EP1214419A2

EP1214419A2 - Lactic acid bacteria transformed to be provided with respiratory metabolism

Info

Publication number: EP1214419A2
Application number: EP00964333A
Authority: EP
Inventors: Patrick Duwat; Alexandra Gruss; Yves Le Loir; Philippe Gaudu
Original assignee: Institut National de la Recherche Agronomique INRA
Current assignee: Institut National de la Recherche Agronomique INRA
Priority date: 1999-09-20
Filing date: 2000-09-20
Publication date: 2002-06-19
Also published as: FR2798670B1; AU783660B2; BR0014111A; AU7529300A; WO2001021808A3; CA2385359A1; NO20021349L; NO20021349D0; AU783660C; PL356133A1; WO2001021808A2; FR2798670A1

Abstract

The invention concerns lactic acid bacteria which have been provided with a respiratory metabolism, in particular by genetic modifications, such that the expression of at least one gene, either heterologous or homologous, coding for a protein intervening in said respiratory metabolism, is altered. Said bacteria are useful in particular for producing lactic acid ferments.

Description

LACTIC BACTERIES TRANSFORMED TO CONFER THEM RESPIRATORY METABOLISM, AND LEAVES INCLUDING THE SAME.

The present invention relates to the improvement of the preservation and acidification properties of lactic starter cultures.

By “lactic sourdough”, is meant any preparation intended for sowing a medium to be fermented, and comprising at least one strain of lactic acid bacteria belonging in particular to one of the genera Lactococcus, Streptococcus, Enterococcus, Leuconostoc, Lactobacillus, Propionibacteria , or Bifidobacteria, or a mixture of strains belonging to one or more of the genera mentioned above. The lactic acid starter used in particular to produce fermented foods and silage products are usually prepared in batch culture, and are then concentrated and packaged for later use in order to inoculate different food products for fermentation. One of the concerns of the producers of sourdoughs is to obtain a high bacterial biomass, and to maintain a good viability of the bacteria during storage so that, during inoculation, the fermentation starts quickly and gives food products having characteristics. reproducible.

However, many causes of stress can intervene during the different stages of preparation of sourdoughs and alter the survival of lactic acid bacteria. In particular, bacterial viability can be quickly lost if the cultures are kept stationary. One of the causes is the accumulation in the environment of natural products of bacterial metabolism, in particular organic acids such as lactic acid which cause a decrease in pH detrimental to bacterial growth. Another cause of loss of viability during preparation and storage is the presence of oxygen, which is naturally toxic to lactic acid bacteria; these bacteria have in fact a metabolism of carbohydrates based on fermentation. BERGEY'S manual, 9 ^th edition, edited by HOLT et al. (1994) WILLIAMS and WILKINS Eds.

To limit the drop in pH, culture media buffered around pH 6 with cations associated with carbonates, hydroxides, phosphates or oxides are usually used for the production of sourdoughs of lactic acid bacteria. However, these additions to the culture medium can cause problems for subsequent productions, for example by promoting the development of phages, or by increasing the solubility of caseins.

To avoid the toxic effects of oxygen, the preparation and storage of sourdoughs is usually carried out anaerobically; for example, during the preparation of starter cultures in batches, certain steps are carried out under nitrogen, in order to remove traces of oxygen. However, when using sourdoughs, they are frequently exposed to high levels of oxygen. For example, the milk that is used for the preparation of fermented milk products is highly aerated during the transfer process and therefore rich in oxygen. This could be a cause of slower restarting of the leaven.

It has been reported [A.K. SIJPESTEIJN, Antoni e von Leeuwenhoek 36: 335, 1970] that Lactococcus and Leuconostoc cultivated in the presence of heme and under aeration produce cytochromes and have a respiratory metabolism.

More recent work [KANEKO et al. Appl. About. Microbiol. , 56: 9, 2644-2649 (1990)], report an improvement in the proliferation of a strain of Lactococcus lactis diacetylactis, cultivated in the presence of heme and / or Cu ²⁺ . These authors did not attribute this effect to the appearance of respiratory metabolism, but to the activation of diacetyl synthase by hemin and / or Cu ²⁺ , which would preferentially orient fermentative metabolism towards production of diacetyl, to the detriment of lactate.

The team of inventors recently discovered that in the context of the preparation of lactic starter cultures, the use of a porphyritic compound associated with an aerobic culture made it possible to obtain greater bacterial growth than that obtained during conventional processes, and that in addition, the percentage of viable bacteria in the bacterial population and the duration of survival were also much greater. What is more, when the leaven obtained in this way is used to inoculate a product to be fermented, a very rapid restart of growth and bacterial fermentation is observed, resulting in an acidification of the product much faster than that observed with classic sourdoughs. These works are described in International Application PCT / IB99 / 01430 (PCT WO 00/05342) in the name of INRA.

The inventors have now shown that the improvements in bacterial yield and viability during storage are due to the acquisition of respiratory metabolism by L. lactis during culture under aeration and in the presence of a porphyritic compound. During the inoculation of the product to be fermented, the bacteria are also capable of immediately restoring a fermentative metabolism, which results in an increase in restarting performance.

Respiratory metabolism requires the presence of enzyme equipment involved in different metabolic pathways, including synthesis and the use of heme, the synthesis of cytochromes, and probably the synthesis of at least part of the cycle of tπcarboxylic acids (Krebs cycle).

Using primers derived from the alignment of gene sequences known to be involved in respiration in other bacteria, the inventors sought the presence of homologous genes in L. lactis. They thus identified three genes respectively coding for ferrochelatase (enzyme involved in the biosynthesis of heme by catalyzing the formation of a complex between iron and a porphyric compound precursor of heme, the complex thus formed can be incorporated into bacterial cytochromes), cytochrome D oxidase (a hemoprotein necessary for respiration), and aconitase (enzyme involved in the Krebs cycle).

They also showed that the genes encoding cytochrome D oxidase and ferrochelatase were functional in L. lactis. They have in fact found that bacteria in which the cytochrome D oxidase gene is inactivated no longer exhibit respiratory metabolism when they are cultivated aerobically and in the presence of a porphyritic compound containing iron. Likewise, they observed that the inactivation of the gene encoding ferrochelatase led to the loss of the respiratory metabolism capacities of L. lacti s in the case of cultures carried out in the presence of a porphyritic compound containing no iron, such as protoporphyπne, but not in the case of cultures carried out in the presence of a porphyritic compound containing iron, such as heme.

These observations confirm that the improvement in the performance of lactic sourdoughs obtained by preparing these sourdoughs aerobically and in the presence of a porphyritic compound, described in the Application PCT / IB99 / 01430, is linked to the appearance of respiratory metabolism under these culture conditions.

The inventors' results demonstrate in particular that the lactic acid bacteria, represented by L. lactis, have the capacity to grow via a fermentative or respiratory mechanism.

The growth mode depends on the culture conditions, but also on the signals transmitted by the cell itself. The metabolism seems rather fermentative at the beginning of growth, then becomes respiratory once the bacteria are in late exponential growth. The inventors have further hypothesized that there is a regulation of this transition exerted by the bacteria, and that an alteration of this regulation, effected by mactivation or by the overexpression of a regulatory gene which controls the transition between fermentative and respiratory growth, can result in more efficient breathing.

The object of the present invention is to provide means of conferring a respiratory metabolism on lactic acid bacteria, or of promoting it, in particular in order to improve the performance of lactic starter cultures in a manner comparable to that observed previously during the addition of 'heme (or other molecules derived from porphynnes).

In accordance with the present invention, this object can be achieved by causing or promoting the expression, in a lactic acid bacterium of at least one protein participating in this metabolism, by modifying the genomic profile of the lactic acid bacteria, or by transferring to a lactic acid bacteria one or more of the genes of respiratory metabolism, cloned from an aerobic bacterium, either by inactivating or overexpressing a gene of the initial bacteria, in order to switch metabolism towards the respiratory tract. The present invention relates to a lactic acid bacterium genetically modified in order to confer on it a respiratory metabolism, or to activate said metabolism. This includes in particular any lactic acid bacterium having undergone at least one modification consisting in the addition of at least one gene coding for a protein intervening in respiratory metabolism or promoting said metabolism, and / or at least one modification resulting in the activation of '' at least one protein intervening in respiratory metabolism or promoting said metabolism, and / or at least one modification resulting in the over-expression of at least one gene coding for a protein intervening in respiratory metabolism or promoting said metabolism, and / or at least one modification resulting in the total or partial activation of at least one gene coding for a protein involved in fermentation metabolism or promoting said metabolism, and / or at least one modification resulting in under-expression, of at least one gene coding for a protein involved in fermentation metabolism or promoting said metabolism.

A modification resulting from the addition of at least one gene encoding or promoting a protein involved in respiratory metabolism can be obtained by transforming said lactic acid bacterium with at least one heterologous gene (i.e. gene which is not naturally present in said bacteria), involved in respiratory metabolism. It may in particular be a gene derived from an aerobic bacterium and involved in respiratory metabolism. Said gene can in particular be chosen from:

- the genes coding for proteins of the heme biosynthesis pathway; - the genes coding for proteins of the biosynthetic pathway of cytochromes; genes encoding heme proteins; - the genes coding for proteins of the Krebs cycle.

A modification resulting in the over-activation of a protein intervening in the respiratory metabolism or promoting it, can for example be obtained by introduction, in the gene coding for this protein, of a mutation resulting in a more active protein. A modification resulting in the overexpression of at least one gene coding for a protein involved in respiratory metabolism, or promoting it, can for example be obtained by transforming said lactic acid bacterium with at least one additional copy of said gene, and / or by acting on the cis or trans regulation of this gene, for example by placing said gene under the control of expression regulation elements allowing greater expression (for example strong promoter, constitutive promoter, transcription enhancer, etc.) and / or by inactivating negative regulation elements of expression associated with said gene (for example repressor, attenuator, etc.). For example, it is thus possible to overactivate and / or overexpress one or more genes chosen from:

- genes regulating the metabolic pathways favoring the respiratory tract;

- enzymes of the cytochromes biosynthesis pathway; genes encoding heme proteins.

A modification resulting in the maccivation, total or partial, of at least one gene coding for a protein intervening in the fermentative metabolism, or promoting it, can be obtained in particular by deletion of all or part of said gene, or by introduction of a mutation resulting in the production of a less active or inactive protein. A modification resulting in the under-expression of at least one gene coding for a protein involved in fermentation metabolism, or promoting it, can for example be obtained by acting on the cis or trans regulation of this gene, for example by placing said gene under the control of elements for the negative regulation of expression (for example repressor, attenuator, etc.) and / or by partially or totally inactivating the elements for the positive regulation of expression (for example promoter, enhancer of transcription, etc.) associated with said gene, or by making this expression mutable. By way of nonlimiting example of activation or overexpression of a gene coding for a protein intervening in respiratory metabolism, or favoring it, there may be mentioned in particular: an activation of one or more genes intervening in assimilation of heme, or a modification increasing the expression of said gene (s) and / or making it constitutive.

This makes it possible to obtain a strain having an earlier and / or more effective assimilation of heme, which is desirable in cases where the availability of heme constitutes a limiting step for respiratory metabolism.

In this case, the switching between a fermentative metabolism and a respiratory metabolism can be controlled by modification of the oxygen content of the culture medium and by the presence of heme.

Non-limiting examples of mactivation or under-expression of genes coding for proteins involved in fermentation metabolism, or promoting it, are in particular: an activation of the ccpA gene, or a modification which attenuates its expression or makes it inducible. The ccpA gene regulates the expression of several genes involved in the catabolism of sugars [LUESINK et al. , Molecular Microbiology 30: 789-798, (1998)]. The inventors have hypothesized that its mactivation could promote the expression of the genes necessary for respiration. an activation of the gls24 gene or a modification which attenuates its expression or makes it inducible A study in Enterococcus faecalis describes the gls24 gene, which suppresses the expression of genes encoding L-lactate dehydrogenase, lipoamide dehydrogenase, and pyruvate decarboxylase, all of which are involved in metabolism [GIARD et al. J. Bacteriol. 182: 4512-4520, (2000)]. A gene analogous to gls24 exists in L. lactis. The inventors have hypothesized that a mutant of L. lactis where gls24 is activated may be advantageous with respect to respiration. According to a preferred embodiment of the present invention, said lactic acid bacterium is chosen from bacteria of the genera Lactococcus, Streptococcus, Enterococcus, Leuconostoc, Lactobacillus, Propionibacteria, or Bifidobacteria. Preferred bacteria are those of the various species of the genus Lactococcus, as well as streptococci of the species Streptococcus thermophilus.

For a given bacterial species, the gene (s) suitable for conferring on bacteria all or part of the enzymatic equipment necessary for acquiring a respiratory metabolism or for improving respiration may be for certain genes identified by a person skilled in the art from the information on the sequences of the bacterial genomes available on the databases, which makes it possible to identify the genes already present in a given microorganism and the metabolic pathways in which these genes may participate. In the absence of the genomic sequence of the bacterial species of interest, the sequence (s) of one or more neighboring species is (are) usable (s) to determine which genes are probably present For example, the complete sequences or almost complete genomes of several species of streptococcus (Streptococcus mutans and Enterococcus [previously Streptococcus] faecalis), as well as other gram-positive bacteria are currently available, and reveal the presence of several of the genes required for respiration. These species are quite phylogenetically close to lactic bacteria commonly used in the food industry such as thermophilic streptococci, and are also related to lactococci.

Thus, the transformation of bacteria of the species Lactococcus or Streptococcus by one or more gene (s) coding for one or more protein (s) of the heme biosynthesis pathway can make it possible to obtain bacteria having a respiratory metabolism without the need to add porphyry derivatives to the culture medium.

The desired genes can be obtained from a strict aerobic bacteria, or from an optional aerobic bacteria. They can easily be identified from the bacterial genomes available on the databases. For example, one can use genes obtained from Bacillus subtilis, which is an aerobic bacterium, and whose complete genomic sequence has been published.

We can thus bring to a lactic bacteria all the genes necessary to confer a respiratory metabolism. It is also possible, if desired, to bring only part of these genes, for example in order to be able to control different ways the conditions under which the bacteria will be able to breathe.

We can thus construct, as non-limiting examples: - a lactic acid bacterium having all of the genes necessary for respiratory metabolism; the switching between a fermentative metabolism and a respiratory metabolism can be controlled by modifying the oxygen content of the culture medium;

- a lactic acid bacterium possessing all the genes encoding the proteins of the Krebs cycle and all the genes of the cytochromes, but devoid of all or part of the genes of the heme biosynthesis pathway; switching from a fermentative metabolism to a respiratory metabolism will then require, in addition to aeration of the medium, the addition of heme or one of its precursors.

To obtain a transformed lactic acid bacterium according to the invention, the desired gene (s) can be introduced separately, or at least part of them can be grouped into one or more operons ( s).

For example, to give L. lactis total or partial capacity for heme biosynthesis, one or two of the heme operons from B can be transferred to L. lactis. subtili s or just some of the genes present on these operons.

To obtain lactic acid bacteria in accordance with the invention, it is also possible to promote the expression of genes involved in the respiratory metabolism naturally already present in said bacteria. This can be done for example by acting on the cis or trans regulation of the activity of these genes. In addition to the genetic modifications mentioned above, which give them a respiratory metabolism, or to promote said metabolism, the lactic acid bacteria in accordance with the invention may also comprise other modifications, in particular the introduction of one or more nucleic acid sequences allowing them to produce substances of interest.

Lactic acid bacteria according to the invention can be obtained by implementing conventional techniques of genetic engineering, known in themselves to those skilled in the art.

For the cloning of the genes, the desired gene or genes can be associated with functional transcription and translation control sequences in the lactic acid bacteria which it is desired to transform. One can in particular, if desired, place one or more of the transferred genes under transcπptional control of a mductible promoter, in order to allow control of the switching between fermentative metabolism and respiratory metabolism. The constructs produced are placed in an appropriate vector to introduce them into the lactic acid bacteria concerned. Vectors which can be used to transform lactic acid bacteria of different species, and which make it possible either to maintain the genetic information introduced in the form of a stable independent replicon, or to integrate it into the bacterial chromosome, are known in themselves. Integration into the bacterial chromosome can in particular be carried out by transposition, or by a method of replacement of genes by homologous recombination, according to methods known in themselves to those skilled in the art. By way of nonlimiting examples of usable methods and vectors allowing the implementation of these methods, mention will be made in particular of the methods and vectors described in PCT application WO 93/18164 in the name of INRA. In cases where the amount of genetic information to be transferred requires the introduction of large segments of DNA, techniques of protoplast fusion or bacterial conjugation can be used. Lactic acid bacteria according to the invention can also be produced by selection of mutants, natural or obtained by random mutagenesis, in which the activity and / or the expression of a protein intervening in the fermentative metabolism, or promoting it, is reduced or nonexistent, or the selection of mutants in which the activity and / or expression of a protein involved in respiratory metabolism is increased. The functioning of the respiratory metabolism in the modified bacterium according to the invention can be verified by carrying out the culture of said bacterium under conditions allowing the induction of a respiratory metabolism (that is to say under aeration, and possibly under conditions of induction of one or more mductible promoters optionally controlling the expression of one or more of the transferred genes and / or in the presence of heme or one of its precursors in the case where the transformed bacterium does not include the all the genes of the heme biosynthesis pathway, etc.), and by measuring the following parameters: i) the pH of the final culture, n) the products consumed or formed during the duration of the culture (for example l oxygen consumed, the production of fumarate or that of lactate, the amount of total carbon at the end of culture, which makes it possible in particular to evaluate the production of C0 ₂ during respiration, etc.), m) the population Bacterial ion at the end of growth, iv) survival during long storage, and v) re-acidification properties when the transformed strain is used as leaven (culture starter) for fermentation. If desired, detection of heme within cells, or of the activity of proteins requiring heme to function (such as cytochromes), can be performed. Strains of modified lactic acid bacteria in accordance with the invention, when cultivated aerobically, exhibit significant growth, which makes it possible to propose their use as host cells in the context of conventional processes for the production of substances of interest by genetic engineering.

The present invention also relates to a process for the cultivation of lactic acid bacteria, characterized in that it comprises the culture of at least one strain of lactic acid bacteria according to the invention under conditions allowing the induction of a respiratory metabolism in said strain.

Said conditions for induction of respiratory metabolism include aeration of the culture; advantageously, this aeration is carried out so as to maintain, throughout the duration of the culture, an oxygen supply equal to at least 5 millimoles per liter of culture medium.

According to the characteristics of the strain according to the invention used, and in particular according to its capacity to assimilate heme, or to carry out biosynthesis thereof, said conditions of induction of respiratory metabolism may also include the addition of a porphyric derivative in the culture medium, as described in Application PCT / IB99 / 01430. Very advantageously, the strains of lactic acid bacteria according to the invention can be used for obtaining lactic starter cultures.

In this case, the process according to the invention further comprises the harvesting of the bacteria at the end of said culture, and optionally, their conditioning and their preservation, by any appropriate means. The bacteria can be harvested by any means known in themselves; one can for example distribute the culture in suitable packaging and keep it in this form until use; generally, however, it is preferable to separate the bacteria from the culture medium and to concentrate them by centrifugation or by filtration. The collected bacteria can then be packaged for storage. The present invention also includes lactic sourdoughs comprising at least one strain of modified lactic acid bacteria according to the invention, and in particular leaveners capable of being obtained by the process according to the invention. These leaven can also include one or more other bacterial strains, of the same species or of different species. Several species or several different strains may have been cultivated simultaneously (if their optimal growth conditions are compatible), or else cultivated separately and brought together after harvest.

The lactic starters in accordance with the invention can be harvested and stored under the same conditions as the lactic starters of the prior art, and in particular as the lactic starters which are the subject of PCT / IB99 / 01430 Application; they have conservation and restart properties at least comparable to those of the latter.

The invention also encompasses the use of lactic starters in accordance with the invention for obtaining fermented products. In particular, the subject of the invention is a process for the preparation of a fermented product, characterized in that it comprises the inoculation of a medium to be fermented using a lactic acid starter in accordance with the invention. The invention will be further illustrated with the aid of the additional description which follows, which refers to non-limiting examples of obtaining lactic acid bacteria according to the invention. EXAMPLE 1: OBTAINING A STRAIN OF L. LACTIS EXPRESSING THE GENES NECESSARY TO PRODUCE PROTOHEM IX

The hewA (NADP (H) genes: glutamyl-tRNA reductase, SWISS-PROT access number: P16618), hemL (GSA 2, 1-aminotransferase, SWISS-PROT access number: P30949), hemB (Porphobilinogen synthase, SWISS-PROT access number: P30950), hemC (Hydroxymethylbilane synthase, SWISS-PROT access number: P16616), hemD (Uroporphyrinogen III synthase, SWISS-PROT access number: P21248), and hemE (Uroporphyrinogen decarboxylase, SWISS-PROT access number: P32395), hemY (functions

Coproporphyrinogen III oxidase and Protoporphyrinogen oxidase SWISS-PROT access number: P32397) and hemH

(ferrochelatase, SWISS-PROT access number: P32396) from

Bacillus subtilis allow the synthesis of protoheme IX from glutamyl-tRNA.

The hemACDBL genes contained in a single operon in B. subtilis are amplified by PCR from the strain 3G18 (pLUG1301) [HANSSON AND HEDERSTEDT, J. Bacteriol. , 174 (24): 8081, (1992)] using primers allowing the coding sequence of the genes to be obtained with the promoter, the ribosome binding site and the terminator: Primer sense: 5 '-GGGGAGCTCGGTATTGTCAATAGGAATGC-3', Antisense primer:

5 '-GGGGATCCGTGGGAGAGCACGAAAAA -3'.

Amplification [5 min 96 ° C, (30 s. 96 ° C, 1 min. 55 ° C, 5 min 72 ° C) 30 times] is carried out with 5 units of high-fidelity Taq polymerase (Promega) in the presence of 4 mM MgC12.

A fragment of 6500 bp is obtained. This fragment is then cloned on the plasmid pCR-TOPO (INVITROGEN) in the E. coli TOP10 strain (INVITROGEN). The plasmid obtained, called pTHem1, is digested with Spel and treated with DNA polymerase, a Klenow fragment, in order to obtain a blunt end. The plasmid pTHeml is then digested with Sac1 and the hemAXCDBL fragment is purified. It is integrated into the plasmid pIL252 previously digested with Xhol, treated with Klenow and then with Sacl [SIMON AND CHOPIN, Biochemistry, 70: 559-566, (1988)]. The resulting plasmid called pILHeml is introduced into the strain of L. lacti s MG1363

[GASSON, J. Bacteriol., 154: 1-9, (1983)]. The production of uroporphyrinogen III by this strain is determined as previously described by ANDERSON and IVANOVICS, [J.

Gen. Microbiol., 49: 31-40, (1967)]. The hemEHY genes contained in a single operon in B. subtilis are amplified by PCR from the strain 3G18 (pLUG1301) using primers allowing the coding sequence of the genes to be obtained, with or without the promoter, with the ribosome binding site and the terminator: primer sense:

5 '-GGGATCCGTATGAAAGGTGGAAATC-3', without promoter 5 '-GGGGGATCCGGCGATTTTTTGAACTTTGAGCTACA-3', with antisense primer promoter: 5 '-GGGCTCGAGACACAATATTGCCATTGCACATC-3'.

Amplification [5 min 96 ° C, (30 s. 96 ° C, 1 min. 55 ° C, 5 min 72 ° C) 30 times] is carried out with 5 units of high-fidelity Taq polymerase (Promega) in the presence of 4 mM MgC12. A fragment of 3600 bp is obtained. This fragment turns out to be unclonable in the cloning systems used in E. coli or in L. lactis. This may be due, according to the literature, to the toxicity of the hemY gene product in E. coli. By extension, it is not excluded that HemY is also toxic in L. lacti s.

The he EH genes contained in the hemEHY operon at B. subtilis are amplified by PCR from the strain 3G18 (pLUG1301) using primers allowing the coding sequence of the genes to be obtained with the πbosome binding site. primer meaning:

5 '-GGGGTACCTCTAGACCGTATGAAAGGTGGAAATCAG-3' antisense primer:

5 '-CCATCGATCTTTAACGTCCTAATTTTTTTAATAC

This fragment is then cloned on the plasmid pCR-TOPO (INVITROGEN) in the strain E. coli TOP10

(INVITROGEN). The plasmid obtained, called pTHem, is linearized by Xbal, then the ends are made blunt by the Klenow fragment of the DNA polymerase. The plasmid pTHem4 is then digested with ClaI and the hemEH fragment is purified. This fragment is then placed under the dependence of the promoter P _πιs , mductible with nisin (NICE system, patent EP0712935 by VOS and KUIPERS) on a plasmid derived from pNZ8020 previously cut with BamHI, treated with Klenow polymerase, then cut with Clal . The resulting plasmid called pGHeml is introduced into the strain of L. lactis NZ9000 containing the plasmid pILHeml. The production of protoheme IX by this strain is determined as described by SHIBATA, [Methods of biochemical analysis, D. Glick (Ed.), Interscience, New York, Vol. VII, 77-109, (1959)].

The operons hemACDBL and hemEH are used to complement corresponding mutants of B. subtilis (Bacillus Genetic Stock Center) to ensure their functionality. The strains obtained are tested for their capacity to breathe autonomously under aeration culture conditions, with or without hemme and by inducing the expression of the hemEH operon at nism. The strain used in negative control is a strain NZ9000 containing the vector plasmids alone respectively pIL252 and pGK: CmR: P _πιs . Optical density of cultures is followed at 600 nm. In aeration condition, with hemme, the DO _SO o values obtained are 2.87 for the negative control and 3.23 for the strain containing the hem genes. Without haem, the values are 2.10 for the negative control and 2.78 for the strain containing the hem genes. These results show that the introduction of hemA, he L, hemB, hemC, hemD, hemE and hemH genes from B. subtilis in L. lacti s seems sufficient to ensure heme biosynthesis and lead to a partial phenotype of respiration.

The results obtained when monitoring the growth of the L. lacti s strain containing the hemA, hemL, he B, hemC, he D, hemE and hemH genes from B. subtilis, compared to a control strain, are summarized in Table I below.

Table I

EXAMPLE 2: SCREENING FOR ISOLATION OF A STRAIN OF L. LACTIS HAVING A BETTER ABILITY TO BREATHE.

The respiration of L. lactis relies in particular on the cell's ability to assimilate the heme, an essential cofactor of respiratory activity. According to the work of KAY et al. [J. Bacteπol. 164: 1332-1336, (1985)] and ISHIGURO et al. [J Bacteπol. 164: 1233-1237, (1985)], the bacteria which accumulate the heme are also capable of fixing a dye, the red congo. The use of red congo makes it possible to isolate strains fixing the dye more or less well than the control.

Random mutagenesis is performed on the L. lacti s MG1363 strain according to the procedure of MAGUIN et al. [J. Bacteπol., 178: 931-935, (1996)]. Cells are spread on a box containing congo red at 30 μg / ml. The mother strain is used as a control.

White mutants (less binding of the dye) are isolated. These mutants assimilate the heme less efficiently than the control and are defective for respiration.

Mutants redder than the control are also isolated. These mutants, having an easier time assimilating the heme, will potentially be more able to breathe than the control.

The mutated genes can then be identified by techniques known to those skilled in the art, for example, according to the procedure of MAGUIN et al. [J. Bacteπol., 178: 931-935, (1996)]. EXAMPLE 3: OBTAINING A STRAIN OF L. LACTIS EXPRESSING THE GENES NECESSARY TO PRODUCE QUINONES.

The addition of vitamin B2 (riboflavin) in the medium M17 glucose, can stimulate the respiration of L. lactis MG1363 (increase in the biomass). In this perspective, we can increase the biomass in respiration by the production of vitamin K2 (menaqumone). This vitamin is also an essential element of the respiratory chains. Based on the chromosomal sequence of IL1403, close to MG1363, we notice that certain genes are absent compared to what is known in gram-positive bacteria (Bacillus subtilis).

The cloning of the men operon of Bacillus subtilis in L. lactis can therefore promote breathing in the latter.

The operon menFBytxMmenBEC comprises five genes (Bacillus Subtilis and others gram positive bacteria, Ed. Sonenshe, AL, Hoch JA and Losick R., ASM, W. DC): menF: menaqumone-specific 2 -ketoglutarate dehydrogenase, access number SWISS-PROT 23973 enD: 2-succinyl-6-hydroxy-2, 4-cyclohexadiene-l- carboxylate synthase, access number SWISS-PROT 23970 menB .- 1, 4 -dihydroxy-2 -naphtoic acid synthase, access number SWISS- PROT 23966 menE .- o-succinylbenzoic acid coenzyme A synthetase, SWISS-PROT access number 23971 menC: o-succinylbenzoic acid synthase, no SWISS-PROT access number.

The genes are amplified by PCR from the strain 168 [ANAGNOSTOPOULOS et al. , J. Bacteriol. 81: 741-747, (1961)] using the primers making it possible to obtain the coding sequence of the genes with the promoter and its terminator. Sense primer: 5 'GTACTGCTGCCATCAGCCC 3' Antisense primer: 5 'CCACGTCCTGTGACGAATACTCCGC 3'

The approximately 8 kilobase fragment is cloned into a multicopy plasmid of the pIL253 type (SIMON et al. Biochemistry 559-566 1988). The functionality of the genes is determined by complementation of mutants in B. subtilis [MILLER et al. , J. Bacteriol., 170: 2735-2741, (1988)]. The production of quinone is determined according to the procedure of MORISHITA et al. [J. Diary. Sci. 82: 1879-1903, (1999)].

EXAMPLE 4: ISOLATION OF MUTANT STRAINS OF L. LACTIS HAVING A BETTER ABILITY TO BREATHE.

The ability to breathe is characterized by the presence of heme in the cell. The gene coding for the catalase of a strain of Bacillus subtilis was previously cloned into L. lactis (application PCT / FR00 / 00885 in the names of 1 INRA and CEA; Inventors BRAVARD and DUWAT). Catalase needs heme for its activity. In the L. lactis strain containing the cloned catalase gene, a transposition tool, pGhost9: ISS1 (PCT application WO 93/18164) is introduced. Mutagenesis is carried out and the mutants resulting from the mutagenesis are screened for their catalase activity in the presence of a small amount of hemin. Colonies showing strong catalase activity are selected. The mutation responsible for the increase in catalase activity is identified by techniques known to those skilled in the art, for example, according to the procedure of MAGUIN et al. , [J. Bacteriol., 178: 931-935, (1996)]. The respiratory activity is tested for all mutant strains having an increased catalase activity compared to the wild strain. Among the mutant strains, those with more efficient respiration can be identified by an increase in biomass, high final pH, and / or respiration in the presence of a smaller amount of hemin. Mutants will be reconstructed, and / or the plasmid containing the catalase can be eliminated.

EXAMPLE 5: OBTAINING A STRAIN OF L. LACTIS WHOSE METABOLISM IS DRIVEN TOWARDS BREATHING. The enzymes that catalyze the breakdown of sugars for energy production are under the control of regulators. The CcpA regulator regulates the expression of several glycolytic enzymes, including phosphofructokinase, pyruvate kinase, and L-lactate dehydrogenase. A ccpA mutant, characterized in fermentation conditions, produces a reduced amount of lactate, but a greater amount of acetate and ethanol, which confirms the regulatory role of CcpA [LUESINK et al. , Molecular Microbiology 30: 789-798, (1998)]. No previous work has described the behavior of a ccpA mutant of lactic acid bacteria in breathing conditions. The inventors have hypothesized that a ccpA mutant could adopt a respiratory metabolism from the start of the culture, thereby improving the acquisition of biomass. The ability to breathe of a strain carrying a mutation in the ccpA gene is tested. CcpA mutants are obtained by either gene replacement

[LUESINK et al. , Mol. Microbiol. 30: 789-798, (1998)], or by insertion of transposon.

The strain used in this example (described by ALEKSANDRZAK et al., Food Biotechnology 17: 61-66, 2000) contains a ccpA gene inactivated by the insertion of a transposon, (but it is likely that any ccpA mutant gives rise to with similar results). The growth and the final biomass are determined in M17 medium plus glucose (1%) or BHI medium plus glucose (1%), and containing or not containing heme (10 μg / ml) and aerated or non-aerated. The mocula are prepared in M17 glucose.

The results showing the respiratory capacity of the mutant compared to the wild-type strain are illustrated by Table II below, and by Figure 1. These data indicate that the ccpA mutant has, in culture fm, a biomass and a pH greater than the wild strain.

TABLE II

ND not determined

FIG. 1 represents the growth of the ccpA mutant, compared with that of the wild strain IL1403, in BHI medium containing 1% of glucose, and under aeration conditions, in the presence or in the absence of hemin. Symbols:, ccpA + hemme; D, ccpA without hemme, - *, IL1403 + hemme; Δ, IL1403 without hemme.

For the preparation of sourdoughs, the ccpA gene can also be placed under the control of a mductible promoter. Culture of bacteria for leaven preparation is carried out under conditions which do not induce the promoter, and ccpA is not expressed. The use of the leaven can be carried out under conditions inducing the promoter, and thus allowing the restoration of the expression of ccpA, producing a strain having activities equivalent to those of the wild strain.

Claims

CLAIMS 1) Recombinant lactic acid bacteria genetically modified in order to give it a respiratory metabolism, or to activate said metabolism. 2) Lactic acid bacteria according to claim 1, characterized in that it has undergone at least one genetic modification consisting in the addition of at least one gene coding for a protein involved in respiratory metabolism or promoting said metabolism.

3) lactic acid bacteria according to any one of claims 1 or 2, characterized in that it has undergone at least one modification resulting in the overexpression of at least one gene coding for a protein intervening in the respiratory metabolism and / or a modification resulting by activating at least one protein involved in respiratory metabolism or promoting said metabolism.

4) lactic acid bacteria according to any one of claims 1 to 3, characterized in that it has undergone at least one modification resulting in 1 mactivation total or partial, of at least one gene coding for a protein intervening in the fermentative metabolism or promoting said metabolism, and / or at least one modification resulting in the under-expression, of at least one gene coding for a protein intervening in fermentative metabolism or promoting said metabolism.

5) lactic acid bacteria according to claim 2, characterized in that said gene is chosen from: - genes coding for proteins of the heme biosynthesis pathway;

- the genes coding for proteins of the biosynthetic pathway of cytochromes;

- the genes coding for proteins of the Krebs cycle. 6) Lactic acid bacteria according to claim 3, characterized in that said gene is chosen from:

- genes regulating the metabolic pathways favoring the respiratory tract; - enzymes of the biosynthetic pathway of cytochromes; genes coding for hemimic proteins.

7) A lactic acid bacterium according to claim 4, characterized in that said gene is chosen from the ccpA gene and the gls24 gene.

8) lactic acid bacteria according to any one of claims 1 to 7, characterized in that it is chosen from bacteria of the genera Lactococcus, Lactobacillus, Leuconostoc, Streptococcus,

Propionibacterium, Bifidobacterium, or Enterococcus.

9) Lactic acid bacteria according to any one of claims 1 to 3, characterized in that it is a strain of the species Lactococcus or Streptococcus transformed by at least one gene coding for a protein of the biosynthetic pathway of l heme.

10) A method of bacterial culture, characterized in that it comprises the culture of at least one strain of lactic acid bacteria according to any one of claims 1 to 9, under conditions allowing one induction of respiratory metabolism in said strain.

11) Culture method according to claim 10, characterized in that it is implemented for the production of a lactic acid starter, and that it comprises the harvesting of bacteria at the end of said culture.

12) Lactic sourdough comprising at least one strain of lactic acid bacteria transformed according to any one of claims 1 to 9. 13) Process for the preparation of a fermented product, characterized in that it comprises seeding a medium to be fermented using a lactic acid starter according to claim 12.

14) Use of a lactic acid starter according to claim 12 for the preparation of a fermented product.

15) From a recombinant lactic sourdough, having the breathing properties according to claims 1 to 9, the introduction of a gene encoding any protein of interest. 16) Use of the strain described in claim 15 under breathing conditions for the production of said heterologous protein.