EP1212443A2 - Targeted gene removal - Google Patents

Targeted gene removal

Info

Publication number
EP1212443A2
EP1212443A2 EP00964384A EP00964384A EP1212443A2 EP 1212443 A2 EP1212443 A2 EP 1212443A2 EP 00964384 A EP00964384 A EP 00964384A EP 00964384 A EP00964384 A EP 00964384A EP 1212443 A2 EP1212443 A2 EP 1212443A2
Authority
EP
European Patent Office
Prior art keywords
plant
attp
transgene
region
genome
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP00964384A
Other languages
German (de)
French (fr)
Inventor
Peter Leeds Inst.Plant Biotech.&Agriculture MEYER
Elena Leeds Inst.Plant Biotech.&Agriculture ZUBKO
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
University of Leeds
Original Assignee
University of Leeds
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University of Leeds filed Critical University of Leeds
Publication of EP1212443A2 publication Critical patent/EP1212443A2/en
Withdrawn legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/81Protease inhibitors
    • C07K14/8107Endopeptidase (E.C. 3.4.21-99) inhibitors
    • C07K14/8139Cysteine protease (E.C. 3.4.22) inhibitors, e.g. cystatin
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/65Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression using markers
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8201Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8201Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
    • C12N15/8209Selection, visualisation of transformants, reporter constructs, e.g. antibiotic resistance markers
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8201Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
    • C12N15/8213Targeted insertion of genes into the plant genome by homologous recombination
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241Phenotypically and genetically modified plants via recombinant DNA technology
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/87Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C12N15/90Stable introduction of foreign DNA into chromosome
    • C12N15/902Stable introduction of foreign DNA into chromosome using homologous recombination

Definitions

  • the invention relates to a method of removing a selectable marker gene or genes or foreign ancillary nucleic acid from a plant and especially from a transgenic plant; means therefor and products thereof.
  • resistance marker genes from plant transgenes are highly desirable for a number of reasons. Cross pollination between related species can lead to a transfer of resistance traits into weeds 3 jeopardising the long-term use of transgenic crops and causing potential ecological problems. For example, a marker encoding either antibiotic or herbicide resistance, could change a transgenic plant into a weedy pest which in turn could disrupt the ecosystem balance. Consumer groups express concern about a widespread distribution of resistance markers in food products, referring to the theoretical risk of a horizontal transfer of transgenes into gut bacteria. If this theoretical risk were to be realised, a marker gene could be transferred into microorganisms and increase the number of resistant pathogenic microorganisms in the human and/or animal gut.
  • a yet further reason for wanting to remove resistance marker genes from transgenic plants is that since there is only a limited number of selection marker genes that can be used for plant transformation, the combination of multiple transgenic traits via crosses among different transgenic lines will frequently produce plants that contain multiple copies of the same selection marker linked to different effector genes. Since the presence of a particular marker gene in a transgenic plant precludes the use of that marker in subsequent transformations, it will be necessary to use different selectable marker systems for each transformation. Thus, in the long term there is likely to be more transgenes one may wish to introduce than the number of suitable selectable markers available. A further problem is that the presence of multiple homologous sequences in plants enhances the likelihood for homology-dependent gene silencing 4 , which could severely limit the reliable long-term use of transgenic crops.
  • transposable element systems and site- specific recombination systems have been employed for marker removal 6 .
  • These systems require the expression of a transposase or recombinase that mediates the deletion of regions bracketed between recombination or transposase target sequences, and the subsequent removal of the helper gene via genetic segregation, which makes these systems relatively time consuming.
  • deleted fragments can reinsert into other genomic positions and recombinase or transposase proteins have the potential to cause undesirable secondary effects.
  • ICR intrachromosomal homologous recombination
  • a method of removing a part of a transgene after its integration into a genome comprising flanking said part of the transgene on each side thereof with an attachment P region (attP) of bacteriophage ⁇ and inducing intrachromosomal homologous recombination between each flanking attP regions whereby said part of a transgene sandwiched therebetween is removed.
  • attP attachment P region
  • attachment P region is intended to include a region of bacteriophage ⁇ DNA that is associated with high recombination efficiency.
  • said part of said transgene comprises a marker gene and/or vector sequence and/or other foreign ancillary nucleic acid.
  • the genome is a plant genome.
  • the marker gene confers resistance to antibiotics and/or herbicide resistance. It will be appreciated that the term marker gene is intended to include genes involved in specific biosynthetic pathways and/or genes involved in environmental tolerance.
  • the marker gene is selected from the group consisting of nptll, Ble, dhfr, cat, aphlV, SPT, aacCS, aacC4, bar, EPSP, bxn, psbA, tfdA, DHPS, AK, sul, crsl-1 and tdc.
  • the method is capable of deleting in the region of up to 10 kb between each of the two attP regions and more preferably in the region of 7kb.
  • each undesirable part of the transgene to be removed is flanked by att P regions.
  • the method of the invention can simultaneously be used to remove more than one undesired part of the genome at the same time.
  • the attP region comprises 3052bp located between position 27492 and 27844 of bacteriophage ⁇ .
  • the attP region comprises the nucleic acid sequence as set forth in SEQ ID NO:l, or fragment thereof with the same functional equivalent, or nucleic acids which hybridise under stringent conditions to the DNA of SEQ ID NO:l and function as an attP region, or nucleic acids which differ from the DNA of SEQ ID NO:l due to the degeneracy of the genetic code and which function as an attP region.
  • the method of the invention provides a novel strategy to remove undesirable and/or other parts of a transgene after its integration into a plant genome.
  • the method of the invention exploits the hitherto unrecognised potential of the high recombination efficiency of the attachment P region (attP) of bacteriophage ⁇ , producing deletion events after intrachromosomal recombination between two attP regions.
  • the attP system has been demonstrated to delete a 5.9kb region from a recombinant vector that had been inserted into two different genomic regions.
  • the attP system does not require the expression of recombinant helper proteins to induce deletion events.
  • the attP deletion method of the invention provides a simple and efficient tool to improve the potential of plant transformation and to address many of the problems including consumer concern about the use of resistance markers.
  • the attP regions are in a cassette.
  • the cassette further includes a transformation booster sequence (TBS) or fragment thereof for enhancing homologous and illegitimate recombination.
  • TBS transformation booster sequence
  • the TBS is typically derived from Petunia hybrida.
  • the cassette further includes an effector gene such as oryzacystastin-I or functional equivalent thereof.
  • a plant having been produced using the method as hereinbefore described so that a part integrated into its genome is removed and optionally further including any of the preferred features as hereinbefore described.
  • the plant is grown and plant products harvested therefrom.
  • a plant cell having been produced using the method as hereinbefore described so that a part integrated into its genome is removed and optionally further including any of the preferred features as hereinbefore described.
  • the plant cell is grown and plant products harvested therefrom.
  • an attP recombination cassette comprising a marker gene and/or vector sequence and/or other foreign ancillary nucleic acid flanked on each side by an attP region.
  • the cassette further includes any of the preferred features as hereinbefore described.
  • a plant or plant cell or plant tissue comprising recombinant attP regions.
  • the invention also includes seeds.
  • an attP recombination cassette for removing a part integrated into a plant genome and optionally further including any of the preferred features as hereinbefore described.
  • kits for removing a part of a transgene after its integration into a plant genome comprising an attP recombination cassette as herein before described and optionally including any of the preferred features as hereinbefore described.
  • a plant or plant cell or plant tissue having a recombinant transgene integrated into its genome the transgene being associated with a bacteriophage ⁇ attP region.
  • the plant or plant cell or plant tissue includes at least one ⁇ attP region and one effector trangene integrated into its genome.
  • the plant or plant cell or plant tissue ideally comprises at least two attP regions to effect ICR but that the plant or plant cell or plant tissue can comprise a first attP region and a second attP region can be subsequently introduced so as to flank the transgene.
  • the plant or plant cell or plant tissue is characterised in that the ⁇ attP region and one transgene are not associated with a marker gene and/or vector sequence and/or other foreign ancillary nucleic acid.
  • the transgene is further associated with a transformation booster sequence or fragment thereof which is capable of enhancing homologous and illegitimate recombination.
  • Figure 1 represents T-DNA region of pattP-ICR
  • Figure 2 represents selection of marker-free transgenic tobacco plants
  • Figure 3 illustrates PCR analysis of the km-resistant and km-sensitive plants and includes the nucleic acid sequence of the ⁇ bacteriophage attP region (SEQ ID NO: 1);
  • Figure 4 illustrates Southern blot analysis of the km-resistant and km-sensitive plants.
  • Figure 1 represents T-DNA region of pattP-ICR.
  • Two 352 bp regions of the attP region (located between position 27492 and 27844 of the phage ⁇ genome) were inserted at both sides of the NPTII gene in vector pPCV002 .
  • Into the attP cassette we inserted the tms-2 coding region and polyA region 9 and the GFP coding region I0 linked to the nos polyA region. Both genes are transcribed by the dual l '-2' promoter ".
  • the attP cassette was embedded into an 0.6 kb DS element that would allow removal of the complete cassette in the presence of an active Ac transposase 5' to the attP cassette a TBS fragment was inserted that enhances illegitimate and homologous recombination and an oryzacystatin-I gene as an example for an effector gene.
  • Arrows indicate the regions amplified by the primers specific for detection of the effector gene (PEl and PE2), the NPTII gene (PN1 and PN2) and the attP cassette (P5' and P3'). ICR between the two attP regions will generate a 5.9kb deletion with only one attP region remaining and the region between the attP regions being removed.
  • Black arrows indicate probes used in Southern blot hybridisation ( Figure 4).
  • Figure 2 represents selection of marker-free transgenic tobacco plants (A). Lines 1 and 2 develop green and white shoots on km-containing medium. White tissue, which has potentially lost the NPTII marker, was further tested for activity of the tms-2 gene (B) On NAM-containing medium shoots with tms2 activity produce abundant calli instead of roots (left), while shoots regenerated from white tissue that have lost the tms2 gene produce normal roots (right).
  • Figure 3 illustrates PCR analysis of the km-resistant plants derived from line 1 (lane 2) and line 2 (lane 4), and km-sensitive plants derived from white tissue of line 1 (lane 3) and line 2 (lane 5).
  • Lane 1 contains a Hw- ⁇ II-digested ⁇ DNA as size marker. Sizes of PCR fragments are indicated in bp.
  • A. PCR with primers PEl and PE2 shows that all four lines contain the effector gene.
  • Genomic DNA digested with Seal was probed with region "a” (see Figure 1) to label the left junction fragment of the integrated T-DNA.
  • Genomic SDNA digested with Seal was probed with region "b” (see Figure 1) to label the right junction fragment of the integrated T-DNA.
  • the left end fragment remains unaltered (A) while the right end fragment is shortened by about 6kb due to the deletion of the region between the two attP regions (B).
  • the pattP-ICR construct was introduced into A. tumefaciens strain GV3101 (pMP90RK) by conjugation as described by Koncz et al. 12 .
  • Leaf disc transformation of Nicotiana tabacum cv. Petit Havana SRI was performed according to Horsch et al. 13 .
  • PCRs were performed in a reaction volume of 50 ⁇ l containing 10 mM TRIS-HC1 PH 8.3, 50 mM KCL, 2mM MgCL 2 , 0.1% w/v gelatin, 0.2 mM of each nucleotide, 25 pmol of each primer and 1U of Taq polymerase (Promega).
  • the PCR cycles used were, for detection of the effector gene: 4 min at 94°C, 30 cycles of 1 min at 94°C, 30 sec at 55°C, 30 sec at 72°C followed by 10 min at 72°C , and to amplify the sequence of NPT II gene: 4 min at 94°C, 30 cycles of 1 min at 94°C, 1 min at 60°C, 1 min at 72°C followed by 10 min at 72°C.
  • a long template PCR was performed using the ExpandTM Long Template PCR System according to manufacturer's protocol (Boehringer Mannheim).
  • PE1 TCA TCA GAC GGA GGA CCA GTT TTG G
  • PE2 ATC CAT GGT TTT TCC CAA ACT TTA G (SEQ ID NO:3)
  • PN1 CCA TGA TCA TGT CGA TTG AAC AAG ATG
  • PN2 CCA TTT TCC ACC ATG ATA TTC GGC AAG (SEQ ID NO:5)
  • P5':GAATTCTAATTCGGGATGACTGCAATATGG SEQ ID NO:6
  • P3' GGA TCC AAC GGG ATA TAC CGG TAA CGA AAA CG (SEQ ID NO:7)
  • Genomic DNA was isolated as described by van Blokland et al. 15 . Fifteen ⁇ g of genomic DNA was digested with Sea I and fractionated by electrophoresis in 0,7% agarose gel. After electrophoresis the DNA was blotted on Nybond N filter, crosslinked by UV irradiation and hybridized with a 32 P-labelled 0,3kb Eco Rl/Sac I DNA fragment of the effector gene at 65°C according to Koes et al. 16 .
  • Integration of bacteriophage ⁇ into the E. coli genome occurs via recombination between the phage attachment region (attP) and the bacterial attachment region (attB).
  • the bacterial integration host factor (IHF), and the virally encoded integrates (Int) gene are required for attP integration, while excision requires in addition the viral excisase (Xis) protein.
  • the three recombination proteins bind to defined DNA regions within a 250bp attP fragment 17 .
  • IHF fulfils an accessory function, bending the attP region and possibly assisting Int in organising attP into a nucleosome-like structure that is required for efficient synapsis with attB I9 .
  • the actual strand exchange, which occurs within a 7bp homology between the core regions of attP and attB is mediated by the Int protein that has a toposisomerase I activity.
  • a tyrosine residue of Int covalently binds to the 3' end of the DNA, resembling a mammalian topoisomerase I type in contrast to E. coli toposisomerases I that binds to the 5' end of the DNA 20 .
  • a plant transformation vector pattP-ICR in which we inserted two 352bp attP regions so as to flank an NPTII resistance marker, a GFP gene and a tms2 gene (figure 1).
  • TBS Transformation Booster Sequence
  • ICR between the two attP regions should delete the 5.9 kb region between the attP regions and produce a transgene that retains the effector gene and the TBS sequence.
  • the construct was introduced into tobacco via leaf disk transformation and resistant calli were selected on kanamycin (km) medium. Two months after transformation, eleven km-resistant calli, 0.5 cm in diameter, were transferred to km-free medium.
  • the attP fragment has a relatively high AT content (67%) that might be responsible for its potentially improved accessibility.
  • AT rich regions have been identified as preferential target site for transgene integration into the plants genome mediated by illegitimate recombination, and it has been proposed that a high AT content increases the probability of DNA integration through steric bending of the chromosomal DNA structure 23 .
  • the attP region due to its sequence composition alone or in combination with nuclear proteins associated with the attP region undergoes a conformational change that improves its accessibility for repair/recombination enzymes.
  • the transformation booster sequence is a retrotransposon derivative that binds to the nuclear scaffold. Mol Gen Genet 247, 614-622(1995).

Landscapes

  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • General Health & Medical Sciences (AREA)
  • Plant Pathology (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Cell Biology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Mycology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

A method of removing a part of a transgene after its integration into a genome comprising flanking the part of the transgene on each side with an attachment P region (attP) of bacteriophage μ and inducing intrachromasomal homologous recombination between the flanking attP regions so that the part of the transgene sandwiched between the attP regions is removed.

Description

Targeted Gene Removal
The invention relates to a method of removing a selectable marker gene or genes or foreign ancillary nucleic acid from a plant and especially from a transgenic plant; means therefor and products thereof.
Background to the Invention
Recombinant genes conferring resistance to antibiotics or herbicides are widely used as selectable markers in plant transformation. Once transgenic material has been selected on the basis of its resistance, the marker gene is dispensable. The presence of antibiotic or herbicide resistance markers in transgenic plants has caused concern about a potential spread of resistance traits to wild plant relatives or to other
. 2 species .
The removal of resistance marker genes from plant transgenes is highly desirable for a number of reasons. Cross pollination between related species can lead to a transfer of resistance traits into weeds 3 jeopardising the long-term use of transgenic crops and causing potential ecological problems. For example, a marker encoding either antibiotic or herbicide resistance, could change a transgenic plant into a weedy pest which in turn could disrupt the ecosystem balance. Consumer groups express concern about a widespread distribution of resistance markers in food products, referring to the theoretical risk of a horizontal transfer of transgenes into gut bacteria. If this theoretical risk were to be realised, a marker gene could be transferred into microorganisms and increase the number of resistant pathogenic microorganisms in the human and/or animal gut.
A yet further reason for wanting to remove resistance marker genes from transgenic plants is that since there is only a limited number of selection marker genes that can be used for plant transformation, the combination of multiple transgenic traits via crosses among different transgenic lines will frequently produce plants that contain multiple copies of the same selection marker linked to different effector genes. Since the presence of a particular marker gene in a transgenic plant precludes the use of that marker in subsequent transformations, it will be necessary to use different selectable marker systems for each transformation. Thus, in the long term there is likely to be more transgenes one may wish to introduce than the number of suitable selectable markers available. A further problem is that the presence of multiple homologous sequences in plants enhances the likelihood for homology-dependent gene silencing4, which could severely limit the reliable long-term use of transgenic crops.
Given the foregoing reasons for desiring the removal of resistance markers from plant transgenes, a number of systems have been developed to ensure the removal of selectable marker genes. For example, co-transformation of two different constructs can result in transgenic lines that have integrated both transgenes 5 but the applicability of this approach is limited because it depends on the efficiency at which both transgenes insert into different genomic regions as this is a requirement to separate them in genetic crosses. Moreover this method has a further disadvantage in that it is laborious and time consuming because of the requirement of a genetic cross.
As an alternative to co-transformation, several transposable element systems and site- specific recombination systems have been employed for marker removal 6. These systems require the expression of a transposase or recombinase that mediates the deletion of regions bracketed between recombination or transposase target sequences, and the subsequent removal of the helper gene via genetic segregation, which makes these systems relatively time consuming. Moreover, deleted fragments can reinsert into other genomic positions and recombinase or transposase proteins have the potential to cause undesirable secondary effects.
Another approach to removing selectable gene markers is to induce DNA deletions based on intrachromosomal homologous recombination (ICR) between two homologous sequences. Although ICR can be enhanced by stimulation of repair systems, the inherent drawback to ICR is that frequencies are too low for an efficient application of this system to produce deletions of transgene regions. In tobacco, for example, on average less than ten ICR events are detectable among all cells of a six-
7 week old tobacco plant .
Despite the foregoing limitations of the ICR method we have developed an ICR strategy based on recombination of a hitherto unexploited region of bacteriophage λ and we have been able to generate a surprisingly and sufficiently high efficiency of ICR that allows for a simplified identification of tissue that has lost a transgenic marker gene.
Statement of the Invention
According to a first aspect of the invention there is provided a method of removing a part of a transgene after its integration into a genome comprising flanking said part of the transgene on each side thereof with an attachment P region (attP) of bacteriophage λ and inducing intrachromosomal homologous recombination between each flanking attP regions whereby said part of a transgene sandwiched therebetween is removed.
Reference herein to attachment P region (attP) is intended to include a region of bacteriophage λ DNA that is associated with high recombination efficiency.
Preferably, said part of said transgene comprises a marker gene and/or vector sequence and/or other foreign ancillary nucleic acid.
Preferably, the genome is a plant genome.
Preferably, the marker gene confers resistance to antibiotics and/or herbicide resistance. It will be appreciated that the term marker gene is intended to include genes involved in specific biosynthetic pathways and/or genes involved in environmental tolerance.
Preferably, the marker gene is selected from the group consisting of nptll, Ble, dhfr, cat, aphlV, SPT, aacCS, aacC4, bar, EPSP, bxn, psbA, tfdA, DHPS, AK, sul, crsl-1 and tdc.
Preferably, the method is capable of deleting in the region of up to 10 kb between each of the two attP regions and more preferably in the region of 7kb.
Preferably, in the instance of removing more than one marker gene and/or vector sequence and/or other foreign ancillary nucleic acid each undesirable part of the transgene to be removed is flanked by att P regions. Thus it will be appreciated that the method of the invention can simultaneously be used to remove more than one undesired part of the genome at the same time.
Preferably, the attP region comprises 3052bp located between position 27492 and 27844 of bacteriophage λ.
Preferably the attP region comprises the nucleic acid sequence as set forth in SEQ ID NO:l, or fragment thereof with the same functional equivalent, or nucleic acids which hybridise under stringent conditions to the DNA of SEQ ID NO:l and function as an attP region, or nucleic acids which differ from the DNA of SEQ ID NO:l due to the degeneracy of the genetic code and which function as an attP region.
The method of the invention provides a novel strategy to remove undesirable and/or other parts of a transgene after its integration into a plant genome. The method of the invention exploits the hitherto unrecognised potential of the high recombination efficiency of the attachment P region (attP) of bacteriophage λ, producing deletion events after intrachromosomal recombination between two attP regions. The attP system has been demonstrated to delete a 5.9kb region from a recombinant vector that had been inserted into two different genomic regions. In contrast to other deletion systems that are based on bacterial recombination systems or on the use of transposable elements 6, the attP system does not require the expression of recombinant helper proteins to induce deletion events. Thus, the attP deletion method of the invention provides a simple and efficient tool to improve the potential of plant transformation and to address many of the problems including consumer concern about the use of resistance markers.
Preferably, the attP regions are in a cassette.
Preferably, the cassette further includes a transformation booster sequence (TBS) or fragment thereof for enhancing homologous and illegitimate recombination.
The TBS is typically derived from Petunia hybrida.
Preferably, the cassette further includes an effector gene such as oryzacystastin-I or functional equivalent thereof.
According to a further aspect of the invention there is provided a plant having been produced using the method as hereinbefore described so that a part integrated into its genome is removed and optionally further including any of the preferred features as hereinbefore described.
Preferably, the plant is grown and plant products harvested therefrom.
According to a yet further aspect of the invention there is provided a plant cell having been produced using the method as hereinbefore described so that a part integrated into its genome is removed and optionally further including any of the preferred features as hereinbefore described.
Preferably, the plant cell is grown and plant products harvested therefrom. According to a yet further aspect of the invention there is provided an attP recombination cassette comprising a marker gene and/or vector sequence and/or other foreign ancillary nucleic acid flanked on each side by an attP region.
Preferably, the cassette further includes any of the preferred features as hereinbefore described.
According to a yet further aspect of the invention there is provided a plant or plant cell or plant tissue comprising recombinant attP regions. In addition the invention also includes seeds.
According to a yet further aspect of the invention there is provided use of an attP recombination cassette for removing a part integrated into a plant genome and optionally further including any of the preferred features as hereinbefore described.
According to a yet further aspect of the invention there is provided a kit for removing a part of a transgene after its integration into a plant genome comprising an attP recombination cassette as herein before described and optionally including any of the preferred features as hereinbefore described.
According to a yet further aspect of the invention there is provided a plant or plant cell or plant tissue having a recombinant transgene integrated into its genome the transgene being associated with a bacteriophage λ attP region.
Preferably the plant or plant cell or plant tissue includes at least one λ attP region and one effector trangene integrated into its genome. It will be appreciated that the plant or plant cell or plant tissue ideally comprises at least two attP regions to effect ICR but that the plant or plant cell or plant tissue can comprise a first attP region and a second attP region can be subsequently introduced so as to flank the transgene. Preferably the plant or plant cell or plant tissue is characterised in that the λ attP region and one transgene are not associated with a marker gene and/or vector sequence and/or other foreign ancillary nucleic acid.
Preferably the transgene is further associated with a transformation booster sequence or fragment thereof which is capable of enhancing homologous and illegitimate recombination.
Detailed description of the Invention
The invention will now be described, by way of example only with reference to the following Figures wherein:
Figure 1 represents T-DNA region of pattP-ICR;
Figure 2 represents selection of marker-free transgenic tobacco plants;
Figure 3 illustrates PCR analysis of the km-resistant and km-sensitive plants and includes the nucleic acid sequence of the λ bacteriophage attP region (SEQ ID NO: 1); and
Figure 4 illustrates Southern blot analysis of the km-resistant and km-sensitive plants.
Figure 1 represents T-DNA region of pattP-ICR. Two 352 bp regions of the attP region (located between position 27492 and 27844 of the phage λ genome) were inserted at both sides of the NPTII gene in vector pPCV002 . Into the attP cassette, we inserted the tms-2 coding region and polyA region 9 and the GFP coding region I0 linked to the nos polyA region. Both genes are transcribed by the dual l '-2' promoter ". The attP cassette was embedded into an 0.6 kb DS element that would allow removal of the complete cassette in the presence of an active Ac transposase 5' to the attP cassette a TBS fragment was inserted that enhances illegitimate and homologous recombination and an oryzacystatin-I gene as an example for an effector gene. Arrows indicate the regions amplified by the primers specific for detection of the effector gene (PEl and PE2), the NPTII gene (PN1 and PN2) and the attP cassette (P5' and P3'). ICR between the two attP regions will generate a 5.9kb deletion with only one attP region remaining and the region between the attP regions being removed. Black arrows indicate probes used in Southern blot hybridisation (Figure 4).
Figure 2 represents selection of marker-free transgenic tobacco plants (A). Lines 1 and 2 develop green and white shoots on km-containing medium. White tissue, which has potentially lost the NPTII marker, was further tested for activity of the tms-2 gene (B) On NAM-containing medium shoots with tms2 activity produce abundant calli instead of roots (left), while shoots regenerated from white tissue that have lost the tms2 gene produce normal roots (right).
Figure 3 illustrates PCR analysis of the km-resistant plants derived from line 1 (lane 2) and line 2 (lane 4), and km-sensitive plants derived from white tissue of line 1 (lane 3) and line 2 (lane 5). Lane 1 contains a Hw-ΛII-digested λ DNA as size marker. Sizes of PCR fragments are indicated in bp. A. PCR with primers PEl and PE2 shows that all four lines contain the effector gene.
B. PCR with primers PN1 and PN2 shows that the km-sensitive plants have lost the NPTII gene.
C. PCR with primers P5' and P3' show that the two km-resistant lines contain the complete attP cassette, while in both km-sensitive plants about 6kb have been deleted from the attP cassette.
D. Sequence of the PCR product shown in C, lane 3, confirms that recombination leaves precisely one attP region bracketed by the 5' and 3' regions. Figure 4 illustrates Southern blot analysis of DNA isolated from km-resistant (lane 2) and km-sensitive tissue of line 1 (lane 3).
A. Genomic DNA digested with Seal was probed with region "a" (see Figure 1) to label the left junction fragment of the integrated T-DNA. B. Genomic SDNA digested with Seal was probed with region "b" (see Figure 1) to label the right junction fragment of the integrated T-DNA.
In km-sensitive tissue, the left end fragment remains unaltered (A) while the right end fragment is shortened by about 6kb due to the deletion of the region between the two attP regions (B).
Materials and Methods
Plant transformation
The pattP-ICR construct was introduced into A. tumefaciens strain GV3101 (pMP90RK) by conjugation as described by Koncz et al.12. Leaf disc transformation of Nicotiana tabacum cv. Petit Havana SRI was performed according to Horsch et al.13.
DNA preparation and analysis
After DNA mini preparation 14 , PCRs were performed in a reaction volume of 50 μl containing 10 mM TRIS-HC1 PH 8.3, 50 mM KCL, 2mM MgCL2, 0.1% w/v gelatin, 0.2 mM of each nucleotide, 25 pmol of each primer and 1U of Taq polymerase (Promega). The PCR cycles used were, for detection of the effector gene: 4 min at 94°C, 30 cycles of 1 min at 94°C, 30 sec at 55°C, 30 sec at 72°C followed by 10 min at 72°C , and to amplify the sequence of NPT II gene: 4 min at 94°C, 30 cycles of 1 min at 94°C, 1 min at 60°C, 1 min at 72°C followed by 10 min at 72°C. For amplification of the attP cassette, a long template PCR was performed using the Expand™ Long Template PCR System according to manufacturer's protocol (Boehringer Mannheim). The sequences of the primers used in PCR were: PE1: TCA TCA GAC GGA GGA CCA GTT TTG G (SEQ ID NO:2) PE2: ATC CAT GGT TTT TCC CAA ACT TTA G (SEQ ID NO:3)
PN1: CCA TGA TCA TGT CGA TTG AAC AAG ATG (SEQ ID NO:4) PN2: CCA TTT TCC ACC ATG ATA TTC GGC AAG (SEQ ID NO:5) P5':GAATTCTAATTCGGGATGACTGCAATATGG (SEQ ID NO:6) P3': GGA TCC AAC GGG ATA TAC CGG TAA CGA AAA CG (SEQ ID NO:7)
Southern blot analysis
Genomic DNA was isolated as described by van Blokland et al. 15. Fifteen μg of genomic DNA was digested with Sea I and fractionated by electrophoresis in 0,7% agarose gel. After electrophoresis the DNA was blotted on Nybond N filter, crosslinked by UV irradiation and hybridized with a 32P-labelled 0,3kb Eco Rl/Sac I DNA fragment of the effector gene at 65°C according to Koes et al. 16.
Results
Integration of bacteriophage λ into the E. coli genome occurs via recombination between the phage attachment region (attP) and the bacterial attachment region (attB). The bacterial integration host factor (IHF), and the virally encoded integrates (Int) gene are required for attP integration, while excision requires in addition the viral excisase (Xis) protein. The three recombination proteins bind to defined DNA regions within a 250bp attP fragment 17. IHF fulfils an accessory function, bending the attP region and possibly assisting Int in organising attP into a nucleosome-like structure that is required for efficient synapsis with attB I9. The actual strand exchange, which occurs within a 7bp homology between the core regions of attP and attB is mediated by the Int protein that has a toposisomerase I activity. A tyrosine residue of Int covalently binds to the 3' end of the DNA, resembling a mammalian topoisomerase I type in contrast to E. coli toposisomerases I that binds to the 5' end of the DNA20. In the present invention we have designed and constructed a plant transformation vector pattP-ICR, in which we inserted two 352bp attP regions so as to flank an NPTII resistance marker, a GFP gene and a tms2 gene (figure 1). Next to one attP site, we positioned the Transformation Booster Sequence (TBS) that enhances homologous and illegitimate recombination 21 and an orystastatin-I gene 22 that served as an example for an 'effector' gene that would finally be transferred into the genome via the attP system. ICR between the two attP regions should delete the 5.9 kb region between the attP regions and produce a transgene that retains the effector gene and the TBS sequence. The construct was introduced into tobacco via leaf disk transformation and resistant calli were selected on kanamycin (km) medium. Two months after transformation, eleven km-resistant calli, 0.5 cm in diameter, were transferred to km-free medium. When calli had grown to 5-6 cm in diameter, they were cut into smaller parts that were transferred onto km-containing shoot regeneration medium. After 3-5 months, multiple shoots had developed on all eleven calli, we detected two clones that produced a mixture of green and white shoots. These two clones (line 1 and 2, figure 2) were further studied to evaluate whether white shoots contained tissue that had lost the NPTII resistance marker and the tms2 gene.
White leaves of both lines were placed on km-free regeneration medium and regenerating shoots were placed on medium supplemented by Naphtaleneacedamide (NAM). As tms2 gene activity converts NAM into the auxine NAA 9, plants expressing the tms2 gene produce high auxine levels that prevent root development and induce callus production instead. Tissue that had deleted the region between the two attP fragments should have also lost the tms2 gene and can therefore be identified due to its ability to form roots on NAM containing medium. Eleven out of 20 shoots tested for line 1 and twelve out of 32 shoots tested for line 2 produced roots, and these 23 plantlets were further analysed as potential candidates that had lost both the NPTII gene and the tms2 gene. PCR analysis showed that all 23 plantlets had indeed lost the NPTII gene and the tms2 gene. Two of the eleven line 1 derivatives and one of the twelve line 2 derivatives had retained the effector gene, while all other lines had lost the effector gene as well.
One representative plant from line 1 and line 2 that had retained the effector gene was further characterised to analyse the precise degree of the deletion events. As a control, we used km-resistant shoots of lines 1 and 2. PCR analysis with primers specific for the effector gene, the NPTII gene and the region flanking the attP dimer cassette showed that the effector gene had been retained, while the NPTII gene had been lost and the region between the two attP fragments had been reduced by about 6 kb, as expected if the two attP sites had recombined (Figure 3). Both clones produced identical PCR patterns indicating that they had both generated the same deletion product. Sequencing of one of the PCR fragments confirmed that precisely one attP region had been maintained between the 5' and 3' region flanking the attP cassette, which is in accordance with the expectation that ICR between the two attP fragments has deleted the 5.9kb region between them. A Southern blot analysis of green and white tissue of line 1 confirmed the PCR data (Figure 4).
The fact that most plantlets that have lost the NPTII/tms2 region also have lost transgene regions outside the attP cassette, shows that ICR is not always associated with precise homologous recombination between the two attP regions but that it can generate larger deletion probably due to illegitimate recombination. However, ICR events can clearly be identified where precise intrachromosomal recombination had occurred between the two attP regions. As the same deletion event can be found in two different transformants, it is unlikely that efficient recombination between attP regions only occurs within transgenes that are integrated at specific genomic integration regions. Our data shows that, starting with a relatively small number of calli, homogeneous material with precise deletion events can be selected, and that, due to the availability of PCR technology, such events can easily be distinguished from undesirable deletion events that have lost more than the region between the two attP sites. As at least 35% of the shoots regenerated from white tissue represent deletion events, the use of the tms2 gene for preselection of deletion events appears dispensable and can probably also be substituted by PCR.
The reason for the relatively high ICR efficiency of the attP fragment is unclear but it is tempting to speculate that this effect is due to an improved accessibility of the attP regions. Somatic intrachromosomal recombination in tobacco is part of a repair mechanism that is stimulated by DNA damage . The efficiency of ICR in plants is normally several magnitudes lower than the efficiency of extrachromosomal recombination suggesting that the packaging of DNA into chromatin significantly protects it from the repair/recombination apparatus 23. Improved accessibility of DNA regions due to an altered chromatin structure could therefore have a drastic effect on the efficiency of ICR. Support for this assumption comes from experiments in human fibroblasts demonstrating an enhanced DNA repair synthesis in hyperacetylated nucleosomes as these have a more open chromatin structure than hypoacetylated nucleosomes 2 .
The attP fragment has a relatively high AT content (67%) that might be responsible for its potentially improved accessibility. AT rich regions have been identified as preferential target site for transgene integration into the plants genome mediated by illegitimate recombination, and it has been proposed that a high AT content increases the probability of DNA integration through steric bending of the chromosomal DNA structure23. As a working hypothesis to explain the high recombination efficiency of attP sites, we propose that the attP region, due to its sequence composition alone or in combination with nuclear proteins associated with the attP region undergoes a conformational change that improves its accessibility for repair/recombination enzymes. In bacteria, bending of the attP region is mediated by IHF, a small basic proteins composed of two dissimilar subunits. Both subunits show features of histone-like bacterial proteins , and one could speculate that an interaction of the attP region with plant histones or histone-like proteins may equally lead to a bend structure. While the molecular mechanisms responsible for the high ICR efficiency of the attP regions remain to be determined, the exploitation of this unexpected effect should provide a useful tool for rapid and efficient removal of resistance marker genes or any other undesirable transgene regions from transgenic plants.
References
I . Dale, P.J. Spread of engineered genes to wild relatives. Plant Physiol. 100, 13-15 (1992). 2. Hoffmann, T., Golz, C. & Schieder, O. Foreign DNA sequences are received by a wild-type strain of Aspergillus niger after co-culture with transgenic higher plants. Curr Genet 27, 70-6 (1994).
3. Gressel, J. Indiscriminate use of selectable markers - sowing wild oats?
TIBTECH 10, 382 (1992). 4. Matzke, M.A. & Matzke, A.J.M. Differential inactivation and methylation of a transgene in plants by two suppressor loci containing homologous sequences. Plant Mol.Biol. 16, 821-830 (1991).
5. De Block, M. & Debrouwer, D. Two T-DNAs co-transformed into Brassica napus by a double Agrobacterium infection are mainly integrated at the same locus. Theor. Appl. Genet. 82, 257-263 (1991).
6. Yoder, J.I. & Goldsbrough, A.P. Transformation systems for generating marker-free transgenic plants. BIO/TECHNOLOGY 2, 263-267 (1994).
7. Puchta, H., Swoboda, P., Gal, S., Blot, M. & Hohn, B. Somatic intrachromosomal homologous recombination events in populations of plant siblings. Plant Mol Biol 28, 281-92 (1995).
8. Konz, C. & Schell, J. The promoter of TL-DNA gene 5 controls the tissue- specific expression of chimeric genes carried by a novel type of Agrobacterium binary vector. Mol. Gen. Genet. 204, 383-396 (1986).
9. Depicker, A.G., Jacobs, A.M. & Van Montagu, M.C. A negative selection scheme for tobacco protoplast-derived cells expressing the T-DNA gene 2. Plant Cell
Reports 7, 63-66 (1988).
10. Chalfie, M., Tu, Y., Euskirchen, G., Ward, W.W. & Prasher, D.C. Green fluorescent protein as a marker for gene expression. Science 263, 802-5 (1994).
I I . Velten, J. & Schell, J. Isolation of a dual plant promoter fragment from Ti plasmid of Agrobacterium tumefaciens. EMBO J. 3, 2723-2730 (1984). 12. Koncz, C. et al. Specialized vectors for gene tagging and expression studies. Plant Molecular Biology Manual B2, 1-22 (1994).
13. Horsch, R.B. et al. A simple and general method for transferring genes into plants. Science 227, 1229-1231 (1985). 14. Dellaporta, S.J., Wood, J. & Hicks, J.B. A plant DNA minipreparation. Plant
Mol.Biol.Rep. 1, 19-21 (1983).
15. Van Blokland, R., Ross, S., Corrado, G., Scollan, C. & Meyer, P.
Developmental abnormalities associated with deoxyadenosine methylation in transgenic tobacco. The Plant Journal 15, 543-551 (1998). 16. Koes, R.E., Spelt, C.E., Mol, J.N.M. & Gerats, G.M. The chalconesynthase multigene family of Petunia hybrida (V30): sequence homology, chromosomal localization and evolutionary aspects. Plant Molecular Biology 10, 159-169 (1987).
17. Gardner, J.F. & Nash, H. A. Role of Escherichia coli IHF protein in lambda site-specific recombination. J Mol. Biol. 191, 181-189 (1986). 18. Yang, C. & H., N. The interaction of E.coli IHF protein with its specific binding sites. Cell 57, 869-880 (1989).
19. Craig, N.L. & Nash, H.A. The mechanism of phage lambda site-specific recombination: site-specific breakage of DNA by Int topoisomerase. Cell 39, 707-
716 (1984). 20. Weisberg, R.A. & Landy, A. Site-specific recombination in phage lambda, in
Lambda II (eds. Hendrix, R.W., Roberts, J.W., Stahl, F.W. & Weisberg, R.A.) 211-
250 (Cold Spring Harbor, New York, 1983).
21. Galliano, H., Mϋller, A.E., Lucht, J.M. & Meyer, P. The transformation booster sequence is a retrotransposon derivative that binds to the nuclear scaffold. Mol Gen Genet 247, 614-622(1995).
22. Urwin, P.E., Atkinson, H.J., Waller, D.A. & McPherson, M.J. Engineered oryzacystatin-I expressed in transgenic hairy roots confers resistance to Globodera pallida. Plant J8, 121-31 (1995). 23. Puchta, H. & Meyer, P. Substrate specificity of plant recombinases determined in extrachromosomal recombination systems, in Homologous recombination and gene silencing in plants (ed. Paszkowski, J.) 123-155 (Kluwer Academic Publishers, Dortrecht, 1994). 24. Ramanathan, B. & Smerdon, M.J. Enhanced DNA repair synthesis in hyperacetylated nucleosomes. J Biol Chem 264, 11026-34 (1989).
25. Takano, M., Egawa, H., Ikeda, J.E. & Wakasa, K. The structures of integration sites in transgenic rice. Plant J ' 11, 353-61 (1997).
26. Drlica, K. & Rouviere-Yaniv, J. Histonelike proteins in bacteria. Microbiol. Reviews 51, 301-319 (1987).
P32058WO 1

Claims

1. A method of removing a part of a transgene after its integration into a genome comprising flanking said part of the transgene on each side thereof with an attachment P region (attP) of bacteriophage λ and inducing intrachromasomal homologous recombination between flanking attP regions whereby said part of the transgene sandwiched therebetween is removed.
2. A method as claimed in Claim 1 characterised in that said transgene comprises a marker gene and/or vector sequence and/or other foreign ancillary nucleic acid.
3. A method as claimed in Claim 1 or Claim 2 characterised in that the marker gene confers resistance to antibiotics and/or herbicide resistance.
4. A method as claimed in any one of the preceding claims characterised in that the marker gene is involved in specific biosynthetic pathways and/or involved in environmental tolerance.
5. A method as claimed in any one of the preceding claims characterised in that the marker gene is selected from the group consisting of nptll, Ble, dhfr, cat, aphlV, SPT, aaaCS, aaaC4, bar, EPSP, bxn, psbA, tfdA, DHPS, AK, sul, crsl-1 and tdc.
6. A method as claimed in any one of the preceding claims characterised in that more than one marker gene and/or vector sequence and/or foreign nucleic acid part is removed from the transgene and each such part is to be removed is flanked by an attP region.
7. A method as claimed in any one of the preceding claims characterised in that the attP region comprises 352 basepairs, or functionally equivalent fragment thereof, located between positions 27492 and 27844 of bacteriophage λ.
8. A method as claimed in any one of the preceding claims characterised in that the attP region comprises a nucleic acid sequence as set forth in SEQ ID NO:l or functionally equivalent fragment thereof, or nucleic acids which hybridise under stringent conditions to the DNA of SEQ ID NO: l and function as an attP region, or nucleic acids which differ from the DNA of SEQ ID NO:l due to the degeneracy of the genetic code and which function as an attP region.
9. A method as claimed in any one of the preceding claims characterised in that the attP regions are in a cassette.
10. A method as claimed in Claim 9 characterised in that the cassette further includes a transformation booster sequence or fragment thereof for enhancing homologous and illegitimate recombination.
11. A method as claimed in Claim 9 or Claim 10 characterised in that the cassette includes an effector gene such as oryzacyctastin-I or functional equivalent thereof.
12. A method as claimed in any one of the preceding claims characterised in that the genome is a plant genome.
13. A plant or plant cell or plant tissue whenever produced by the method of any one of Claims 1 to 12.
14. A method which comprises performing the method of Claim 12 to produce a plant or providing a plant or plant cell or plant tissue of Claim 13 and, in either case growing the plant and/or harvesting products therefrom.
15. A plant or plant cell or plant tissue comprising recombinant attP regions.
16. An attP recombination cassette comprising a marker gene and/or vector sequence and/or foreign ancillary nucleic acid flanked on either side by an attP region.
17. Use of an attP recombination cassette of Claim 16 for removing a part integrated into a plant genome.
18. A kit for removing a part of a transgene after its integration into a plant genome comprising an attP recombination cassette as claimed in Claim 16.
19. A plant or plant cell or plant tissue comprising a recombinant transgene integrated into its genome characterised in that the transgene is associated with a bacteriophage λ attP region on respective sides thereof.
20. A plant or plant cell or plant tissue as claimed in Claim 19 characterised in that it includes one such bacteriophage λ attP region and one effector transgene integrated into its genome.
21. A plant or plant cell or plant tissue as claimed in Claim 20 characterised in that the bacteriophage λ attP regions and one transgene are not associated with a marker gene and/or vector sequence and/or other foreign ancillary nucleic acid.
22. A plant or plant cell or plant tissue as claimed in any one of Claims 19 to 21 characterised in that the transgene is further associated with a transformation booster sequence or fragment thereof which is capable of enhancing homologous and illegitimate recombination.
P32Q58WO 1
EP00964384A 1999-09-17 2000-09-15 Targeted gene removal Withdrawn EP1212443A2 (en)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
GB9921937 1999-09-17
GBGB9921937.0A GB9921937D0 (en) 1999-09-17 1999-09-17 Targeted gens removal
PCT/GB2000/003543 WO2001021780A2 (en) 1999-09-17 2000-09-15 Targeted gene removal

Publications (1)

Publication Number Publication Date
EP1212443A2 true EP1212443A2 (en) 2002-06-12

Family

ID=10861053

Family Applications (1)

Application Number Title Priority Date Filing Date
EP00964384A Withdrawn EP1212443A2 (en) 1999-09-17 2000-09-15 Targeted gene removal

Country Status (10)

Country Link
EP (1) EP1212443A2 (en)
JP (1) JP2003510043A (en)
CN (1) CN1375010A (en)
AU (1) AU7532500A (en)
BR (1) BR0014521A (en)
CA (1) CA2384932A1 (en)
GB (1) GB9921937D0 (en)
HU (1) HUP0202805A2 (en)
RU (1) RU2002108173A (en)
WO (1) WO2001021780A2 (en)

Families Citing this family (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6750379B2 (en) * 2000-03-09 2004-06-15 Dekalb Genetics Corporation Homologous recombination-mediated transgene alterations in plants
US6580019B1 (en) 2000-03-09 2003-06-17 Dekalb Genetics Corporation Non-reciprocal recombination-mediated transgene deletion in transgenic plants
EP1276884A2 (en) * 2000-04-20 2003-01-22 Btg International Limited Transgenic plants
CA2608636C (en) * 2005-05-17 2015-02-10 Frank Koentgen Sequential cloning system

Family Cites Families (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4673640A (en) * 1984-04-30 1987-06-16 Biotechnica International, Inc. Regulated protein production using site-specific recombination
NL8701450A (en) * 1987-06-22 1989-01-16 Solvay METHOD FOR TRANSFORMING CELLS.
WO1991019796A1 (en) * 1990-06-12 1991-12-26 Baylor College Of Medicine Method for homologous recombination in animal and plant cells
US5736367A (en) * 1992-03-31 1998-04-07 Medimmune, Inc. Vectors and prokaryotes which autocatalytically delete antibiotic resistance
US5527695A (en) * 1993-01-29 1996-06-18 Purdue Research Foundation Controlled modification of eukaryotic genomes
AU728915B2 (en) * 1996-05-09 2001-01-18 Nippon Paper Industries Co. Ltd. Vector for introducing a gene into a plant from which a selectable marker gene can be optionally removed
EP1025217B1 (en) * 1997-10-24 2006-10-04 Invitrogen Corporation Recombinational cloning using nucleic acids having recombination sites
DK1234022T3 (en) * 1999-07-23 2010-07-19 Univ California DNA recombination in eukaryotic cells with the bacteriophage PHIC31 recombination system

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO0121780A3 *

Also Published As

Publication number Publication date
AU7532500A (en) 2001-04-24
WO2001021780A2 (en) 2001-03-29
JP2003510043A (en) 2003-03-18
RU2002108173A (en) 2004-03-10
GB9921937D0 (en) 1999-11-17
BR0014521A (en) 2002-06-11
CN1375010A (en) 2002-10-16
WO2001021780A3 (en) 2001-10-18
HUP0202805A2 (en) 2002-12-28
CA2384932A1 (en) 2001-03-29

Similar Documents

Publication Publication Date Title
Zubko et al. Intrachromosomal recombination between attP regions as a tool to remove selectable marker genes from tobacco transgenes
US7115798B1 (en) Methods for regulated expression of triats in plants using multiple site-specific recombination systems
Miao et al. Targeted disruption of the TGA3 locus in Arabidopsis thaliana
EP0959133A1 (en) A process for inhibiting expression of genes
EP2796558A1 (en) Improved gene targeting and nucleic acid carrier molecule, in particular for use in plants
JPH11500617A (en) Method for obtaining a male sterile plant
CN110157726A (en) The method of Plant Genome fixed point replacement
Mlynárová et al. A self-excising Cre recombinase allows efficient recombination of multiple ectopic heterospecific lox sites in transgenic tobacco
CN1195064C (en) Vector for gene transfer into plant allowing optional deletion of marker gene
US7238854B2 (en) Method of controlling site-specific recombination
Moravčíková et al. Feasibility of the seed specific cruciferin C promoter in the self excision Cre/lox P strategy focused on generation of marker-free transgenic plants
US20030154518A1 (en) Removal of selectable markers from transformed cells
EP2875137B1 (en) Method for performing homologous recombination
Marjanac et al. Evaluation of CRE-mediated excision approaches in Arabidopsis thaliana
WO2001021780A2 (en) Targeted gene removal
JPWO2003020940A1 (en) Genome modification of higher plants
Husaini et al. Approaches for gene targeting and targeted gene expression in plants
Boszorádová et al. Application of Arabidopsis tissue-specific CRUC promoter in the Cre/lox P self-excision strategy for generation of marker-free oilseed rape: potential advantages and drawbacks
AU2000270487B2 (en) Reduction of transmission of transgenes in plants
Thirukkumarana et al. Generation of phenotypically normal marker-free transgenic plants of Kalanchoe blossfeldiana through hairy root induction
CN100552031C (en) Method for removing exogenous genes acting in stages in transgenic plants
KR101050048B1 (en) vector
AU2000270487A1 (en) Reduction of transmission of transgenes in plants
AU2004217489A1 (en) Removal of plastid sequences by transiently expressed site-specific recombinases
WO2024229458A2 (en) Lox sites and methods for genome engineering in plants

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20020301

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE

AX Request for extension of the european patent

Free format text: AL;LT;LV;MK;RO;SI

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20040401