications to be carried out. Using S. macrospora genomic DNA, the oligonucleotide primers 1095 and 1096 were used for the PCR amplifications of the cpc2 gene and the oligonucleotide primers 1265 and 1266 for the amplification of the ndk "gene. The resulting amplificates of 655 bp (cpc2) and 594 bp (ndk) were then used for DNA sequencing The DNA sequence of the nd / d gene, which also contains a 1.4 Kb promoter region in front of the putative ATG start codon, is shown in FIG 2. The ATG start codon is located in this sequence at position 1384-1386 The nucleic acid sequence and the amino acid sequences of the cpc2 gene derived therefrom are shown in FIG.

The gene fragments were then used for so-called Northern hybridizations, and comparative hybridizations were carried out with other genes from S. macrospora. The comparative hybridizations with 10 different S. macrospora gene probes show that the cpc2 gene and the nd / d gene of S. macrospora have a very high transcriptional level. In comparison to hybridization signals with other probes, this level can be classified as significantly higher. In order to use these genes for the construction of expression vectors, The complete genomic copies of both genes were isolated from an indexed genomic cosmid gene bank by S. macrospora (Pöggeler et al. 1997). The screening resulted in the isolation of the cosmid clones VIG10 (cpc2) and VIIG10 (/ 7d / 1). Sub-fragments of both cosmid clones were sequenced to clearly identify the regulatory sequences.

Example 3 Subcloning of the cpc2 promoter

To subclone the cpc2 promoter, the corresponding cosmid clone was digested with EcoRV. A 3.0 kb fragment was identified which carries the cpc2 promoter. This fragment was inserted in a “shot-gun” experiment into the EcoRV linearized vector pBCKS + (Strategene, La Jolla, California). The transformants obtained after transformation of E. coli with the recombinant vector were further analyzed by colony filter hybridization Approximately 600 E. coli transformants were identified by several positive clones, which ultimately led to the isolation of a single clone carrying the recombinant plasmid pSE36-5, and the subsequent control DNA sequencing clearly demonstrated that this recombinant plasmid was parts of the cpc2 gene, namely the sequence from nucleotide position 1 to nucleotide position 2981 in FIG. 3.

The oligonucleotide pairs cpc9 / cpc11 and cpc10 / cpc12 were used to subamplify parts of the cpc2 promoter from the plasmid pSE36-5. The oligonucleotide pair cpc9 / cpc11 enables the amplification of a 1359 bp amplicon (nucleotide positions 1250-2609 in FIG. 3) which, owing to the oligonucleotide sequence, has Λ / col overhangs at both ends. A 1359 bp fragment could also be amplified with the oligonucleotide pair cpc10 / cpc12, here EcoRVr recognition sequences are generated at the ends of the fragment. The sequence of this fragment corresponds to the sequence from nucleotide position 1250 to nucleotide position 2609 in FIG. 3.

The amplificates described above were then subcloned into the vector pDrive (Qiagen, Hilden, FRG). After the corresponding ligation and transformation in E. coli, recombinant strains were identified by DNA hybridization. As a result, two recombinant plasmids with the following designation were obtained: a) pSE38-16 contains an approximately 1.4 kb EcoRV fragment in the vector pDrive;

b) pSE39-14 contains an approximately 1.4 kb Λ / col fragment in the vector pDrive.

Example 4 Construction of expression vectors with regulatory elements of the ach gene from S. macrospora

In animals and fungi, ATP citrate lyase (ACL) is localized in the cytosol, while the homologous protein in plants is localized in the chloroplast. ACL produces acetyl-CoA in all three organism systems, which is mainly used for fatty acid and sterol biosynthesis. In fungi, the enzyme consists of two subunits that are encoded by two separate genes (ac / 7, acl2) that are located adjacent to the chromosomal DNA (Nowrousian et al., 2000). In contrast, the continuous polypeptide in animals is encoded by a gene.

The promoter element of the ac / 7 gene from S. macrospora (Nowrousian et al. 1999) was used for the construction of the expression plasmid pMN110 (see FIG. 4). To amplify the promoter sequence, the oligonucleotides 1197 and 1199 (Table 2) were used together with the genomic DNA from S. macrospora as template DNA. The expected fragment of 2.3 Kb was cloned into the plasmid pMON 38201 (Borovkov and Rivkin, 1997). The resulting plasmid was named pMN95. The terminator sequence of the ac / 7 gene was then amplified and cloned. In this case too, the S. macrospora genomic DNA served as template DNA in order to generate a fragment of 0.6 Kb in size by PCR with the oligonucleotides 1194 and 1200. The resulting plasmid was named pMN102. The terminator sequence was then cloned from the plasmid pMN102 into the vector pKS + (Stratagene, La Jolla, California). For this purpose, the plasmid pMN102 was hydrolyzed with the enzymes No and Sa. The resulting restriction fragment of 0.6 Kb was ligated into the Not \ - and Sacl-restricted vector pKS +. The resulting plasmid was named pMN109. This plasmid was then restricted with the enzymes HindW1 and Noü and ligated with the 2.3 Kb fragment of the plasmid pMN95. The resulting plasmid was named pMN110 and was used for further cloning. The cloning strategy is shown in FIG. 4 and the corresponding sequence of the insert DNA of the plasmid pMN110 is shown in FIG. 5. In the next cloning step, the plasmid pMN112 was constructed, which is suitable for the transformation of S. macrospora and for the transformation of E. coli (see FIG. 6). For this purpose, the plasmid pBCHygro (Silar, 1995) was hydrolyzed with Not \ and the corresponding restriction ends were filled in using Klenow polymerase. The resulting linear plasmid with filled in Λ / ofl ends was restricted with the enzyme C / al. This creates a linear vector molecule which is terminated by a "blunt" end or by a C / al cut. This vector molecule treated in this way was used in a ligation in which a 2.9 Kb fragment from the plasmid pMN110 was used This fragment was generated by linearizing the plasmid pMN110 with the enzyme Hind \\\. The protruding restriction ends were then filled in with Klenow polymerase in order to generate “blunt” ends. This restriction fragment treated in this way was then restricted with the enzyme C / al and eluted after gel electrophoresis in order to be used for the ligation discussed above. The cloning strategy is shown in FIG. 6 and the resulting plasmid pMN112 is shown in FIG. 7. It has a total size of 9.605 Kb.

The expression plasmid pMN112 can be used to produce heterologous proteins in S. macrospora. In this plasmid, the ac / 1 promoter is connected to the ac / 1 terminator by a Λ / ofl restriction cut. This unique Λ / ofl restriction cut is suitable for the insertion of foreign DNA, which is to be expressed under the control of the ac / 1 promoter.

Example 5 Production of bacterial β-galactosidase in Sordaria macrospora under the

Control of the ac / f promoter

In order to express the bacterial ß-galactosidase gene (lac∑) in S. macrospora, the plasmid pSMY1-1 was constructed. The plasmid pSMY1-1 was generated by inserting the / acZ gene into the singular Λ / ofl restriction site of the plasmid pMN112. The / acZ gene was generated from the plasmid pSI8.8 (Menne et al., 1994) by PCR amplification. For this purpose, oligonucleotides 1206 and 1215 (Table 2) were used, which have the recognition sequence for the restriction enzyme Not \ at the end. The amplificate has a size of 3.0 Kb and was inserted into the unique site of the plasmid pMON 38201 (Borovkov and Rivkin 1997). The result The resulting plasmid was given the name pMN104, which was subsequently hydrolyzed with Noü. The resulting 3.0 Kb Λ / ofl fragment was inserted into the plasmid pMN112 linearized with Nou (see FIG. 7). The resulting plasmids pSMY1-1 (FIG. 8) and pSMY1-2 differ in the orientation of the / acZ gene. In the plasmid pSMY1-1, the / acZ gene is under the control of the ac / 1 promoter. In pSMY1-2 there is an inverse arrangement of the / acZ gene with respect to plasmid pSMY1-1, which means that ac / 1 promoter-controlled expression is not possible. The plasmid pSMY1-2 can thus be used as a control in expression experiments. All constructs were checked for correctness by control DNA sequencing. The sequence on the ATG start codon in plasmid pSMY1-1 is shown in FIG. 9.

After transformation of Sordaria macrospora with the expression plasmids pSMY1-1 and pSMY1-2, the transformants selected for hygromycin were examined for the formation of the heterologous gene product β-galactosidase. For this purpose, the fungal mycelium was washed with glass beads and extraction buffer (2.5 mM Tris-HCl (pH 8), 125 mM NaCl, 2 mM MgCl ₂ , 12 mM β-mercaptoethanol (pH 7.5), 2 mM 4-methylumbelliferyl ß-D-galactopyranoside, 10% (v / v) DMF) added and disrupted by intensive vortexing. The cell debris was removed by centrifugation. The detection of the β-galactosidase activity in the crude protein extract of the pSMY1-1 transformants is carried out by measuring the release of the fluorescent 4-methylumbilliferone from 4-methylumbelliferyl-β-D-galactopyranoside. While ß-galactosidase activity was detected in the crude extract of the SMY1-1 transformand, ß-galactosidase activity was not detectable in the crude extract of the SMY1-2 transformande, in which the expression cassette contains the / acZ gene in the inverse orientation.

Example 7

Production of the pre-protein of human serum albumin under the control of the ac / f promoter from Sordaria macrospora

In order to produce the pre-protein of human serum albumin (HSA) in Sordaria, the hsa gene (from plasmid pPreHSA, Rhein Biotech GmbH, Duesseldorf, FRG) was cloned into the expression vector pMN112. For this purpose, the gene for the pre-protein of human serum albumin (PreHsa) was obtained by amplification. With the help of the oligonucleotides hsal and hsa2 using the plasmid pPreHsa as tem- the gene was amplified by plate DNA. The 1.8 kb amplificate has terminal no restriction sites. The PCR fragment was inserted into the Xcml-restricted cloning vector pMON 38201 (Borovkov and Rivkin 1997) by ligation. The resulting plasmid was named pMON-HSA. The insert of the plasmid pMON-HSA was checked by sequencing. This plasmid was then restricted with the enzyme Noü and the resulting 1.8 Kb fragment was inserted into the vector pMN112 restricted with Noü. The plasmid thus generated was given the name pSMY4-1 (FIG. 10). The vector pSMY4-2, also created by cloning, contains the PreHsa gene in inverse orientation and was used as a negative control for the expression experiments. All constructs were checked for correctness by control DNA sequencing.

After transformation of Sordaria macrospora with the expression plasmids pSMY4-1 and pSMY4-2, the transformants selected for hygromycin were examined for the formation of the heterologous gene product HSA. For this purpose, the fungal mycelium was mixed with glass beads and extraction buffer (2.5 mM Tris-HCl (pH 8), 125 mM NaCl, 2 mM MgCl ₂ , 12 mM β-mercaptoethanol (pH 7.5)) and disrupted by intensive vortexing , The cell debris was removed by centrifugation. The HSA was detected in the crude protein extract by means of an enzyme-linked immunosorbent assay (ELISA). The total protein extracts were pipetted into the wells of a microtiter plate (MaxiSorp, Nunc) and incubated at 4 ° C. overnight. After three times washing the plate with PBS-buffer (137 mM NaCl, 2.7 mM KCI, 4.3 mM Na ₂ HPO _4, 14 mM KH ₂ PO _4, pH 7.4) containing 0.05% Tween ^® 20 contained, the free binding sites were blocked for one hour with a 0.2% Tween ^® 20 solution in PBS buffer. After re-washing three times, peroxidase-coupled HSA antibody (BioTrend, Cologne, FRG; diluted 1: 1000 in PBS buffer with 0.05% Tween ^® 20) is added and incubated for one hour at room temperature. The ELISA was developed by color reaction of the peroxidase substrate 3,3 ', 5,5'-tetramethylbenzidine (TMB) in the presence of hydrogen peroxide according to the manufacturer's instructions (Pierce, Helsingborg). HSA could be detected in the crude extracts of the SMY4-1 transformants; HSA detection was negative in the expression controls with the parent strain and the SMY4-2 transformants. Example 6

Construction of expression vectors with regulatory elements of the ppg-f gene from Sordaria macrospora

The ppg1 gene for the sex pheromone from S. macrospora codes for a preproprotein of 277 amino acids. Included here is a leader peptide of 16 amino acids (Pöggeler, 2000), which can be used as a signal sequence for protein secretion.

For the construction of the expression plasmid pSMY3, the promoter sequence, the sequence coding for the leader peptide and the termination sequence of the ppg7 gene were used (see FIG. 11).

For the cloning of the promoter sequence together with the sequence encoding the leader peptide, the oligonucleotides ppg1-1 and ppg1-2 were used. Both oligonucleotides contained sequences for restriction endonucleases (see Table 2). In the case of the oligonucleotide ppg1-1, the recognition sequence for the enzyme Sacl was used, in the case of the oligonucleotide ppg1-2 that for the enzyme Noü. The S. macrospora genomic DNA was used for the amplification with these two oligonucleotides. The amplification gave a 1.8 Kb fragment.

The termination sequence of the ppαl gene was also obtained by amplifying the corresponding sequence. The oligonucleotides ppg1-3 and ppg1-4 were used for this. Both oligonucleotides also contain sequence extensions for the enzyme Noü (ppg1-3) and for the enzyme SamHI (ppg1-4). The amplification with these two oligonucleotides was again carried out using genomic DNA from S. macrospora and yielded an 880 bp DNA fragment.

The two amplificates were inserted into the vector pMON38201 linearized with Xcm \ as described above. The plasmids resulting from the cloning were named pPROMI (contains the promoter region) or pTERMI (contains the terminator sequence). The physical-genetic map of the plasmids pPROMI and pTERMI is shown in FIGS. 12 and 13, respectively.

The promoter sequence was then cloned into the transformation vector pCB1004 (Carroll et al., 1994). For this purpose, the plasmid pPROMI was restricted with Sacl and Noü, and inserted into the SacUNoü hydrolyzed vector pCB1004. The corresponding recombinant plasmid was given the name pSMY2 (FIG. 14). This plasmid was then hydrolyzed with the enzymes Noü and BamHl and the Noü and SamHI restriction fragment from the plasmid pTERMI was inserted into the vector pSMY2 restricted with Noü and BamHl. The resulting plasmid was given the name pSMY3 (FIG. 15) and contains both the promoter sequence, including the sequence encoding the leader peptide, and the terminator sequence of the ppgl gene. The promoter sequence is linked to the terminator sequence by a Λ / ofl restriction cut. This restriction cut is in the plasmid pSMY3 singular and can therefore be used for the insertion of heterologous DNA. The DNA sequence of the insert in plasmid pSMY3 is shown in FIG. 16.

Example 7

Construction of expression vectors with regulatory elements of the cpc2 gene from Sordaria macrospora

In the following, the construction of expression vectors with regulatory elements of the cpc2 gene will be postponed on the basis of the vector pSM2 already described. The vector pSM2 (see example 12, FIG. 26) contains the egp gene which is fused with the TtrpC terminator from Aspergillus nidulans. Upstream of the egfp gene is a polylinker region, which allows optimal cloning with different fragments.

In the first construct, the EcoRV fragment described in Example 3 from the plasmid pSE38-16 was ligated into the vector pSM2 / EcoRV. The resulting recombinant plasmid was named pSE40-6 (Figure 17). The correct orientation of the promoter fragment was checked by restriction analysis. In a second alternative vector, the 1.4 kb Λ / col fragment from the plasmid pSE39-4 (see example 3) was inserted into the vector pSM3 linearized with Λ / col (see example 12, FIG. 26). The resulting recombinant plasmid was named pSE42-9. After restriction of this plasmid with the enzyme Sa / I, the linearization of the plasmid is achieved. Finally, the ligation was carried out with a 1.4 kb Sa / I fragment from the plasmid pCB1004. This Sa // fragment carries the hygromycin B gene, which can be used for selection in fungal transformants. The corresponding recombinant plasmid was named pSE43-2 (FIG. 18).

The wild-type strain of S. macrospora was transformed in independent experiments with the recombinant plasmids pSE40-6 and pSE43-2. After selecting the Approx. 20 transformants were isolated on hygromycin B transformants in each experiment. In the subsequent analysis, evidence was provided by fluorescence microscopy that the heterologous egr / p protein was produced in S. macrospora. In FIG. 19, the T1 P40-6 and T1 P43-2 transformants are shown as examples, which carry the recombinant plasmid pSE40-6 and the recombinant plasmid pSE43-2. The fluorescence is clearly and unambiguously recognizable in the fluorescence microscope and is completely absent in the untransformed comparison strains (not shown). No background fluorescence, for example due to phenolic substances, can be seen in the latter.

Example 8 Construction of the basic plasmid pGV-MCS

To construct a vector which allows the exchange of promoter and terminator elements and selection markers and contains multicloning sequences (MCS), the starting vector pSMY5-1 (FIG. 20) was cut with SssHII and an approximately 4.6 Kb fragment was isolated by gel elution. A synthetic polylinker fragment was added to the fragment and religated. The synthetic fragment was prepared by hybridizing the subsequent oligonucleotides. The oligonucleotides and the sequence of the restriction sites are listed below. The SssHIl sequence is underlined.

Linker 1 (SEQ ID NO: 24)

5'-TCGACGCGCGCCTCGAGAGGCCTACTAGTGAATTCAGATCTGGATCCGCGG

CCGCATCGATTCGCGAGGTACCGCGCGCA

Linker 2 (SEQ ID NO: 25) δ'-GCGCGCGGAGCTCTCCGGATGATCACTTAAGTCTAGACCTAGGCGCCGGCG

TAGCTAAGCGCTCCATGGCGCGCGTTCGA

The sequence of the restriction sites in the synthetic cloning site was as follows: SssHII- \ val-X7ll-Sfel-Spel-EcoRI-Sgf / ll-6a / 77HI-Sacll- / Vofl-C / al-Λ / rul-Acc65l- Kpπl- SssHII. The construct p-GV-MCS obtained (FIG. 21) was checked by DNA sequencing. Example 9

Construction of expression vectors with the ndkl or cpc2 promoter based on the base plasmid pGV-MCS

In subsequent cloning steps, various promoters and terminators were introduced into the vector pGV-MCS. Promoter elements were installed in various MCS interfaces. For this purpose, a 1378 bp fragment containing the / 7d / c7 promoter (nucleotide positions 6-1383 in Figure 2), a 1331 bp fragment containing the cpc2 promoter (nucleotide positions 1281-2611 in Figure 3) and the terminator element of the ac 'gene (nucleotide positions 2338-2860 in FIG. 5) either obtained from previous plasmids using suitable restrictions or amplified with terminal recognition sequences using PCR and cloned into the vector.

The oligonucleotides ndkδ- (Spel) and ndk3- (EcoRI) (see Table 2) were used for the PCR amplification of the / 7d / c7 promoter with terminal Spei and EcoRI interfaces. The oligonucleotides cpc2- (Aval) and cpc2- (Spel) (see Table 2) were used for the PCR amplification of the cpc2 promoter with terminal Spei and / Aval restriction sites.

In a next step, the ac / 1 terminator was introduced into the vectors. The terminator element was obtained from the plasmid pSMY1-2 (see Example 5) by means of PCR amplification with terminal Λ / ofl / C / al interfaces. The oligonucleotides acM- (Notl) and acM- (Clal) (see Table 2) were used for the amplification.

The resulting vectors pGV-ndk1-MCS-acl1 (Figure 22) and pGV-cpc2-MCS-acI1 (Figure 23) contain an MCS with the unique restriction sites EcoRI / Bg / ll / BamHI / Λ / ofl for the inclusion of heterologous coding sequences.

Example 10

Production of phytase in Sordaria macrospora under the control of the cpc2 or ndkl promoter

Aspergillus fumigatus phytase (Pasamontes et al., 1997) was chosen as an example for the production of a secreted heterologous gene product. The coding region of the phytase gene as a 1403 bp EcoRI fragment was inserted into the plasmid pGV-ndk1-MCS-acl1 (FIG. 22) downstream of the ndkl or into the plasmid pGV-cpc2-MCS-acl1 (Figure 23) cloned downstream of the cpc2 promoter. The resulting expression plasmids were verified for their integrity and used for the transformation of Sordaria macrospora. The media supernatants were examined for secreted phytase activity over a period of seven days. Corresponding aliquots were mixed with 25 μl of 5 M NaAc and 50 μl of 4-nitrophenyl phosphate. The batch was 60 min. incubated for long at 37 ° C. The enzymatic reaction was stopped by adding 100 μl of 15% trichloroacetic acid. After the addition of 100 μl of 1 M NaOH, positive culture supernatant samples appeared colored intensely yellow. The yellowing was quantified by the OD ₄₀ 5 measurement in the photometer.

The activity determinations of the culture supernatants of the transformants with the respective phytase expression vector were carried out in comparison to the wild-type strain and a transformand with an expression vector without a phytase insert (mock transformande). Expression of the phytase gene in Sordaria macrospora as well as secretion of recombinant phytase in the culture supernatant were detected for both the ndkl and cpc2 promoters.

For the expression of phytase controlled by the nd / d promoter, an OD ₀₅ of 0.4 was measured after 190 hours; the corresponding OD ₄₀₅ values of the media supernatants of the Sordar / a wild type and the mock transformants were 0.136 and 0.09, respectively. For the expression of phytase controlled by the cpc2 promoter, an OD ₄₀₅ of 0.37 was measured after 190 hours; the corresponding OD ₄₀₅ values of the media supernatants of the Sordar / a wild type and the mock transformants were 0.049 and 0.05, respectively.

Example 11 Production of human lactoferrin in Sordaria macrospora under the control of the ndkl or the cpc2 promoter

A coding sequence for a fusion of human lactoferrin and the N-terminus of glucoamylase from Aspergillus awamori was cloned as a 3641 bp EcoRI fragment into the vector pGV-ndk1-MCS-acl1 (FIG. 22). Restriction, fragment isolation and ligation were carried out under standard conditions. In the vector with the cpc2 promoter (pGV-cpc2-MCS-acl1, FIG. 23), which contains an additional EcoRI site in the promoter sequence, the EcoRI fragment was cloned into the Sg / N / SamHI site. Blunt ends were produced at the fragment ends and the intersections of the vector before ligation by Klenow treatment. provides. The treatment was carried out according to standard methods.

The transformation with the generated vectors was carried out as previously described. Positive lactoferrin-secreting transformants were detected by ELISA detection according to the following protocol:

1. Coating a microtiter plate (Nunc Maxisorp) with 100 μl / sample bag with anti-hLactoferrin in 0.1 M NaCO ₃ pH 9.6 (dilution 1: 2400) (rabbit affinity-purified anti-hLactoferrin; ICN, Costa Mesa, California ; 2.4 mg / ml) and overnight incubation

2. Wash with 200 μl PBS + 0.05% Tween ^® 20 (3 x)

3. Incubate with 200 μl PBS + 0.05% Tween ^® 20 + 1% BSA for 2 hours at room temperature with gentle shaking

4. Wash as in 2.

5. Attachment for 2 hours at RT of 100 μl / bag of dilutions of an hLactoferrin standard (ICN). The dilutions are carried out in PBS (control) or in aliquots of culture supernatants to be tested from the various recombinant clones.

6.Wash as in 2.

7. Add the second antibody for 1 hour at RT. Anti-hLactoferrin (peroxidase conjugated) (Rabbit Affinity-purified; Jackson Immuno Research Laboratories, West Grove, PA, USA) was used as the second antibody (1: 5000 dilution of a 0.8 mg / ml solution in PBS + 0.25 % Tween ^® 20 + 0.25% BSA).

8. Wash as in 2.

9. Development of the TMB peroxidase substrate. TMB peroxidase substrate (Pierce, Helingborg) and reaction solution (Pierce) were mixed in a ratio of 1: 1 and added to the sample pockets in 100 μl aliquots. When the desired color intensity was reached, the reaction was stopped by adding 100 μl of a 2 M sulfuric acid solution.

10. The color intensity is measured at 450 nm in the ELISA reader. The concentration determinations for the supernatant samples are made by comparison with the values of the standard series.

The ELISA measurements of the culture supernatants of the transformants with the respective lactoferrin expression vector were carried out in comparison to the wild-type strain and a transformand with an expression vector without lactoferrin insert (mock transformande). For both the ndkl and cpc2 promoters, an express sion of lactofering in Sordaria macrospora as well as a secretion of recombinant lactoferrins in the culture supernatant. For the expression of lactoferrin controlled by the nd 7 promoter, an OD ₄₅₀ of 1,375 was measured after seven days; the corresponding OD ₄₅₀ values of the media supernatants of the Sotdar / a wild type and the mock transformants were 0.2 and 0.24, respectively. For controlled by the promoter expression of lactoferrin CPC2 an OD of ₅ o 1, 95 was measured after seven days; the corresponding OD ₅₀ values of the media supernatants of the Sordaria WΛd type and the mock transformants were 0.273 and 0.236, respectively.

Example 12

Construction of expression vectors and production of the "green fluorescent protein" (GFP) in Sordaria macrospora under the control of the gprf promoter from Aspergillus nidulans

In order to express the heterologous gfp gene (Clonetech, USA) in Sordaria macrospora, two expression plasmids were constructed in which the gfp gene was placed under the control of various promoters or is free of promoters. The plasmid pEGFP / gpd / tel (Inglis et al., 1999) was used as the starting plasmid (see FIG. 24).

In the plasmid pSM1, the gfp gene is controlled by the Aspergillus nidulans gpd promoter and terminated by the Aspergillus nidulans frpC termination sequence. The plasmid also contains the hygromycin B resistance gene for the selection of fungal transformants. The construction of the plasmid pSM1 is shown in FIG. 25. Unlike the plasmid pSM1, the plasmid pSM2 does not contain a gpd promoter. In front of the gfp gene there is a multiple cloning site for several enzymes which are suitable for inserting heterologous or homologous promoter sequences and thus for controlling gfp gene expression. The construction of the plasmid pSM3 is shown in FIG. 26.

In three different experiments, a sterile Sordaria macrospora strain was transformed with the plasmids pEGFP / gpd / tel, pSM1 and pSM3. The transformants obtained were then selected for hygromycin resistance as described and analyzed by fluorescence microscopy. The analysis was carried out using the Zeiss axi-phot microscope when excited with light of wavelength 420 nm. GFP-producing clones were then used for a formal genetic analysis against the wild-type strain or other tester strains. The intersection can be used to check to what extent the terologic GFP protein is passed on stably in meiosis, and in particular to what extent GFP expression is also stably retained in the offspring.

As can be seen from FIG. 27, the GFP gene expression can be seen both in the vegetative mycelium of the transformants and in the ascospores. The expected 1: 1 splitting can be clearly seen in the eight-pore Asci (4 spores show fluorescence, 4 spores show no fluorescence). This GFP gene expression can also make it clear that the heterologous gene expression in S. macrospora after the meiotic cross is not destroyed by inactivation processes (e.g. RIP, MIP, quelling).

Example 13

Production of GFP in Sordaria macrospora under the control of the cpc2 or ndkl promoter

The EGFP gene was amplified with the oligonucleotides EGFP5 'and EGFP3' (see Table 2) by PCR from the vector pSM2. The PCR product obtained was used as a 726 bp EcoRI fragment in the plasmid pGV-ndk1-MCS-acl1 (FIG. 22) downstream of the ndkl or in the plasmid pGV-cpc2-MCS-acl1 (FIG. 23) downstream of the cpc2 Promoter cloned. The resulting expression plasmids were verified for their integrity and used for the transformation of Sordaria macrospora. The intracellular expression of the EGFP gene was detected as described in Example 12.

FIG. 28 shows an example of a transformant which contains the EGFP gene under the control of the t? D / c7 promoter. The fluorescence attributable to EGFP can be clearly seen in the fluorescence microscope image (below) and was completely missing in the control (untransformed strain) (not shown). Table 1

Comparison of the most commonly used amino acid codons in E. coli, Saccharomyces cerevisiae {S.c), Sordaria macrospora (S.m.), Drosophila melanogaster (D.m.) and primates (Prim). Such codons were shaded in the individual columns, which are also used most frequently in Sordaria macrospora.

Table 2

Oligonucleotides used

Table 2 (continued)

Table 3

Recombinant plasmids

bibliography

Old school SF. et al. (1990) Basic local alignment search tool. J. Mol. Biol. 215: 403-410

Borovkov AY, Rivkin MI (1997). Xcml-containing vector for direct cloning of PCR products. BioTechniques 22: 812-814

Carroll AM, Sweigard JA, Valent B (1994). Improved vectors for selecting resistance to hygromycin. Fungal Genet Newsl 41: 22

Cogoni C, Macino G (1999) Homology-dependent gene silencing in plants and fungi: a number of variations on the same theme. Curr Opin Microbiol 2: 657-662

Devereux, J. et al. (1984) Nucleic Acids Research 12 (12): 387

Esser K, Straub J (1958) Genetic studies on Sordaria macrospora Auersw., Compensation and induction in the case of genetic defects. Journal of Inheritance Studies 89: 729-746

Gordon CL, Archer DB, Jeenes DJ, Doonan JH, Wells B, Tinci AÜ, Robson GD (2000) A gluycoamylase: GFP gene fusion to study protein secretion by individual hyphae of Aspergillus niger. J. Microbiol Methods 42 (1): 39 -48

Gouka RJ, Punt PJ, van den Hondel CA (1997) Glucoamylase gene fusions alleviate limitations for protein production in Aspergillus awamori at the transcriptional and (post) translational levels. Appl Environ Microbiol 63 (2): 488-597

Inglis PW, Queiroz PR, Valadares-Inglis MC (1999) Transformation with green fluorescent protein of Trichoderma harzianum 1051, a strain with biocontrol activity against Crinipellis perniciosa, the agent of witches'-broom desease of cocoa. J Gen Appl Microbiol 45: 63-67

Kaster KR, Burgett SG, Rao RN and Ingolia TD (1983) Analysis of a bacterial hygromycin B resistance gene by transcriptional and translational fusions and by DNA sequencing. Nucleic Acids Res 11 (19): 6895-911

Le Chavanton L, Lebion G (1989) The uraδ gene of the ascomycete Sordaria macrospora: molecular cloning, characterization and expression in Escherichia coli. Gene 77: 39-49

Masloff S, Pöggeler S, Kück U (1999) The pro7 gene from Sordaria macrospora encodes a C ₆ zinc finger transcription factor required for fruiting body development. Genetics 152: 191-199

Menne S, Walz M, Kück U (1994) Expression studies with the bidirectional pcbAB-pcbC Promoter region from Acremonium chrysogenum using reporter gene fusions. Appl Microbiol Biotechnol 42: 57-66

Mullaney EJ, Hamer JE, Roberti KA, Yelton MM, Timberlake WE (1985) Primary structure of the trpC gene from Aspergillus nidulans. Mol Gen Genet 199: 37-45

Needleman and Wunsch (1970) J. Mol. Biol 48: 443-453

Nowrousian M, Masloff S, Pöggeler S, Kück U (1999) Cell differentiation during sexual development of the fungus Sordaria macrospora requires ATP citrate lyase activity. Mol Cell Biol 19: 450-460

Nowrousian M, Kück U, Loser K, Weltring KM (2000) The fungal acll and acl2 genes encode two polypeptides with homology to the N- and C-terminal parts of the animal ATP citrate lyase polypeptide. Curr Genet 37: 189-193

Pasamontes L, Haiker M, Wyss M, Tessier M, van Loon APGM (1997) Gene cloning, purification and characterization of a heat-stable phytase from the fungus Aspergillus fumigatus. Appl Environ Microbiol 63: 1696-1700

Pöggeler S, Nowrousian M, Jacobsen S, Kück U (1997) An efficient procedure to isolate fungal genes from an indexed cosmid library. J Microbiol Meth 29: 49-61

Pöggeler S (2000) Two pheromone precursor genes are transcriptionally expressed in the homothallic ascomycete Sordaria macrospora. Curr Genet 37: 403-411

Sambrook J, Fritsch EF, Maniatis T (1989) Molecular cloning: a laboratory manual. 2nd edition, Cold Spring Harbor Laboratory, Cold Spring Harbor, New York.

Selker EU (1997) Epigenetic phenomena in filamentous fungi: usefui paradigms or repeat-induced confusion? Trends Genet 13 (8): 296-301

Silar PC (1995) Two new easy to use vectors for transformations. Fungal Genet Newsl 42: 73

Singer MJ, Marcotte BA, Selker EU (1995) DNA methylation associated with repeat-induced point mutation in Neurospora crassa. Mol Cell Biol 15 (10): 5586-5597

Turcq B and Begueret J (1987) The uraδ gene of the filamentous fungus Podospora anserina: nucleotide sequence and expression in transformed strains. Gene 53: 201-9

Walz M, Kück U (1995) Transformation of Sordaria macrospora to hygromycin B resistance: characterization of transgenic strains by electrophoretic karyotyping and tetrad analysis. Curr Genet 29: 88-95

Claims

claims

1. A method for producing heterologous protein in a filamentous fungus, comprising cultivating a homothallic fungus of the Sordariaceae family which contains an expression cassette which contains the following elements in functional combination:

a promoter active in the fungus of the Sordariaceae family,

- a heterologous gene and

a terminator active in the fungus of the Sordariaceae family,

and harvesting the protein produced in a manner known per se.

2. The method according to claim 1, characterized in that the homothallic mushroom belongs to the genus Sordaria.

3. The method according to claim 2, characterized in that the homothallic mushroom is Sordaria macrospora or Sordaria fimicola.

4. The method according to claim 1, 2 or 3, characterized in that the fungus is a sterile mutant.

5. The method according to any one of claims 1 to 4, characterized in that the cultivation of the homothallic fungus takes place at 27 + 2 ° C.

6. The method according to any one of claims 1 to 5, characterized in that the promoter active in the homothallic fungus of the Sordariaceae family comes from a filamentous fungus.

7. The method according to claim 6, characterized in that the promoter is a promoter from Sordaria macrospora.

8. The method according to claim 7, characterized in that the promoter is the cpc2 promoter, the πd / 7 promoter, the ac / 7 promoter and the ppg7 promoter from Sordaria macrospora.

9. The method according to any one of claims 1 to 8, characterized in that the terminator active in the fungus of the Sordariaceae family comes from a filamentous fungus.

10. The method according to claim 9, characterized in that the terminator is a terminator from Sordaria macrospora.

11. The method according to claim 10, characterized in that the terminator is the cpc2 terminator, the πdA terminator, ac / 7 terminator or the ppgl terminator from Sordaria macrospora.

12. The method according to any one of claims 1 to 11, characterized in that the heterologous gene codes for a glycosylated protein after expression in eukaryotes.

13. The method according to any one of claims 1 to 12, characterized in that the heterologous gene is a growth factor, a cytokine, a coagulation factor, an industrial protein or a technical enzyme.

14. The method according to claim 13, characterized in that the heterologous gene codes for one of the following proteins: G-CSF, GM-CSF, IL-1, IL-2, IL-4, IL-6, IL-1ra, IFN -α, IFN-ß, IFN-γ, erythropoietin, glucoamylase, coagulation factor VIII, coagulation factor XII, coagulation factor XIII, human serum albumin.

15. The method according to any one of claims 1 to 14, characterized in that a sequence is arranged between the promoter and the heterologous gene in reading frame with the heterologous gene, which encodes a signal sequence functioning in the fungus of the Sordariaceae family.

16. The method according to claim 15, characterized in that the signal sequence is a signal sequence from a filamentous fungus.

17. The method according to claim 16, characterized in that the signal sequence is a signal sequence from Sordaria macrospora.

18. A nucleic acid molecule comprising:

(1) a promo active in a homothallic fungus of the Sordariaceae family gate, which is selected from the following nucleic acids:

(a) a nucleic acid with the sequence given in SEQ ID NO: 1;

(b) a nucleic acid with the sequence given in SEQ ID NO: 2;

(f) a fragment of one of the nucleic acids given in (a) to (e), which retains the function of the promoter active in the fungus of the Sordariaceae family;

or

(2) a nucleic acid with a sequence which is complementary to the sequence of one of the nucleic acids given in (a) to (g).

19. Nucleic acid molecule according to claim 18, characterized in that the nucleic acid specified under (c) has at least 70% identity with one of the sequences specified in (a) or (b).

20. Nucleic acid molecule according to claim 18, characterized in that the nucleic acid specified under (c) has at least 90% identity with one of the sequences specified in (a) or (b).

21. Nucleic acid molecule according to claim 18, characterized in that the nucleic acid specified under (c) has at least 95% identity with one of the in (a) or (b) specified sequences.

22. Vector for the transformation of a homothallic fungus of the Sordariaceae family, characterized in that it contains the following elements in functional connection with one another:

a promoter active in the fungus of the Sordariaceae family,

- a heterologous gene,

- a terminator active in the fungus of the Sordariaceae family and

- a selection marker.

23. Vector according to claim 22, characterized in that the promoter active in the fungus of the Sordariaceae family is the ac / promoter from Sordaria macrospora or the ppg7 promoter from Sordaria macrospora.

24. Vector according to claim 22, characterized in that the promoter active in the homothallic fungus of the Sordariaceae family comprises a nucleic acid according to one of claims 18 to 21, alternative (1).

25. Vector according to one of claims 22 to 24, characterized in that the terminator active in the fungus of the Sordariaceae family is the cpc2 terminator, the / 7d / 7 terminator, the ac / 7 terminator or the ppg7 terminator from Sordaria macrospora is.

26. Vector according to one of claims 22 to 25, characterized in that the selection marker is a hygromycin B resistance gene. i

27. Host organism, characterized in that it is a homothallic fungus of the Sordariaceae family which contains a vector according to any one of claims 22 to 26.

28. Host organism according to claim 27, characterized in that it belongs to the genus Sordaria.

29. Host organism according to claim 28, characterized in that it is Sordaria macrospora or Sordaria fimicola.

30. Host organism according to claim 27, 28 or 29, characterized in that it is a sterile strain.

31. Kit comprising:

(a) a vector according to any one of claims 22 to 26 and

(b) a homothallic fungus from the Sordariaceae family suitable for producing heterologous protein.

32. Use of a nucleic acid molecule according to one of claims 18 to 21 or an expression vector according to one of claims 22 to 26 or a kit according to claim 31 for the expression of a heterologous gene under the control of the promoter.

33. Use of a nucleic acid molecule according to one of claims 18 to 21 or an expression vector according to one of claims 22 to 26 or a kit according to claim 31 for the production of one or more proteins.