AU7529300A - Lactic acid bacteria transformed to be provided with respiratory metabolism, and ferments comprising said lactic acid bacteria - Google Patents

Description

WO 01/21808 PCT/FROO/02611 LACTIC ACID BACTERIA TRANSFORMED TO BE PROVIDED WITH A RESPIRATORY METABOLISM The present invention relates to the enhancing of the 5 preservation and acidification properties of lactic starter culture. The expression "lactic starter culture" denotes any preparation intended for inoculating a medium to be 10 fermented, and comprising at least one strain of lactic acid bacteria belonging in particular to one of the genera Lactococcus, Streptococcus, Enterococcus, Leuconostoc, Lactobacillus, Propionibacteria, or Bifidobacteria, or a mixture of strains belonging to 15 one or more of the abovementioned genera. The lactic starter cultures used in particular to produce fermented foods and silage products are usually prepared in batch culture, and are then concentrated 20 and packaged for subsequent use so as to inoculate various food products for the purpose of their fermentation. One of the concerns of producers of starter cultures is to obtain a large bacterial biomass, and to maintain good viability of the bacteria 25 during storage so that, during inoculation, the fermentation starts rapidly and gives food products possessing reproducible characteristics. However, numerous causes of stress can occur during the 30 different stages of preparation of starter cultures and impair the survival of the lactic acid bacteria. In particular, bacterial viability can be rapidly lost if the cultures are maintained in stationary phase. One of the causes thereof is the accumulation, in the medium, 35 of natural products of bacterial metabolism, in particular organic acids such as lactic acid, which cause a reduction in pH which is damaging to bacterial growth. Another cause of loss of viability during -2 preparation and storage is the presence of oxygen, which is :acteria bacteria indeed have in common fermentation-based carbohydrate metabolism. BERGEY's manual, 9th Edition, 5 published by HOLT et al. (1994) WILLIAMS and WILKINS Eds. To limit the reduction in pH, culture media buffered at around pH 6 with cations combined with carbonates, 10 hydroxides, phosphates or oxides are normally used for the production of lactic starter cultures. However, these additions to the culture medium can cause problems for subsequent productions, for example by promoting the development of phages, or by increasing 15 the solubility of caseins. To avoid the toxic effects of oxygen, the preparation and storage of starter cultures are normally carried out under anaerobic conditions; for example, during the 20 preparation of batch cultures of starter cultures, some stages are carried out under nitrogen in order to eliminate traces of oxygen. However, during the use of starter cultures, the latter are frequently exposed to high levels of oxygen. For example, the milk which is 25 used for the preparation of fermented dairy products is highly aerated during the transfer processes and is therefore high in oxygen. This could constitute a cause for the slowing down of the restarting of the starter cultures. 30 It has been reported [A.K. SIJPESTEIJN, Antonie von Leeuwenhoek 36: 335, 1970] that Lactococcus and Leuconostoc cultured in the presence of heme and under aeration produce cytochromes and possess a respiratory 35 metabolism. More recent studies [KANEKO et al. Appl. Environ. Microbiol., 56: 9, 2644-2649 (1990)] report an improvement in the proliferation of a strain of -3 Lactococcus lactis diacetylactis, cultured in the preserc h c.o./or Cu". Tnese autnor ciad --E attribute this effect to the appearance of a respiratory metabolism, but to the activation of 5 diacetyl synthase by hemin and/or Cu 2 ,, which would preferentially orient the fermentative metabolism toward the production of diacetyl, at the expense of lactate. 10 The Inventors' team has recently discovered that, in the context of the preparation of lactic starter cultures, the use of a porphyrin compound combined with an anaerobic culture made it possible to obtain greater bacterial growth than that obtained during conventional 15 procedures, and that, in addition, the percentage of viable bacteria in the bacteria population and the survival time were also much higher. Furthermore, when the starter cultures obtained in this manner are used to inoculate a product to be fermented, a very rapid 20 restarting of growth and of bacterial fermentation is observed, resulting in a much more rapid acidification of the product than that observed with conventional starter cultures. These studies are described in international application PCT/IB99/01430 (PCT WO 25 00/05342) in the name of INRA. The Inventors have now shown that the improvements in bacterial yield and viability during storage were due to the acquisition of a respiratory metabolism by 30 L. lactis during the culture under aeration and in the presence of a porphyrin compound. During the inoculation of the product to be fermented, the bacteria are, in addition, capable of immediately restoring a fermentative metabolism, which results in 35 an increase in the restarting performance. Respiratory metabolism requires the presence of the enzymatic package involved in various metabolic pathways, in particular the synthesis and the use of -4 heme, the synthesis of cytochromes, and probably the synthesis of at least part of the tricarboxylic acid cycle (Krebs cycle). 5 Using primers derived from the alignment of sequences of genes known to be involved in respiration in other bacteria, the Inventors have searched for the presence of homologous genes in L. lactis. They have thus identified three genes encoding ferrochelatase (enzyme 10 involved in the biosynthesis of heme by catalyzing the formation of a complex between iron and a porphyrin compound which is a precursor of heme, it being possible for the complex thus formed to be incorporated into bacterial cytochromes), cytochrome D oxidase (a 15 hemoprotein necessary for respiration) , and aconitase (enzyme involved in the Krebs cycle), respectively. They have, in addition, shown that the genes encoding cytochrome D oxidase and ferrochelatase were functional 20 in L. lactis. They indeed observed that bacteria in which the gene for cytochrome D oxidase is inactive no longer exhibit respiratory metabolism when they are cultured under aerobic conditions and in the presence of an iron-containing porphyrin compound. Similarly, 25 they observed that the inactivation of the gene encoding ferrochelatase resulted in the loss of the respiratory metabolism capacities of L. lactis in the case of cultures carried out in the presence of a porphyrin compound not containing iron, such as 30 protoporphyrin, but not in the case of cultures carried out in the presence of an iron-containing porphyrin compound such as heme. These observations confirm that the improvement in the 35 performance of lactic starter cultures which is obtained by preparing these starter cultures under aerobic conditions and in the presence of a porphyrin compound, described in application PCT/IB99/01430, is linked to the appearance of a respiratory metabolism 5 under these culture conditions. The results of the inventors demonstrate in particular that lactic acid bacteria, represented by L. lactis, possess the capacity to grow via a fermentative or 5 respiratory mechanism. The method of growth depends on the culture conditions, but also on the signals transmitted by the cell itself. The metabolism appears to be rather fermentative at the 10 beginning of growth, and then becomes respiratory once the bacteria are in late exponential growth. The Inventors have, in addition, made the hypothesis that regulation of this transition, exerted by the bacterium, existed and that impairment of this 15 regulation, brought about by the inactivation or by the overexpression of a regulatory gene which controls the transition between fermentative and respiratory growth, can have, as a result, a more effective respiration. 20 The aim of the present invention is to provide means of conferring a respiratory metabolism on lactic acid bacteria, or of promoting it, in particular so as to improve the performance of lactic starter cultures in a manner comparable to that previously observed during 25 the addition of heme (or of other molecules derived from porphyrins). In accordance with the present invention, this aim can be achieved by causing or by promoting the expression, 30 in a lactic acid bacterium, of at least one protein participating in this metabolism, by modifying the genomic profile of the lactic acid bacterium, either by transferring, to a lactic acid bacterium, one or more genes for respiratory metabolism, cloned from an 35 aerobic bacterium, or by inactivating or overexpressing a gene of the initial bacterium, so as to tip the metabolism toward the respiratory pathway. The subject of the present invention is a lactic acid -6 bacterium which has been genetically modified so as to be prov-L-ci wi"-'. resp- .- .a-.-5M, or to activate said metabolism. 5 This encompasses in particular any lactic acid bacterium which has undergone at least one modification consisting in the addition of at least one gene encoding a protein involved in respiratory metabolism or promoting said metabolism, and/or at least one 10 modification resulting in the activation of at least one protein involved in respiratory metabolism or promoting said metabolism, and/or at least one modification resulting in the overexpression of at least one gene encoding a protein involved in 15 respiratory metabolism or promoting said metabolism, and/or at least one modification resulting in the complete or partial inactivation of at least one gene encoding a protein involved in fermentative metabolism or promoting said metabolism, and/or at least one 20 modification resulting in the underexpression of at least one gene encoding a protein involved in fermentative metabolism or promoting said metabolism. A modification resulting in the addition of at least 25 one gene encoding a protein involved in respiratory metabolism, or promoting it, may be obtained by transforming said lactic acid bacterium with at least one heterologous gene (that is to say a gene which is not naturally present in said bacterium) which is 30 involved in respiratory metabolism. This may include, in particular, a gene derived from an aerobic bacterium and involved in respiratory metabolism. Said gene may in particular be chosen from, - the genes encoding proteins of the heme 35 biosynthesis pathway; - the genes encoding proteins of the cytochrome biosynthesis pathway; - the genes encoding hemin proteins; - the genes encoding proteins of the Krebs cycle.

-7 A modification resulting the overactivation or a protein involved in respiratory metabolism or promoting it may, for example, be obtained by introducing, into 5 the gene encoding this protein, a mutation resulting in a more active protein. A modification resulting in the overexpression of at least one gene encoding a protein involved in respiratory metabolism, or promoting it, may for example be obtained by transforming said lactic 10 acid bacterium with at least one additional copy of said gene, and/or by acting on the cis or trans regulation of this gene, for example by placing said gene under the control of elements for regulation of expression allowing greater expression (for example 15 strong promoter, constitutive promoter, transcription enhancer, and the like) and/or by inactivating elements for negative regulation of expression which are combined with said gene (repressor, attenuator, and the like). 20 For example, it is thus possible to overactivate and/or overexpress one or more genes chosen from: - genes regulating metabolic pathways promoting the respiratory pathway; 25 - enzymes of the cytochrome biosynthesis pathway; - genes encoding hemin proteins. A modification resulting in the complete or partial inactivation of at least one gene encoding a protein 30 involved in fermentative metabolism, or promoting it, may be obtained in particular by deleting all or part of said gene, or by introducing a mutation resulting in the production of a less active or an inactive protein. A modification resulting in the underexpression of at 35 least one gene encoding a protein involved in fermentative metabolism, or promoting it, may for example be obtained by acting on the cis or trans regulation of this gene, for example by placing said gene under the control of elements for negative -8 regulation of expression (for example repressor, a a~ and/or by partially o: completely inactivating the elements for positive reg-ulation of expression (for example promoter, 5 transcription enhancer, and the like) combined with said gene, or by making this expression inducible. By way of nonlimiting example of activation or overexpression of a gene encoding a protein involved in 10 respiratory metabolism, or promoting it, there may be mentioned in particular: - an activation of one or more genes involved in the assimilation of heme, or a modification increasing the expression of said gene(s) and/or making it 15 constitutive. This allows the production of a strain having an earlier and/or a more effective assimilation of heme, which is desirable in cases where the availability of 20 heme constitutes a limiting step for a respiratory metabolism. In this case, the switch between a fermentative metabolism and a respiratory metabolism can be 25 controlled by modifying the oxygen content of the culture medium and by the presence of heme. Nonlimiting examples of inactivation or underexpression of genes encoding proteins involved in fermentative 30 metabolism, or promoting it, are in particular: - an inactivation of the ccpA gene, or a modification attenuating its expression or making it inducible. The ccpA gene regulates the expression of several genes involved in the 35 catabolism of sugars [LUESINK et al., Molecular Microbiology 30: 789-798, (1998)]. The inventors made the hypothesis that its inactivation could promote the expression of the genes necessary for respiration; -9 - an inactivation of the gls24 gene or a -. dlification attenuating its expression or making it inducible. A study in Enterococcus faecalis describes the gls24 gene, which represses the 5 expression of the genes encoding L-lactate dehydrogenase, lipoamide dehydrogenase, pyruvate decarboxylase, all of which are involved in metabolism [GIARD et al. J. Bacteriol. 182: 4512 4520, (2000)]. A gene analogous to gls24 exists in 10 L. lactis. The inventors made the hypothesis that a mutant of L. lactis where gls24 is inactive could be advantaged with respect to respiration. According to a preferred embodiment of the present 15 invention, said lactic acid bacterium is chosen from bacteria of the genera Lactococcus, Streptococcus, Enterococcus, Leuconostoc, Lactobacillus, Propioni bacteria, or Bifidobacteria. Preferred bacteria are those of the different species of the genus 20 Lactococcus, as well as streptococci of the species Streptococcus thermophilus. For a given bacterial species, the appropriate gene(s) for conferring on the bacteria all or part of the 25 enzymatic package necessary for the acquisition of a respiratory metabolism or for enhancing respiration may be, for some genes, identified by persons skilled in the art from the information on the sequences of the bacterial genomes available on databases, which makes 30 it possible to identify the genes already present in a given microorganism and the metabolic pathways in which these genes may participate. In the absence of the genomic sequence of the bacterial species of interest, the sequence(s) of one or more related species can be 35 used to determine which genes are probably present. For example, the complete or practically complete sequences of the genome of several- species of streptococci (Streptococcus mutans and Enterococcus [previously Streptococcus] faecalis) as well as other Gram-positive 10 bacteria are currently available, and reveal the r c 2 sevra of the aenes re aired for respiration. These species are phylogenetically fairly closely related to lactic acid bacteria, commonly used 5 in the food industry, such as thermophilic streptococci, and are also related to lactococci. Thus, the transformation of bacteria of the species Lactococcus or Streptococcus with one or more genes 10 encoding one or more proteins of the heme biosynthesis pathway can make it possible to obtain bacteria possessing a respiratory metabolism without the need to add porphyrin derivatives to the culture medium. 15 The desired genes may be obtained from a strict aerobic bacerium, or from a facultative aerobic bacterium. They can be easily identified from the bacterial genomes available on databases. For example, it is possible to use genes obtained from Bacillus subtilis, which is an 20 aerobic bacterium, and whose complete genomic sequence has been published. It is thus possible to provide a lactic acid bacterium with all the genes necessary to confer a respiratory 25 metabolism. It is also possible, if desired, to provide only a portion of these genes, for example so as to be able to control, in different ways, the conditions under which the bacterium would be capable of respiration. 30 It is thus possible to construct, by way of nonlimiting examples: - a lactic acid bacterium possessing all the genes necessary for respiratory metabolism; the switch 35 between a fermentative metabolism and a respiratory metabolism may be controlled by modifying the oxygen content of the culture medium; - a lactic acid bacterium possessing all the genes -11 encoding the Krebs cycle proteins and all the genes of the heme biosynthesis pathway; the switch from a fermentative metabolism to a respiratory 5 metabolism will then require, in addition to the aeration of the medium, the addition of heme or of one of its precursors. For the production of a transformed lactic acid 10 bacterium in accordance with the invention, the desired gene(s) may be introduced separately, or at least some of them may be grouped into one or more operons. For example, to provide L. lactis with the total or 15 partial capacity to biosynthesize heme, one or both B. subtilis heme operons or only some of the genes present on these operons may be transferred into L. lactis. To obtain lactic acid bacteria in accordance with the 20 invention, it is also possible to promote the expression of genes involved in respiratory metabolism which are already naturally present in said bacteria. This may be carried out, for example, by acting on the cis or trans regulation of the activity of these genes. 25 In addition to the abovementioned genetic modifications, which make it possible to provide them with a respiratory metabolism, or to promote said metabolism, the lactic acid bacteria in accordance with 30 the invention may comprise, in addition to other modifications, in particular the introduction of one or more nucleic acid sequences allowing them produce substances of interest. 35 Lactic acid bacteria in accordance with the invention may be obtained using conventional genetic engineering techniques known per se to persons skilled in the art. For the cloning of the genes, the desired gene(s) may - 12 be combined with sequences for the control of transcription and of translation which are func:unal in the lactic acid bacterium which it is desired to transform. It is possible in particular, if desired, to 5 place one or more of the transferred genes under transcriptional control of an inducible promoter, in order to allow control of the switch between fermentative metabolism and respiratory metabolism. 10 The constructs prepared are placed in an appropriate vector in order to introduce them into the relevant lactic acid bacterium. Vectors which can be used for transforming lactic acid bacteria of different species, and which make it possible either to maintain the 15 genetic information introduced in the form of a stable independent replicon, or to integrate it into the bacterial chromosome, are known per se. The integration into the bacterial chromosome may be carried out by transposition, or by a method for replacing genes by 20 homologous recombination, according to methods known per se to persons skilled in the art. By way of nonlimiting examples of methods which can be used and of vectors allowing the implementation of these methods, there may be mentioned in particular the 25 methods and vectors described in PCT application WO 93/18164 in the name of INRA. In the cases where the quantity of genetic information to be transferred requires the introduction of large 30 segments of DNA, it is possible to use protoplast fusion or bacterial conjugation techniques. Lactic acid bacteria in accordance with the invention may also be produced by selection of mutants, which are 35 natural or which are obtained by random mutagenesis, in which the activity and/or the expression of a protein involved in fermentative metabolism, or promoting it, is reduced or nonexistant, or from the selection of mutants in which the activity and/or the expression of 13 a protein involved in respiratory metabolism is increased. The functioning of respiratory metabolism in the 5 modified bacterium in accordance with the invention may be checked by culturing said bacterium under conditions allowing the induction of a respiratory metabolism (that is to say under aeration, and optionally under conditions for inducing one or more inducible promoters 10 optionally controlling the expression of one or more of the transferred genes and/or in the presence of heme or of one or its precursors in the case where the transformed bacterium does not contain all the genes of the heme biosynthesis pathway, and the like), and by 15 measuring the following parameters: i) the pH of the final culture, ii) the products consumed or formed during the period of culture (for example the oxygen consumed, the production of fumarate or that of lactate, the total quantity of carbon at the end of 20 culture, which makes it possible in particular to evaluate the production of CO 2 during respiration, and the like) , iii) the bacterial population at the end of growth, iv) the survival during long storage, and v) the reacidification properties when the transformed 25 strain is used as starter (starter culture) for fermentation. If desired, a detection of heme in the cells, or of the activity of the proteins requiring heme to function (such as, for example, cytochromes), may be carried out. 30 Modified strains of lactic acid bacteria in accordance with the invention, when they are cultured under aerobic conditions, exhibit substantial growth, which makes it possible to propose their use as host cells in 35 the context of conventional methods for producing substances of interest by genetic engineering. The object of the present invention is also a method for culturing lactic acid bacteria, characterized in - 14 that it comprises the culture of at least one strain of lactic acid bacterium in accordance with the invention under conditions allowing the induction of a respiratory metabolism in said strain. 5 Said conditions for inducing respiratory metabolism comprise aeration of the culture; advantageously, this aeration is carried out so as to maintain, during the entire period of culture, an oxygen supply equal to at 10 least 5 millimoles per liter of culture medium. According to the characteristics of the strain in accordance with the invention which is used, and in particular according to its capacity to assimilate 15 heme, or to carry out the biosynthesis thereof, said conditions for inducing respiratory metabolism may also comprise the addition of a porphyrin derivative to the culture medium as described in application PCT/IB99/01430. 20 Most advantageously, the strains of lactic acid bacteria in accordance with the invention may be used for the production of lactic starter cultures. 25 In this case, the method in accordance with the invention comprises, in addition, the harvesting of the bacteria at the end of said culture, and, optionally, their packaging and their storage, by any appropriate means. 30 The bacteria may be harvested by any means known per se; it is possible, for example, to distribute the culture into appropriate packaging and to preserve it in this form up to the time of use; generally, it will 35 be preferable, however, to separate the bacteria from the culture medium and to concentrate them by centrifugation or by filtration. The harvested bacteria can then be packaged with a view of their preservation.

- 15 The present invention also encompasses the lactic one modified straw ca m a-C-rdance with the invention, and in particular starter cultures which can 5 be obtained by the method in accordance with the invention. These starter cultures may also comprise one or more other bacterial strains, of the same species or of 10 different species. Several different species or several different strains may have been cultured simultaneously (in the case where their optimum growth conditions are compatible), or cultured separately and combined after harvest. 15 The lactic starter cultures in accordance with the invention may be harvested and preserved under the same conditions as the lactic starter cultures of the prior art, and in particular as the lactic starter cultures 20 which are the subject of application PCT/IB99/01430; they possess preservation and restarting properties which are at least comparable to those of the latter. The invention also encompasses the use of the lactic 25 starter cultures in accordance with the invention for the production of fermented products. In particular, the subject of the invention is a method for preparing a fermented product, characterized in that it comprises the inoculation of a medium to be fermented using a 30 lactic starter culture in accordance with the invention. The invention will be further illustrated using the additional description which follows, which refers to 35 nonlimiting examples of obtaining lactic acid bacteria in accordance with the invention. EXAMPLE 1: PRODUCTION OF A STRAIN OF L. LACTIS EXPRESSING THE GENES NECESSARY FOR PRODUCING PROTOHEME - 16 Ix hemA gene (NADP(H) :glutamyl-tRNA reductase, SWISS-PROT accession number: P16616) , hemL gene (GSA 2,1-amino 5 transferase, SWISS-PROT accession number: P30949), hemB gene (porphobilinogen synthase, SWISS-PROT accession number: P30950), hemC gene (hydroxymethylbilane synthase, SWISS-PROT accession number: P16616), hemD gene (uroporphyrinogen III synthase, SWISS-PROT 10 accession number: P21248), and hemE gene (uropor phyrinogen decarboxylase, SWISS-PROT accession number: P32395), hemY gene (coproporphyrinogen III oxidase and protoporphyrinogen oxidase functions, SWISS-PROT accession number: P32397) and hemH gene (ferro 15 chelatase, SWISS-PROT accession number: P32396) of Bacillus subtilis allow the synthesis of protoheme IX from glutamyl-tRNA. The hemACDBL genes contained in a single operon in 20 B. subtilis are amplified by PCR from the strain 3G18 (pLUG1301) [HANSSON AND HEDERSTEDT, J. Bacteriol., 174 (24) : 8081, (1992)1 using primers which make it possible to obtain the coding sequence of the genes with the promoter, the ribosome-binding site and the 25 terminator: Sense primer: 5' -GGGGAGCTCGGTATTGTCAATAGGAATGC-3'. Antisense primer: 5' -GGGGATCCGTGGGAGAGCACGAAAAA-3'. 30 The amplification [5 min 96 0 C, (30 s 96 0 C, 1 min 55*C, 5 min 72 0 C) 30 times] is carried out with 5 units of high fidelity Taq polymerase (promega) in the presence of 4 mM of MgCl 2 . 35 A fragment of 6 500 bp is obtained. This fragment is then cloned into the plasmid pCR-TOPO (INVITROGEN) in the E. coli TOP10 strain (INVITROGEN). The plasmid obtained, called pTHem1, is digested with SpeI and - 17 end. The plasm -,nl is digested with SacI and the hemAXCDBL fragment is purified. It is integrated into the plasmid pIL252 5 previously digested with XhoI, treated with Klenow and then with SacI [SIMON AND CHOPIN, Biochimie, 70: 559 566, (1988)1. The resulting plasmid, called pILHemi, is introduced into the L. lactis MG1363 strain [GASSON, J. Bacteriol., 154: 1-9, (1983)]. The production of 10 uroporphyrinogen III by this strain is determined as previously described by ANDERSON and IVANOVICS, (J. Gen. Microbiol., 49: 31-40, (1967)]. The hemEHY genes contained in a single operon in 15 B. subtilis are amplified by PCR from the strain 3G18 (pLUG1301) using primers which make it possible to obtain the coding sequence of the genes with or without the promoter, with the ribosome-binding site and the terminator: 20 sense primer: 5' -GGGATCCGTATGAAAGGTGGAAATC-3', without promoter 5' -GGGGGATCCGGCGATTTTTTGAACTTTGAGCTACA-3' , with promoter antisense primer: 5'-GGGCTCGAGACACAATATTGCCATTGCACATC-3' . 25 The amplification [5 min 96 0 C, (30 s 96 0 C, 1 min 55 0 C, 5 min 720C) 30 times] is carried out with 5 units of high fidelity Taq polymerase (promega) in the presence of 4 M of MgCl 2 . A fragment of 3 600 bp is obtained. 30 This fragment proves to be unclonable into the cloning systems used in E. coli or in L. lactis. This may be due, according to the literature, to the toxicity of the product of the hemY gene in E. coli. By extension, it is not impossible that HemY could also be toxic in 35 L. lactis. The hemEH genes contained in the hemEHY operon in B. subtilis are amplified by PCR -from the strain 3G18 (pLUG1301) using primers which make it possible to - 18 obtain the coding sequence of the genes with the Sense primer: 5' -GGGGTACCTCTAGACCGTATGAAAGGTGGAAATCAG- 3' 5 Antisense primer: 5' -CCATCGATCTTTAACGTCCTAATTTTTTTAATAC This fragment is then cloned into the plasmid pCR-TOPO (INVITROGEN) in the E. coli TOP10 strain (INVITROGEN) . 10 The plasmid obtained, called pTHem4, is linearized with XbaI, and then the ends are made blunt by the Klenow fragment of DNA polymerase. The plasmid pTHem4 is then digested with ClaI and the hemEH fragment is purified. This fragment is then placed under the control of the 15 promoter Pois, which is inducible with nisin (NICE system, patent EP0712935 by VOS and KUIPERS), in a plasmid derived from pNZ8020 previously cleaved with BamHI, treated with Klenow polymerase, and then cleaved with ClaI. The resulting plasmid, called pGHeml, is 20 introduced into the L. lactis NZ9000 strain containing the plasmid pILHeml. The production of protoheme IX by this strain is determined as described by SHIBATA, [Methods of biochemical analysis, D. Glick (Ed.), Interscience, New York, Vol. VII, 77-109, (1959)]. 25 The hemACDBL and hemEH operons are used to complement corresponding mutants of B. subtilis (Bacillus Genetic Stock Center) so as to ensure their functionality. 30 The strains obtained are tested for their capacity for autonomous respiration under aeration culture conditions, with or without hemin and by inducing the expression of the hemEH operon with nisin. The strain used as negative control is a strain NZ9000 containing 35 the vector plasmids alone pIL252 and pGK:CmR:Pn 1 , respectively. The optical density of the cultures is monitored at 600 nm. Under aeration condition, with hemin, the OD 600 values obtained are 2.87 for the negative control and 3.23 for the strain containing the - 19 hem genes. Without hemin, the values are 2.10 for the eo for the strain containing the hem genes. These results show that the introduction of the B. subtilis hemA, hemL, hemB, hemC, hemD, hemE and 5 hemH genes into L. lactis seems sufficient to bring about the biosynthesis of heme and lead to a partial respiratory phenotype. The results obtained during the monitoring of the 10 growth of the L. lactis strain containing the B. subtilis hemA, hemL, hemB, hemC, hemD, hemE and hemH genes, compared with a control strain, are summarized in table I below. 15 Table I Optical density A6 0 o (biomass) Culture conditions Control (without hem genes) : Cloned hem genes: L.lactis NZ9000 L. lactis NZ9000 (pIL252:pGK:CmR:pn 1 s) (pILHeml:pGHeml) Aeration, nisin 2.1 2.8 without hemin Aeration, nisin 2.9 3.2 plus hemin EXAMPLE 2: SCREENING FOR THE ISOLATION OF AN L. LACTIS STRAIN HAVING A BETTER RESPIRATORY CAPACITY 20 The respiration of L. lactis depends in particular on the capacity of the cell to assimilate hemin, an essential cofactor for the respiratory activity. According to the studies by KAY et al. [J. Bacteriol. 164: 1332-1336, (1985)] and ISHIGURO et al. [J. 25 Bacteriol. 164: 1233-1237, (1985)], bacteria which accumulate hemin are also capable of binding a dye, Congo red. The use of Congo red makes it possible to isolate strains binding the dye to greater or lesser degree than the control. 30 Random mutagenesis is carried out on the L. lactis - 20 MG1363 strain according to the procedure by MAGUIN 93r-935, (1996)] . The cells are plated on a dish containing Congo red at 30 pg/ml. The mother strain is used as control. 5 White mutants (binding the dye less) are isolated. These mutants assimilate hemin less efficiently than the control and are respiration deficient. 10 Mutants which are redder than the control are also isolated. These mutants, which find it easier to isolate hemin, will be potentially more capable of respiration than the control. 15 The mutated genes may then be identified by techniques known to persons skilled in the art, for example according to the procedure by MAGUIN et al. [J. Bacteriol., 178: 931-935, (1996)]. 20 EXAMPLE 3: PRODUCTION OF AN L. LACTIS STRAIN EXPRESSING THE GENES REQUIRED TO PRODUCE QUINONES The addition of Vitamin B2 (riboflavin) to the M17 glucose medium can stimulate respiration in L. lactis 25 MG1363 (increase in the biomass) . For this purpose, it is possible to increase the biomass undergoing respiration by the production of Vitamin K2 (menaquinone). This vitamin is also an essential component of the respiratory chains. Based on the 30 chromosomal sequence of IL1403, which is close to MG1363, it is observed that some genes are absent in relation to what is known in Gram-positive bacteria (Bacillus subtilis). 35 The cloning of the Bacillus subtilis men operon into L. lactis can therefore promote respiration in the latter. The menFBytxMmenBEC operon comprises five genes (Bacillus - 21 subtilis and other Gram-positive bacteria, Ed. Sonenshein, menF: menaquinone-specific 2-ketoglutarate dehydrogenase, SWISS-PROT accession number 23973 5 menD: 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1 carboxylate synthase, SWISS-PROT accession number 23970 menB: 1,4-dihydroxy-2-naphthoic acid synthase, SWISS-PROT accession number 23966 menE: o-succinylbenzoic acid coenzyme A synthase, SWISS 10 PROT accession number 23971 menC: o-succinylbenzoic acid synthase, no SWISS-PROT accession number. The genes are amplified by PCR from the strain 168 15 [ANAGNOSTOPOULOS et al., J. Bacteriol. 81: 741-747, (1961)] using primers which make it possible to obtain the coding sequence of the genes with the promoter and its terminator. Sense primer: 20 5' GTACTGCTGCCATCAGCCC 3' Antisense primer: 5' CCACGTCCTGTGACGAATACTCCGC 3' The fragment of about 8 kilobases is cloned into a 25 multicopy plasmid of the pIL253 type (SIMON et al. Biochimie 559-566 1988) . The functionality of the genes is determined by complementation of men mutants in B. subtilis [MILLER et al., J. Bacteriol., 170: 2735 2741, (1988)] . The production of quinone is determined 30 according to the procedure by MORISHITA et al., [J. Diary. Sci. 82: 1879-1903, (1999)]. EXAMPLE 4: ISOLATION OF THE MUTANT STRAINS OF L. LACTIS HAVING A BETTER RESPIRATORY CAPACITY 35 The respiratory capacity is characterized by the presence of heme in the cell. The gene encoding catalase of a Bacillus subtilis strain has been previously cloned into L. lactis (application - 22 PCT/FR00/00885 in the names of INRA and CEA; Inventors activity. Into the L. lactis strain containing the cloned gene for catalase, a tool for transposition, 5 pGhost9:ISS1 (PCT application WO 94/18164), is introduced. Mutagenesis is performed and the mutants derived from the mutagenesis are screened for their catalase activity in the presence of a small quantity of hemin. The colonies demonstrating a high catalase 10 activity are selected. The mutation responsible for the increase in the catalase activity -is identified by techniques known to persons skilled in the art, for example according to the procedure by MAGUIN et al., [J. Bacteriol., 178: 931-935, (1996)]. The respiratory 15 activity is tested for all the mutant strains having an increased catalase activity compared with the wild-type strain. Among the mutant strains, those having a more efficient respiration can be identified by an increase in biomass, high final pH, and/or respiration in the 20 presence of a smaller quantity of hemin. Mutants will be reconstructed, and/or the plasmid containing catalase can be eliminated. EXAMPLE 5: PRODUCTION OF AN L. LACTIS STRAIN WHOSE 25 METABOLISM IS DIVERTED TO RESPIRATION The enzymes which catalyze the degradation of sugars for the production of energy are under the control of regulators. The regulator CcpA regulates the expression 30 of several glycolitic enzymes, including phosphofructokinase, pyruvate kinase and L-lactate dehydrogenase. A ccpA mutant, characterized under fermentation conditions, produces a reduced quantity of lactate, but a larger quantity of acetate and of 35 ethanol, which confirms the regulatory role of CcpA (LUESINK et al., Molecular Microbiology 30: 789-798, (1998)] . No previous work describes the behavior of a ccpA mutant of lactic acid bacteria under respiratory conditions. The inventors made the hypothesis that a - 23 ccpA mutant could adopt a respiratory metabolism from the start of the culture, thus improving biomass acquisition. 5 The respiratory capacity of a strain carrying a mutation in the ccpA gene is tested. ccpA mutants are obtained either by gene replacement [LUESINK et al., Mol. Microbiol. 30: 789-798, (1998)], or by transposon insertion. 10 The strain used in this example (described by ALEKSANDRZAK et al., Food Biotechnology 17: 61-66, 2000) contains a ccpA gene inactivated by the insertion of a transposon, (but it is probable that any ccpA 15 mutant gives similar results). The growth and the final biomass are determined in M17 plus glucose (1%) medium or BHI plus glucose (1%) medium, and containing or otherwise hemin (10 pg/ml) and aerated or not aerated. The inocula are prepared in M17 glucose. 20 The results showing the respiratory capacity of the mutant relative to the wild-type strain are illustrated by.table II below, and by figure 1. These data indicate that the ccpA mutant has, at the end of the culture, a 25 biomass and a pH greater than the wild-type strain. Table II Strain Growth conditions Optical density Final pH

A

600 (biomass) M17 BHI M17 BHI ccpA (derived without aeration 2.3 ND 5.2 ND from the aeration without hemin 2.8 2.7 5.2 4.2 IL1403 strain) aeration plus hemin 3.6 5 5.6 5.3 IL1403 (wild without aeration 2.3 ND 5.2 ND type) aeration without hemin 2.6 1.5 5.2 4.2 aeration plus hemin 3.2 3.9 5.4 4.5 ND: not determined 30 Figure 1 represents the growth of the ccpA mutant, - 24 relative to that of the wild-type strain IL1403, in BHI conditions, in the presence or in the absence of hemin. Symbols: 0, ccpA + hemin; E, ccpA without hemin; 5 +, IL1403 + hemin; A, IL1403 without hemin. For the preparation of starter cultures, the ccpA gene may also be placed under the control of an inducible promoter. The culture of bacteria for the preparation 10 of the starter culture is carried out under conditions which do not induce the promoter, and ccpA is not expressed. The use of the starter culture may take place under conditions inducing the promoter, and thus allowing the restoration of the expression of ccpA, 15 producing a strain having activities equivalent to those of the wild-type strain.

Claims (16)

1. A recombinant lactic acid bacterium which has been genetically modified so as to provide it with a 5 respiratory metabolism, or to activate said metabolism.

2. The lactic acid bacterium as claimed in claim 1, characterized in that it has undergone at least one genetic modification consisting in the addition of at 10 least one gene encoding a protein involved in respiratory metabolism or promoting said metabolism.

3. The lactic acid bacterium as claimed in either of claims 1 and 2, characterized in that it has undergone 15 at least one modification resulting in the overexpression of at least one gene encoding a protein involved in respiratory metabolism and/or a modification resulting in the activation of at least one protein involved in respiratory metabolism or 20 promoting said metabolism.

4. The lactic acid bacterium as claimed in any one of claims 1 to 3, characterized in that it has undergone at least one modification resulting in the complete or 25 partial inactivation of at least one gene encoding a protein involved in fermentative metabolism or promoting said metabolism, and/or at least one modification resulting in the underexpression of at least one gene encoding a protein involved in 30 fermentative metabolism or promoting said metabolism.

5. The lactic acid bacterium as claimed in claim 2, characterized in that said gene is chosen from: - the genes encoding proteins of the heme 35 biosynthesis pathway; the genes encoding proteins of the cytochrome biosynthesis pathway; the genes encoding proteins of the Krebs cycle. 26

6. The lactic acid bacterium as claimed in claim 3, characterized in that said gene is chosen from: - genes regulating metabolic pathways promoting the 5 respiratory pathway; - enzymes of the cytochrome biosynthesis pathway; - genes encoding hemin proteins.

7. The lactic acid bacterium as claimed in claim 4, 10 characterized in that said gene is chosen from the ccpA gene and the g1s24 gene.

8. The lactic acid bacterium as claimed in any one of claims 1 to 7, characterized in that it is chosen from 15 bacteria of the genera Lactococcus, Lactobacillus, Leuconostoc, Streptococcus, Propionibacterium, Bifidobacterium, or Enterococcus.

9. The lactic acid bacterium as claimed in any one of 20 claims 1 to 3, characterized in that it is a strain of the species Lactococcus or Streptococcus transformed with at least one gene encoding a protein of the heme biosynthesis pathway. 25

10. A method of bacteria culture, characterized in that it comprises the culture of at least one strain of lactic acid bacterium as claimed in any one of claims 1 to 9, under conditions allowing the induction of a respiratory metabolism in said strain. 30

11. The method of culture as claimed in claim 10, characterized in that it is carried out for the production of a lactic starter culture, and in that it comprises harvesting the bacteria at the end of said 35 culture.

12. A lactic starter culture comprising at least one strain of lactic acid bacterium transformed as claimed in any one of claims 1 to 9. - 27

13. The method for preparing a fermented product, characterized in that it comprises inoculating a medium to be fermented using a lactic starter culture as 5 claimed in claim 12.

14. The use of a lactic starter culture as claimed in claim 12 for the preparation of a fermented product. 10 15. From a recombinant lactic starter culture, having the respiratory properties as claimed in claims 1 to 9, the introduction of a gene encoding any protein of interest.

15

16. The use of the strain described in claim 15 under respiratory conditions for the production of said heterologous protein.