EP1311462A2 - Arrays of immobilised biomolecules, production and use thereof - Google Patents

Abstract

The invention relates to arrays of immobilised biomolecules, coupled by means of coupling groups, preferably quinone, to a carbonaceous support surface. The carbonaceous surface comprises at least one polymer based on cycloolefins, or may be obtained whereby a glass, metal or ceramic surface is treated with an aqueous solution of at least one carbon-containing compound which may be hydrolysed and the surface subjected to thermal treatment. Anthraquinone and polycycloolefin surfaces based on norbornene are preferably used, or surfaces silanised with hydrophobic residues according to the sol-gel technique. The advantages of said arrays lie above all in the quality thereof, in particular with relation to the homogeneity and reproducibility with which the biomolecules are immobilised. The invention further relates to methods for the immobilisation of biomolecules and the use of the arrays for diagnostic purposes.

Description

 Arrays of immobilized biomolecules, their production and use

The present invention relates to arrays of immobilized biomolecules on carbon-containing surfaces, their production and use. The present invention also relates to devices based on the arrays, in particular chips and dipsticks, and carriers with a structured surface for the targeted immobilization of biomolecules.

With the increasing practical importance of molecular biological analysis, the established standard techniques, which often involve days and weeks, are very labor intensive and costly. New test formats such as biochips should enable enormous time and cost savings. Since many different substances immobilized in a very small space can be brought into contact with a single sample to be analyzed at the same time with this technology, the information content obtained from one chip per measurement is very high.

An overview of the best known biochip systems is given by Bowtell D. D. L. nature qenetics Supplement 21 (1999) 25-32.

A typical example of a so-called "high density array" is the GeneChip from Affymetrix, an oligonucleotide array with typically over 400 different capture probes, which are built up base by base on the glass wafer. The chips are characterized by a very high information density of up to 40,000 oligonucleotides / cm ^2. The individual “spots” are rectangular, but the spot areas are not homogeneous and poor hybridization can often be observed especially at the edges (cf. also US 5,744,305; US 5,800,922; US 5,445,934; US 5,795,716).

"Low density arrays" are available from Genometrix, for example. A maximum of 250 spots with a diameter of 50 μm are printed with a capillary pin bundle made up of up to 1000 individual capillaries into the cavities of a 96-well microtiter plate. Conventional techniques are used for coupling to the surface which are based in particular on amino silanizations and NHS-activated haptens, epoxy-activated surfaces, carbodiimide couplings on carboxyl groups and biotin / streptavidin bonds (cf. WO 97/18226; EP 0910570 A1; WO 98/29736).

However, the quality of these biochips is not sufficient for satisfactory use, especially in medical diagnostics. There are several reasons for this. For example, the carrier materials commonly used pose problems. Glass surfaces initially require silanizations. For this purpose, solutions of silanes in aprotic solvents are applied to the glass surfaces. The OH groups present on the surface hydrolyze the silanes, which then condense to form a network (cf. DE 197 22 374 C2; DE 38 79 612 T2). Coatings of this type are generally very inhomogeneous and not very reproducible and moreover depend heavily on the pretreatment of the glass surface. A disadvantage of membranes or gels is the frequently occurring diffusion problems and, especially with nylon membranes, a high background fluorescence.

Couplable functional groups are usually missing for plastics. Only polystyrene has a certain importance for the adsorption of proteins. For this reason, attempts have already been made to modify polymer surfaces in order to introduce functional groups. For example, EP 0 319 957 A2 names various known photoreactive groups with which olefinic polymer surfaces can be modified. In contrast, quinones are preferred as photoreactive groups according to WO 96/31557. The teaching of US Pat. No. 5,292,873 shows that quinones of this type can react not only with the polymer surface, but also with attached functional groups, according to which quinone derivatives react with oligonucleotides for crosslinking. For the immobilization of biomolecules via quinones of this type, this means a possible side reaction which affects the result.

The coupling process of biomolecules to the surface is also critical. If the biomolecules are applied in a structured manner, the evaporation of the tiny amounts of liquid has a strong influence on the spot quality. The drying process leads to large differences in concentration within a spot. The very short reaction times of often only a few seconds are usually not sufficient for a completely homogeneous saturation of the surface with biomolecules. The inhomogeneity of the spots and the lack of alignment of the biomolecules leads to high coefficients of variation and a low dynamic measuring range in almost all cases.

An independent control of the biochip quality or a comparison of different systems would be desirable. Various control spots are usually integrated in most of the available arrays. However, these only allow a statement as to whether sample preparation and incubation were successful and whether all the necessary reagents were added. An evaluation of the results and a plausibility The test is left to the user. There are no uniform standards for the quality characteristics of biochip arrays.

The present invention is therefore based on the technical problem of providing high-quality biochips with homogeneously and reproducibly applied biomolecules.

To solve this problem, the invention proposes coupling the biomolecules to a carbon-containing surface which is either based on polycycloolefins or can be obtained by a specific hydrophobization process.

The present invention therefore relates to arrays of immobilized biomolecules which are coupled to a carbon-containing support surface, the arrays being characterized in that the carbon-containing surface a) contains at least one cycloolefin-based polymer; or b) is obtainable by treating a glass or metal surface with an aqueous solution of at least one hydrolyzable carbon-containing compound and heating the surface.

There are numerous advantages associated with the invention:

The arrays created are very robust and have good storage properties. The arrays can be encapsulated and / or integrated into automatic analysis devices. Biomolecules immobilized as spots have a uniform coating, ie they are homogeneous, in particular “coffee stain shapes” are avoided. Good discrimination rates are achieved for oligonucleotide arrays and a high dynamic range is provided for hybridization experiments of> 10 ^4. Intra- and interarray variations are available An intra-assay variance of less than 7% and an inter-assay variance of less than 12% can be achieved, which enables the arrays to be used in the diagnostic / analytical field.

The term “array” denotes an arrangement of defined places, in particular a local assignment of certain substances to defined places, different places being able to be assigned the same or different substances. A defined place corresponds to a certain area, the value of which is advantageously less than an intra-assay variance 15%, preferably less than 7% or an interassay variance of advantageously less than 20%, preferably less than 15% and in particular less than 10%, is subject to two areas with one another compares. A substance type is usually assigned to a place, although it is also conceivable to assign mixtures of two or more substance types to a place. Two-dimensional arrays are preferred. The places expediently form a regular two-dimensional pattern of fields. One field or several fields can be assigned to each substance type or each type of substance mixture within an array.

The term “biochip” refers to an array of biorholules that are covalently, adsorptively, or via other physical / chemical interactions immobilized on a solid support.

The term “biomolecules” denotes any biochemical and biological substances, both as single molecules and as several interacting molecules. Examples include: • nucleic acids, in particular oligonucleic acids, for example single and / or double-stranded, linear, branched or circular DNA, cDNA, RNA, PNA (peptide nucleic acid), LNA (locked nucleic acid), PSNA (phosphothioate nucleic acid);

• Antibodies, in particular human, animal, polyclonal, monoclonal, recombinant, antibody fragments, for example Fab, Fab ', F (ab) ₂ , synthetic; • Proteins, eg allergens, inhibitors, receptors;

Enzymes, e.g. Peroxidases, alkaline phosphatases, glucose oxidase, nucleases;

Small molecules (haptens), e.g. Pesticides, hormones, antibiotics, pharmaceuticals, dyes, synthetic receptors, receptor ligands.

According to another aspect, the term "biomolecule" defines the ability of one

Substance, with a biological sample or a part thereof, in particular the analyte, to be able to enter into a specific analytical interaction.

According to a special aspect, a certain type of biomolecule can be called a ligand. Ligands interact with and in particular bind - preferably specifically - to certain targets.

The biomolecules are coupled to a support surface for immobilization. This can be done in a number of ways. In principle, the surfaces can be functionalized in a suitable manner, for example using epoxides, NHS esters or aldehydes to couple amino-modified biomolecules. A preferred possibility according to the invention is to implement the coupling via certain groups (coupling tion groups) which are reactive with non-functionalized and in particular the carbon-containing surfaces described in more detail below. In this context, groups which can form a bond with hydrocarbon radicals are particularly preferred. Structures which can be activated by radiation are to be mentioned here, such as coumarins, benzofurans, indoles, anglecins, psoralens, groups which can produce carbenes, nitrenes or excited ketones, for example azides, diazo compounds, diazirines, ketones such as diphenyl ketones, benzophenones and acetophenones, and peroxides (cf. also the compounds of the formula I disclosed in EP 0 319 957 A2, which are part of the present disclosure by reference).

According to a preferred embodiment of the invention, the coupling takes place via quinones. On the basis of this embodiment, special configurations of arrays according to the invention will now be described as representative of further useful coupling groups.

Quinones are usually photochemically reactive and can be coupled to carbon-containing materials using suitable radiation. The coupling usually takes place via covalent bonds.

According to the invention, the term "quinone" describes compounds which have at least 2 conjugated carbonyl groups as part of at least one cyclic hydrocarbon structure. The meaning of the term "quinone" is common knowledge. The quinones include, for example, anthraquinones, phenanthrenequinones, benzoquinones, naphthoquinones and other quinones, some of which representatives, which are part of this application by reference, are shown in FIG. 1 of WO 96/31557. Like the coupling groups mentioned above, these quinones can be substituted. A list of useful substituents which are part of this application by reference can be found on pages 11 and 12 of WO 96/31557. Anthraquinones are preferred.

Quinone and biomolecule are linked. In principle, this linkage can be based on any physico-chemical way, in particular covalent and adsorptive interactions, and can take place directly or indirectly, for example via spacers or further at least bifunctional linkers. Quinone derivatives which are at least monosubstituted are expediently used. For example, quinonecarboxylic acid derivatives which are bonded to the biomolecule or optionally to a spacer or other linker via ester and preferably amide bonds are advantageous. In a corresponding manner, a person skilled in the art is able to use quinones to provide other functional groups that can form bonds that are stable under the manufacturing and use conditions of the arrays. Ether, amine, sulfide and disulfide bonds are mentioned here as examples.

In addition, the quinones can carry one or more further substituents. It is thus possible to influence the polarity and thus in particular the solubility and affinity of the quinones, and advantageously to adapt them to certain modalities such as the application of the quinones to the support surface or to the surface material.

The term “quinone derivative” is used below for substances which have at least one quinone structure. These include, for example, functionalized quinones, linkages of quinones with spacers, linkers and / or biomolecules or modified variants thereof, for example activated, protected or in other derivatives prepared for synthetic purposes.

According to one embodiment, quinones are linked directly to biomolecules. This arrangement of quinone derivatives according to the invention is abbreviated to "Q-B" below and is used above all for biomolecules with a relatively high molecular weight, such as antibodies, proteins and enzymes.

According to a further embodiment, quinones are linked to biomolecules via spacers. This arrangement of quinone derivatives according to the invention is referred to below as "Q-S-B" and is used above all for biomolecules with a relatively low molecular weight, such as nucleic acids, in particular oligonucleic acids and haptens.

The term "spacer" denotes multifunctional and in particular bifunctional linkers of a certain length, which in the present case are usually linked to quinone on the one hand and biomolecule on the other hand. In principle, spacers can be homo- or hetero (bi) functional, a hetero (bi) functionality allowing a variation of the functionality which is inherently predetermined by a certain quinone derivative. By choosing suitable heterobifunctional spacers, quinone and biomolecule can be optimally linked to one another, on the one hand to correspond to the type of binding specified by the quinone derivative and, on the other hand, to provide a functionality that enables an effective link, but also one that is particularly gentle on proteins. If the biomolecule is a ligand, the interaction of the biomolecule and the target can be influenced by the type and in particular the length of the spacer. Especially the accessibility of immobilized biomolecules can be optimized for the interaction with the target.

Preferred quinone derivatives are anthraquinon-2-yl derivatives of the formula I.

Phenanthrenchinon-3-yl derivatives of the formula II

where in the formulas I and II the radicals R can be identical or different and independently of one another for the abovementioned substituents and preferably for CC ₄ alkyl, C ₃ -C ₁₀ cycloalkyl, C ₆ -C ₁₀ aryl or C ₇ -C ₁₂ aralkyl, z1 and z2 independently of one another have a value of 0, 1, 2, 3 or 4 and A1 stands for CO, CH ₂ , CS, 0 or S. Z1, z2 are preferably zero and A1 is CO or CH ₂ . Anthraquinone-2-cabonic acid derivatives are particularly preferred. As immobilized biomolecules, these quinone derivatives are linked to at least one biomolecule, optionally via spacers and / or further linkers.

Suitable spacers are, for example, homobifunctional compounds, such as diamines, diacids, e.g. Dicarboxylic acids, or ethylene glycol oligomers, or heterobifunctional compounds, such as amino acids, e.g. β-alanine, glycine, 6-aminocapric acid or aminobutyric acid, arylacetylenes, biotins, avidines, strepavidines, oligosaccharides, e.g. from riboses or deoxyriboses, nucleic acids, especially oligo- (d) A or - (d) T, fatty acids, phosphoric acid esters and derivatives and / or combinations thereof.

Spacers can also be constructed from several parts (linkers) which are linked to one another by covalent and / or non-covalent bonds. Examples of covalently linkable parts of a spacer are heterobifunctional elements, such as amino acids, for example. 6-aminocaproic acid or ^ -aminobutyric acid, several of which are used for Extension of a spacer can be connected. Examples of noncovalently linkable parts of a spacer are molecules between which affinity bonds can form, such as between biotin and avidin or streptavidin or their analogs. Biotin / avidin spacers, avidin / biotin / avidin spacers, anti-biotin antibodies / biotin / avidin spacers or dig / anti-dig spacers are preferred spacers of this aspect.

Spacers can have one or more binding sites for biomolecules (e.g. dendrimers). The above-mentioned heterobifunctional elements, for example, generally have one, two or three such binding sites, while molecules that form affinity bonds, such as avidin or streptavidin, have several binding sites. The latter can lead to an advantageous increase in immobilized biomolecules per unit area.

Spacers can also have variable binding sites that offer different binding options depending on their respective configuration. This applies in particular to affinity bonds, the binding affinity of which can vary depending on the configuration of the binding partners involved.

Preferred spacers are based on diamines of the formula III

-NH- (CHR ¹ ) _n1 -NH- (III)

Amino acids of formula IV

-NH- (CHR ¹ ) m-CO- (IV)

Polyethylene glycols of the formula V

- (OCH ₂ CH ₂ ) _n2 - (V)

Oligo sugarphosphate of the formula VI

- (O-PO ₂ -O-5'-sugar-3 ') _n1 -O-PO ₂ - (VI)

or combinations thereof, in particular -NH- (CHR ¹ ) _π1 -NH- (OCH ₂ CH ₂ ) _n2 - (VII)

where in the formulas III to VII n1 corresponds to a value from 1 to 50 and in particular from 5 to 20 and n2 corresponds to a value from 2 to 100 and preferably 5 to 50, R ^{1 has} the meanings given for R, with several radicals R ¹ can be the same or different (for n1 ≠ 1) and the sugar is in particular ribose and deoxyribose, preferably in the D form. In combination, n1 corresponds in particular to a value from 2 to 6 and preferably from 3 while n2 corresponds in particular to a value from 2 to 20, preferably 4 to 10, for example 6. R ^{1 is} preferably α-C substituent of naturally occurring amino acids, in particular hydrogen and C 1 -C ₄ -alkyl. In principle, the linkage to the quinone can take place at both binding sites (QS or -SQ), according to the above illustration, QS derivatives are preferred.

In principle, the above applies to the binding of quinones or spacers to biomolecules

Corresponding explanations for the binding of quinones to spacers. Covalent bonds, especially -O-, -NH- or -S-, are preferred.

Biomolecules can specify certain functionalities for this, but they can also be modified appropriately. For example, proteins via amino, sulfide or

Carboxy groups, and bind nucleic acids via 5'- or 3'-OH groups. For example, proteins can be reductively modified in a manner known per se in order to convert disulfide bridges into free sulfide groups, and nucleic acids can be reacted for example with known and also commercially available reagents in order to convert terminal OH groups into groups having amino groups.

According to a preferred embodiment, nucleic acids are bound to quinone or spacers via their respective 5 'ends. This can advantageously be done via polyethylene spacers, in particular the spacers of formula VII.

In addition to immobilized biomolecules, other substances that do not contain a biomolecule in the sense of the invention can be immobilized on the carbon-containing surface. These can be immobilized (co-immobilized) in one place at the array's own locations or together with biomolecules in a statistical distribution.

Such molecules are expediently also coupled to the support surface via quinones. In principle, quinones and quinone derivatives that can be used derive from the respective immobilized biomolecules, but do not themselves contain a biomolecule in the sense of the invention. These include in particular quinone derivatives, in particular functionalized quinones (Q), which are optionally linked to spacers (QS) and / or further groups. Suitable further groups (B ') can in particular be derived from immobilized biomolecules, for example analogs or parts of a biomolecule which are unable to interact with a biological sample, in particular an analyte, which the corresponding biomolecule is capable of , For example, the part of a biomolecule can be a nucleotide, dinucleotide or trinucleotide that cannot hybridize with the nucleic acids present in the biological sample, while the biomolecule is an oligonucleotide that is capable of doing so.

In principle, more than 60, 100, 600, 1000, 5000, 10000, 40000, 100000, 400000 or 1000000 defined places can be arranged on an array per cm ² carrier surface. As a rule, arrays according to the invention have 5-10000 spaces / mm ² . A special embodiment is arrays with 5 to 100 places / mm ² and in particular 10 to 50 places / mm ² (low density). Another special embodiment is arrays with 100-10000 spaces / mm ² and in particular 500-2500 spaces / mm ² (high density). The same or different quinone derivatives, sometimes different biomolecules, can be immobilized in different places.

The purpose of the arrangement described above using co-immobilized quinone derivatives is to provide sites with defined densities of immobilized biomolecules. According to the invention, densities are achieved in this way that are smaller than the value that corresponds to a maximum occupancy of immobilizable molecules per unit area. In the case of a total of x quinones or quinone derivatives (xy) coupled to a surface unit, arrangements according to the invention can have immobilized biomolecules, y being the number of co-immobilized quinone derivatives. The value x preferably corresponds to the maximum number of quinones that can be coupled to a surface unit (degree of saturation), ie preferred arrays have fields of immobilized biomolecules whose surface is saturated with respect to the coupling of the quinone derivatives used. The proportion of immobilized biomolecules (xy / x) is advantageously at least 0.001, preferably at least 0.1. and in particular at least 0.75. In certain cases, the proportion can advantageously be less than 1, preferably less than 0.75 and in particular less than 0.5. According to a special embodiment, arrays according to the invention contain at least 2 places with biomolecules of the same type immobilized in different densities. In the form of standard series, internal calibration can thus be made possible.

According to an advantageous embodiment, a site of immobilized biomolecules contains a label which is proportional to the amount of coupled quinone derivatives. The purpose of this configuration is to be able to assess the immobilized biomolecules, in particular with regard to the amount and distribution of the immobilized biomolecules.

For this, immobilized biomolecules and / or co-immobilized quinone derivatives can be labeled. The spacers are preferably marked.

Basically all types of marking are suitable. The marking is preferably selected such that it does not interfere with the subsequent analysis, or interferes only minimally, so that it does not influence the use of the arrays or only to an insignificant extent. For this purpose, any necessary markings of the sample, in particular of nucleic acid targets, must be observed. On the other hand, the marking can be chosen so that it interacts with the marking of the sample. The signal emanating from interacting markings can be distinguishable from that emanating from the corresponding non-interacting markings. The interaction can affect the signal intensity, e.g. amplify or quench, or modify the signal, e.g. change the wavelength of absorbed or emitted light.

Marking systems which can be recognized, for example, spectroscopically, photochemically, biochemically, immunochemically, electrically, optically or chemically are suitable according to the invention. These include direct labeling systems such as radioactive markers (e.g. ³² P, ³ H, ¹²⁵ l, ³⁵ S, ¹ C), magnetic markers, chromophores, for example UV, VIS or IR absorbing compounds, fluorophores, chemical or bioluminescent

Markers, transition metals, which are generally chelate-bound, or enzymes, e.g. horseradish peroxidase or alkaline phosphatase and the detection reactions linked to them, as well as indirect labeling systems, for example haptens, such as biotin or digoxigenin, which can be recognized by appropriate detection systems. Favorable chromophores have an intense color that is only slightly absorbed by the surrounding molecules. Dye classes such as quinolines, triarylmethanes, acridines, alizarines, phthaleins, azo compounds, anthraquinones, cyanines, phenazathionium compounds or phenazoxonium compounds are to be mentioned here as representative of the broad spectrum of chromophores suitable according to the invention.

Fluorescent labels are preferred. You get strong signals with little background, high resolution and high sensitivity. It is advantageous according to the invention that one and the same fluorophore, depending on the excitation and detection principle, can emit several distinguishable radiations.

Fluorophores can be used alone or in combination with a quencher (e.g. molecular beacons).

Preferred fluorophores are, for example, aminomethylcoumarin acetic acid (AMCA, blue), EDANS, BODIPY 493/503; FL; FL Br2; R6G; 530/550; 558/568; TMR 542/574; TR 589/617; 630/650; 650/665, 6-FAM Fluorescein (green), 6-OREGON green 488, TET, Cy3 (red), Rhodamine (red), 6-JOE, HEX, 5-TAMRA, NED, 6-ROX, TEXAS Red7 (red ), Cy5, Cy5.5, LaJolla Blue, Cy7, Alexa fluorocarboxylic acids, in particular of the type 647 and 532, for example as succinimidyl ester, and IRD41.

Particularly preferred fluorophores are Cy5, 5-Tamra and Cy3 as well as Alexa fluorocarboxylic acids.

The exemplary list above illustrates that a large number of distinguishable markings are available, so that an appropriate ratio of markings of the immobilized molecules on the one hand and, if necessary, the sample on the other hand can be realized.

Cycloolefin-based polymers are known per se. One or more of the following properties are appropriate:

a relatively low total surface energy, which is in particular lower than, for example, that of polymethyl methacrylate (PMMA) and is preferably in a range from 25 to 35 mN / m and more preferably in a range from 28 to 32 mN / m. A relatively small polar component is particularly advantageous here. The ratio of the dispersive component to the polar component according to the OWRK method advantageously at least 2: 1, preferably 3: 1 and particularly preferably at least 4: 1;

- a relatively low surface roughness. Rms roughnesses of less than 1.5 nm and preferably less than 1.0 nm are advantageous by means of atomic force microscopy (AFM). The rms roughness is advantageously in a range from 0.6 to 0.8 nm;

a relatively high transmission, advantageously at least 85% and preferably at least 90% transmissions at λ = 400 nm and / or λ = 800 nm (to be determined by means of UV-VIS spectrophotometry); a relatively low reflection, advantageously less than 10% and preferably less than 9% reflection at λ = 400 nm and / or λ = 800 nm (to be determined by means of UV-VIS spectrophotometry);

a relatively low water absorption, which is advantageously less than 0.01% by weight (ASTM D570); - a relatively low proportion of foreign particles. It is advantageous here if the content of foreign particles with a diameter of 0.5 μm or more is less than 10 ⁵ particles / g and preferably less than 5 × 10 ⁴ particles / g;

- A relatively low intrinsic fluorescence, which is conveniently similar to that of Pyrex glass.

For example, reference is made here to the polycycloolefins (polymers and copolymers) described in EP 0 591 892, US 5,008,356, US 5,087,677, WO 97/46617, EP 0 713 893, EP 0 827 975, EP 0 997482, which are part of this application ,

Preferred representatives of this group are based on structural units of the formula VIII

where the radicals R ² , R ³ , R ⁴ , R ^{5 may be the} same or different and independently of one another for hydrogen, halogen, hydroxy, cyano, or - optionally single, double, triple, quadruple or quintuple with halogen, cyano or alkyl - substituted alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl, alkoxy, alkoxycarbonyl, alkanoyloxy, aryl or aralkyl, or R ² together with R ³ or R ⁴ together with R ^{5 represent} optionally substituted alkylidene in the manner described above, or 2 or more of the radicals R ² , R ³ , R ⁴ , R ^{5 is} a double bond or with the corresponding modification cation of the aforementioned monovalent radicals, form a ring or more rings, in particular cycloaliphatic rings, which in turn can be substituted with monovalent radicals of the type R ² , R ³ , R ⁴ , R ⁵ . The symbol - stands for a carbon single bond or double bond.

Unless stated otherwise, "alk" or "alk" primarily stands for hydrocarbon radicals with 1 to 15 carbon atoms, and "aryl" primarily for aromatics with 6 to 10 hydrocarbon radicals, in particular for phenyl and naphthyl.

Preferred polymers of this type are based on structural units of the formula IX

where R ⁶ to R ¹³ independently of one another have the meanings given above for R ¹ to R ⁴ . R ⁸ to R ⁹ are preferably independently of one another hydrogen, C Ce alkyl or CrC ₆ alkylidene, or 2 or more of the radicals R ⁶ to R ⁹ together form a cyclohexane ring, cyclopentane ring, norbornene ring or benzene ring. These are also the preferred meanings of R ¹⁰ to R ¹³ .

The polymers described above can be referred to as ring opening polymers or copolymers. They are available from monomers of the formula X

wherein R ² to R ^{5 have} the meanings given above, and optionally further comonomers by ring opening polymerization or copolymerization and, if appropriate, subsequent hydrogenation. Preferred representatives of these polymers are obtainable from monomers of the formula XI

wherein R to R have the meanings given above, and / or

Monomers of formula XII

where R to R have the meanings given above,

and optionally other comonomers in a corresponding manner.

Further preferred representatives of polymers based on cycloolefin are based on structural units of the formula XIII

wherein R ² to R ^{5 have} the meanings given above and R ⁴ , R ^{15 may be the} same or different and are independently hydrogen, alkyl or aryl.

Preferred polymers of this type are based on structural units of the formula

wherein R ⁶ to R ^{13 have} the meanings given above. R ¹⁴ , R ¹⁵ are preferably hydrogen, C 1 -C ₆ -alkyl or C ₆ -C ₁₀ aryl, in particular hydrogen.

These polymers can be referred to as addition polymers or copolymers. They can be obtained by addition polymerization or copolymerization of at least one cycloolefin monomer of the formula X, preferably at least one cycloolefin polymer of the formula XI and / or at least one cycloolefin monomer of the formula XII with a monomer of the formula XV

where R ¹⁴ , R ^{15 have} the meanings given above,

and optionally other comonomers.

Specific examples of monomers of the formula X are in EP 0 827 975 A2 on pages 6, line 41 to page 8, line 21, in EP 0 997 482 A1 on page 4, lines 24-49, in EP 0 713 893 A1 in column 3, line 39 to column 5, line 2 and in US Pat. No. 5,008,356 in column 6, line 37-67 and in tables 1 and 2. Reference is made in full to these statements, with which these monomers are also part of this application.

Specific examples of the monomers of the formula XV are given in EP 0 827 975 A2 on pages 10, line 54 to page 11, line 3, and in EP 0 997 482 A1 on page 4, lines 55-58. Reference is also made in full to these statements, with which these monomers are also part of this application.

Preference is given to polycycloolefins which are obtainable from norbornene derivatives, i.e. in particular norbornene and the above information correspondingly substituted norbornene derivatives.

A particular embodiment of cycloolefin-based polymers which can be used according to the invention are obtainable by addition polymerization of vinyl compounds of the formula XV, in particular ethylene, with a) norbornene monomers, in particular norbornene, tetracyclododecene or dicyclopentadiene;

b) monocycloolefin monomers, especially cyclopentene or cyclohexene; or

c) Cyclic conjugated diene monomers, in particular cyclopentadiene or cyclohexadiene.

Such addition polymers can be obtained, for example, by the process described in US Pat. No. 5,087,677.

Another particular embodiment of cycloolefin-based polymers which can be used according to the invention are obtainable by ring-opening polymerization of norbornene derivatives and subsequent hydrogenation of the double bonds remaining after polymerization. If the norbornene derivatives used are substituted with aromatic groups or if they have polycyclic structures with norbornene and aromatic structural elements, it is advantageous if at least 90% of the unsaturated bonds of the polymer main chain are hydrogenated while at least 80% of the aromatic structures are obtained.

Such ring opening polymers can be obtained, for example, by the process described in EP 0 713 893 A1.

An addition polymer made of norbornene and ethylene is sold, for example, by the Hoechst company under the trade name Topas®. Other commercially available

Cycloolefin-based polymers, for example, carry the trade names Zeonex®, in particular Zeonex®480 R and Zeonex®480, and are available from Zeon.

If the carrier surface contains at least one cycloolefin-based polymer, it can additionally contain further polymers, in particular polyolefins. A preferred one

Embodiment of carbon-containing surfaces consists essentially of a polymer based on cycloolefin or a mixture of several polymers based on cycloolefin.

The carrier can be made of a uniform material. This is particularly preferred for supports with a polycycloolefin surface. However, supports made of different materials are also possible, for example those with an inventive one Surface is applied to other substrates. In principle, the carbon-containing surfaces according to the invention can be applied to any usable carrier materials. For example, the following materials can be used as carrier material: glass (standard glass, pyrex glass, quartz glass), plastics preferably high purity or low intrinsic fluorescence (such as polyolefins, e.g. PE (polyethylene), PP (polypropylene), polymethylpentene, polystyrene, PMMA (poly ( methyl methacrylate)), polycarbonate, Teflon), metals (such as gold, chrome, copper, titanium, silicon), oxidic materials (ceramics, aluminum-doped zinc oxide (TCO), silica, aluminum oxide).

As an alternative to the above-described carbon-containing surfaces based on polycycloolefin, surfaces according to the invention can be obtained by treating glass, metal or ceramic surfaces with an aqueous solution of at least one hydrolyzable carbon-containing compound and drying the surface.

Appropriate configurations of this procedure are based primarily on the regulations for sol-gel processes (see, for example, DE 44 08 152 A1; DE 38 87 074 T2; CJ Brinker, GW Scherer, Sol-Gel-Science: The Physics and Chemistry of Sol-Gel Processing, Academic Press, San Diego 1990.

Suitable hydrolyzable carbon-containing compounds are based primarily on

Elements M of the main groups III to V and the subgroups II to IV of the periodic table of the elements, in particular Si, Al, B, Pb, Sn, Ti, Zr, V and Zn, of which Si, Al, Ti and Zr and in particular Si are preferred are. These compounds have at least one hydrolyzable group A and at least one non-hydrolyzable carbon-containing group B. As a rule, the molar ratio of groups A to groups B in the compounds can be 10: 1 to 1: 2.

Hydrolyzable groups A include groups which are split off by the action of water - if appropriate under acidic or basic catalysis - and thereby generate groups in the sense of the sol-gel process which work with one another and with suitable groups on the glass, metal or ceramic surface can react to form bonds (condensation). Useful hydrolyzable groups are therefore primarily halogens, in particular Cl and Br, and alkoxy groups, in particular Alkoxy groups, aryloxy groups, especially C _6-10 aryloxy groups, acyloxy groups, especially CC ₄ acyloxy groups, and alkylcarbonyl groups, especially C _1- alkylcarbonyl groups. Preferred groups are Cl, methoxy, ethoxy, n-propoxy, i-propoxy, butoxy, phenoxy, acetoxy, propionyloxy and acetyl. At least one non-hydrolyzable carbon-containing group B is expediently able to couple to quinones. Such groups B are derived primarily from aliphatic, heteroaliphatic, cycloaliphatic, cycloheteroaliphatic or aromatic radicals. These include, in particular, alkyl groups, in particular CrC o -alkyl groups, cycloalkyl groups, in particular C ₃ -C ₁₀ -cycloalkyl groups, cycloalkylalkyl groups, in particular C ₃ -C ₁₀ -cycloalkyl-C ₆ -C ₆ -alkyl groups, alkenyl groups, in particular C ₂ -C ₃₀ alkenyl groups, aryl groups, in particular C ₆ -C ₁₂ aryl groups, aralkyl groups, in particular C ₇ -C ₁₀ aralkyl groups, these groups being substituted one or more times by alkyl, in particular CC alkyl, alkoxy, in particular CC ₄ alkoxy and halogen could be. Hydrolyzable carbon-containing compounds having at least one aliphatic or cycloaliphatic group B having 3 to 20 carbon atoms, preferably 3 to 16 carbon atoms, are preferred.

A particularly preferred class of hydrolyzable carbon-containing compounds are the silanes of the formula XVIa

the radicals R ¹⁶ , which may be the same or different, independently of one another represent a group A and preferably halogen, in particular Cl or Br, CC ₄ alkoxy, in particular methoxy and ethoxy, CC ₄ acyloxy, in particular acetyloxy and the radicals R ¹⁷ , which can be the same or different, independently of one another for a group B and preferably for GrOso-alky! or C ₃ -C ₀ cycloalkyl, in particular cyclohexyl, and z corresponds to a value of 1, 2 or 3.

Particular mention may be dihalosilanes as Dichlormethylcyclohexylsilan, halo gensilane as phenyldimethylchlorosilane, trialkoxysilanes such as phenyltriethoxysilane, trihalo gensilane such as (2-phenylethyl) trichlorosilane, dialkoxysilanes such Dimethoxymethylcyclohe- xylsilan and (C ₃ -C ₁₆ alkyl) _n - (C ₁ -C ₄ -alkoxy) _m - (chloro) _r silanes, where n, m and I independently of one another have a value of 0, 1, 2 or 3 and the sum of n, m and I is 4.

Disilanes of the formula (XVIb) can also be used

(R ¹⁷ ) z (R ¹⁶ ) _4-z Si-R ¹⁹ -Si (R ¹⁶ ) _4-z (R ⁷ ) _z (XVIb) in which R ¹⁶ , R ¹⁷ and z have the meanings given above and a plurality of radicals R ¹⁶ and R ^{17 can be the} same or different and also the variables z can have the same or different meanings for the two Si atoms, and the radical R ¹⁹ for alkylene, in particular C 1 -C ₆ -alkylene, cycloalkylene, in particular C ₃ -C ₁₀ -

Cycloalkylene.Arylene, in particular phenylene or biphenylene, or O, where alkylene can be interrupted 1, 2, 3 or more times by a group which is selected from 0, S, CO and CS. These include e.g. To (dialkoxy) silanes.

These compounds can be prepared in a manner known per se and some can also be obtained commercially.

These compounds are at least partially hydrolyzed in the aqueous solution to be used according to the invention. They preferably form a colloidal solution. In particular, lyosols and especially hydrosols are used. As a rule, these are disperse systems.

Useful aqueous solutions are based on water and can contain additional further solvents, in particular lower alcohols, such as methanol, ethanol and isopropanol, ketones such as acetone, ethers such as diethyl ether, sulfoxides such as DMSO and other water-miscible solvents. The water content, based on the total weight of solvent, is at least 30%, preferably at least 50% and in particular at least 80%.

According to a particular embodiment, aqueous solutions are used which contain enough water to hydrolyze more than 10, preferably more than 20 and in particular more than 40%, advantageously 10 to 99%, preferably 25 to 75%, in particular about 50% of all hydrolyzable groups are. In the acidic process variant, the pH of the solution is generally below 7, preferably 2 to 5 and in particular 3 to 4 and can be mixed with suitable acids, e.g. Hydrochloric acid or acetic acid, also as an aqueous solution. On the other hand, one can also hydrolyze under basic conditions, e.g. by adding ammonium and alkali metal hydroxides.

The solutions to be used contain at least one hydrolyzable carbon-containing compound. The solution can also contain other hydrolyzable compounds of a similar type as an admixture, for example for crosslinking. To be mentioned here in particular tetraalkoxysilanes, bis (trialkoxy) silanes and oligomeric and polymeric dialkylsiloxanes.

Before the glass, metal or ceramic surface to be treated is brought into contact with the aqueous solution of the hydrolyzable carbon-containing compound, it is advantageous to clean the surface. This can be done in a manner known per se, e.g. with degreasing agents, e.g. Isopropanol and / or diethyl ether, and / or ultrasound.

The surface is preferably coated with the aqueous solution. For this purpose, customary coating methods can be used, for example dipping, flooding, drawing, pouring, spinning, spraying or painting. Diving is preferred. This process is carried out and optimized by a specialist.

The surface and the aqueous solution of the hydrolyzable carbon-containing compound in contact with it are then heated. Solvent evaporates and the coating hardens.

In this context, drying means the removal of solvents, especially water. At least part of the solvent is removed. The substantially complete removal of water is advantageous. Drying can be supported by heating. The heating is usually carried out at temperatures in a range from 20 to 500 ° C. and preferably 50 ° C. to 200 ° C.

The cured layers usually have thicknesses in the range between 2 μm and 30 μm. Layer thicknesses in the range from 2 to 10 μm and in particular from 2 to 5 μm are preferred.

This technique can be used to treat carrier materials which have functional groups which can condense with the hydrolyzed carbon-containing compound.

The carbon-containing surfaces according to the invention are notable for their low roughness. The R _a value is advantageously less than 0.5 μm, preferably less than 0.2 μm and in particular less than 0.1 μm. The carbon-containing surfaces according to the invention also show a pronounced water-repellent behavior. The contact angle is advantageously more than 60 °, preferably more than 70 ° and in particular more than 80 °.

According to a special embodiment, parts of the carrier surface of arrays according to the invention have further coatings to which no quinones are coupled. Metals, e.g. copper, titanium, chromium, gold and especially platinum, or polymers are particularly suitable. Such coatings expediently provide a surface structuring, according to which the places where biomolecules are immobilized do not have such a coating, while the parts of the surface with such a coating have no immobilized biomolecules. Such arrays can advantageously have a more precise coupling of quinones on defined areas.

The present invention also relates to supports in the sense of a preliminary product, the surfaces of which are partially covered with appropriate materials. Carriers with a structured coating (pre-structuring) are preferred, recesses in the coating specifying defined locations (array) on which biomolecules can subsequently be immobilized.

Carriers in the sense of the invention are generally materials with a rigid or semi-rigid surface and in this sense can be described as solid. Planar surfaces are common. In certain cases, however, it can be advantageous to use profiled beams. Elevations and depressions such as steps, grooves, channels, notches, for example V-notches or mesa structures are possible. These structures can be arranged on the surface in such a way that they appropriately influence the immobilization of the biomolecules. In the case of light-controlled coupling, for example, incident light can be influenced in a targeted manner by structures of the support surface of this type, for example mirrored and even focused, channels can be used to guide liquid. At least parts of the surface of such carriers correspond to the specifications according to the invention.

The shape of a carrier can be varied and depends primarily on the type of use of the carrier to be described. For example, slides, microtiter plates, tubes, chips, dipsticks, stamps, caps, particles, strands, in particular fiber bundles, spherical bodies such as spheres or spheres, precipitation products, membranes, gels, sheets, containers, capillaries, disks, foils or trade plates. Wafer formats can also serve as supports, which can be separated if desired. The carriers can also be provided with further useful components, for example chips can be encapsulated. According to a particular embodiment, a body, in particular in the form of a dipstick, is provided with a closure means, for example a snap or screw cap, which, when placed on a suitable container, in particular an incubation vessel, contains the biomolecules immobilized on the body with a sample fluid in the container can bring in contact. The body is preferably in the form of a stick, at one end of which the closure means and at the other end of which the biomolecules are expediently immobilized. At least part of the surface of the body thus complies with the requirements of the invention. Conveniently, the body can be formed from the polymer based on polycycloolefin or a suitable composite material with corresponding surface parts. Furthermore, a plurality of dipsticks can also be connected to one another, also in accordance with the embodiment explained above.

The surface of the carrier available for the coupling can have customary dimensions. This surface and thus the array is preferably smaller than 1 cm ² and in particular smaller than 0.5 cm ² .

The locations at which biomolecules are immobilized, in particular fields of immobilized biomolecules, can have different geometries. In principle, the shape can be any, for example circular, rectangular, square or elliptical. The area is preferably less than 1 mm ² , in particular less than 10,000 m ² , and very particularly preferably less than 1000 μm ² .

According to a particular embodiment of the invention, biomolecules are immobilized as spots, i.e. as essentially circular fields. Such spots preferably have diameters in a range from 1 μm to 1000 μm, in particular 5 μm to 20 μm or 50 μm to 500 μm. In particular, spots with diameters below 200 μm and especially below 20 μm can advantageously be realized with the pre-structuring described above.

According to a preferred embodiment of arrays according to the invention, the biomolecules are nucleic acids, in particular oligonucleotides with a length of 2 to 500 bases. As a rule, the immobilized oligonucleotides are able to bind to a target nucleic acid. In this sense, the immobilized oligonucleotides are also referred to as probes. The probes are usually single-stranded oligomers. DNA, RNA and nucleic acid analogs and derivatives, such as, optionally modified, PNA, LNA and PSNA as well as modified DNA or RNA can be used. The minimum length of the probes depends on the complexity of the sample, in particular the number of bases of nucleic acids to be detected, but also on the type of nucleic acid used as the probe and the thermodynamic stability that can be achieved between the sample and the probe.

Depending on the nucleic acid type, probes usually have a length of 8 to 60, preferably 13 to 25 and in particular 13 bases for DNA, 8 to 60, preferably 13 to 25 and in particular 13 bases for DNA-LNA hybrids, 8 to 60, preferably from 13 to 25 and in particular from 13 bases for PSNA, from 6 to 30, preferably from 8 to 18 and in particular from 9 bases for LNA, and from 6 to 18, preferably from 8 to 18 and in particular from 9 bases for PNA on.

With relatively low complexity of the nucleic acids to be detected, e.g. Amplificates, in particular PCR amplificates, viruses, plasmids and microorganisms, in particular for applications such as the detection of mutations, SNPs or methylations (epigenetics), are relatively short probes, for example in the range of 8-25 and especially 8-15 years, useful , With relatively high complexity of the nucleic acids to be detected, e.g. unamplified RNA; Longer probes, for example in the range of 16-60 mer and in particular 25-50 mer for synthetic probes, are expedient for cDNA of total amplified RNA, unamplified total genomic DNA and amplified total genomic DNA, in particular for applications such as gene expression determinations or the detection of genomic amplifications or deletions or the probes consist of PCR products, cDNA, plasmids or DNA from lysed bacteria, which can also have a number of bases beyond this.

The base sequence of the probes depends primarily on their function. A test probe generally has a base sequence which is complementary to a specific target sequence of a nucleic acid to be detected or which, according to another aspect, can hybridize specifically with the target sequence. A control probe can in particular have the function of a normalization, mismatch, housekeeping, sample preparation, hybridization or amplification control and accordingly have a base sequence which is complementary to a base sequence of a reference nucleic acid, a nucleic acid to be detected and the like Base sequence, a constitutively expressed nucleic acid, for example one of the ß ₂ microglobulin, ß-actin, GAPDH, PBGD, ubiquitin, tubulin or transferrin receptor gene derived nucleic acid, a species-specific nucleic acid or an amplificate.

The present invention also relates to a process for immobilizing biomolecules, a) wherein at least one derivative of a coupling group, preferably a quinone derivative, is applied to a support with a carbon-containing surface, exposed and, if necessary, the immobilized derivatives are converted into the biomolecules, the process thereby characterized in that at least one polycycloolefin is used as the carbon-containing surface; or b) wherein a carrier surface is treated with at least one hydrolyzable carbon-containing compound, at least one derivative of a coupling group, preferably a quinone derivative, is applied to the carbon-containing carrier surface, exposed and, if necessary, the immobilized derivatives are converted into the biomolecules, the method being characterized in that an aqueous solution of the hydrolyzable carbon-containing compound is used.

Embodiments of this subject according to the invention are also described on the basis of the preferred embodiment directed towards quinones, representative of other suitable coupling groups.

Exposure is carried out to couple the quinone to the carbon-containing surface. Exposure here means the irradiation of electromagnetic radiation for the purpose of quinone activation. It should be a non-ionizing radiation, the wavelength of which is usually in the UV-VIS range. The radiation should interact as little as possible with other functional groups of the quinone derivatives. For practical reasons, incoherent continuous light is usually used. Monochromatic, polarized, pulsed or coherent light can also be used. Suitable light sources are known and can usually be obtained commercially.

The exposure time is measured by an effective coupling of the quinones to the carbon-containing surface with minimal decomposition of the quinone derivative. The exposure time is usually less than 200 minutes. Exposure times of less than 60 minutes, especially less than 10 minutes and in particular less than 5 minutes, are preferred. This procedure has the advantage that the surface does not have to be activated before the coupling, as is customary by chemical modification, and consequently there is also no need for splitting off the protective groups that are normally required.

The quinone derivative to be applied is based on at least one functionalized one

Quinone structure and can have spacers and / or biomolecules or derivatives or parts thereof. For example, functionalities on spacers and / or biomolecules can have suitable protective or activation groups.

The resulting procedures for immobilizing biomolecules can basically be differentiated into one variant in which the biomolecule is present during the quinone coupling and another variant in which the biomolecule is only added to an already immobilized quinone derivative after the quinone coupling has taken place. The variant to be selected in the individual case depends on the type of biomolecule and its synthesis.

For example, it may be appropriate to first bind the functionalized quinone to the biomolecule, optionally with the interposition of a spacer, and then to couple this prefabricated construct to the carbon-containing surface. This variant has the advantage that the prefabricated constructs as a substance

- if necessary after appropriate purification and advantageously characterized - can be essentially homogeneous, so that the quality of the resulting array is determined primarily by the coupling reaction. Here, the present invention in turn offers advantageous configurations which, on the one hand, contribute to an effective and reproducible coupling, and on the other hand enable the coupling result and thus the array to be checked.

According to a preferred embodiment of the present method, prefabricated constructs containing quinone and biomolecule or derivatives thereof are therefore applied (if appropriate using spacers and other linkers) to the carbon-containing surface and exposed. If necessary, the immobilized constructs can be converted into the desired biomolecules, but this is generally not necessary. This embodiment is primarily used for nucleic acids and in particular oligonucleotides.

For this purpose, the nucleic acid is first provided in a manner known per se. Oligonucleotides can be conveniently synthesized using solid phase methods such as phosphate diester coupling or phosphoramidite method can be synthesized. Suitable peptide synthesis systems are used for PNAs. Another possibility uses nucleic acids of natural origin as a template for generating nucleic acids suitable according to the invention, for example in the form of cDNA, ccDNA, RNA or cRNA. Amplicons, in particular PCR products, are to be mentioned here in particular.

For binding to functionalized quinone or spacer, the nucleic acid must be modified if necessary at a suitable point, for example by reaction with amino modifiers or biotin analogs, such as e.g. activatable arylazide derivatives of biotin. Binding at the 5 'end of the nucleic acid is preferred.

The quinone is preferably reacted as a carboxylic acid or reactive acyl derivative, for example as a carboxylic acid halide, with suitable spacers, biomolecules or spacer-biomolecule constructs or suitable derivatives thereof. This implementation takes place in a manner known per se, depending on the type of binding to be implemented. Spacers can also be built up step by step, for example by successively adding the individual linkers and finally the biomolecule (s) starting from the functionalized quinone, or by implementing the functionalized quinone with one or more linkers and the biomolecule with one or more linkers and then assembling the resulting constructs. If amplificates, in particular PCR products, are to be immobilized, the primers to be used can first be derivatized with the quinone, optionally with the interposition of spacers. The amplificate then already has the quinone and can usually be coupled directly to the surface.

In certain cases, however, it may be necessary and also expedient that the biomolecule is not present during the quinone coupling. This is particularly useful when the coupling conditions affect the biomolecule. Another case relates to the possibility of successively synthesizing the biomolecules following the coupling, starting from the immobilized quinone derivatives.

In principle, the methods known to be used in the solid-phase synthesis of nucleic acids and peptides can be used for this purpose. If different biomolecules, especially oligonucleotides and peptides with different sequences are to be synthesized in parallel, only those oligomers can be deprotected by means of photoactivatable protective groups and selective irradiation, which are then to be provided with a specific additional building block. The selective Irradiation is usually carried out using suitable lithographic masks. For further explanation, reference is made here to the basic explanations in US Pat. No. 5,744,305.

As a rule, the quinone derivative is applied in solution to the carbon-containing carrier surface. Suitable solvents should be compatible with the quinone derivative and especially the photo-activated quinone derivative. In addition, it is advantageous that the quinone derivatives have been uniformly distributed on the surface before the solvent has evaporated. There is preferably a homogeneous distribution of the quinone derivatives on the treated surface, it being particularly preferred that the treated surface is saturated with quinone derivatives.

In principle, aqueous and organic solvents can be used. Aqueous solvents are preferred. These can contain organic solvents. The proportion of organic solvents is preferably less than 10% by volume and in particular less than 5% by volume. Suitable organic solvents include lower alcohols such as methanol, ethanol and 1-propanol, ketones such as acetone, ethers such as diethyl ether, sulfoxides such as DMSO and other water-miscible solvents. Aqueous solutions with a propanol content of about 1 to 10% by volume, in particular about 5%, have proven to be expedient.

According to a preferred embodiment of the method according to the invention, a hygroscopic salt is added to the solution to be applied. Calcium chloride is preferred. It has proven expedient to add the hygroscopic salt in the mM range, preferably about 0.1 mM to 200 mM, preferably 1 mM to 50 mM and in particular about 50 mM.

In principle, all techniques are suitable for applying the quinone derivatives, which allow a defined and reproducible delivery of a certain amount of liquid. For example, techniques such as pipetting, dispensing, printing, stamping can be used.

Non-contact methods such as piezo dispensers and pressure pulse dispensers can be used, for example. The control of temperature and relative air humidity to avoid satellite spots has proven to be useful here. In the case of inert plastics in particular, the grounding of the carrier material is useful for dissipating electrostatic charge. Contacting methods, such as capillary dispensers (cf. for example PCT / DE 00/03447), which apply the liquid with a thin capillary, for example with an inner diameter of 1.5 to 5 μm, and the so-called pin and ring Technology. The polarity of the medium to be dispensed can be used to ensure optimal tear-off, for example by adding salt or solvents such as ethanol or 1-propanol.

The amount of liquid dispensed is important because it determines the area on which the biomolecules are immobilized, in particular the spot size. As a rule, amounts of liquid in the femto to nanoliter range are applied. For example, spots with a diameter of approximately 150 to 200 μm are available with a contact-free amount of approximately 0.5 nl to 1.5 nl. Spots with diameters in the range of 10 μm can be created by applying amounts of approximately 1 pl using capillary dispensers.

According to a particularly advantageous embodiment, the device used to apply the liquid, in particular a dispenser, e.g. Piezo-dispenser, between the application or dispensing of two different fluids, for example liquids containing different probes, rinsed with sodium hydroxide. Expedient rinsing times are in a range from a few seconds to a few minutes, preferably around 10 to 60 seconds. An approximately 0.1 normal aqueous solution of sodium hydroxide has been found to be suitable. This procedure leads to decisive advantages, particularly in the case of dispensers with polar surfaces, such as glass capillaries, quartz, silicon, metals or metal oxide coatings. In particular, this can improve the quality of the arrays, which is reflected in better stringency and / or fewer false positive signals.

According to a particular embodiment of the method according to the invention, the quinone derivatives are applied to a pre-structured surface. For this purpose, parts of the surface are treated in such a way that quinone derivatives essentially do not couple to the treated surfaces. For example, parts of the surface can be coated with materials that do not essentially react with the quinone derivatives under the coupling conditions. These primarily include metals such as chromium, copper, titanium, platinum, gold and the like, other inorganic materials such as glasses or ceramics, and organic materials, including polymers. Plasma treatment of the surface, for example with argon plasma, is also suitable. According to a preferred embodiment of this embodiment, a metal layer, preferably a platinum or chrome layer, is first applied to the carbon-containing surface. This can be done in a manner known per se, for example the metal can be sputtered or vapor-deposited. The parts of the applied layer are then removed again and the parts of the carbon-containing surface are exposed again on which biomolecules are to be immobilized. Parts of the metal layer can also be removed in a manner known per se. For example, a photoresist conventionally used for this purpose can be applied, exposed through a suitable mask, usually a photolithographic mask, at the points at which the metal is subsequently to be removed, for example by etching. In this way, by choosing a specific mask with recesses of a defined size and shape, the carbon-containing surface as an image of this mask can be divided into areas that can be coupled and those that cannot.

Alternatively, photoresist can also be applied to the carbon-containing surface first. This is then exposed and developed using an inverse mask, so that metal can subsequently be applied to those parts of the surface on which biomolecules are not to be immobilized. The places where

Biomolecules to be immobilized are initially coated with photoresist, which is removed before the biomolecules are coupled in a suitable manner, for example with suitable solvents such as acetone.

In addition to applying defined and reproducible amounts of liquid, this embodiment offers the particular advantage of being able to choose the shape and the maximum area of a place for immobilizing biomolecules.

After the application of the quinone derivatives, the solvent is generally first allowed to evaporate. This can normally take place at room temperature because of the relatively small amounts of liquid, but can also be influenced by the selection of suitable higher or lower temperatures. Accordingly, the coupling reaction essentially does not take place in solution, although a residual solvent content can be advantageous.

Following the exposure and the associated coupling of quinones to the carbon-containing surface, a washing process is usually carried out. The purpose of this washing process is in particular to remove uncoupled quinone derivatives. Based on the solution previously used to apply the quinone derivative, aqueous solvents or solvent mixtures are also used for washing. In principle, the above statements apply here.

According to a particular embodiment, washing is carried out with a solvent or solvent mixture which contains a surfactant, preferably a nonionic surfactant. Polyalkoxylated, in particular polyethoxylated, fatty acid esters of polyols, in particular of glycerol or sorbitol, for example the sorbitan fatty acid esters sold under the trade name Tween®, are particularly preferred. In particular, the use of ethoxylated sorbitan hexylaurate has proven to be expedient.

The concentration of surfactant in the wash solution is expediently chosen so that, on the one hand, an effective removal of uncoupled quinone derivatives is ensured, and on the other hand, the wash solution is compatible with the immobilized biomolecules. Concentrations in the range from 0.01% by weight to 10% by weight and preferably 0.05% by weight to 2% by weight have proven to be expedient.

For example, after exposure, the carrier surface can be washed with a solution containing about 0.5% by weight to about 2% by weight of Tween 20, in particular into this

Solution to be dipped. The purpose of this first washing process is in particular to avoid coupling the reagents to be removed. The carrier surface can then be rinsed with a solution containing about 0.01% to about 0.05% by weight of Tween 20.

The concentration of the quinone derivatives in the solution to be applied is variable and depends in particular on the desired density of immobilized biomolecules. Concentrations in the range from 0.1 μM to 100 μM can be used, in certain cases in the lower concentration range, saturation of the surface with quinones is not achieved, while this is the case in the upper concentration range and excess quinone derivatives that are not coupled due to saturation have, can then be removed. Concentrations above at least 5 μM have proven to be expedient for the saturation of the surface with a satisfactory homogeneity of the immobilized biomolecules.

After washing with a surfactant-containing solvent or solvent mixture, further washing steps can follow. To do this, it may be appropriate to use organic To use solvents, especially lower alcohols, for example isopropanol, which can then be removed by rinsing with water.

Finally, the surface is dried under customary conditions, conveniently at ambient temperature and, if desired, by blowing dry with air or inert gas.

If the immobilized biomolecules are provided with a marking in accordance with the above particular embodiment, a quality control of the array can now follow. For this purpose, the array can be measured using a detection system corresponding to the marking. In particular, the coupling efficiency and thus the immobilization of the biomolecules can be assessed in terms of area, homogeneity and density via the measured amount of immobilized marking.

The present invention also relates to the use of arrays according to the invention for analytical and in particular diagnostic purposes.

The following applications are mentioned as examples:

Diagnostics, choice of therapy and therapy control of tumor and metabolic diseases; Investigation of the genetic predisposition (SNPs), especially the detection of mutations, also in the forensic field; Detection of promoter methylations (Epigenetics); Gene expression control; Sequencing, in particular sequencing by hybridization; Microbiological applications such as in bacteriology and virology, for example to differentiate between different strains; ELISA applications with immobilized antibodies, antigens, receptors and ligands in clinical chemistry to food chemistry and environmental analysis; Allergy diagnostics with immobilized allergens; High throughput screening of substance libraries; Toxicogenomics.

In principle, arrays according to the invention are suitable both for non-competitive and for competitive analytical methods (assays).

In non-competitive assays, the substance to be analyzed (analyte) interacts with the biomolecules immobilized on the surface. As a rule, the analyte is marked beforehand, but marking is also possible after the analyte has already interacted with the immobilized biomolecules, for example by means of primer extension or rolling-cycle PCR. In these cases, a measurement signal is obtained, which is all the more is greater, the more analyte is present. It is also possible that the interaction of the sample with the substances immobilized on the surface changes the fluorescence of the immobilized substances (attenuation, amplification, for example molecular beacons) or changes the activity of an enzyme and this change is registered as a measurement signal. Examples of non-competitive assays are hybridization reactions of PCR products or labeled DNA / RNA to nucleic acids immobilized on the surface, in particular oligonucleotides or cDNA, and sandwich immunoassays.

In the case of competitive methods, a labeled substance (marker) is added to the sample, which has similar binding properties to the biomolecules immobilized on the surface as the analyte itself. There is a competitive reaction between analyte and marker for the limited number of binding sites on the surface. A signal is obtained which is lower the more analyte is present. Examples of competitive assays are immunoassays (ELISA) and receptor assays.

The arrays according to the invention are suitable for examining any samples of biological origin that can contain a certain analyte. One embodiment relates to body samples of human and animal origin. If necessary, the analyte present in the sample or a fraction which may contain this analyte is prepared. This work-up generally corresponds to normal practice. Samples such as blood and blood components or isolates thereof, tissue, native, frozen, fixed, with and without dissection, cells from body fluids, e.g. Sputum, lavage, punctate, exudate and urine, or stool, can advantageously be examined with arrays according to the invention. Such analytical methods using the arrays are in vitro methods (cf. also WO 99/10528 and WO 00/06702)

According to a preferred embodiment, arrays according to the invention are intended for hybridization experiments. Expediently, nucleic acids are immobilized on the carrier surface, which can hybridize as probes with specific targets. A special type of such arrays are oligonucleotide arrays.

The design of the probes takes place in particular with a view to the target or targets that are of analytical interest (analyte). Test probes are usually designed in such a way that they specifically hybridize with a defined target, for example a certain base sequence. Good discrimination between perfect match and mismatch is particularly important (cf. also DE 100 09 081.8). You can do this the melting points of the hybrid of probe and target as well as the corresponding melting points for defined mismatches are calculated according to the nearest neighbor model and statements are made about the discrimination between perfect match and mismatch. (See, for example, JJ Santa Lucia: Proc. Natl. Acad. Sci. USA 95 (1998) 1460 and Peyret, et al .: Biochemistrv 38 (1999) 3468-3477).

For hybridization, the immobilized probe is brought into contact with a hybridization mixture which comprises a part derived from the sample to be examined after expedient sample preparation and, if appropriate, further expedient additives. It goes without saying that parts of the mixture can initially be brought into contact with the probe separately from one another. The hybridization conditions are expediently chosen so that the probe and the complementary target can form stable hybrids. As a rule, conditions of relatively low stringency are initially selected, e.g. Temperatures of about 20-70 ° C, preferably about 20-50 ° C and in particular about 30-40 ° C and ionic strengths of about 6 x SSPE or lower. Temperatures in the range of 20-55 ° C are particularly suitable for probe lengths of less than 25 mm; 40-70 ° C are particularly suitable for probe lengths from 25 years. Then with similar or higher stringency, e.g. about 1 x SSPE at about 30-40 ° C to about 0.25 x SSPE at about 30-50 ° C. It can also be hybridized under stringent conditions and the unbound labeled sample portion can be washed away. Furthermore, known agents, e.g. Detergents, block reagents, denaturing agents, renaturation accelerating agents and Tm-leveling reagents are used. The optimization of the hybridization protocol is a matter for the person skilled in the art.

Amplified or non-amplified nucleic acids can be used for the hybridization step. The known amplification methods for which the polymerase chain reaction (PCR), also carried out as nested PCR, asymmetric PCR or multiplex PCR, or alternative methods such as the ligase chain reaction (LCR), nucleic acid sequence-based amplification (NASBA) can be used. , Transcription-mediated amplification (TMA) and the like. Certain versions of these techniques, such as mutation-enriching PCR, and / or combinations with other molecular biological methods, such as with reverse transcription (RT), may be appropriate. In particular, the arrays according to the invention enable hybridization without prior amplification, in particular for the detection of mRNA or nucleic acids derived therefrom. The detection in the sense of the invention includes the determination of whether a specific target (analyte) is present in a sample or not (presence or absence). The determination can be made qualitatively or quantitatively.

As a rule, the detection requires a quantification of those nucleic acids that hybridize to an immobilized probe. The quantification can be absolute or relative. Suitable detection systems are well known to the person skilled in the art. A widely used possibility is the introduction of markings, e.g. radioactive, colorimetric, fluorescent or luminescent type. These are generally introduced into the nucleic acids present in the sample and in particular into the nucleic acids to be detected with a certain base sequence or nucleic acids with a similar base sequence, e.g. in the course of an amplification preceding the hybridization or in another manner known per se.

The invention is illustrated by the following examples.

Examples

It shows

FIG. 1 shows the relative fluorescence of different carrier materials based on standard slide glass carrier A (Menzel): B: Pyrex glass; C: Polymethylpentene

(Permanox; Nunc); D: polycycloolefin (Zeonex 480R; Zeon); E: polycycloolefin (Zeonex 480; Zeon); F: polycycloolefin (Topas; Hoechst); G: polycarbonate (Nunc); H: polystyrene (Nunc); I: polystyrene on Pyrex; J: CxHy on silicon (soft deposited carbon; plasma; the H / C ratio can be set via the hydrogen content, technology IMM Mainz); K:

Teflon on Pyrex; L: gold on pyrex; FIG. 2 shows the fluorescence after hybridization of a Cy5-labeled 16-mer

Oligonucleotide sample with immobilized 16mer oligonucleotide for various carrier materials A: polycycloolefin (Zeonex 480R; Zeon); B: polystyrene on pyrex glass; C: Teflon on pyrex glass; D: CxHy on silicon. The ratio of signal (white bars) to background fluorescence (black bars) can be seen; FIG. 3 shows the fluorescence after hybridization of a Cy5-labeled 55mer

Oligonucleotide sample with polycycloolefin-immobilized 18-mer oligonucleotide, solutions for immobilization with different

Concentrations of the oligonucleotide were used (A: 1 μM; B: 3 μM; C: 5μM), each applied 5 times in a 400 μm grid as a spot;

FIG. 4 shows the fluorescence after hybridization of a Cy5-labeled 55mer

Oligonucleotide sample with polycycloolefin-immobilized 18-mer oligonucleotide as a function of the concentration [μM] of the oligonucleotide in the solution used for immobilization;

FIG. 5 shows the fluorescence after hybridization of a Cy5-labeled 55mer

Oligonucleotide sample with polycycloolefin-immobilized 18-mer oligonucleotide, a 10 μM solution of the oligonucleotide being applied 5 times in a 400 μm grid as a spot for immobilization;

FIG. 6 shows the fluorescence after hybridization of a Cy5-labeled 24-mer

Oligonucleotide sample with various 13mer oligonucleotides, which is immobilized on a cyclohexyl-silanized glass slide, one oligonucleotide being complementary to the sample (left, 2 spots, perfect match) and another oligonucleotide with the sample has a base mismatch (right, 2 spots , Mismatch);

FIG. 7 shows the fluorescence after hybridization of a Cy5-labeled 24-mer

Oligonucleotide sample with polycycloolefin-immobilized AQ-coupled PCR amplificate (A, 0.1 - 0.5 μM), AQ-coupled PCR amplificate (B, 0.01 - 0.05 μM), non-AQ-coupled PCR amplificate (C, 0.1 - 0.5 µM);

8 shows the fluorescence after hybridization of a Cy5-labeled 55mer

Oligonucleotide sample with polycycloolefin-immobilized 18-mer oligonucleotide, which was applied as a spot for immobilization in a mixture with an anthraquinone derivative AQ-HEG-5'-T, the AQ-HEG-5 being based on a total anthraquinone concentration of 10 μM '-T-

Share [%] 0; 10; 25; 50; 75; Was 90 and 99 mol%;

FIG. 9 shows the fluorescence after hybridization of a Cy5-labeled 55mer

Oligonucleotide sample with polycycloolefin-immobilized 18mer oligonucleotide, for immobilization a 10 μM solution of the oligonucleotide 5-fold with a capillary dispenser (inside capillary diameter in

Range of 1.5 - 5 μM) was applied as a spot in a grid of 50 μm; FIG. 10 shows a mask for the photolithographic pre-structuring of the carrier surface with recesses of 100 μm diameter in a grid of 400 μm and positioning marks;

FIG. 11 shows the fluorescence after hybridization of different concentrations of a Cy5-labeled 55mer oligonucleotide sample (10 ^'11 ; 10 ^"10 ; 10 ^"9; 10 ^"8 ; 10 ^"7 ; 10 ^"6; 10 ^{~ 5} M) with polycycloolefin-immobilized 18-mer oligonucleotide (200 μm spots), the values marked with O without a filter, the values marked with Δ with a first filter and the values marked with Oge were recorded with a second filter; FIG. 12 shows the fluorescence after hybridization of different concentrations of a Cy5-labeled 55mer oligonucleotide sample (2x10 ^"13 ; 2x10 ^"12; 2x10 ^"11 ; 2x10 ^"10;"2x10^{" 9} M;) with polycycloolefin-immobilized 18mer oligonucleotide (10 μm spots); FIG. 13 shows the fluorescence of polycycloolefin-immobilized, Cy5-labeled (B) and unlabeled (A) 18-mer oligonucleotide before hybridization and the

Chemiluminescence after hybridization with biotinylated 18mer oligonucleotide sample and subsequent incubation with streptavidin-POD (B 'or A'); Figure 14 is a schematic exploded view of a dip stick (A) and a matching container (B).

In FIGS. 2 to 9 and 11 to 13, the fluorescence is plotted as an intensity in arbitrarily selected units [AU].

1 background fluorescence of the support material

The background fluorescence of various carrier materials with 635 nm excitation and 670 nm emission was examined with a high-resolution confocal laser scanner (FIG. 1). Polycycloolefins, polymethylpentene and polystyrene on pyrex glass show a lower fluorescence than a standard slide.

Manufacture of the probes

a) oligonucleotide (biomolecule B)

Oligonucleotides were produced in a manner known per se via a solid phase synthesis using the phosphoramidite method. Oligonucleotides coupled to the solid phase with DMTr-protected 5'-OH and the following sequence were synthesized via the 3'-OH:

SEQ ID NO: 1: 5'-AACAGCTATGACCATG-3 'SEQ ID NO: 2: 5 ^» -TATTCAGGCTGGGGGCTG-3' SEQ ID NO: 3: 5'-AGCTGGTGGCGTA-3 'SEQ ID NO: 4: 5'-TGGTGACGTAGGC-3' SEQ ID NO: 5: 5'-GTACTGGTGGAGTATTTGATAGTG-3 '

b) Quinone spacer construct (Q-S)

This was synthesized in a manner known per se from anthraquinone-2-carboxylic acid, mono-Boc-1, 3-propanediamine and hexaethylene glycol.

c) Quinone-spacer-oligonucleotide construct (QSB) or quinone-spacer-T construct. After the construction of the above sequences, the DMTr protective group at the 5 'end was removed again under acidic conditions with ZnBr ₂ and the free 5' -OH implemented with the 2-cyanoethyl-N, N-diisopropyl-chlorophosphoramidite-activated construct QS.

A construct of thymidine and the Q-S construct was obtained in an analogous manner.

The following table shows an overview of the synthesized quinone derivatives:

1) instead of oligonucleotide a single base T

2) Cy5-labeled, between HEG and oligo

3) PCR primer

Array manufacturing

3.1 Arrays with a plastic surface

Unless expressly stated otherwise, the polycycloolefin available under the trade name Zeonex®480R was used at the time of registration. 3.1.1 Oligonucleotide Arrays

3.1.1.1 Arrays with spots from 16mer on different surface materials

AQ-1 (0.05 μM) aqueous solutions (0.2M NaCI) were pipetted on as a 0.5 μL drop in 4-fold values onto various surfaces (AD) (pitch 2-4 mm): A: Polycycloolefin (Zeonex 480R; Zeon); B: polystyrene on pyrex glass; C: Teflon on pyrex glass; D: CxHy on silicon. After the spots had dried, the supports were irradiated for 10 min with UV light (340 nm) and washed 3 × 5 min with bidest water in order to remove excess probes.

3.1.1.2 Arrays with different sizes of spots from 18mer

An aqueous solution (2 mM calcium chloride; 1 vol.% 1-propanol) of AQ-2 (10 μM) was treated with a piezodispenser (1 channel; Genesis NPS 100/4 with Active Tip M, TECAN AG, Hombrechtikon, CH ) applied in a grid of 500 μm to polycycloolefin (Zeonex 480R; Zeon). The drop size was approximately 1.5 nL. After the spots had dried, the support was irradiated with UV light for 1 min. The carrier was then immersed in an aqueous solution containing 0.5-1% Tween 20 and briefly swirled. Then it was rinsed thoroughly with 0.1% Tween 20 solution and the support was immersed 2 × 10 min in fresh 0.5-1% Tween 20 solution, shaken. Finally, the support was immersed in 2-propanol with shaking for 10 minutes, rinsed with water and air-dried at room temperature. The diameters of the resulting spots were approximately 150 to 200 μm. Correspondingly, spots with a diameter of approximately 12 μm could be obtained by applying drop sizes of approximately 1 pL (inner diameter of the capillary in the range of 1.5-5 μM) with a capillary dispenser in a grid of 50 μm.

3.1.1.3 Array with spots from 18mer in different amounts

5-fold replicates of the solutions used in 3.1.1.2 with different concentrations (0.5; 1; 3; 5; 8; 10; 20 μM) of AQ-2 were, as described under 3.1.1.2, with the piezodispenser at a drop size of 1, 5 nL immobilized on polycycloolefin.

3.1.1.4 Arrays with spots from 18mer in different densities

Following the procedure described in Example 3.1.1.2, solutions (2 mM calcium chloride; 1% by volume 1-propanol) were applied to the piezodispenser with a droplet size of 1.5 nL polycycloolefin, which in addition to the AQ-2 contains the anthraquinone derivative AQ -5 contained in different concentrations. To apply Solutions were adjusted so that the anthraquinone concentration of AQ-2 + AQ-5 was always 10 uM.

3.1.1.5 Arrays with spots from fluorescence-labeled 18mer

Following the procedure described in Example 3.1.1.2, solutions (2 mM calcium chloride; 1% by volume 1-propanol), which contained AQ-2 (10 μM) on the one hand and AQ-6 (10μM) on the other hand, were triplicated with the Piezodispenser applied with a drop size of 1.5 nL on the same polycycloolefin carrier.

3.1.1.6 Arrays with 150 μm or 200 µm spots from 13 meres using a piezo or pressure pulse dispenser

Furthermore, following the procedure described in Example 3.1.1.2, aqueous solutions (2 mM calcium chloride; 1% by weight 1-propanol) of AQ-3 (10 μM) were used on the one hand with a piezodispenser (1 channel; Genesis NPS 100 / 4 with Active Tip M, TECAN AG, Hombrechtikon, CH), on the other hand with a pressure pulse dispenser (24-channel; TopSpot, HSG-IMIT, Villingen-Schwenningen) spotted on a grid of 300 μm or 500 μm on polycycloolefin. The drop size was about 0.5 nl or 1.5 nl.

3.1.2 Array with spots from PCR amplificate

DNA from the Colo320 cell line (k-ras wild type) was amplified using the primers RasUSI and RasDS135 specified below. The length of the PCR amplificate was 157 bp. A corresponding amplificate was also generated using RasDS135 and an AQ-coupled primer (AQ-7) corresponding to RasUSI.

PCR conditions per batch: 100 ng DNA, 1, 5 mM MgCl ₂ ; 100 µM dNTPs; 250 nM primer; 1 U Taq polymerase (Qiagen; HotStar); 7.5% glycerol; in 50 ul 1 x PCR buffer. Thermocycling: 1 x 95 ° C 15 min; 35 x (94 ° C 60 s, 70 ° C 50 s, 58 ° C 50 s, 72 ° C 60 s); 1 x 72 ° C 7 min.

The PCR products with and without AQ primer were diluted 1: 2 and 1:20 (only AQ primer) with spotting solution (2mM CaCI ₂ , 1 vol% 1-propanol) and 1.5 nL each in 5-fold replicates immobilized on polycycloolefin following the procedure described in Example 3.1.1.2.

3.2 Array with glass surface Glass slides were precoated with cyclohexyldichloromethyllsilane (Fluka) using a sol-gel process. For this purpose, the silane was pre-hydrolyzed with water and the mixture was slightly acidified with dilute hydrochloric acid. Glass slides (Menzl) previously cleaned with isopropanol (10% diethyl ether) and ultrasound (15 min) were immersed in the hydrolyzate and slowly pulled out again. The glass slides were dried at 80-150 ° C. Aq-3 and AQ-4 (each 10μm) aqueous solutions (2mM CaCl ₂ ) with a pressure pulse dispenser (24-channel; TopSpot, HSG-IMIT, Villingen-Schwenningen) in 4-fold replicates with a drop size of 1, 5 nL immobilized in a grid of 500 μm on the same polycycloolefin support.

3.3 Arrays with a structured surface

First, a chrome layer is sputtered onto the polycycloolefin or glass surface. When using titanium, it is evaporated. The subsequently applied photoresist (resist system AZ 1512, Clariant) is then exposed through the mask shown schematically in FIG. 10. The exposed lacquer areas are removed during development. Finally, the exposed areas of the metal layer are etched away. The recessed areas have a diameter of 100 μm and the grid is 400 μm. The spot diameters of 12 recessed areas were 102.07 μm for polycycloolefin and 100.74 μm for glass with coefficients of variation of 0.033% and 0.042%, respectively.

FIG. 14 schematically shows an exploded view of a dipstick (A) with closure means 1 and body (2) attached thereto, which has an array 3, and a container 4 with sample fluid 5. The array 3 can be an array of immobilized biomolecules with or without pre-structuring. 4. Array quality control

The array from Example 3.1.1.5 was measured using a confocal fluorescence scanner. Fig. 13 (left half) shows the scan. Immobilized AQ-2 cannot be seen (section A), while immobilized AQ-6 (section B) provides a fluorescence signal, by means of which the quality of the spots can be assessed.

5. Array hybridization

5.1 16mer probes

The chips (surface samples with array) are soaked for 1 h at RT in 20 mL of a 0.05 μM solution of a 5'-Cy5-labeled 16mer sample (SEQ ID NO: 7: 5'-

CATGGTCATAGCTGTT-3 ') in 5xSSC-T (sodium chloride / sodium citrate buffer with 0.1% Tween 20). The excess sample was then rinsed off with 5xSSC-T and the fluorescence was measured.

5.2 18mer probes

10 μl of a 5'-Cy5-labeled 55mer sample dissolved in PerfectHyb (Sigma, Deisenhofen) SEQ ID NO: 8 [5'-

CTACGTTGCCCCCCTGACCTGCAGCCCCCAGCCTGAATATGTGAACCAGCCAGAT-3 '] was pipetted onto the array. The sample concentration was 10 ^"11 ; 10 ^"10; 10 ^"9 ; 10 ^"8; 10 ^"7 ; 10 ^"β; 10 ^{~ 5} M or 0.05 nM. It was incubated for 1 h at RT. The excess sample was then rinsed briefly with 5 × SSPE and the fluorescence was measured.

5.3 Cy5-labeled 18mer probes

20 μl of a 5nM dissolved in 6xSSPE-T (= 6xSSPE with 0.1 vol% Tween 20) and biotinylated 18mer sample at the 5'-end (SEQ ID NO: 9: 5'-CAGCCCCCAGCCTGAATA-3 ') was pipetted onto the array. After a washing step with 6xSSPE-T, incubation was carried out with steptavidin-POD (Sigma; dilution 1: 100 in 6xSSPE-T) (30 min, RT). It was washed again with 6xSSPE-T. 10 μL of chemiluminescent substrate (SuperSignal, ELISA, Pierce) were added, exposure was carried out for 2 s and the chemiluminescence was determined.

5.4 13mer probes; PCR Amplifkate

30 μl of a Cy5-labeled 24mer sample dissolved in 6 × SSPE with 0.1% Tween 20 (SEQ ID NO: 10: 5'CTTGCCTACGCCACCAGCTCCAAC-3 ') were pipetted onto the array. The sample concentration was. 5 nM. It was incubated for 1 h at 37 ° C. The excess sample was then rinsed briefly with 6xSSPE-T and the fluorescence was measured. Using the dip stick shown in Figure 14, the procedure is as follows. The hybridization mixture containing the sample is placed in the container 4. The dipstick is inserted into the container 4 so that the array 3 comes into contact with the hybridization mixture. The container 4 is closed with the closure means 1. If necessary, the sample, eg a PCR amplificate, is denatured, usually at least 2 min at 94 ° C. Then it can be cooled to 0 to 4 ° C. The subsequent hybridization is carried out as usual, for example at 37 ° C. for 60 minutes. Then takes the dipstick, washes and evaluates the array.

6. Evaluation

The arrays were measured with a confocal fluorescence scanner (fluorescence) or with a chemiluminescence detector (chemiluminescence).

6.1 Unspecific binding

Examination of the arrays produced in Example 3.1.1.1 shows that polycycloolefin and polystyrene on pyrex glass show a significantly better ratio of signal to background fluorescence than CxHy on silicon and Teflon on pyrex glass due to the lower non-specific binding of the sample Range is below 10 (Fig. 2).

6.2 Spot homogeneity

Different amounts of probes were applied to produce the arrays from Example 3.1.1.3. With increasing probe concentration, the homogeneity of the spots increases (Fig. 3) until the surface is finally saturated (Fig. 4). With a probe concentration of 10-20 μM, very homogeneous spots of approximately 150-200 μm diameter are obtained (FIG. 5).

The spots applied to glass surfaces according to Example 3.2 are also homogeneous. There is good discrimination between perfect match and mismatch (Fig. 6).

7 shows that good immobilization yields are also achieved for PCR amplificates (cf. Example 3.1.2). 6.3 Probe density

The examination of an array produced according to Example 3.1.1.4 shows that the amount of hybridized sample and thus the density of immobilized probe AQ-1 steadily decreases with increasing proportion of the non-hybridizing AQ-HEG-5'-T (AQ-6) (Fig . 8th). In this way, the surface density of the immobilized probes can be adjusted reproducibly. In contrast to a simple reduction in the probe concentration, the homogeneity of the spots is retained when diluted with AQ-HEQ-5'-T.

6.4 Precision The measurement data for the spots plotted with the 1-channel piezo dispenser according to Example 3.1.1.6 are shown in Table 1.

Table 1:

The coefficient of variation (VC) over 64 spots for the spot areas (area) for single drop delivery (approx. 0.5 nL) is 5%. The coefficient of variation for the spot volume (volume) and the spot diameter (diameter) after hybridization is less than 7%. All 64 spots together formed a regular grid (array).

The measurement data for the spots applied with the 24-channel pressure pulse dispenser according to Example 3.1.1.6 are shown in Table 2.

Table 2:

The variation coefficients for the spot areas are below 6% and the integrated signals below 7%. The interassay variances for the spot diameters are 7.0% with the arbitrary selection of 4 chips out of 400 after hybridization.

The measurement data for the spots plotted with the capillary dispenser according to Example 3.1.1.2 are plotted in FIG. 9 and shown in Table 3.

Table 3:

As can be seen in the cross section, the approx. 12 μm wide spots are also very even. The intra-assay variance (n = 20) for the spot areas is below 10% and the intra-assay variance for the volumes is only 11%.

6.5 Dynamic hybridization area

It can be seen from FIG. 11 that the dynamic range of the 200 μm spots obtained according to Example 3.1.1.2 is larger than the dynamic measuring range of the confocal fluorescence scanner used. Attenuation filters therefore had to be introduced into the beam path in the upper concentration range. The dynamic hybridization range for the 200 μm spots is> 10 ⁵ . For the 10 μm spots obtained according to Example 3.1.1.2, a dynamic range of> 10 ^{4 is achieved} with a detection limit that is an order of magnitude lower (FIG. 12).

Claims

[Claims]

1. Array of immobilized biomolecules which are coupled to a carbon-containing carrier surface, characterized in that the carbon-containing surface contains at least one cycloolefin-based polymer or is obtainable by having a glass, metal or ceramic surface with an aqueous solution of at least one hydrolyzable carbonaceous compound treated and the surface dries.

2. Array according to claim 1, characterized in that the biomolecules are coupled via at least one quinone, preferably an anthraquinone.

3. Array according to claim 1 or 2, characterized in that the coupling group and the biomolecule are linked via a spacer.

4. Array according to claim 3, characterized in that the spacer is marked.

5. Array according to one of the preceding claims, characterized in that the polymer is based on norbornene structural units.

6. Array according to one of claims 1 to 4, characterized in that the hydrolyzable carbon-containing compound is a silane of the formula XVIa

(R ¹⁷ ) _z Si (R ¹⁶ ) _4-z (XVIa)

is, the radicals R ¹⁶ independently of one another for halogen, CC ₄ -alkoxy or

CC ₄ -acyloxy, the radicals R ¹⁷ independently of one another are CC ₃₀ -alkyl or OrC-io-cycloalkyl and z corresponds to a value of 1, 2 or 3.

7. Array according to one of the preceding claims, characterized in that parts of the surface have a metal layer, preferably a chrome or platinum layer.

8. Carrier with a carbon-containing surface for immobilizing biomolecules via coupling groups, characterized in that parts of the surface have a coating to which the coupling groups do not couple.

9. Device based on at least one array according to one of claims 1 to 7 in the form of a chip or dipstick.

10. The device based on at least one carrier according to claim 8 in the form of a chip or dipstick.

11. Dipstick according to claim 9 or 10, comprising a closure means 1 and an attached body 2, which has at least one array 3.

12. A method for immobilizing biomolecules, wherein at least one derivative of a coupling group is placed on a support with carbon-containing applied surface, exposed and, if necessary, the immobilized derivatives transferred into the biomolecules, characterized in that at least one polycycloolefin is used as the carbon-containing surface.

13. A method for immobilizing biomolecules, wherein one has a support surface with at least one hydrolyzable carbon-containing

Compound treated, at least one derivative of a coupling group is applied to the carbon-containing carrier surface, exposed and, if necessary, the immobilized derivatives are converted into the biomolecules, characterized in that an aqueous solution of the hydrolyzable carbon-containing compound is used.

14. The method according to claim 12 or 13, characterized in that quinone derivatives are used.

15. The method according to any one of claims 12 to 14, characterized in that the derivatives of the coupling groups and a hygrocopical salt, preferably

Calcium chloride.

16. The method according to any one of claims 12 to 15, characterized in that

Parts of the surface treated so that the derivatives of the coupling groups essentially do not couple to the treated surface.

17. The method according to claim 16, characterized in that a metal layer is applied to the surface and parts of this layer are removed again.

18. The method according to any one of claims 12 to 17, characterized in that after exposure to washing with a solvent or solvent mixture which contains 0.1 to 10, preferably 0.5 to 2 and in particular 1 wt .-% of a surfactant.

19. Use of an array according to one of claims 1 to 7 or a device according to claim 9 or 11 for diagnostic / analytical purposes.