EP1339736A2 - Oncolytic virus - Google Patents
Oncolytic virusInfo
- Publication number
- EP1339736A2 EP1339736A2 EP01998300A EP01998300A EP1339736A2 EP 1339736 A2 EP1339736 A2 EP 1339736A2 EP 01998300 A EP01998300 A EP 01998300A EP 01998300 A EP01998300 A EP 01998300A EP 1339736 A2 EP1339736 A2 EP 1339736A2
- Authority
- EP
- European Patent Office
- Prior art keywords
- virus
- reovirus
- protein
- til
- amino acid
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
- A61K35/66—Microorganisms or materials therefrom
- A61K35/76—Viruses; Subviral particles; Bacteriophages
- A61K35/765—Reovirus; Rotavirus
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N7/00—Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2720/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsRNA viruses
- C12N2720/00011—Details
- C12N2720/12011—Reoviridae
- C12N2720/12211—Orthoreovirus, e.g. mammalian orthoreovirus
- C12N2720/12232—Use of virus as therapeutic agent, other than vaccine, e.g. as cytolytic agent
Definitions
- This invention provides methods of reducing the viability of a tumor cell, infecting a neoplasm in a mammal with a virus, or treating a neoplasm in a mammal, comprising administering a non-naturally occurring virus wherein the virus is: a) a reovirus whose mu-2 protein has amino acid residues A, R, M, F, L, M, I, Q, I and S at positions 93, 150, 300, 302, 347, 372, 434, 458, 652 and 726, respectively; or b) a reassortant of two or more parent strains of a viral species selected from the family Reoviridae, or progeny thereof; or c) a virus other than a reovirus wherein the virus other than a reovirus is: i) capable of expressing a reovirus mu-2 protein having amino acid residues A, R, M, F, L, M, I, Q, I and S at positions 93, 150, 300
- This invention futher provides the use of such non-naturally occurring virus in the manufacture of a medicament for reducing the viability of a tumor cell, infecting a neoplasm in a mammal, or treating a neoplasm in a mammal.
- This invention provides a method of identifying a PKR sensitive virus comprising: a) dividing a sample of a virus to be tested into a first portion and second pqrtion; b) contacting PKR +/+ cells with the first portion and contacting PKR -/- cells with the second portion, under conditions permitting growth of the virus in PKR -/- cells; c) determining the rate of growth of the virus in the PKR +/+ cells and in the PKR -/- cells; and d) comparing the growth rates from step c), wherein a higher rate of growth in the PKR -/- cells than in the PKR +/+ cells identifies the virus as PKR sensitive.
- Such PKR sensitive viruses identified in accordance with this invention are useful for reducing the viability of a tumor cell, infecting a neoplasm in a mammal, or treating a neoplasm in a mammal. DESCRIPTION OF THE FIGURES
- Figure 1 Virus yield of reovirus strains TIL and T3D in PKR -/- vs. PKR +/+ murine embryo fibroblasts.
- Figure 2 Immuno-blot of PKR in MEF Infected with Reo TIL and T3D.
- Figure 3 Lungs of mice with ct26 tumors after treatment with reovirus strains.
- TIL T3D
- EB96 EB96
- EB108 EB146 relative to untreated control lung.
- the lungs from 2 mice are shown for each treatment.
- Figure 4 The weight of BALB-C mouse lungs relative to the presence of
- FIG. 5 Histological sections stained with hematoxylin and eosin showing lung lobes of mice with ct26 tumors after treatment with reovirus strains. TIL, T3D, EB96, EB108 and EB146 relative to untreated control lung.
- amino acids are generally identified using the standard one-letter abbreviation, but can also be identified by name or standard three-letter abbreviations.
- T3D, TIL, T3A and T2J are standard abbreviations for reovirus strains T3 Dearing, Tl Lang, T3 Abney, and T2 Jones, respectively.
- the above-listed names of strains and their respective abbreviations are used interchangeably.
- phenotype refers to the sequence of the expressed proteins of a virus.
- the expressed proteins are the gene products of the LI, L2, L3, Ml, M2, M3, SI, S2, S3 and S4 genes.
- amino acid sequences of the products of these genes are the same in two different reoviral strains they are said to have the same phenotype.
- genotype refers to the nucleotide sequence of the coding region of a virus.
- nucleotide sequences of the LI, L2, L3, Ml, M2, M3, SI, S2, S3 and S4 genes of two reoviruses are the same in two different reoviral strains they are said to have the same genotype.
- PFU plaque forming units and is a quantitative measure of live virus particles.
- Examples of the anti-neoplastic and anti-tumor methods and use of this invention as described above, include those utilizing a reovirus whose mu-2 protein has amino acid residues A, R, M, F, L, M, I, Q, I and S at positions 93, 150, 300, 302, 347, 372, 434, 458, 652 and 726, respectively.
- the reeo viral mu-2 protein has the amino acid sequence of the mu-2 protein of reovirus strain T3 Dearing, for example when the mu-2 protein is expressed by a gene having the nucleic acid sequence of the Ml gene of reovirus strain T3 Dearing.
- the reovirus has the same genotype as a reovirus strain selected from the group consisting of eb86, ebl29, eb88, ebl3, and ebl45.
- the reovirus has a Ml gene whose sequence is the same as the Ml gene of reovirus strain T3 Dearing and an L3 gene whose sequence is the same as the L3 gene of reovirus strain Tl Lang, for example the virus can have the same genotype as a reovirus strain selected from the group consisting of eb28, eb31, eb97, ebl23 and gl6.
- the reovirus has a Ml gene whose sequence is the same as the Ml gene of reovirus strain T3 Dearing and an L3 gene, LI gene, and S2 gene whose sequences are the same as the corresponding genes of reovirus strain Tl Lang, for example reo viruses having the same genotype as a reovirus strain selected from eb96, ebl46 and ebl08.
- the reovirus has a Ml gene whose sequence is the same as the Ml gene of reovirus strain T3 Dearing and an L3 gene, LI gene, S2 gene and S4 gene whose sequences are the same as the corresponding genes of reovirus strain Tl Lang, for example reoviruses having the same genotype as reovirus strain eb96.
- anti-neoplastic and anti-tumor methods and use of this invention include those utilizing a virus that is a reassortant of two or more parent strains of a viral species selected from the family Reoviridae, or progeny thereof.
- reassortants can be made of two, three or four of the reovirus strains T3 Dearing, Tl Lang, T3 Abney, and T2 Jones.
- the reassortants are generated from parent strains T3 Dearing and Tl Lang. Examples of such strains include ebl 18, eb73.1, hl7, hl5, eb39, and h60 as well as the other strains shown in Tables 1 and 2.
- anti-neoplastic and anti-tumor methods and use of this invention include those utilizing a virus other than a reovirus that is: i) capable of expressing a reovirus mu-2 protein having amino acid residues A, R, M, F, L, M, I, Q, I and S at positions 93, 150, 300, 302, 347, 372, 434, 458, 652 and 726, respectively, and ii) is a DNA virus, a positive-sense RNA virus, or a negative-sense RNA virus selected from the group consisting of the families Orthomyxoviridae, Rhabdoviridae and Paramyxoviridae.
- Suitable DNA viruses include a Herpesvirus, Adenovirus, Parvovirus, Papovavirus, Iridovirus, Hepadenavirus, Poxvirus, mumps virus, human parainfluenza virus, measles virus or rubella virus.
- suitable a positive-sense RNA viruses include a Togavirus, Flavivirus, Picomavirus, or Coronavirus.
- suitable negative-sense RNA virus selected from the group consisting of Orthomyxoviridae, Rhabdoviridae and Paramyxoviridae include an influenza virus or a vesicular stomatitis virus.
- any PKR +/+ and -/- cells can be used, and the rate of growth of the virus is determined by any standard technique for monitoring viral growth including those that measure the number of virus particles directly or the quantity of viral proteins.
- the PKR cells are mouse embryo fibroblasts.
- the rate of growth of the virus is determined by a technique selected from the group consisting of plaque titer assay, antibody assay, and Western blot. Each of these techniques is exemplified below.
- the growth rate of the virus in PKR -/- cells is at least ten times higher than the growth rate in PKR +/+ cells.
- the virus can be a replication competent virus and/or a clonal virus.
- the virus can be administered by any conventional route, including but not limited to intranasally, intratracheally, intravenously, intraperitoneally or intratumorally.
- the virus can be administered to the tumor cell either in vivo or ex vivo.
- the mammal can be either a human or a non-human mammal such as a mouse, sheep, cow, pig, dog or rabbit.
- viruses utilized in accordance with this invention can be produced by any conventional means, including reassortment among two or more parent virus strains or the use of standard recombinant genetic techniques. Once produced, such viruses can be reproduced by culturing in cells to produce progeny.
- reassortants of viruses are well known and is described, for example in Brown, et al., "The L2 Gene of Reovirus Serotype 3 Controls the Capacity to Interfere, Accumulate Deletions and Establish Persistent Infection" in Double- Stranded RNA Viruses, Compans, et al. eds. Elsevier (1983).
- reassortants can be made of two, three or four of the reovirus strains T3 Dearing, Tl Lang, T3 Abney, and T2 Jones. Reassortants of T3 Dearing and Tl Lang are described in Example 2.
- the virus is replication competent and/or a clonal virus.
- Indirect Immunostaining Cells were grown on glass coverslips in 35 mm diameter dishes and were infected with reovirus TIL or T3D at a multiplicity of infection (moi) of 10. After 48 hours incubation the cells were rinsed in PBS and fixed in prechilled acetone for 5 min. After rinsing in PBS (3x5min), lOO ⁇ l of an appropriate dilution of type- specific rabbit antivirus antisera was applied and incubated at room temperature for 30 min. The coverslips were then rinsed in PBS (3x5min) and treated with the appropriate dilution of Cy3-conjugated donkey anti-rabbit antibody (Jackson ImmunoResearch Laboratories, Inc.) as the secondary antibody. After another 30 min incubation period at room temperature the coverslips were rinsed in PBS (3x5min) and mounted on glass slides in Gel/Mount (Biomeda Corp). All antibody dilutions were done in PBS/3 % BSA.
- the samples were examined with a Zeiss microscope equipped with epifluorescence and a 40X 1.40 NA PlanApo objective.
- the images were collected using Image One Metamorph software and a Hamamatsu chilled charge-coupled digital camera (model C5985). Configuration of the digital images was done using Corel Presentations software.
- sample buffer 62.5mM Tris-HCl pH6.8, 10% glycerol, 2 % SDS, 0.05% bromophenol blue and 5 % 2-mercaptoethanol
- Mouse L929 cells were coinfected with Reovirus Serotype 1 Lang strain (TIL) and Serotype 3 Dearing strain (T3D) at a multiplicity of infection of 5 each.
- Virus was harvested 24 hr post infection by 3 cycles of freezing and thawing before progeny viruses were isolated by 2 cycles of plaque isolation in L929 monolayers. Since each of the corresponding genome segments of TIL and T3D is distinguishable by electrophoretic mobility the genetic composition of each virus was determined by poly aery lamide gel electrophoresis of the segmented double stranded RNA (dsRNA) genome where the mobility of each segment is compared to the parental strains.
- dsRNA segmented double stranded RNA
- Gels prepared as described by Laemmli contained 10% polyacrylamide and 0.27% methylene bis-acrylamide. Double-stranded RNA was obtained from L929 cells infected for 3 days and solubilised in buffer containing sodium dodecyl sulphate and was detected in gels stained with ethidium bromide as described previously (Zou S. and E.G. Brown. (1992) Identification of Sequence elements containing signals for replication and encapsidation of the reovirus Ml genome segment. Virology 186:377-88. The use of this panel of reassortants was first described by E.G. Brown, M. L. Nibert and B.N.
- TIL, T3D and virus stocks from the reassortment procedure described above were prepared in L929 cells grown in Earl's Minimal Essential Medium (MEM) supplemented with 5 % fetal bovine serum and penicillin to 100 units/ml and streptomycin to 100 ug/ml until cytopathic effect was complete. Cells and culture supernatant were subjected to 3 cycles of freezing and thawing before titration by plaque assay.
- MEM Earl's Minimal Essential Medium
- Wild type PKR+/+ cells were obtained from Balb-C mice and PKR-/- cells were obtained from PKR knockout mice.
- Cell cultures were produced using 15-17 days embryos that had been disaggregated by mincing and trypsin treatment.
- Cell monolayers were grown in 35 mm plastic dishes in MEM supplemented with 10% FBS and P/S at 37 C in a 5% CO2 atmosphere.
- Cells were infected with titrated TIL, T3D or reassortant reovirus at a multiplicity of infection (moi) of 10 by adsorption of stock virus for 0.5 hr with agitation at 15 minute intervals.
- m multiplicity of infection
- Unadsorbed virus was removed by 3 washes with 2 ml of warm PBS each before the addition of 3 ml of MEM supplemented with 5 % fetal bovine serum and penicillin to 100 units/ml and streptomycin to 100 ug/ml.
- the yield of TIL and T3D was assayed at time points over a 4 day period and is shown in Figure 1. Comparison of yields of virus from MEF cells infected with reassortant reovirus was done after 3 days incubation by plaque assay of duplicate cultures. The results are shown below in Table 1 (PKR -/-) and Table 2 (PKR +/+).
- Monolayer cultures of L929 cells were decanted of medium and infected in duplicate with 0.1 ml volumes of serially diluted virus in PBS. Virus was adsorbed for 0.5 hr before the application of 3 ml of MEM supplemented with 1 % agar, 5 % FBS and P/S. Cultures were incubated at 37 C and supplementary overlays of 2 ml aliquots of the same medium was added 3 and 6 days post infection. After 8 days of infection the monolayers were stained for 24 hr with 2 ml of the same overlay solution supplemented with neutral red (0.01 % weight/volume) to observe plaques.
- the genetic basis for the increased ability of TIL to grow in each cell type was determined using TIL x T3D reassortants.
- the comparison of the genetic basis for replication in PKR +/+ relative to PKR -/- MEF cells indicates that the ability of the PKR gene to inhibit reovirus infection is dependent on the properties of the Ml gene. Furthermore the extent of replication and thus exploitation of PKR -/- cells is dependent on the nature of the LI, L3, M3 and S2 genes.
- the reassortant viruses with the greatest differential ability to replicate in PKR -/- relative to PKR +/+ cells possess the T3D Ml gene and the viruses with the greatest ability to replicate in PKR -/- cells (characteristic of many tumor cells) possess the LI, L3, M3 and S2 genes of TIL.
- Such viruses are restricted in replication of PKR +/+ cells but replicate to a greater extent than either TIL or T3D in PKR -/- cells and are embodied in the properties of the reassortants eb96 and ebl08.
- the amino acid sequences of the TIL and T3D mu2 proteins are shown in Table 4. Each protein is 736 amino acids long and they differ at 10 aa positions. The observed difference in sensitivity to PKR seen as an ability to replicate in PKR+/+ relative to PKR-/- MEF cells is attributed to the difference in amino acid sequence between these proteins and thus Ml proteins of reo viruses with these amino acid changes or other substitutions at these positions are addressed herein.
- the mu2 protein is encoded by the Ml gene.
- the nucleotide sequences of the TIL and T3D Ml gene are shown in Table 5. Each genome segment is 2304 nucleotides long and they differ at 51 nucleotide positions.
- TIL GenBank Accession No. CAA42570.1
- T3D GenBank Accession No. AAA47256.1 mu2 proteins. These amino acid sequences were deduced from cDNA. Each protein is 736 nucleotides long and differs at 10 aa positions.
- TIL 721 RGAAY ARLAFRSDLA 736 Consensus
- TIL gctattcgcggtcatggcttacatcgcagttcctgcggtggtggattcacgttcaa gtga 60
- TIL 61 ggctattggactgctagaatcgtttggagtagacgctggggctgatgcgaatgacg tttc 120
- TIL 121 atatcaagatcatgactatgtgttggatcagttacagtatatgttagatggatatg aggc 180
- T3D 121 atatcaagatcatgactatgtgttggatcagttacagtacatgttagatggatatg aggc 180
- TIL 181 tggcgacgttatcgatgcactcgtccacaagaattggttacatcactccgtctatt gctt 240
- T3D 181 tggtgacgttatcgatgcactcgtccacaagaattggttacatcactctgtctatt gctt 240
- TIL 241 gttgccacccaaaagtcaactactagagtattggaaaagtaatccttcagtgatac cgga 300
- T3D 241 gttgccacccaaaagtcaactattagagtattggaaaagtaatccttcagcgatac cgga 300
- TIL 301 caacgttgatcgtcggcttcgtaaacgactaatgctaaagaagatctcagaaaag atga 360
- T3D 301 caacgttgatcgtcggcttcgtaaacgactaatgctaaagaaagatctcaggaaag atga 360
- TIL 361 tgaatacaatcaactagcgcgtgctttcaagatatcggatgtctacgcacctctca tctc 420
- T3D 361 tgaatacaatcagctagcgcgtgctttcaagatatcggatgtctacgcacctctca tctc 420
- TIL 421 atccacgacgtcaccgatgacaatgatccagaacttgaatcaaggcgagatcgtgt acac 480
- T3D 421 atccacgacgtcaccgatgacaatgatacagaacttgaatcgaggcgagatcgtgt acac 480
- TIL 481 cacgacggacagggtaattggggctagaatcttgttatatgctcctagaaagtact atgc 540
- T3D 481 cacgacggacagggtaataggggctagaatcttgttatatgctcctagaaagtact atgc 540
- TIL 541 gtcaactctatcatttactatgactaagtgcatcattccgtttggcaaagaggtgg gtcg 600
- TIL 661 tgtcatgagtggggttgatattgagtccatcccaaatgaattcatcaagttgtttt acca 720
- T3D 661 tgtcatgagtggggttgatattgagtccatcccaaatgaatttatcaagttgtttt acca 720
- TIL 721 gcgcgtcaagagtgttcacgccaatatactaaatgacatatcacctcagatcgtct ctga 780
- T3D 721 gcgcgtcaagagtgttcacgctaacatactaaatgacatatctcctcagatcgtct ctga 780
- TIL 781 catgataaacagaaagcgtttgcgcgttcatactccatcagatcgtcgagccgcgc agtt 840
- T3D 781 catgataaacagaaagcgtctgcgcgttcatactccatcagatcgtcgagccgcgc agtt 840
- TIL 841 gatgcatttgccctaccatgttaaacgaggagcgtctcacgtcgacgtttacaagg tgga 900
- T3D 841 gatgcatttgccttaccatgttaaacgaggagcgtctcacgtcgacgtttacaagg tgga 900
- TIL 901 tgttgtagacgtgttgttagaggtagtggatgtggccgatgggttgcgcaacgta tctag 960
- T3D 901 tgttgtagacatgttgttcgaggtagtggatgtggccgatgggttgcgcaacgta tctag 960
- TIL 961 gaaactaactatgcataccgttccggtatgtattcttgaaatgttgggtattgaga ttgc 1020
- T3D 961 gaaactaactatgcataccgttcctgtatgtattcttgaaatgttgggtattgaga ttgc 1020
- TIL 1021 ggactattgcattcgtcaagaggatggaatgttcacagattggttcctacttttaa ccat 1080
- TIL 1081 gctatctgatggcttaactgatagaaggacgcattgtcaatacttgattaatccgt caag 1140
- T3D 1081 gctatctgatggcttgactgatagaaggacgcattgtcaatacttgatgaatccgt caag 1140
- TIL 1141 tgtgcctcctgatgtgatacttaacatctcaattactggatttataaataggcata caat 1200
- TIL 1201 cgatgtcatgcctgatatatatgacttcgttaaacccattggcgctgtgctgccta aggg 1260
- T3D 1201 cgatgtcatgcctgacatatatgacttcgttaaacccattggcgctgtgctgccta aggg 1260
- TIL 1261 atcatttaaatcaacaattatgagagttcttgattcaatatcaatattaggagtcc agat 1320
- T3D 1261 atcatttaaatcaacaattatgagagttcttgattcaatatcaatattaggaatcc aaat 1320
- TIL 1321 catgccgcgcgcgcatgtagttgactcggatgaggtgggcgagcaaatggagccta cgtt 1380
- T3D 1321 catgccgcgcgcgcatgtagttgactcagatgaggtgggcgagcaaatggagccta cgtt 1380
- TIL 1381 tgagcatgcggttatggagatatacaaagggattgctggcgttgactcgctggatg atct 1440
- T3D 1381 tgagcaggcggttatggagatatacaaagggattgctggcgttgactcgctggatg atct 1440
- TIL 1441 catcaagtgggtgctgaactcggatctcattccgcatgatgacaggcttggccaat tatt 1500
- T3D 1441 catcaagtgggtgttgaactcggatctcattccgcatgatgacaggcttggtcaat tatt 1500
- TIL 1501 tcaagcgtttctgcctctcgcaaaggacttgttagctccaatggccagaaagtttt atga 1560
- T3D 1501 tcaagcgtttttgcctctcgcaaaggacttattagctccaatggccagaaagtttt atga 1560
- TIL 1561 taactcaatgagtgagggtagattgctgacattcgctcatgccgacagtgagttgc tgaa 1620
- T3D 1561 taactcaatgagtgagggtagattgctaacattcgctcatgccgacagtgagttgc tgaa 1620
- TIL 1621 cgcaaattactttggtcatttattgcgactaaaaataccatatattacagaggtta atct 1680
- T3D 1621 cgcaaattattttggtcatttattgcgactaaaaataccatatattacagaggtta atct 1680
- TIL 1681 gatgattcgcaagaatcgtgagggtggagagctatttcagcttgtgttatcgtatc tata 1740
- TIL 1741 taaaatgtatgctactagcgcgcagcctaaatggtttggatcattattgcgattgt taat 1800
- T3D 1741 taaaatgtatgctactagcgcgcagcctaaatggtttggatcattattgcgattgt taat 1800
- TIL 1801 atgtccctggttacatatggagaaattaataggagaagcagacccggcatctacgt cggc 1860
- T3D 1801 atgtccctggttacatatggagaaattaataggagaagcagacccggcatctacgt cggc 1860
- TIL 1861 tgaaattggatggcatatccctcgtgaacagctgatgcaagatggatggtgtggat gtga 1920
- T3D 1861 tgaaattgggtggcatatccctcgtgaacagctgatgcaagatggatggtgtggat gtga 1920
- TIL 1921 agatggattcattccctatgttagcatacgtgcgccaagactggttatggaggagt tgat 1980
- TIL 2041 cgaaccgcggagggtatctgccaaggctgtgatcaagggtaatcacttaccagtta agtt 2100
- T3D 2041 cgaaccgcggagggtatctgctaaggctgtgatcaagggtaaccacttaccagtta agtt 2100
- TIL 2101 agtttcacgatttgcatgtttcacattgacggcgaagtatgagatgaggctctcgt gcgg 2160
- T3D 2101 agtttcacgatttgcatgtttcacattgacggcgaagtatgagatgaggctttcgt gcgg 2160
- TIL 2161 ccatagcactggacggggggctgcatacaatgcgagactagctttccgatctgact tggc 2220
- TIL 2221 gtgatccgtgacatgcgtagtgtgacacctgcccctaggtcaatgggggtaggggg cggg 2280
- TIL 2281 ctaagactacgtacgcgcttcatc 2304
- IP injections involved the administration of 0.1 ml of stock virus or virus diluted in PBS.
- IN infection involved the application of 0.05 ml volumes of stock virus or virus diluted in PBS onto the nose-pad of mice anaesthetized with halothane (administered at 3% in oxygen). The survival of adult mice was monitored over a 30 day period.
- PKR+/+ MEF results in a greater expression of the phosphorylated form ofPKR (Fig. 2).
- PKR+/+ MEF were infected at a moi of 10 and incubated over a 48 hr period for immunoblot analysis using rabbit anti-PKR serum that reacts with the first 100 amino acids of PKR. Proteins were separated on a 10% poly aery lamide gel and transferred to IMMOBILON membrane (Millipore Inc.) before incubation with 1/100 diluted primary antibody in the presence of casein.
- PKR results in an electrophoretic form of slightly slower mobility indicated as PKR-P.
- Infection with T3D results in a greater production of this form than with infection with TIL. This demonstrates that PKR expression is enhanced in T3D infected cells and indicates that this may be responsible for the greater sensitivity of this virus to the PKR gene.
- reassortants were chosen for testing of oncolytic properties relative to their parental viruses.
- Each of the reassortants EB96, EB108 and EB146 posessed the Ml gene of T3D and were expected to preferentially replicate in cells that were damaged in their interferon response.
- These reassortants also possessed their LI, L3 and S2 genes of TIL that would be predicted to provide optimal replication abilities.
- Oncolytic testing was performed by intranasal infection of 10 7 pfu of each virus into mice that possessed lung tumors derived form the CT26 colon tumor cell line fo Balb-C origin.
- On day 7 groups of 3 mice were anaesthetized and infected with 10 7 pfu of virus in a 0.050 volume of culture medium. Mice were housed for an additional 6 days before euthanization with 90% CO 2 /10% O 2 .
- Lungs were removed, weighed, fixed in formalin and photographed. One set of lungs was examined histopathologically by hematoxylin and eosin staining after paraffin embedding and sectioning.
- Fig 3 The gross appearance of lungs after treatment showed that the untreated control lungs were heavily tumor laden having a pebbled surface appearance due to contiguous tumor nodules. These animals were in the terminal stages of cancer since one animal died at this time and the others were in respiratory distress. These lungs were 3 times heavier than uninfected balb-c lungs indicating the increased tumor mass approximated twice the mass of the lung tissue (Fig 4). Histologically these lungs were covered with a contiguous layer of tumor nodules and internal tumor masses seen as eosinophilic growths of cells (Fig 4 and 5).
- T3D treatment was not as effective as TIL resulting in lungs that were only distinguishable form untreated controls by a slight (8 %) decrease in size but were similar in gross and microsopic appearance of tumors (Fig 3, 4 and 5).
- EB96 reassortant virus cleared the lung of gross tumor mass on treatment (Fig 3).
- the lungs were of approximately normal weight having been freed of tumor masses (Fig 4).
- a small number of residual tumor cells remained at this time as detected by histological examination (Fig 5).
- the lungs were of normal size and appearance except for some circular patterns and dents on the lungs surface that presumably marked the location of prior tumor nodules.
- EB146 virus was not more effective at tumor lysis than the T3D parental virus (Fig 3, 4 and 5).
- Reassortant EB108 was partially effective at oncolysis producing results that were marginally better but similar than the TIL parental strain.
- the 3 influenzaants possess 7 genome segments in common and thus differ in their L2, S3 and S4 genome segments indicating that the latter group of genes include important modulators of oncolysis.
- the EB96 reassortant is more effective than EB108 soley due to the nature of the S4 gene since these viruses only differ in the parental origin of this gene. This indicates that the TIL S4 gene conferred enhanced oncolytic properties relative to the T3D S4 gene. Since the S4 gene encodes the dsRNA binding protein that blocks PKR activation it is possible that the TIL S4 gene differs in this ability and thus, in concert with other combinations of TIL and T3D genome segments, controls oncolytic potential.
- Table 6 Ranking of the ability of reovirus reassortants to lyse ct26 lung tumors.
- the relative weight of ct26 tumor bearing lungs relative to untreated control tumor bearing lungs are shown.
- the parental origin of genome segments are indicated as L for TIL and D for T3D.
- a panel of tumor cell lines obtained fron the NCI tumor panel (SF539, ens; SKMEL28, melanoma; HT29; NCI H23, nsc-lung; SW620, colon; DU145, prostate) were infected with the TIL, T3D, or the reassortants , EB96, EB108 and EB146 at an moi of 10 and were observed for cytopathic effect over a 5 day period.
- the ability to lyse tumor cells was scored visually on a scale of- to +++, where - indicates no difference form mock infected cells and +, ++, and +++ indicate 33 % cell destruction, 66 % cell destruction and complete lysis respectively.
- the reassortants viruses were all as effective or more effective than the T3D parental virus at tumor cell lysis in vitro (Table 7).
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Virology (AREA)
- Organic Chemistry (AREA)
- Animal Behavior & Ethology (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- Genetics & Genomics (AREA)
- Microbiology (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Pharmacology & Pharmacy (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biomedical Technology (AREA)
- General Engineering & Computer Science (AREA)
- Biochemistry (AREA)
- Epidemiology (AREA)
- Immunology (AREA)
- Biotechnology (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Mycology (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Applications Claiming Priority (5)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US25013100P | 2000-12-01 | 2000-12-01 | |
| US250131P | 2000-12-01 | ||
| US32701601P | 2001-10-05 | 2001-10-05 | |
| US327016P | 2001-10-05 | ||
| PCT/CA2001/001703 WO2002043647A2 (en) | 2000-12-01 | 2001-11-30 | Oncolytic virus |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| EP1339736A2 true EP1339736A2 (en) | 2003-09-03 |
Family
ID=26940619
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| EP01998300A Ceased EP1339736A2 (en) | 2000-12-01 | 2001-11-30 | Oncolytic virus |
Country Status (5)
| Country | Link |
|---|---|
| EP (1) | EP1339736A2 (https=) |
| JP (1) | JP2004519431A (https=) |
| AU (2) | AU2002220416A1 (https=) |
| CA (1) | CA2430495A1 (https=) |
| WO (2) | WO2002043647A2 (https=) |
Families Citing this family (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| AUPQ425699A0 (en) | 1999-11-25 | 1999-12-23 | University Of Newcastle Research Associates Limited, The | A method of treating a malignancy in a subject and a pharmaceutical composition for use in same |
| AU2002953436A0 (en) | 2002-12-18 | 2003-01-09 | The University Of Newcastle Research Associates Limited | A method of treating a malignancy in a subject via direct picornaviral-mediated oncolysis |
| WO2005111200A1 (en) * | 2004-05-17 | 2005-11-24 | Universite De Montreal | Novel strains of reoviruses and methods of uses thereof |
| WO2007099401A2 (en) | 2005-08-01 | 2007-09-07 | University Technologies International, Inc. | Oncolytic attenuated reoviruses for treatment of proliferative disorders |
| US10668119B2 (en) | 2005-08-01 | 2020-06-02 | Virocure, Inc. | Attenuated reovirus |
| JP5577103B2 (ja) | 2007-03-12 | 2014-08-20 | オンコリティクス バイオテク,インコーポレーテッド | 改変配列を有するレオウイルス |
| US10369171B2 (en) | 2007-03-13 | 2019-08-06 | Virocure, Inc. | Attenuated reoviruses for selection of cell populations |
| WO2019237063A1 (en) * | 2018-06-07 | 2019-12-12 | Emory University | Modified reoviruses, particles, and uses in treating proliferative disorders |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6110461A (en) * | 1997-08-13 | 2000-08-29 | Oncolytics Biotech Inc. | Reovirus for the treatment of neoplasia |
| US6136307A (en) * | 1997-08-13 | 2000-10-24 | Oncolytics Biotech Inc. | Reovirus for the treatment of cellular proliferative disorders |
| CA2323067A1 (en) * | 1998-03-12 | 1999-09-16 | The Trustees Of The University Of Pennsylvania | Producer cells for replication selective viruses in the treatment of malignancy |
-
2001
- 2001-11-30 JP JP2002545626A patent/JP2004519431A/ja active Pending
- 2001-11-30 WO PCT/CA2001/001703 patent/WO2002043647A2/en not_active Ceased
- 2001-11-30 AU AU2002220416A patent/AU2002220416A1/en not_active Abandoned
- 2001-11-30 EP EP01998300A patent/EP1339736A2/en not_active Ceased
- 2001-11-30 CA CA002430495A patent/CA2430495A1/en not_active Abandoned
- 2001-12-03 WO PCT/US2001/045108 patent/WO2002050304A2/en not_active Ceased
- 2001-12-03 AU AU2002243257A patent/AU2002243257A1/en not_active Abandoned
Non-Patent Citations (1)
| Title |
|---|
| See references of WO0243647A2 * |
Also Published As
| Publication number | Publication date |
|---|---|
| AU2002220416A1 (en) | 2002-06-11 |
| WO2002050304A2 (en) | 2002-06-27 |
| AU2002243257A1 (en) | 2002-07-01 |
| JP2004519431A (ja) | 2004-07-02 |
| WO2002043647A3 (en) | 2003-01-03 |
| WO2002043647A2 (en) | 2002-06-06 |
| WO2002050304A3 (en) | 2002-11-28 |
| CA2430495A1 (en) | 2002-06-06 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Cowley et al. | Genetic reassortants for identification of the genome segment coding for the bluetongue virus hemagglutinin | |
| Weiner et al. | Absolute linkage of virulence and central nervous system cell tropism of reoviruses to viral hemagglutinin | |
| Desselberger | Genome rearrangements of rotaviruses | |
| Sherry et al. | The reovirus M1 gene, encoding a viral core protein, is associated with the myocarditic phenotype of a reovirus variant | |
| Hrdy et al. | Molecular basis of reovirus neurovirulence: role of the M2 gene in avirulence. | |
| US20040115170A1 (en) | Oncolytic virus | |
| Thalmann et al. | Broome virus, a new fusogenic Orthoreovirus species isolated from an Australian fruit bat | |
| Šantak et al. | Accumulation of defective interfering viral particles in only a few passages in Vero cells attenuates mumps virus neurovirulence | |
| US20070036758A1 (en) | Mutants of vaccinia virus as oncolytic agents | |
| Blackhall et al. | Serine protein kinase activity associated with rotavirus phosphoprotein NSP5 | |
| WO2002043647A2 (en) | Oncolytic virus | |
| Van de Zande et al. | Central nervous system signs in chickens caused by a new avian reovirus strain: a pathogenesis study | |
| KR101749130B1 (ko) | 레오바이러스과 바이러스의 백신용 바이러스 균주를 제조하는 방법 | |
| Wakamatsu et al. | The effect on pathogenesis of Newcastle disease virus LaSota strain from a mutation of the fusion cleavage site to a virulent sequence | |
| Jiang et al. | Genetic characterization and pathogenicity of a divergent broiler‐origin orthoreovirus causing arthritis in China | |
| KR19990072201A (ko) | 로타바이러스 항원, 로타바이러스 감염증에 대한백신 및 진단제와 항원 제조방법 | |
| Sokol et al. | Structure-function relationships and mode of replication of animal rhabdoviruses. | |
| Ramig et al. | Genetics of reoviruses | |
| Faulkner-Valle et al. | Molecular biology of rotaviruses. III. Isolation and characterization of temperature-sensitive mutants of bovine rotavirus | |
| Fields | Genetics of reovirus | |
| Yawei et al. | Subgenomic S1 segments are packaged by avian reovirus defective interfering particles having an S1 segment deletion | |
| US20210008136A1 (en) | Improved Oncolytic Reovirus | |
| Tauscher et al. | Viral determinants of rotavirus pathogenicity in pigs: production of reassortants by asynchronous coinfection | |
| ES2241506T3 (es) | Uso de ribozimas en la detección de agentes adventicios. | |
| Mann et al. | Type 3 reovirus neuroinvasion after intramuscular inoculation: viral genetic determinants of lethality and spinal cord infection |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
| 17P | Request for examination filed |
Effective date: 20030624 |
|
| AK | Designated contracting states |
Kind code of ref document: A2 Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE TR |
|
| AX | Request for extension of the european patent |
Extension state: AL LT LV MK RO SI |
|
| RIN1 | Information on inventor provided before grant (corrected) |
Inventor name: STOJDL, DAVID, FRANCIS Inventor name: BELL, JOHN, CAMERON Inventor name: MBISA, JEAN, LUTAMYO Inventor name: BROWN, EARL, GARNET |
|
| 17Q | First examination report despatched |
Effective date: 20050316 |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE APPLICATION HAS BEEN REFUSED |
|
| 18R | Application refused |
Effective date: 20060729 |