EP1171628A2 - Verfahren zum screening von verbindungen - Google Patents

Verfahren zum screening von verbindungen

Info

Publication number
EP1171628A2
EP1171628A2 EP00919102A EP00919102A EP1171628A2 EP 1171628 A2 EP1171628 A2 EP 1171628A2 EP 00919102 A EP00919102 A EP 00919102A EP 00919102 A EP00919102 A EP 00919102A EP 1171628 A2 EP1171628 A2 EP 1171628A2
Authority
EP
European Patent Office
Prior art keywords
elegans
serca
activity
protein
transgenic
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP00919102A
Other languages
English (en)
French (fr)
Inventor
Richard Zwaal
Jose Groenen
Thierry Bogaert
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Devgen NV
Original Assignee
Devgen NV
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from GBGB9908670.4A external-priority patent/GB9908670D0/en
Priority claimed from GBGB9912736.7A external-priority patent/GB9912736D0/en
Application filed by Devgen NV filed Critical Devgen NV
Publication of EP1171628A2 publication Critical patent/EP1171628A2/de
Withdrawn legal-status Critical Current

Links

Classifications

    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K67/00—Rearing or breeding animals, not otherwise provided for; New or modified breeds of animals
    • A01K67/033—Rearing or breeding invertebrates; New breeds of invertebrates
    • A01K67/0333—Genetically modified invertebrates, e.g. transgenic, polyploid
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/34—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving hydrolase
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/34—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving hydrolase
    • C12Q1/42—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving hydrolase involving phosphatase
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/5082—Supracellular entities, e.g. tissue, organisms
    • G01N33/5085—Supracellular entities, e.g. tissue, organisms of invertebrates
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/5308—Immunoassay; Biospecific binding assay; Materials therefor for analytes not provided for elsewhere, e.g. nucleic acids, uric acid, worms, mites
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6887—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids from muscle, cartilage or connective tissue
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/94—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving narcotics or drugs or pharmaceuticals, neurotransmitters or associated receptors
    • G01N33/9406—Neurotransmitters
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00—Genetically modified animals
    • A01K2217/05—Animals comprising random inserted nucleic acids (transgenic)
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
    • G01N2333/43504—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans from invertebrates
    • G01N2333/43526—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans from invertebrates from worms
    • G01N2333/4353—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans from invertebrates from worms from nematodes
    • G01N2333/43534—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans from invertebrates from worms from nematodes from Caenorhabditis
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
    • G01N2333/46—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans from vertebrates
    • G01N2333/47—Assays involving proteins of known structure or function as defined in the subgroups
    • G01N2333/4701—Details
    • G01N2333/4709—Amyloid plaque core protein
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
    • G01N2333/46—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans from vertebrates
    • G01N2333/47—Assays involving proteins of known structure or function as defined in the subgroups
    • G01N2333/4701—Details
    • G01N2333/4712—Muscle proteins, e.g. myosin, actin, protein

Definitions

  • the invention is concerned with methods for use in the identification of compounds which affect the activity of a physiologically important calcium pump, the sarco/endoplasmic reticulum Ca 2+ ATPase (SERCA) .
  • SERCA sarco/endoplasmic reticulum Ca 2+ ATPase
  • Intracellular Ca 2+ stores hold a key position in the intracellular signalling. They allow the rapid establishment of Ca 2 " gradients, and accumulate and release Ca 2+ in order to control cytosolic Ca 2+ levels.
  • lumenal Ca + intervenes in the regulation of the synthesis, folding and sorting of proteins in the endoplasmic reticulum (Brostrom and Brostrom, 1990, Ann. Rev. Physiol. 52:577-590; Suzuki et al., 1991, J. Cell. Biol. 114:189-205; ileman et al., 1991, J. Biol. Chem. 266:4500-4507). Furthermore it controls signal-mediated and passive diffusion through the nuclear pore (Greber and Gerace, 1995, J. Cell. Biol. 128:5-_14) .
  • SERCA sarco/endoplasmic reticulum Ca 2' ATPase
  • SERCA3 SERCA3.
  • the SERCA isoforms are usually tagged to the endoplasmic reticulum (ER) or ER subdomains like the sarcoplasmic reticulum, although the precise subcellular location is often not known.
  • the SERCA proteins belong to the group of ATP-driven ion-motive ATPases, which also includes, amongst others, the plasma membrane Ca 2+ -transport ATPases (PMCA), the Na+-K+-ATPases, and the gastric H+-K+-ATPases .
  • PMCA plasma membrane Ca 2+ -transport ATPases
  • the SERCA Ca 2+ -transport ATPases can be distinguished from their plasma membrane counterparts like PMCA by the specific SERCA inhibitors: thapsigargin, cyclopiazonic acid, and 2, 5-di (tert-butyl) -1, -benzohydroquinone
  • SERCA1 is only expressed in fast-twitch skeletal muscle fibres.
  • the gene encodes two different isoforms; SERCAlb which is the neonatal isoform and SERCAla the adult isoform (Brandl et al., 1986, Cell 44:597-607; Brandl et al . , 1987, J. Biol. Chem. 262:3768-3774).
  • the difference between the two isoforms is the result of an alternative splice.
  • the neonatal isoform contains a highly charged carboxyl-terminal extension (Korczak et al., 1988, J. Biol. Chem. 263 : 4813-4819) .
  • SERCAla and SERCAlb exhibit nearly identical maximal Ca 2+ -turnover rate, Ca"-affinity and ATP-dependency of Ca 2 " transport (Maruyama and MacLennan, 1988, PNAS 85:3314-3318).
  • the human SERCA1 gene is mapped on chromosome 16P12.1 and is about 26 kb long (MacLennan et al., 1987, Somatic Cell Mol. Genet. 13:341-346;
  • SERCA2 is expressed in muscle and non-muscle cells.
  • the human SERCA2 gene maps to chromosome 12q23-q24.1 (Otsu et al . , 1993, Genomics 17:507-509). Partial sequence analysis suggests that the same exon/intron layout is conserved between SERCA1 and SERCA2.
  • mRNA of SERCA2 can be divided in 4 different classes; class 1 encodes SERCA2a and is mainly expressed in muscle, the other classes encode SERCA2b and are mainly expressed in non-muscle tissues.
  • SERCA2b harbors a 49 amino acid extension, which contains a highly hydrophobic stretch. As with SERCA1, no functional difference can be measured between the two SERCA2 isoforms when expressed in COS cells (Campbell, 1991, J.
  • SERCA2a slow-twitch skeletal and cardiac muscle only express SERCA2a
  • SERCA2b referred to as the "housekeeping" isoform
  • Cardiac muscle expresses 70 times more protein and only 7 times more SERCA2a mRNA compared to stomach smooth muscle which expresses SERCA2b (Khan et al., 1990, J. Biochem. 268:415-419) .
  • SERCA3 is considered to be the non-muscle SERCA isoform. SERCA3 lacks the putative interacting domain for phospholamban, and hence, does not respond to this modulator (Toyofuku et al., 1993, J. Biol. Chem. 268:2809-2815). When expressed in COS cells, SERCA3 shows approximately 5-fold lower activity for Ca 2* and a slightly higher pH optimum (Toyofuku et al., 1992, J. Biol. Chem. 267:14490-14496). In platelets, mast cells and lymphoid cells SERCA3 is co-expressed with SERCA2b (Wuytack et al., 1994, J. Biol. Chem.
  • PLB and the SERCA Ca " pump are able to interact and phosphorylation of PLB alters its properties, as confirmed by cross-linking experiments (James et al., 1989, Nature 342:90-92). In some experiments, inhibitory effects of PLB have been observed on co-transfection of PLB and SERCA2a in COS-1 cells (Fuji et al. 1990, FEBS Lett. 273:232-234).
  • This CaM kinase phosphorylation is specific for SERCA2 and may act synergistically with the phosphorylation of phospholamban.
  • Sarcolipin is a peptide of 33 amino acids in length that co-purifies with SERCAl.
  • the human gene encoding SLN was mapped to chromosome Ilq22-q23.
  • the protein sequence shows some homology to phospholamban, especially in the lumenal part of the protein.
  • SERCAl In rabbits SLN is highly expressed in fast-twitch skeletal muscle, as is SERCAl (Odermatt et al., 1997, Genomics 45:741-553).
  • SERCAl Optt et al., 1997, Genomics 45:741-553.
  • a decrease of SERCAl affinity for Ca 2* was observed, but maximal Ca 2* uptake rates were stimulated. Mutational analysis provided evidence for different mechanisms of interaction of both SLN and
  • SERCA plays an important role in regulating Ca 2+ levels, and hence in pathologies related to abnormal Ca 2+ concentrations and regulation. For instance, abnormal cytosolic free Ca 2+ levels are involved in different muscle pathologies (Morgan, 1991, N. Engl. J. Med. 325:625-632; Perreault et al., 1993, Circulation 87 Suppl. VII.31-37). Other major pathologies in which SERCA may play a role include cardiac hypertrophy, heart failure, and hypertension (Arai et al., 1994, Circ. Res. 74:555-564; Lompre et al.,_-1994, J. Mol. Cell. Cardiol. 26:1109-1121).
  • Cardiac hypertrophy is an adaptive response of the cardiac muscle to a hemodynamic overload, in which diastolic dysfunction is one of the earliest signs of pathological hypertrophic response.
  • diastolic dysfunction is one of the earliest signs of pathological hypertrophic response.
  • SERCA2 mRNA and protein levels are decreased, as is the sarcoplasmic reticulum Ca 2+ uptake ( Komuro et al., 1989, J. Clin Invest. 83:1102-1108; de la Bastie et al., 1990, Circ. Res. 66:554-564).
  • SERCA2 mRNA, SERCA2 protein levels and decreased Ca :* uptake in a failing heart (Arai et al., 1993, Circ. Res. 72:463-469; Hasenfuss et al., 1994, Circ. Res., 75: 434-442) .
  • the decreased levels of SERCA2 expression are accompanied by decreased expression of phospholamban, cardiac ryanodine receptor and dihydropyridine receptor (Vatner et al., 1994, Circulation 90:1423-1430; Go et al., 1995, J. Clin. Invest. 95:888-894; Takahashi et al., 1992, J. Clin. Invest. 90:927-935).
  • Darier-White disease is an autosomal-dominant skin disorder characterized by loss of adhesion between epidermal cells (acantholysis) and abnormal keratinization.
  • SERCA2 mutations have been found in SERCA2, demonstrating the role of SERCA and Ca 2* -signalling pathway in the regulation of cell-to-cell adhesion and differentiation of the epidermis (Sakuntabhai et al., 1999, Nature Genetics 21:271-277) .
  • NIDDM non-insulin-dependent diabetes mellitus
  • C. elegans In mammals, there are three genes encoding different SERCA isoforms. In contrast, the nematode worm Caenorhabditis elegans (C. elegans) has only a single homologue of the mammalian SERCA protein, which was identified by the C. elegans genome-sequencing consortium (see Science issue 282, 1998).
  • the C. elegans SERCA gene is located on chromosome III on a cosmid named K11D9. On a physical level, the gene consists of six exons that span an Open Reading Frame of 3.2 kb, resulting in a predicted protein of 1059 amino acids.
  • the consensus alternative splice site that is present in the C-terminal end of mammalian
  • SERCA genes is present in the worm as well. This leads to a second isoform consisting of 7 exons that span an ORF of 3.0kb, resulting in a protein of 1004 amino acids. This may indicate a functional conservation of this domain of the protein, e.g. in regulating the activity of the SERCA pump.
  • C. elegans is a small roundworm that has a life span of only three days, allowing rapid accumulation of large quantities of individual worms. The cell-lineage is fixed, allowing identification of each cell which has the same position and developmental potential in each individual animal. C. elegans is extremely amenable to genetic approaches and a large collection of mutants have been isolated that are defective in embryonic development, behaviour, morphology, neurobiology etc. There is also a large cosmid collection covering almost the whole C. elegans genome, which is used to determine the complete genomic sequence of the worm. These characteristics of C. elegans make it the organism of choice for use as a tool in the drug discovery process. In particular, C.
  • elegans may be used in the development of high throughput live animal compound screens, useful in r.he development of potential candidate drugs, in which worms are exposed to the compound under test and any resultant phenotypic and/or behavioural changes are recorded.
  • the present inventors have developed a number of C. elegans-based screening methods which may be used to identify compounds which modulate the activity of SERCA, either directly or via the SERCA/PLB interaction.
  • Compounds identified as modulators of SERCA activity using these screening methods may be useful as pharmaceuticals in the treatment of the wide range of diseases with which the SERCA genes have been associated.
  • the invention provides a method of identifying compounds which are capable of enhancing or up-regulating the activity of a sarco/endoplasmic reticulum calcium ATPase, which method comprises:
  • the method of the invention which will be hereinafter referred to as the ⁇ up-regulation assay' is performed using a C. elegans strain which exhibits reduced SERCA ATPase activity in one or more cell types or tissues, as compared to the SERCA ATPase activity in wild-type C. elegans .
  • worms which exhibit reduced SERCA activity compared to wild-type worms manifest a variety of phenotypic and behavioural defects.
  • the basis of the up-regulation assay is therefore to take worms which exhibit defects due to reduced SERCA activity, contact these worms with the compound under test and screen for phenotypic, behavioural or biochemical changes indicating a reversion towards wild-type SERCA activity.
  • worms with reduced SERCA activity often show a reduction in the rate of pharynx pumping.
  • screening for an increase in the rate of pharynx pumping in the presence of a test compound would indicate a reversion towards wild-type SERCA activity due to the ability of the compound to enhance or up-regulate SERCA.
  • N2 strain an example of a C. elegans strain which exhibits 'wild-type' SERCA activity is the N2 strain (this strain can be obtained from CGC, University of Minnesota, USA) .
  • the N2 strain has been particularly well characterised in the literature with respect to properties such as pharynx pumping rate, growth rate and egg laying capacity (see Methods in Cell Biology, Volume 48, Caenorhabditis elegans: Modern biological analysis of an organism, ed. by Henry F. Epstein and Diane C. Shakes, 1995 Academic Press; The nematode Caenorhabditis elegans, ed. by William Wood and the community of C. elegans researchers., 1988, Cold Spring Harbor Laboratory Press; C. elegans II, ed. by Donald L. Riddle, Thomas Blumenthal, Barbara J. Meyer and James R. Priess, 1997, Cold Spring Harbor Laboratory Press.).
  • C. elegans which exhibit reduced SERCA activity in one or more cell types or tissues can be obtained in several different ways.
  • worms with reduced SERCA activity are obtained by treating a culture of worms with a chemical inhibitor of SERCA such as, for example, thapsigargin .
  • a chemical inhibitor of SERCA such as, for example, thapsigargin .
  • treatment of C. elegans with thapsigargin results in recognisable phenotypic and behavioural changes such as paleness, reduced growth, pharynx pumping defects and production of very few progeny which are sick and grow very slowly. Accordingly, reversion of any one of these characteristics towards wild-type can provide an indication of a reversion towards wild-type SERCA activity.
  • worms with reduced SERCA activity can be produced by specifically down-regulating the expression of SERCA in one or more tissues using antisense techniques or double stranded RNA inhibition.
  • This can be achieved by transfection of C. elegans with a vector that expresses either an antisense C. elegans SERCA RNA or double stranded C. elegans SERCA RNA.
  • Specific down-regulation of SERCA expression in different cell types or tissues of the worms can be achieved by incorporating into the vector an appropriate tissue-specific promoter to drive expression of the antisense RNA or double stranded RNA in the required tissues.
  • SERCA expression will be specifically down-regulated only in those tissues which express the antisense RNA or double stranded RNA.
  • the promoter region of the C. elegans SERCA gene itself can be used to direct expression of an antisense RNA or double stranded RNA in all the cells and tissues which express SERCA.
  • the C. elegans myo-2 promoter can be used to direct expression in the pharynx.
  • the C. elegans myo-3 promoter can be used to direct expression in the body wall muscles.
  • RNAi techniques which may be used to inhibit SERCA activity are described in the applicant's co-pending International patent application No. WO 00/01846. These techniques, which are based on delivery of dsRNA to C. elegans by feeding with an appropriate dsRNA or feeding with food organisms which express an appropriate dsRNA, may lead to a more stable RNAi phenotype than results from injection of dsRNA.
  • the C. elegans exhibiting reduced SERCA ATPase activity in one or more cell types or tissues may be a mutant strain in which SERCA activity is reduced but not eliminated i.e. a reduction-of-function mutant. The mutation may give rise to reduced SERCA activity through a down-regulation of SERCA expression in one or more cell types or tissues or through a defect in the SERCA protein itself or a defect in regulation of the activity of the SERCA protein.
  • a reduction-of-function mutant or a knock-out mutant can be isolated using a classical non-_complementation screen, starting with a heterozygote C. elegans strain carrying a mutant SERCA allele on one chromosome and a recessive marker close to the wild-type SERCA allele on the other chromosome.
  • the worms are subjected to mutagenesis using standard techniques (EMS or UV-TMP are suitable for this purpose) and the progeny is screened by eye for defects, especially in tissues which express SERCA. Since the screening is performed in the FI generation, mutations will only give rise to a phenotype if the mutation occurs in the SERCA gene (due to non-complementation) or if the mutation is dominant, which does not occur frequently. These two possibilities can be distinguished in subsequent generations.
  • a newly introduced SERCA mutation should be linked to the recessive marker.
  • DNA sequencing can be performed to determine the nature of the mutation.
  • the step of 'detecting a phenotypic, biochemical or behavioural change in the C. elegans indicating a reversion towards wild type SERCA activity' may be performed in several different ways.
  • the method of choice is generally dependent upon the phenotype/behavioural characteristics of the starting worm strain, which is in turn generally dependent upon the nature of the cell types or tissues in which SERCA activity is reduced.
  • Inhibition experiments for example the RNAi experiments and thapsigargin experiments described herein, demonstrate that SERCA is a vital protein for C. elegans .
  • reduction of SERCA activity results in a variety of phenotypes that can be used as basis of an assay to isolate compounds that alter the activity of SERCA.
  • the main defects, and hence phenotypes, associated with reduced SERCA activity are related to muscle function e.g pharyngeal muscle, body wall muscle, vulva muscle, anal repressor muscle, and anal_- sphincter muscle. Screens based on reversion of defects in these muscles to wild-type can be used to identify compounds and genes that alter the activity of SERCA. Moreover, other phenotypes, such as paleness, reduced growth, reduced progeny, protruding vulva and protruding rectum can be used to identify compounds and genes that alter the function of SERCA.
  • the up- regulation assay can be based on detection of changes in the pharynx pumping efficiency. If the starting worm strain exhibits a reduced rate of pharynx pumping due to reduced SERCA activity in the pharynx, then an increase in the rate of pharynx pumping in the presence of a test compound can be used as an indicator of a reversion towards wild-type SERCA activity in the pharynx.
  • C. elegans feeds by taking in liquid containing its food (e.g. bacteria).
  • pharyngeal pumping The process of taking up of liquid and subsequently spitting it out, requiring contraction and relaxation of muscles, is called pharyngeal pumping or pharynx pumping.
  • Alterations in SERCA activity influence the pharyngeal pumping rate.
  • inhibition of SERCA using thapsigargin causes a reduction in the rate of pharynx pumping.
  • Measurement of the pumping rate of the C. elegans pharynx is hence a method to determine the activity of SERCA.
  • the pharynx pumping efficiency can be conveniently measured by placing the nematodes in liquid containing a fluorescent marker molecule precursor, such as calcein-AM.
  • Calcein-AM present in the medium is taken up by the nematodes and the .AM moiety is cleaved off by the action of esterases present in the C. elegans gut, resulting in the production of the fluorescent molecule calcein.
  • the fluorescence measured in the gut of the formed calcein is a quantitative and qualitative measurement of the SERCA activity.
  • the up-regulation assay can be based on detection of changes in the egg laying behaviour of the C. elegans or on detecting changes in the amount of progeny produced by the C. elegans .
  • Defects associated with reduced SERCA activity in the vulva muscles include defects in the production and laying of eggs and hence a reduction in the number of progeny produced.
  • worms with reduced SERCA expression in the vulva are not able to lay their eggs. The eggs thus hatch inside the mother, which then dies. These mothers are easy to recognize under the dissection microscope. As a consequence of the egg laying defect, these worms produce less progeny, and hence the culture as a whole grows much more slowly.
  • Defects associated with reduced SERCA activity have also been observed in the gonad, including the sheath cells and the spermatheca. These defects also result in reduced egg formation and hence a reduced egg laying phenotype.
  • the offspring can be measured directly using the growth rate assay and/or the movement assay described below.
  • specific antibodies and fluorescent antibodies can be used to detect the offspring. Any specific antibody that only recognizes eggs, or LI or L2 or L3 or L4 stage worms, will only recognize offspring, such a specific antibody that recognizes an antigen on the LI surface has been described by Donkin and Politz, 13G 10(2) :71.
  • the FANS device is a 'worm dispenser apparatus' having properties analogous to flow cytometers such as fluorescence activated cell scanning and sorting devices (FACS) and is commercially available from Union Biometrica, Inc,
  • the FANS device also designated a nematode flow meter, can be the nematode FACS analogue, described as fluorescence activated nematode scanning and sorting device (FANS) .
  • FANS fluorescence activated nematode scanning and sorting device
  • the FANS device enables the measurement of nematode properties, such as size, optical density, fluorescence, and luminescence and the sorting of worms based on these properties.
  • the up-regulation assay can be based on detection of a change in the defecation behaviour of the C. elegans .
  • Defecation rate can be measured using an assay similar to that described above for the measurement of pharynx pumping efficiency, but using a marker molecule which is sensitive to pH.
  • a suitable marker is the fluorescent marker BCECF. This marker molecule can be loaded into the C. elegans gut in the form of the precursor BCECF-AM which itself is not fluorescent.
  • BCECF-AM is added to worms growing in liquid medium the worms will take up the compound which is then cleaved by the esterases present in the C. elegans gut to release BCECF.
  • BCECF fluorescence is sensitive to pH and under the relatively low pH conditions in the gut of C. elegans (pH ⁇ 6) the compound exhibits no or very low fluorescence.
  • the level of BCECF fluorescence in the medium is therefore an indicator of the rate of defecation of the nematodes.
  • Defecation can also be measured using a method based on the luminescent features of the chelation of terbium by aspirin.
  • the method requires two preloading steps, first the wells of a multi-well plate are pre-loaded with aspirin (prior to the addition of the nematode worms) and second, bacteria or other nematode food source particles are pre-loaded with terbium using standard techniques known in the art. C. elegans are then placed in the wells pre-loaded with aspirin and are fed with the bacteria pre-loaded with terbium.
  • the terbium present in the pre-loaded bacteria added to the wells will result in a low level of background luminescence.
  • the bacteria When the bacteria are eaten by the nematodes the bacterial contents will be digested but the terbium will be defecated back into the medium. The free terbium will then be chelated by the aspirin which was pre-loaded into the wells resulting in measurable luminescence. The luminescence thus observed is therefore an indicator of nematode defecation.
  • Growth rate can be monitored by measuring the number of eggs or the number offspring present in the culture, by measuring the total fluorescence in the culture (this can be autoflourescence, or fluorescence caused by a transgene encoding a flourescent or luminescent protein) , but can also be measured using the movement screen described below.
  • the growth rate of a culture of C. elegans can also be assayed by measuring the turbidity of the culture.
  • the worms are grown in liquid culture in the presence of E. coli or other suitable bacterial food source. As the culture of worms grows the food source bacteria will be consumed. The greater the number of worms in the culture, the more food source bacteria will be digested.
  • measurement of the turbidity or optical density of the liquid culture will provide an indirect indication of the number of worms in the culture.
  • the growth rate and amount of progeny can be measured on a plate.
  • Slow growing nematodes, nematodes with vulva defects and nematodes with gonad defects will produce less progeny within a certain time compared to nematodes which do not have these defects.
  • the amount of offspring produced is scored on day five and on day eight. In experiments where the amount of offspring is reduced very drastically due to severe defects in the vulva, gonad or growth rate reduction, the offspring can also be scored at later time intervals.
  • the up-regulation assay can be performed by detecting changes in the movement behaviour of C. elegans .
  • SERCA is widely expressed in the muscles of C. elegans, including the muscles of the body wall.
  • a reduction of SERCA activity in the body wall muscles gives rise to worms with movement defects.
  • These strains can be used as the basis of an assay in which the worms are contacted with a compound under test and any changes in the movement behaviour of the worms are observed.
  • Compounds which cause the defective movement to revert towards wild-type movement behaviour are scored as compounds capable of enhancing/up-regulating the activity of SERCA.
  • Nematode worms that are placed in liquid culture will move in such a way that they maintain a more or less even (or homogeneous) distribution throughout the culture. Nematode worms that are defective in movement will precipitate to the bottom in liquid culture. Due to this characteristic of nematode worms as result of their movement phenotype, it is possible to monitor and detect the difference between nematode worms that move and nematodes that do not move.
  • Advanced multi-well plate readers are able to detect sub-regions of the wells of multi-well plates. By using these plate readers it is possible to take measurements in selected areas of the surface of the wells of the multi-well plates. If the area of measurement is centralized, so that only the middle of the well is measured, a difference in nematode autofluorescence (fluorescence which occurs in the absence of any external marker molecule) can be observed in the wells containing a liquid culture of nematodes that move normally as compared to wells containing a liquid culture of nematodes that are defective for movement. For the wells containing the nematodes that move normally, a low level of autofluorescence will be observed, whilst a high level of autofluorescence can be observed in the wells that contain the nematodes that are defective in movement.
  • nematode autofluorescence fluorescence which occurs in the absence of any external marker molecule
  • autofluorescence measurements can be taken in two areas of the surface of the well, one measurement in the centre of the well, and on measurement on the edge of the well. Comparing the two measurements gives analogous results as in the case if only the centre of the well is measured but the additional measurement of the edge of the well results in an extra control and somewhat more distinct results.
  • the inventors have developed a method of analysing SERCA activity in a given cell type or tissue which is based upon the use of the marker molecule apoaequorin which is sensitive to changes in intracellular Ca 2+ .
  • Aequorin is a calcium-sensitive bioluminescent protein from the jellyfish Aequorea victoria. Recombinant apoaequorin, which is luminescent in the presence of calcium but not in the absence of calcium, is most useful in determining intracellular calcium concentrations and even calcium concentrations in sub- cellular compartments.
  • Expression vectors suitable for expressing recombinant apoaequorin and, in addition, vectors expressing apoaequorin proteins which are targeted to different sub-cellular compartments, for example the nucleus, the mitochondria or the endoplasmic reticulum are available commercially (see below) .
  • an apoaequorin that is targeted to the endoplasmic reticulum (hereinafter referred to as erAEQ) is particularly useful for developing assays for SERCA activity.
  • erAEQ an apoaequorin that is targeted to the endoplasmic reticulum
  • erAEQ an apoaequorin that is targeted to the endoplasmic reticulum
  • the mouse gene targets the aequorin to the endoplasmic reticulum, and the aequorin is mutated to make it less sensitive to calcium, as the concentrations of this ion are relatively high in the endoplasmic reticulum.
  • apoaequorin is the calcium sensor of choice, it would be apparent to persons skilled in the art that any other calcium sensor localized in the endoplasmic reticulum could be used with equivalent effect
  • Plasmid expression vectors which drive expression of the ER-localized apoaequorin in C. elegans can be easily constructed by cloning nucleic acid encoding erAEQ downstream of a promoter capable of directing gene expression in one or more tissues or cell types of C.
  • the promoter and the erAEQ- encoding sequence are operatively linked.
  • operatively linked refers to a juxtaposition wherein the components described are in a relationship permitting them to function in their intended manner.
  • the apoaequorin gene in fusion with the signals to locate the resulting protein to the endoplasmic reticulum was isolated from erAEQ/pcDNAI by EcoRI digestion and cloned into pBlue2SK.
  • the erAEQ was then isolated as an EcoRI/Acc65l fragment by partial digestion and cloned in the vector pGK13 digested with the same enzymes .
  • Suitable promoters include the pharynx-specific promoter myo-2, the C. elegans SERCA promoter which directs expression in a wide range of muscle tissues and the body wall muscle-specific promoter myo-3.
  • the vectors can then be used to construct transgenic C. elegans according to the standard protocols known to those of ordinary skill in the art.
  • Expression of erAEQ allows for the determination of the calcium levels in the endoplasmic reticulum of various C. elegans cells and tissues, using the protocols of the manufacturer of erAEQ, or minor modifications thereof.
  • Alterations in SERCA activity influence the concentration of calcium in the endoplasmic reticulum as SERCA functions as an endoplasmic reticulum calcium pump.
  • the apoaequorin luminescence measured in the assay is directly related to SERCA activity.
  • the basic ⁇ up-regulation assay' methodology can also be adapted to perform a genetic screen in order to identify C. elegans which carry a mutation having the effect of enhancing or up-regulating the activity of SERCA.
  • the invention also provides a method of identifying C. elegans which carry a mutation having the effect of enhancing or up-regulating the activity of a sarco/endoplasmic reticulum calcium ATPase, which method comprises: subjecting a population of C. elegans with wild-type SERCA activity to random mutagenesis; allowing the mutagenized C. elegans to grow for one or two generations; treating the mutagenized C.
  • elegans to reduce the activity of the SERCA ATPase in one or more cell types or tissues; and scoring a phenotypic, biochemical or behavioural characteristic of the C. elegans as an indicator of SERCA ATPase activity in the C. elegans in the said one or more cell types or tissues.
  • This genetic screen differs from the ⁇ up- regulation' assay used to identify compounds in that the C. elegans are subjected to a random mutagenesis step before they are treated to reduce the activity of the SERCA ATPase.
  • the random mutagenesis step can be performed using any of the techniques known in the art. EMS and UV-TMP mutagenesis, both of which are well known in the art (see Methods in Cell biology Vol. 48, 1995, ed. by Epstein and Shakes, Academic press) are preferred. After mutagenesis the worms are grown for one or two generations before they are treated to reduce the activity of SERCA.
  • the worrr.s are heterozygous for any mutation, after two generations they may be homozygous or heterozygous for any mutation. Therefore growth for one generation leads to isolation of dominantly acting suppressors, growth for two generations yields both recessively and dominantly acting suppressors.
  • the step of treating the C. elegans to reduce the activity of the SERCA ATPase preferably comprises either treating the worms with a chemical inhibitor of SERCA, for example thapsigargin, or specifically down- regulating the expression of SERCA using antisense or double-stranded RNA inhibition.
  • a chemical inhibitor of SERCA for example thapsigargin
  • thapsigargin is added to worms in plate or liquid culture few progeny are produced and these don't grow as well as wild-type worms.
  • To perform a genetic screen based on thapsigargin inhibition wild-type worms are first subjected to standard mutagenesis protocols (using EMS or UV/TMP or any other mutagen) .
  • FI or F2 progeny of the mutagenized worms are distributed individually to standard growth medium with bacteria, to which 10 to 50 mM thapsigargin is added. After 4-8 days the cultures are inspected for growth of progeny, either by eye or using the ⁇ ⁇ ,urbidity assay', as described above. Wild-type C. elegans with an integrated transgenic array causing general expression of a reporter protein such as GFP can also be used. In this case, cultures are inspected for growth of progeny either by eye or by detecting expression of the reporter protein.
  • Thapsigargin causes a short term pharynx pumping defect.
  • the genetic screen can also be performed by measuring changes in the pharynx pumping efficiency.
  • Wild-type worms are mutagenized and grown on solid media according to standard techniques known in the art.
  • Adults are washed off the plates and put in buffer with calcein-AM and thapsigargin (an assay buffer of 40mM NaCl, ⁇ mM Kcl, ImM CaCl 2 , lmM MgCl 2 can be used for this purpose) .
  • the worms are viewed under a fluorescence microscope and individual worms that show far brighter gut fluorescence than the other worms are selected, placed individually onto fresh plates and grown for an additional generation.
  • Calcein-AM uptake in the presence of thapsigargin is then re-checked.
  • Inhibition of SERCA by antisense or double stranded-RNA inhibition will result in the same phenotypes as described above for the up-regulation assay and hence the same screens can be used to select for mutants that enhance or up-regulate SERCA activity.
  • the precise nature of the screen used depends on the tissue in which the antisense or double stranded SERCA RNA is expressed.
  • An analogous genetic screen can also be performed using a reduction-of-function mutant C. elegans strain which exhibits reduced C. elegans activity in one or more cell types or tissues.
  • the invention provides a method of identifying C. elegans which carry a mutation having the effect of enhancing or up-regulating the activity of a sarco/endoplasmic reticulum calcium ATPase, which method comprises the steps of: subjecting a population of mutant C. elegans which exhibit reduced SERCA activity in one or more cell types or tissues to random mutagenesis; allowing the mutagenized C. elegans to grow for one or two generations; and scoring a phenotypic, biochemical or behavioural characteristic of the C. elegans as an indicator of SERCA ATPase activity in the C. elegans in the said one or more cell types or tissues.
  • a suitable reduction-of-function mutant strain can be isolated as described above.
  • the basis of the above-described genetic screens is to screen for mutations that have the effect of enhancing or up-regulating SERCA activity and thus suppress the inhibitory effect of thapsigargin treatment, antisense or double stranded RNA inhibition of SERCA expression or a reduction-of-function mutation.
  • Mutations likely to be identified using the method of the invention include mutations in genes involved in transcription and/or translation of SERCA, mutations that influence Ca 2+ cycling between the ER and cytoplasm, mutations that influence Ca 2+ buffering and mutations that influence the activity of Ca 2+ binding proteins.
  • the up-regulation assay which may be used to identify compounds which enhance the activity and/or expression of SERCA is based on the use of C. elegans worms in which the activity or expression of the C. elegans SERCA protein is reduced. This may be achieved in at least three different ways. First, mutants can be selected that show reduced SERCA activity. Second, wild-type, mutant, or transgenic C. elegans strains can be treated with compounds that inhibit SERCA activity, such as thapsigargin. Third, RNAi technology can be applied to wild-type, mutant or transgenic C. elegans to reduce the SERCA activity. In each case, screening can be performed to select for compounds that enhance SERCA activity.
  • Such screens may be based on the pharynx pumping rate, egg laying or movement.
  • wild-type, mutant or transgenic strains can be made transgenic for apoaequorin or another calcium marker. These markers may be expressed in the various tissues, such as the pharynx, the body wall muscles, the oviduct, vulva-muscles etc, for which specific promoters are known in the art. Apoaequorin may also be expressed more generally in C. elegans, for instance under the control of the SERCA promoter. The apoaequorin may further be fused to a specific signal peptide translocating the apoaequorin to the endoplasmic reticulum. Selecting compounds that enhance the activity or the expression of SERCA will enhance calcium uptake, and hence increase the bio-luminescence of the apoaequorin located in the lumen of the endoplasmic or sarcoplasmic reticulum.
  • the invention provides a method of identifying compounds which modulate the interaction between a sarco/endoplasmic reticulum calcium ATPase and phospholamban, which method comprises : exposing transgenic C. elegans which contains a first transgene comprising nucleic acid encoding a vertebrate PLB protein and which expresses a SERCA protein to a compound under test; and detecting a phenotypic, biochemical or behavioural change in the transgenic C. elegans indicating an increase in the activity of the SERCA protein.
  • the vertebrate phospholamban (PLB) protein used in this second method of the invention hereinafter referred to as the 'interaction assay' can be any vertebrate PLB protein. Most preferred are pig PLB (GenBank P07473) or human PLB (GenBank P26678) or a humanized pig PLB (see below) . Mutant PLB proteins which exhibit stronger or weaker inhibition of SERCA relative to the wild-type protein may also be used.
  • the SERCA protein expressed by the C. elegans may be a C. elegans SERCA protein, a vertebrate SERCA protein, a fusion between a vertebrate SERCA protein and C. elegans SERCA protein or a mutant SERCA protein, for example a mutant which exhibits greater sensitivity to PLB.
  • the vertebrate SERCA protein can be any vertebrate SERCA isoform.
  • Preferred isoforms are pig SERCA2a (GenBank P11606) , human SERCAla (GenBank AAB 53113), human SERCAlb (GenBank AAB 53112), human SERCA2a (GenBank P16614) and human SERCA2b (GenBank P16615) .
  • Human and pig SERCA2a are most preferred.
  • fusion proteins between C. elegans SERCA and vertebrate SERCA proteins which may be used in the method of the invention are described in the accompanying Examples.
  • the fusion might comprise the N- terminal part of C. elegans SERCA and the C- terminal part of a vertebrate SERCA.
  • transgene refers to a DNA construct comprising a promoter operatively linked to a protein-encoding DNA fragment.
  • the construct may contain additional DNA sequences in addition to those specified above.
  • the transgene may, for example, form part of a plasmid vector.
  • operatively linked it is to be understood that the promoter is positioned to drive transcription of the protein-encoding DNA fragment.
  • a typical approach involves the construction of a plasmid-based expression vector in which a protein-encoding DNA of interest is cloned downstream of a promoter having the appropriate tissue or cell-type specificity.
  • the plasmid vector is then introduced into C. elegans of the appropriate genetic background, for example using microinjection.
  • a second plasmid carrying a selectable marker may be co- injected with the experimental plasmid.
  • the plasmid vector is maintained in cells of the transgenic C. elegans in the form of an extrachromosomal array.
  • plasmid vectors are relatively stable as extrachromosomal arrays they can alternatively be stably integrated into the C. elegans genome using standard technology, for example, using gamma ray-induced integration of extrachromosomal arrays (methods in Cell Biology, Vol 48 page 425-480) .
  • the DNA fragment encoding the SERCA protein or the PLB protein may be a fragment of genomic DNA or cDNA.
  • the DNA encoding the vertebrate SERCA protein is operatively linked to the promoter region of a SERCA gene.
  • the promoter region of the C. elegans SERCA gene is used.
  • the term 'promoter region' as used herein refers to a fragment of the upstream region of a given gene which is capable of directing a pattern of gene expression substantially identical to the natural pattern of expression of the given gene.
  • the aim of the interaction assay is to identify compounds which directly or indirectly disrupt the SERCA/PLB interaction, leading to an increase in SERCA activity.
  • the increase in SERCA activity is monitored indirectly, by detecting phenotypic, biochemical or behavioural changes in the C. elegans which are indicative of an increase in SERCA activity.
  • the nucleic acid encoding PLB is operatively linked to a tissue-specific promoter.
  • the vertebrate PLB can be expressed in all the cells of C. elegans, in a given type of tissue (i.e. all muscles) , in a single organ or tissue (for example, the pharynx or the vulva) , in a subset of cell types, in a single cell type or even in a single cell.
  • tissue i.e. all muscles
  • tissue for example, the pharynx or the vulva
  • the interaction assay may be performed using functional combinations of C. elegans SERCA (especially mutant versions thereof, as discussed below) and vertebrate PLB, it is preferred to use functional combinations of vertebrate SERCA and vertebrate PLB.
  • a transgenic strain which has been modified such that expression of the endogenous C. elegans SERCA protein is abolished or substantially reduced down to background levels. This may be achieved by introducing the transgenes encoding the vertebrate SERCA and PLB into a mutant strain having a knock-out or loss-of-function mutation in the chromosomal C.
  • elegans SERCA gene e.g. strain okl 90 described in the accompanying Examples
  • a protocol for isolating a suitable knock-out mutant strain is given in the examples included herein.
  • expression of the endogenous C. elegans SERCA gene may be abolished/reduced using RNAi technology, as described hereinbefore.
  • the genetic background of the transgenic C. elegans may be wild-type.
  • a vertebrate-specific interaction assay may be achieved by using transgenic C. elegans expressing a mutant version of the vertebrate SERCA protein which is resistant to a chemical inhibitor of SERCA activity, such as thapsigargin.
  • the mutation Phe259Val renders C. elegans SERCA resistant to inhibition with thapsigargin.
  • Equivalent mutations may be introduced into transgenes encoding the vertebrate SERCA proteins using standard site-directed mutagenesis. Applying the SERCA inhibitor, e.g. thapsigargin, to transgenic C. elegans which express a resistant mutant vertebrate SERCA and a vertebrate PLB will result in inhibition of the endogenous C. elegans SERCA only. Thus, if the inhibitor is added to the interaction assay in addition to the test compound, the screen will be specific for the interaction between the vertebrate SERCA and the vertebrate PLB.
  • a particular variant of the interaction assay uses a mutant version of the C. elegans SERCA protein which is more sensitive to vertebrate PLB proteins, such as, for example, a C. elegans SERCA containing 0 T IB
  • the double transgenic is also modified such that expression of the endogenous C. elegans SERCA gene is abolished or substantially reduced.
  • this may be achieved by using a mutant C. elegans genetic background having a knock-out or loss-of-function mutation in the chromosomal SERCA gene or by using RNAi technology to inhibit SERCA expression.
  • it is possible to engineer the mutant SERCA so that in addition to the KDDKPV insertion it also carries a further mutation which renders it resistant to a SERCA inhibitor other than PLB, e.g. the thapsigargin resistance mutation Phe259Val. Addition of the SERCA inhibitor, e.g. thapsigargin, to the assay will result in specific inhibition of the endogenous C. elegans SERCA protein but not the resistant mutant.
  • the step of ""detecting a phenotypic, biochemical or behavioural change in the transgenic C. elegans indicating an increase in the activity of SERCA" can be performed in several different ways.
  • the method is performed by detecting changes in the pharynx pumping efficiency.
  • the rate of pharynx pumping can be measured using a marker molecule precursor such as calcein-AM, as described above for the up-regulation assay.
  • the method can be performed by detecting changes in the egg laying behaviour of the C. elegans or by detecting changes in the number of progeny produced by the C. elegans .
  • the number of progeny produced by the C. elegans can, as described above in connection with the up-regulation assay, be directly counted or can be measured indirectly using a growth assay or a turbidity assay.
  • SERCA activity in cells of the C is particularly suitable for use when the transgenic C. elegans expresses PLB in the pharynx.
  • elegans pharynx can be monitored using apoaequorin luminescence.
  • the C. elegans are transfected with a third transgene which comprises nucleic acid encoding an apoaequorin protein, preferably ER-targeted apoaequorin, operatively linked to promoter capable of directing gene expression in the C. elegans pharynx.
  • a third transgene which comprises nucleic acid encoding an apoaequorin protein, preferably ER-targeted apoaequorin, operatively linked to promoter capable of directing gene expression in the C. elegans pharynx.
  • suitable expression vectors comprising such a transgene has been described hereinbefore.
  • the basic SERCA-PLB interaction screen to select for compounds that inhibit the interaction between SERCA and PLB is based on the construction of transgenic C. elegans expressing PLB.
  • the PLB may be of any vertebrate origin, such as human or pig.
  • the PLB may be expressed ubiquitously or in specific tissues, such as the pharynx, the body wall muscles, the oviduct, vulva muscles etc, for which specific promoters are known in the art.
  • Preferred configurations of the interaction assay are summarised below, however, this is not intended to be limiting to the scope of the invention:
  • Double transgenic C. elegans Double transgenic C. elegans, first transgene encoding a vertebrate PLB, second transgene encoding a vertebrate SERCA; expression of endogenous C. elegans SERCA abolished/reduced by mutation of the SERCA gene in the genetic background or by using RNAi on wild- type genetic background,
  • Double transgenic C. elegans Double transgenic C. elegans, first transgene encoding a vertebrate PLB, second transgene encoding a fusion between C. elegans SERCA and a vertebrate SERCA; expression of endogenous C. elegans SERCA abolished/reduced by mutation of the SERCA gene in the genetic background or by using RNAi on wild-type genetic background,
  • Double transgenic C. elegans Double transgenic C. elegans, first transgene • encoding a vertebrate PLB, second transgene encoding a mutant vertebrate SERCA which is resistant to a SERCA inhibitor other than PLB, e.g. thapsigargin; wild-type genetic background; inhibitor is added to the assay in addition to the compound under test to specifically inhibit endogenous C. elegans SERCA expression,
  • Double transgenic C. elegans Double transgenic C. elegans, first transgene encoding a vertebrate PLB, second transgene encoding a mutant C. elegans SERCA which is more sensitive to inhibition by vertebrate PLB (e.g. KDDKPV insertion); expression of endogenous C. elegans SERCA abolished/reduced by mutation of the SERCA gene in the genetic background or by using RNAi on wild-type genetic background,
  • Double ransgenic C. elegans Double ransgenic C. elegans, first transgene encoding a vertebrate PLB, second transgene encoding a double mutant C. elegans SERCA which is (i) more sensitive to inhibition by vertebrate PLB (e.g. KDDKPV insertion) and (ii) resistant to inhibition by a SERCA inhibitor such as thapsigargin (e.g. Phe259Val) ; wild- type genetic background; inhibitor is added to the assay in addition to the compound under test to specifically inhibit endogenous C. elegans SERCA expression.
  • a SERCA inhibitor such as thapsigargin (e.g. Phe259Val)
  • wild- type genetic background wild- type genetic background
  • inhibitor is added to the assay in addition to the compound under test to specifically inhibit endogenous C. elegans SERCA expression.
  • the invention provides a method of identifying compounds capable of down-regulating the activity of a sarco/endoplasmic reticulum calcium ATPase, which method comprises: exposing transgenic C. elegans containing a transgene comprising nucleic acid encoding a SERCA protein operatively linked to a promoter capable of directing gene expression to a sample of the compound under test; and detecting a phenotypic, biochemical or behavioural change in the transgenic C. elegans indicating a decrease in the activity of the SERCA protein.
  • the SERCA protein used in this third aspect of the invention can be any SERCA isoform from any species.
  • the SERCA protein is C. elegans SERCA, pig SERCA2a, or a human SERCA isoform, most preferably human SERCA 2A.
  • the nucleic acid encoding the SERCA protein is operatively linked to a tissue-specific promoter.
  • the tissue-specific promoter is the C. elegans myo-2 promoter which directs tissue-specific expression in the pharynx.
  • the transgenic C. elegans further contain a second transgene comprising nucleic acid encoding a reporter protein operatively linked to a promoter which is capable of directing gene expression in one or more cell types or tissues of C. elegans .
  • the reporter protein is preferably an autonomous fluorescent protein, for example, a green fluorescent protein or a blue fluorescent protein or a luminescent protein.
  • Transgenic C. elegans over-expressing SERCA are generally observed to be starved and show delayed growth. Compounds which reduce or down-regulate the activity of SERCA will cause a reversion or reduction of this phenotype towards a wild-type phenotype. Accordingly, these worms can be used as a basis of a screen to identify compounds capable of reducing or down-regulating the activity of SERCA, by bringing the worms into contact with the compound under test and then detecting a reversion of the over-expression phenotype reflecting a decrease in the activity of the SERCA transgene.
  • the step of "detecting a phenotypic, biochemical or behavioural change in the transgenic C. elegans indicating a decrease in the activity if the SERCA protein” can be performed in several different ways.
  • transgenic C. elegans which overexpress the SERCA protein exhibit delayed growth. Accordingly, it is possible to look for a reversion of the overexpression phenotype by comparing the growth rate of the transgenic C. elegans in the presence and the absence of the compound under test.
  • Compounds which increase the growth rate of the C. elegans culture are scored as compounds which are capable of reducing or down-regulating SERCA activity. Any of the growth assay methods described in connection with the ⁇ up-regulation' assay could be used for this purpose.
  • the basic down-regulation assay consists of introducing extra SERCA into C. elegans and screening for a compound that inhibits SERCA activity.
  • the SERCA introduced into C. elegans maybe C. elegans SERCA or a SERCA of any vertebrate origin, such as human or pig.
  • the SERCA protein may be expressed ubiquitously or in specific tissues such as the pharynx, the body wall muscles, the oviduct, the vulva muscles etc, for which appropriate tissue or cell type-specific promoters are known in the art.
  • the above-described methodology for the down- regulation assay can be adapted to perform a genetic screen to identify C. elegans carrying a mutation having the effect of reducing or down-regulating SERCA activity.
  • the invention provides a method of identifying C. elegans which carry a mutation having the effect of reducing or down-regulating the activity of a sarco/endoplasmic reticulum calcium ATPase, which method comprises the steps of: providing a transgenic C.
  • elegans strain containing a first transgene comprising nucleic acid encoding a SERCA protein operatively linked to a promoter capable of directing gene expression in one or more cell types or tissues of C. elegans; subjecting a population of the said C. elegans strain to random mutagenesis; allowing the mutagenized C. elegans to grow for one or more generations; and scoring a phenotypic, biochemical or behavioural characteristic of the C. elegans as an indicator of SERCA ATPase activity in the C. elegans in the said one or more cell types or tissues.
  • the genetic screen is preferably carried out using transgenic C. elegans containing an integrated transgene harboring 20-50 ng/ ⁇ l pGK7 (containing the C. elegans genomic SERCA gene, including the promoter region, see examples given below) and a general GFP expressing construct. These worms are starved and show general growth delay.
  • a vertebrate SERCA such as the human or pig SERCA.
  • the screen can be performed using transgenic nematodes containing an integrated transgene harboring the genomic C. elegans SERCA gene operatively linked to the myo-2 promoter, and a general GFP expressing construct. These worms are also starved and show growth delay.
  • the worms are grown and subjected to random mutagenesis according to standard techniques known in the art.
  • the mutagenized worms then are distributed individually to standard growth medium with supplemented with food source bacteria. After 4-8 days the cultures are inspected for growth of progeny, either by eye, by using any of the growth assay techniques mentioned previously in connection with the up-regulation assay, using the turbidity assay or by counting the numbers of progeny produced.
  • Mutations identified using this screen may include mutations in genes involved in transcription and/or translation of SERCA, mutations that influence Ca 2+ cycling between the ER and the cytoplasm, mutations that influence Ca 2+ buffering and mutations that influence the activity of Ca 2+ binding proteins .
  • compounds identified as modulators of SERCA activity using the screening methods of the invention may be useful leads in the development of pharmaceuticals for the treatment of the wide range of diseases with which the SERCA genes have been associated, such as cardiac hypertrophy, heart failure, hypertension, NIDDM, Darier- hite disease, Brody' s disease.
  • SERCA inhibitors are potential pesticides or can be considered as basic compounds for the development of pesticides such as herbicides, insecticides and nematocides.
  • SERCA function is essential in the intracellular trafficking of the Notch receptor in drosophila (Periz et al., 1999 EMBO J; 5983-5993). This studies and others indicate that SERCA is an interesting target for pesticidal intervention. Accordingly, the screening methods described herein could be applied to screen for pesticides.
  • Figure 1 shows a dose-response curve for thapsigargin produced using a liquid culture assay.
  • Figure 2 shows a dose-response curve for thapsigargin produced using a plate assay.
  • Figure 3 illustrates the growth of C. elegans strain UG530 (strain harboring plasmid pGK28) on different concentrations of thapsigargin.
  • the stage of the progeny was determined 5 days after adults were put on the plates. Since the mothers carry the pGK28 containing plasmid on an extrachromosomal transgene, part of the progeny inherited it and part of the progeny did not. These were differentiated based on a GFP marker also present on this transgene.
  • Figure 4 illustrates the nucleotide sequence of the genomic fragment of C. elegans SERCA bounded by primers SERCA P4 and SERCA P8. Exon IV and exon V are shown in capitals, intron IV in lower case. The fragment deleted in okl90 is underlined.
  • SERCA exon 5 (SEQ ID NO: 1) was PCR amplified and cloned into the vector pGEM3 (PROMEGA corporation,
  • the generated double stranded RNA was injected into C. elegans (see Fire at al., 1998, Nature 391:806-811). This resulted in the following phenotypes: 50% of the progeny of the injected animals were embryonic lethal, while the other 50% were early larval lethal. This indicates that SERCA function is vital for C. elegans .
  • inhibition of the expression of SERCA in all tissues results in embryonic or early larval lethality of the nematode.
  • RNAi phenotype Although injection of SERCA dsRNA results in a clear phenotype, useful in the development of assays to select for compounds that alter the SERCA activity, or that alter the activity of partners in the SERCA pathway, or that alter the activity proteins involved in calcium metabolism, a more stable RNAi phenotype would be more efficient. Improved RNAi methods which lead to more stable RNAi phenotypes exist and are described, for example in International patent application No. WO 00/01846. More particularly, an RNAi technology has been developed and tested in which dsRNA can be delivered by feeding the nematode dsRNA or by feeding nematodes with DNA.
  • pGN4 was constructed by cloning the Hindlll - EcoRI fragment of SERCA cloned in vector pGNl using these same restriction sites. This is the same fragment as was used for in vi tro transcription and dsRNA injection, described above.
  • HT115(DE3) bacteria (Fire A, Carnegie Institution, Baltimore, MD) were transfected with pGN4 (and controls with pGNl) and seeded on plates containing IPTG and ampicillin resulting in a high expression of dsRNA by the bacteria.
  • N2 and nuc-1
  • RNAi phenotype useful in assay development and compound screening can be developed using feeding.
  • other possibilities and variants can be used to create a C. elegans SERCA RNAi phenotype.
  • E. coli HT115 has the following characteristics which make it a useful host cell for high level expression of dsRNA: HT115 (DE3) : F- crA mcrb IN (rrnD-rrnE) 1 ⁇ - rncl 4 : : trl O (DE3 lysogen: lacUV5 promoter-T7 polymerase) ; host for IPTG inducible T7 polymerase expression; Rnaselll-.
  • a 11207 bp Spel-Mlul fragment from the cosmid K11D9 was cloned into the vector pUC18 (Messing, J. , 1998, Methods in Enzymol. 101: 20), resulting in the plasmid pGK7.
  • This genomic fragment contains the complete SERCA gene with 5631 bp upstream sequences, the complete coding region and 1088 bp downstream sequences.
  • Transfection of C. elegans with this vector using standard technology resulted in various results. Transfection with high concentrations of DNA (80-200 ng/ ⁇ l) induced embryonic lethality.
  • a 5026bp fragment of the upstream region of the C. elegans SERCA gene was cloned into the vector pPD95.79 (described in Fire et al. (1990) Gene, 93: 189-198) in fusion with a GFP fluorescent protein, resulting in vector pGKlO.
  • the cloned fragment can be considered as the promoter region of the C. elegans SERCA.
  • the vector was injected into C. elegans, using standard methodology well known to persons skilled in the art, and the expression of the GFP was monitored applying standard fluorescent techniques.
  • GFP expression was observed all over the early embryo of the worm, although expression was faint in some tissues. In a later stage of development, from mid-embryo stage, through larval stage to adult stage, strong GFP expression could be observed in all muscle tissue, including the pharyngeal muscles, the body wall muscles, the anal depressor and the anal sphincter. In adults staining was seen in the vulva muscles, the uterine muscles, the spermatecae and the proximal myoepithelial sheath cells of the gonad.
  • a construct containing a smaller promoter fragment, including A of the initiating ATG codon and extending 2915 bp upstream (SEQ ID NO:4), fused to a GFP gene was generated by a PstI deletion of the plasmid pGKlO.
  • This plasmid was designated pGK13.
  • Transfection of the nematode with pGK13 resulted in the same pattern of GFP expression as was observed with pGKlO.
  • a third construct was made containing a 6612 bp fragment of the C. elegans SERCA gene in the plasmid pPD95.75 (described in Fire et al. (1990) Gene, 93: 189-198).
  • the resultant plasmid was designated pGK12.
  • This 6612 bp fragment contains 5637 bp of upstream sequences an ends in exon 4 of the C. elegans SERCA gene (SEQ ID NO: 5).
  • the fragment was cloned as a Sall-Bglll fragment isolated from pGK7, and cloned in fusion to GFP. This fragment contains two transmembrane domains of SERCA. Transfection of C.
  • pGK26 contains GFP inserted directly after the CDS of C. elegans SERCA isoform A using overlap PCR, also containing the SERCA downstream region.
  • pGK27 contains GFP inserted directly after the CDS of the C. elegans SERCA isoform B using overlap PCR, also containing the SERCA downstream region.
  • pGK26 was constructed by the following strategy: Three separate PCR reactions were done to yield three PCR fragments that are joined in consequent overlap PCR. The first fragment is made with the oligonucleotides oGK25 and oGK26 and contains the region upstream of where GFP is inserted. The primer oGK26 is an overlap primer and contains the last 21 nt of SERCA until but not including the stop codon followed by the first 15 nt of GFP. The second fragment contains the complete ORF of GFP including the stop codon. The third fragment is made with oGK27 and oGK28 and contains the region downstream of where GFP is inserted.
  • the primer oGK27 is an overlap primer and contains the last 15 nt of GFP including the stop codon and the first 22 nt of the 3' UTR.
  • the end result after overlap PCR is a "recombination" of these three fragments in which GFP is inserted exactly after and in-frame with the SERCA coding region such that the fragment encodes a SERCA:: GFP fusion protein.
  • This PCR fragment is cloned into pGKT to replace the normal C-terminus of the gene using unique restriction sites in the SERCA coding region and 3' UTR (Apal in the first fragment and Pad in the third fragment) .
  • pGK27 was constructed the same way, using primers oGK21 and oGK22 instead of oGK25 and oGK26, and primers cGK23 and oGK24 instead of primers oGK27 and OGK28. Sequence of primers:
  • OGK24 GCGTTTATCCTTGATTGGAGCTTC
  • OGK25 GAATGGATCGCCGTGTTGAAG oGK26 : TTCTCCTTTACTCATGTCGCGTTTATCCTTGATTGG
  • OGK28 GTGGGATCCTGGTTTGTTCTGAG
  • constructs were made in which the pig SERCA2a cDNA was cloned under the regulation of the C. elegans SERCA promoter. Suitable constructs can easily be made by replacing the GFP sequences in pGKlO or pGK13 with the coding region of the pig SERCA2a cDNA.
  • the sequence of the pig SERCA2a cDNA is shown in SEQ ID NO: 7.
  • elegans were transfected with plasmid pGKlOl, harboring the pig SERCA2a cDNA under the control of the worm SERCA promoter derived from pGK 10 by injection of the plasmid at a concentration of 100 ng/ ⁇ l, resulting in the overexpression of the pig SERCA2a in all C. elegans muscles.
  • the overexpression of this vertebrate SERCA protein results in embryonic lethality, LI arrest and growth delay, effects which are quite analogous to the overexpression of C. elegans SERCA.
  • the pig SERCA2a was also expressed in C. elegans under the control of the myo-2 promoter (pGK201), which is specific for induction of expression in the pharyngeal muscles. Overexpression of SERCA2a in the pharyngeal muscles resulted in apparently normal healthy lines, although a slight growth delay was observed. In a pharynx pumping assay, with the fluorescent dye precursor calcein-AM, it was shown that the nematode pumps with a slightly lower efficiency than a wild-type strain.
  • PLB mammalian phospholamban
  • the following strategy may be used to isolate a nematode that is mutated in the SERCA gene, using standard selection procedures well known in the art.
  • a population of nematodes are mutagenized, preferentially using UV-TMP, and grown for two generations.
  • the mutagenized worms are distributed per 500 over approximately 1152 plates and grown for an additional two generations.
  • DNA is isolated from a fraction of the worms from each of these plates and used as a template for PCR selection to select for a SERCA gene that has a deletion. From a plate with worms, of which some have been demonstrated to contain a SERCA deletion, new plates are started with fewer worms. Further rounds of PCR selection finally result in the isolation of a heterozygote C.
  • the expression levels of SERCA in C. elegans can be specifically reduced by using antisense technology or double stranded RNA inhibition.
  • antisense technology to specifically reduce expression of a given protein is well known.
  • the non-coding strand of a fragment of the SERCA gene can be expressed under the control of the SERCA, myo-2 or myo-3 promoter or any other promoter.
  • the expression of the antisense SERCA RNA will result in the inhibition of expression of SERCA.
  • Antisense technology can be used to control gene expression through triple-helix formation of antisense DNA or RNA, both of which methods are based on binding of a polynucleotide to DNA or RNA.
  • the 5' coding portion or the mature protein sequence, which encodes for the SERCA protein is used to design an antisense RNA oligonucleotide of from 10 to 50 base pairs in length.
  • the antisense RNA oligonucleotide hybridises to the mRNA in vivo and blocks translation of an mRNA molecule into the protein (Okano, J.
  • a DNA oligonucleotide is designed to be complementary to a region of the gene involved in transcription (triple-helix - see Lee et al . Nucl. Acids Res., 6:3073 (1979); Cooney et al . , Science, 241:456 (1988); and Dervan et al . , Science, 251: 1360 (1991), thereby preventing transcription and the production of the protein.
  • an EcoRI-Hind III fragment of SERCA exon 5 was cloned antisense under the control of the myo-2 promoter, the myo-3 promoter, the SERCA promoter or the ceh-24 enhancer and injected into C. elegans. These vectors result in the expression of an antisense SERCA RNA, and hence in inhibition of SERCA activity.
  • the expression of a given gene in a cell can also be specifically reduced by introducing into the cell double stranded RNA corresponding to a region of the transcript transcribed from the gene.
  • Double stranded RNA can be prepared by cloning an appropriate fragment into a plasmid vector containing opposable promoters.
  • a suitable example is the pGEM® series of vectors from Promega Corporation, Madison, WI, USA, which contain opposable promoters separated by a multiple cloning site.
  • RNA will be transcribed from each of the promoters.
  • the vector contains two promoters oriented in the opposite sense, complementary sense and antisense transcripts will be transcribed which will combine to form double stranded RNA.
  • the injection of double stranded RNA in C. elegans has previously been described (Fire et al, Potent and Specific Genetic Interference by Double- Stranded RNA in C. elegans 1998, Nature 391, 860-811) .
  • a C. elegans strain mutated in the SERCA gene was kindly provided by R. Barstead (Oklahoma, USA) . Heterozygous animals show no defect, but their homozygous progeny die as LI. The lethal phenotype can be rescued by reintroduction of the C. elegans gene by injection of pGK7.
  • nucleotide sequence of the genomic fragment of C. elegans SERCA bounded by primers SERCA P4 and SERCA P8 is shown in Figure 4 and as SEQ ID NO: 16. Exon IV and exon V are shown in capitals, intron IV in lower case. The fragment deleted in okl90 is underlined.
  • a mutated C. elegans SERCA gene which encodes mutant protein resistant to thapsigargin inhibition has been constructed.
  • the mutation is TTC ⁇ GTC, which results in a Phe258Val substitution. This is analogous to the substitution Phe256Val in hamsters, which was shown to be 40-fold resistant to thapsigargin inhibition (Yu et al., 1999, Arch. Biochem. Biophys. 15:225-232) .
  • the mutation was introduced in the gene with the QuickChange Site-Directed Mutagenesis Kit (Stratagene, CA, USA) .
  • PCR was performed on pGK7, according to the instructions supplied by the manufacturer, with the following primers: OGK33F256V (CAACAGAAGTTGGACGAAGTCGGAGAGCAACTTTC) oGK34F256V (GAAAGTTGCTCTCCGACTTCGTCCAACTTCTGTTG)
  • the resulting mutation was screened by EcoRI digestion, as the mutation resulted in the disruption of the EcoRI restriction site.
  • the new vector was sequenced, and the vector was transfected into C. elegans .
  • the resulting vector was designated pGK28.
  • thapsigargin The effect of thapsigargin on worms carrying a pGK28 transgene was measured in the following way: 10 ⁇ l of thapsigargin dissolved in DMSO (5, 2.5, 1, 0.5, 0.25, 0.1, and 0.05 mM respectively) was added onto a drop of E. coli strain OP50cs2 in 12-well plates. The wells with compounds were placed at 10°C overnight, after which 1 to 10 young adults were added to the wells. The pharynx pumping rate and movement behaviour was scored for the ten worms after 10 minutes and after one hour (short term effect) . Furthermore the wells were scored for protruding vulva and rectum, production of progeny (few eggs in body) after one day (mid-term-effects) , and for progeny after four days (long term effect)
  • Cold-sensitive E. coli strain OP50cs2 was deposited on 25th March 1999 in accordance with the provisions of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms in the Belgian Coordinated Collections of Microorganisms (BCCM) /Laboratorium voor Microbiologie- Bacterienverzameling (LMG) bacteria collection, Universiteit Gent, K. L. Ledeganckstraat 35, B-9000, Gent, Belgium under accession number LMG P-18934.
  • BCCM Belgian Coordinated Collections of Microorganisms
  • LMG Microbiologie- Bacterienverzameling
  • nematodes harboring the Phe259Val SERCA mutant had slightly more progeny than wild-type and that the protruding vulva and rectum-phenotype was very often observed in the wild-type nematodes treated with thapsigargin, whereas these phenotypes were not or were only occasionally observed in strain UG530 (strain harboring plasmid pGK28), treated with thapsigargin.
  • Phospholamban is known to interact with the KDDKPV site in mammalian SERCAl and SERCA2 (Toyofuku et al., J. Biol Chem. 1994, 269:22929-22932).
  • SERCA3 does not contain this sequence and does not bind phospholamban.
  • SERCA3 does bind phospholamban when the KDDKPV sequence is introduced, while SERCA2 can no longer bind phospholamban when this sequence is mutated (Toyofuku et al., J. Biol Chem. 1994, 269:22929-22932).
  • Phospholamban also interacts with transmembrane helix TM6, which is identical in all three mammalian SERCA genes (Asahi et al., J. Biol. Chem. 1999, 274:32855-32862).
  • the C. elegans SERCA gene does not contain the KDDKPV sequence, but the TM6 domain is identical to mammalian SERCA.
  • a variant of C. elegans SERCA containing the KDDKPV recognition site was constructed using standard site directed mutagenesis technology (QuikChange Site-Directed Mutagenesis Kit of Stratagene) .
  • the primers oGKll ⁇ and OGK119 and plasmid pGK28 were used to obtain a plasmid designated pGK115 containing thapsigargin-resistant C. elegans SERCA with the KDDKPV site.
  • OGK118 GCCAGTCGGAAAGGTTTCCAAGGACGACAAGCCAGTTAACCCAGCTG CTGGAGAATT oGKl19 :AATTCTCCAGCAGCTGGGTTAACTGGCTTGTCGTCCTTGGAAACCTT TCCGACTGGC
  • Plasmid pGK115 was introduced into C. elegans using standard techniques. Introduction of this mutant SERCA into C. elegans results in a more efficient interaction between the C. elegans SERCA (here the mutant) and vertebrate PLB. Introduction of a KDDKPV mutant into a C. elegans strain which is mutant for SERCA, such as the okl 90 strain, results in a strain which is directly useful for performing screens to select for compounds that alter the interaction of SERCA with PLB and hence that alter the activity of SERCA. Since pGK115 also contains the thapsigargin resistance mutation, it can also be expressed in a wild-type C.
  • elegans for use in screens to select for compounds that alter the interaction of SERCA with PLB and hence that alter the activity of SERCA.
  • thapsigargin should be added to differentiate between activity of the endogeneous SERCA and the introduced double mutant SERCA.
  • C. elegans the latter being a SERCA mutant such as okl 90 or a wild-type strain where the endogenous SERCA is inhibited for example by RNAi technology
  • RNAi RNAi
  • a fusion protein may be constructed that has sufficient properties of the C. elegans SERCA for rescue of the mutant phenotype, and has those vertebrate SERCA properties sufficient in a screen to select for compounds that alter the vertebrate SERCA activity.
  • a fusion protein harboring the N- terminal end of the C. elegans and the C-terminal part of a vertebrate SERCA 2) A fusion protein harboring the N-terminal part of a vertebrate SERCA and the C-terminal part of the C. elegans SERCA
  • Such fusion proteins can easily be constructed using standard molecular techniques .
  • a SERCA fusion protein of type 1 has been made in the following way:
  • 0GKIO8 GACCGTACGAAATTTTCAGGAAAGGAATGCAGAAAATGCC OGK109: CCCCGGCCGGCCTTACTCCAGTATTGCAGGTTCCAGG
  • the resulting 2701 bp PCR fragment was digested with Bsi I and EagI and cloned in the 10131 bp fragment of pGK8 (containing genomic C. elegans SERCA) cut at the same sites.
  • the resulting vector was designated pGK114.
  • elegans can improve the basic screen to select for compounds that alter the interaction of PLB and SERCA in such a way that the parameters of the screen can be fine-tuned exactly as is most useful, allowing screening for more specific compounds directed to the PLB SERCA interaction.
  • PLB mutations can easily be made using standard site directed mutagenesis techniques as described above, and as known in the art. •
  • One phospholamban mutant of particular interest is Serl6Ala. In intact beating hearts or isolated cardiac myocytes, serinel6 becomes phosphorylated by cAMP-dependent protein kinase upon stimulation with isoproterenol. This leads to increased cardiac relaxation due to decreased inhibition.
  • a phospholamban mutant for this phosphorylation site thus lacks cAMP-dependent protein kinase-mediated regulation (Simmerman et al., J. Biol. Chem. 1986, 261:13333-13341; egener et al . , J. Biol. Chem. 1989, 264:11468-11474; Kuschel et al . , Am. J. Physiol. 1999, 276:H1625-H1633) .
  • Pig PLB cDNA was cloned from pGEM7PigPLB
  • PCR amplification was performed using standard procedures (PCR, A practical approach, ed. by M. J. McPherson, P. Quirke and G. R. Taylor, 1993, Oxford University Press.
  • oGK51 and oGK52 contain an Xbal site for cloning oGK55 and OGK56 contain an Asp718 site for cloning oGK52 contains T-to-G point mutation compared to pig PLB cDNA so as to introduce a D-to-E amino acid substitution at position 2 of PLB. Since this is the only difference between the human and pg PLB proteins, the resultant polypeptide is the same as the human PLB sequence (NB the point mutated cDNA does not have the same sequence as the human PLB cDNA but encodes a protein having identical amino acid sequence to human PLB, hence it is referred to as a humanized pig PLB cDNA) .
  • pGK202 was constructed by cloning the oGK51-oGK55 PCR fragment digested with Xbal and Asp718 into pPd96.48 digested with the same enzymes.
  • the vector expresses pig PLB under the control of the myo-2 promoter.
  • pGK204 was constructed by cloning the oGK51-oGK56 PCR fragment digested with Xbal and Asp718 into pGK203 digested with the same enzymes.
  • the vector expresses the pig PLB fused to GFP under the control of the myo- 2 promoter.
  • pGK205 was constructed by cloning the oGK52-oGK55 PCR fragment digested with Xbal and Asp718 into pPD96.48 digested with the same enzymes.
  • the vector expresses the humanized pig PLB under the control of the myo-2 promoter.
  • pGK206 was constructed by cloning the oGK52-oGK56 PCR fragment digested with Xbal and Asp718 into pGK203 digested with the same enzymes.
  • the vector expresses the humanized pig PLB fused to GFP under the control of the myo-2 promoter.
  • pGK302 was constructed by cloning the oGK51-oGK55 PCR fragment digested with Xbal and Asp718 into pPD96.52 digested with the same enzymes.
  • the vector expresses the pig PLB under the control of the myo-3 promoter.
  • pGK304 was constructed by cloning the oGK51-oGK56 PCR fragment digested with Xbal and Asp718 into pGK303 digested with Nhel-Asp718.
  • the vector expresses the pig PLB fused to GFP under the control of the myo-3 promoter.
  • pGK305 was constructed by cloning the oGK52-oGK55 PCR fragment digested with Xbal and Asp718 intointo pPD96.52 digested with Nhel-Asp718.
  • the vector expresses the humanized pig PLB under the control of the myo-3 promoter.
  • pGK306 was constructed by cloning the oGK52-oGK56 PCR fragment digested with Xbal and Asp718 into pGK303 digested with Nhel-Asp718.
  • the resulting vector expresses the humanized pig PLB fused to GFP under the regulation of the myo-3 promoter.
  • the optimal concentration of compounds that inhibit the activity SERCA has been determined.
  • the first assay is designated the drop or plate assay in which the nematodes are fed E. coli strains pre-loaded with the compound.
  • the compound is administrated to the worm in liquid culture.
  • a standard plate drop assay is performed according to the following protocol. 4ml NGM agar (see "The nematode C. elegans” Ed. by William B. Wood and the Community of C. elegans researchers, CSHL Press, 1988, pg589) is into 3cm plates and seeded with approximately 5 ⁇ l of an E. coli overnight culture and grown preferably for one week at room temperature. Approximately lO ⁇ l of test compound dissolved in DMSO or other suitable solvent is pipetted onto the bacterial lawn so that the lawn is covered completely. After overnight soaking in or compound, one C. elegans (L4 stage) per plate is put onto the bacterial lawn. Plates are incubated at 21°C and checked after some hours. Plates are checked again after 4 days for phenotypes of the FI progeny (control shows all stages up to gravid hermaphrodites) .
  • Thapsigargin at various concentrations causes the nematode to stop pharynx pumping within 10 min.
  • the worms restart pumping, although at a low level.
  • the worms are pale and thin and have a slow and irregular movement, with an increased amplitude. No plate drop response is observed, and the worms show poor backing, reduced pumping and strong constipation.
  • the worms have a defective gonad with only very few eggs, and a protruding vulva. Some worms also have a protruding rectum. Progeny reaches L2 stage only after four days, and the brood size is very small. Lower concentrations of thapsigargin (0.5 ⁇ M, 0.25 ⁇ M, 0.125 ⁇ M) still cause reduced brood size.
  • 2,5-di-tert butylhydroquinone at a concentration of 500 ⁇ M resulted in pale, starved, thin worms with slow movement, defective gonad, constipated and reduced brood size.
  • Cyclopiazonic acid at a concentration of 500 ⁇ M resulted in nematodes that lay still or move slowly after one hour.
  • the worms showed strong avoidance and after 24 hours they look starved, pale and thin, with only a few eggs in the body, a defective gonad, and reduced brood size. A delayed growth of the FI generation was observed.
  • Thapsigargin-epoxide did not result in a clear observable effect, even at the highest concentration tested (1 mM drop, 5 ⁇ M end concentration) .
  • Thapsigargin at 100, 50 and 20 ⁇ M resulted in small worms which show slow and loopy movement. They had a protruding vulva, and no progeny (or no progeny that grows up) were observed. At lower concentrations of 10 ⁇ M and 5 ⁇ M a reduced number of progeny and delayed growth could be observed.
  • 2,5-di-tert butylhydroquinone at a concentration of lmM resulted in progeny exhibiting delayed growth and the worms be observed to be thinner than ⁇ normal' worms .
  • Cyclopiazonic acid at a concentration of lmM resulted in pale, thin worms with a slow movement and a very strongly reduced brood size. At lower concentrations of 0.5mM, growth delay was observed.
  • the compound thapsigargin is known to inhibit the activity of SERCA.
  • the SERCA protein pumps calcium into the sarco/endoplasmic reticulum and provides the cell with an internal storage of calcium.
  • the internal storage of calcium is important for muscle activity.
  • inhibiting SERCA activity by applying thapsigargin to the worm results in a decrease in the pharynx pumping rate.
  • Another feature observed by the action of thapsigargin on the nematode worm C. elegans is decreased movement, which is a result of the inhibition of SERCA activity of the body wall muscles.
  • a pharynx pumping screen has been developed to screen for chemical substances that suppress the activity of thapsigargin on SERCA.
  • the pumping rate of the pharynx is measured indirectly by adding a marker molecule precursor such as calcein-AM to the medium and measuring the formation of marker dye in the C. elegans gut.
  • Calcein-AM is cleaved by esterases present in the C. elegans gut to release calcein, which is a fluorescent molecule.
  • the pumping rate of the pharynx will determine how much medium will enter the gut of the worm, and hence how much calcein-AM will enter the gut of the worm. Therefore by measuring the accumulation of calcein in the nematode gut, detectable by fluorescence, it is possible to determine the pumping rate of the pharynx.
  • a standard pharynx pumping screen may be carried out as follows :-
  • a 'worm dispenser' apparatus e.g. the device commercially available from Union Biometrica, Inc, Somerville, MA, USA which has properties analogous to flow cytometers, such as fluorescence activated cell scanning and sorting devices (FACS) , may be used for this purpose.
  • FACS fluorescence activated cell scanning and sorting devices
  • 40 +/- 5 worms are added to each well of the microtiter plate.
  • Thapsigargin is added to the worms at an inhibitory concentration and calcein-AM is added at a concentration of 5-10 ⁇ M.
  • the chemical substances to be selected are added. Control wells are also set up containing thapsigargin alone with no second chemical substance.
  • the chemical substances are typically made up in DMSO. Any other solvent can be used for this purpose, but most selected chemical substances appear to be soluble in DMSO.
  • the chemical substance is added in the wells at various concentrations, but preferentially a concentration between 3 to 30 ⁇ M is chosen as this gives the clearest results. It possible to screen for dosage effects by varying the concentration of the chemical substance from less than 1 ⁇ M up to lOO ⁇ M.
  • the concentration of the DMSO should not be too high and preferentially should not exceed 1%, more preferentially the concentration of the DMSO should not exceed 0.5% and even more preferentially, the concentration of the DMSO is lower than 0.3%.
  • Wells harboring a chemical substance where the measured fluorescence is higher than in the control wells containing no chemical substance are scored. These wells harbor a chemical substance that is an antagonist of the thapsigargin activity, as the inhibitory activity of tbapsigargin is suppressed. Chemical substances thus identified may inhibit directly the activity of thapsigargin, or stimulate the activity of SERCA, or have an enhancer activity on the SERCA pathway, and hence on the calcium biology of the organism. Chemical substances selected in this screen as antagonists of thapsigargin are considered as potential therapeutics, or as hits for the further development of therapeutics in the disease areas which are the cause of a malfunction of the calcium biology of the organism. Examples of disease areas for which these therapeutics are useful are cardiac hypertrophy, cardiac failure, arterial hypertension, Type 2 diabetes and Brody disease.
  • thapsigargin is used as an example of a compound having a defined phenotypic effect on C. elegans as a result of inhibition of SERCA activity. It will be appreciated that other SERCA inhibitors which have an inhibitory activity on the pharynx pumping rate may be used in analogous screens with equivalent effect.
  • An increase of the internal storage of calcium is general considered to be important for the strength of muscle contraction, and consequently an improvement or increase of this muscle contraction can be realized by enhancing SERCA activity.
  • Chemical substances that enhance SERCA activity or inhibit the SERCA-PLB interaction are considered as potential therapeutics, or as hits for the further development of therapeutics in the disease areas which are the cause of a malfunction of the calcium biology of the cell or organism. Examples of disease areas where an increase of SERCA activity may be beneficial are cardiac hypertrophy, cardiac failure, arterial hypertension, Type 2 diabetes and Brody disease.
  • SERCA2 and PLB are associated with cardio-vascular diseases
  • SERCAl and sarcolipin are associated with skeletal- muscle diseases
  • three SERCA genes have been associated with non-insulin-dependent diabetes mellitus .
  • SERCA genes and PLB have been expressed in C. elegans .
  • the expression of these genes can be regulated under the control of several specific promoters with the following activities:
  • the C. elegans myo-2 promoter which promotes expression in the pharynx
  • the C. elegans SERCA promoter which promotes expression in the C. elegans muscles, including the pharynx, the vulva muscles and the body wall muscles.
  • SERCA and/or the myo-2 promoter SERCA and/or the myo-2 promoter.
  • pig and/or human SERCA under the SERCA promoter and pig and/or human PLB-GFP under the myo-2 promoter.
  • pig and/or human SERCA under the SERCA promoter and pig and/or human PLB-GFP under the myo-2 promoter in a C. elegans mutated for the C. elegans SERCA (Knock-out and selected mutants) .
  • transgenic and mutant worms show a clear change in pharynx pumping rate as can be measured by the fluorescence of calcein in the gut using the calcein-AM pharynx pumping assay. Some of these strains were considered to be useful for further screen development.
  • the transgenic and mutant animals were placed in the wells of multi-well plates. Calcein-AM and chemical substances under test were then added.
  • the fluorescence of the calcein formed in the gut was measured in a multi-well plate reader set to measure fluorescence.
  • Chemical substances that altered the properties of the pharynx pumping rate, and hence altered the function and activity of the SERCA pathway were selected for further analysis, and can be considered as potential compounds for therapeutic use, or as hits for the further development of therapeutics.
  • a analogous experiment can be performed with the SERCAl gene and its regulator Sarcolipin (SLN) , to detect chemical substances that alter their activity and/or regulation.
  • SSN regulator Sarcolipin
  • the pPD' series of vectors were all obtained from the laboratory of Andrew Fire, see Fire A, Harrison S. ., and Dixon D.
  • pGK301 was constructed by cloning a 3181bp fragment of pERIIIA (F. uytack, personal communication) into pPD96.52 digested with the same restriction enzymes.
  • pGK301 expresses the SERCA2a cDNA under the regulation of the myo-3 promoter.
  • pGK201 was constructed by cloning a 480009bp Nhel/Spel fragment of pGK301 in pPD96.48 digested with the same enzymes.
  • the vector expresses pig SERCA2a under the regulation of the m.oy-2 promoter.
  • pGKlOl was constructed by cloning a 4828bp Nhel/Apal fragment of pGK201 into plasmid pDW2600 digested with the same enzymes.
  • the vector expresses the pig SERCA2a cDNA under the regulation of the worm SERCA promoter.
  • pD 2600 was constructed by cloning a 5046bp Sphl- Smal fragment of pGKlO in pPD49.26.
  • pGK203 was constructed by cloning the Accl/Spel fragment of pPD95.79 into pPD96.48 digested with the same enzymes .
  • This vector contains the myo-2 promoter, GFP and unc-54 3' UTR.
  • pGK303 was constructed by cloning the Asp718-Apal fragment of pPD95.79 into pPD96.52 digested with the same enzymes.
  • This vector contains the myo-2 promoter, GFP and unc-54 3' UTR.
  • SEQ ID NO:l is the nucleic acid sequence of a 732bp EcoRI-Hindll fragment of C. elegans SERCA exon 5. This fragment was cloned into pGEM3 for use in RNA inhibition experiments.
  • SEQ ID NO: 2 Is the nucleic acid sequence of a
  • SEQ ID NO: 3 is the nucleic acid sequence of a 5026 bp fragment of the upstream region of C. elegans SERCA, up to and including A of the initiating ATG. This fragment was cloned into pPD95.79, in fusion with
  • SEQ ID NO: is the nucleic acid sequence of a 2915bp fragment of the upstream region of C. elegans SERCA, as found in plasmid pGK13.
  • SEQ ID NO: 5 is the nucleic acid sequence of a 6612bp fragment of the C. elegans SERCA gene containing 5637bp of upstream sequence and ending in exon 4, as cloned in pPD95.75, resulting in pGK12.
  • SEQ ID NO: 6 is the nucleic acid sequence of the long isoform of the C. elegans SERCA cDNA.
  • SEQ ID NO: 7 is the nucleic acid sequence of the pig SERCA2a cDNA.
  • SEQ ID NO: 8 is the nucleic acid sequence of the human SERCA2a cDNA.
  • SEQ ID NO: 9 is the nucleic acid sequence of the pig phospholamban cDNA.
  • SEQ ID NO: 10 is the nucleic acid sequence of the C. elegans myo-2 promoter.
  • SEQ ID NO: 11 is the nucleic acid sequence of the C. elegans myo-3 promoter.
  • SEQ ID NO: 12 is the nucleic acid sequence of the C. elegans vulval muscle enhancer. This is an enhancer element from ceh-24 that directs gene expression in the vulval muscles (Harfe and Fire, 1998,
  • SEQ ID NO: 13 is the nucleic acid sequence of humanized pig PLB cDNA.
  • SEQ ID NO: 14 is the amino acid sequence of pig PLB.
  • SEQ ID NO: 15 is the amino acid sequence of human PLB and humanized pig PLB.
  • SEQ ID NO: 16 is the nucleotide se ⁇ uence of a genomic fragment of C. elegans SERCA covered by primers SERCA P4 and SERCA P8.
  • SEQ ID Nos: 17-38 are primers used in the accompanying Examples.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Immunology (AREA)
  • Organic Chemistry (AREA)
  • Biomedical Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Biochemistry (AREA)
  • Urology & Nephrology (AREA)
  • Biotechnology (AREA)
  • Hematology (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Microbiology (AREA)
  • Wood Science & Technology (AREA)
  • Cell Biology (AREA)
  • Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Food Science & Technology (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Biophysics (AREA)
  • Toxicology (AREA)
  • General Engineering & Computer Science (AREA)
  • Environmental Sciences (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Animal Husbandry (AREA)
  • Biodiversity & Conservation Biology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
EP00919102A 1999-04-15 2000-04-14 Verfahren zum screening von verbindungen Withdrawn EP1171628A2 (de)

Applications Claiming Priority (7)

Application Number Priority Date Filing Date Title
US12959699P 1999-04-15 1999-04-15
GBGB9908670.4A GB9908670D0 (en) 1999-04-15 1999-04-15 Compound screening method
GB9908670 1999-04-15
US129596P 1999-04-15
GBGB9912736.7A GB9912736D0 (en) 1999-06-01 1999-06-01 Compound screening methods
GB9912736 1999-06-01
PCT/IB2000/000558 WO2000063426A2 (en) 1999-04-15 2000-04-14 Compound screening methods

Publications (1)

Publication Number Publication Date
EP1171628A2 true EP1171628A2 (de) 2002-01-16

Family

ID=27269699

Family Applications (1)

Application Number Title Priority Date Filing Date
EP00919102A Withdrawn EP1171628A2 (de) 1999-04-15 2000-04-14 Verfahren zum screening von verbindungen

Country Status (7)

Country Link
EP (1) EP1171628A2 (de)
JP (1) JP2002541859A (de)
AU (1) AU3984700A (de)
CA (1) CA2369478A1 (de)
GB (1) GB2349217B (de)
HK (1) HK1029376A1 (de)
WO (1) WO2000063426A2 (de)

Families Citing this family (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB2359359B (en) * 1999-04-15 2002-01-23 Devgen Nv Compound screening method
AU2002218457A1 (en) * 2000-10-18 2002-04-29 Devgen N.V. Methods for identifying pesticidal compounds
JP2006265102A (ja) * 2003-05-08 2006-10-05 Taisho Pharmaceut Co Ltd ＴＧＦβ由来アポトーシス調節方法
DE602007010321D1 (de) * 2006-09-18 2010-12-16 Univ North Texas Multinetzwerk-nervenzellenassay-plattform mit parallelaufzeichnungsmöglichkeit
WO2012168474A1 (en) * 2011-06-10 2012-12-13 Monell Chemical Senses Center Novel methods
EP2775302A1 (de) * 2013-03-08 2014-09-10 Assistance Publique - Hôpitaux de Paris Verbindungsträgersysteme für Tests in Nematoden
CN114794029B (zh) * 2022-06-09 2023-02-28 上海大学 一种计数秀丽隐杆线虫子宫内发育胚胎数目的方法

Family Cites Families (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JPH09502163A (ja) * 1993-06-03 1997-03-04 ザ ユニバーシテイ オブ シドニイ 天然産物および類縁合成化合物の心臓血管系疾患を治療する用途
FR2753722A1 (fr) * 1996-09-26 1998-03-27 Smithkline Beecham Lab Procede de detection de modulateurs de relaxation cardiaque et modulateurs ainsi obtenus
WO1998051351A1 (en) * 1997-05-15 1998-11-19 The General Hospital Corporation Therapeutic and diagnostic tools for impaired glucose tolerance conditions
US6329566B1 (en) * 1997-05-29 2001-12-11 The General Hospital Corporation Methods for the detection, treatment, and prevention of neurodegeneration
EP1009236A4 (de) * 1997-07-22 2000-10-25 Gen Hospital Corp Evaluierung, verabreichung und verwendung von mitteln zur behandlung vonherzerkrankungen

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO0063426A3 *

Also Published As

Publication number Publication date
CA2369478A1 (en) 2000-10-26
GB2349217A (en) 2000-10-25
AU3984700A (en) 2000-11-02
GB2349217B (en) 2001-04-04
HK1029376A1 (en) 2001-03-30
JP2002541859A (ja) 2002-12-10
WO2000063426A2 (en) 2000-10-26
WO2000063426A3 (en) 2001-02-08
GB0009363D0 (en) 2000-05-31

Similar Documents

Publication Publication Date Title
Chen et al. Two insulin-like peptides antagonistically regulate aversive olfactory learning in C. elegans
Tonkin et al. RNA editing by ADARs is important for normal behavior in Caenorhabditis elegans
Vassalli et al. Minigenes impart odorant receptor-specific axon guidance in the olfactory bulb
Chen et al. G protein-coupled receptor kinase 2 promotes high-level Hedgehog signaling by regulating the active state of Smo through kinase-dependent and kinase-independent mechanisms in Drosophila
US6540996B1 (en) Compound screening methods
Bastiani et al. Caenorhabditis elegans Gαq regulates egg-laying behavior via a PLCβ-independent and serotonin-dependent signaling pathway and likely functions both in the nervous system and in muscle
Lesch et al. The homeodomain protein hmbx-1 maintains asymmetric gene expression in adult C. elegans olfactory neurons
EP2622351B1 (de) Neuropeptid q als gpcr-galr2-modulator und seine verwendung
US20060286584A1 (en) Compositions and methods for the regulation of cell proliferation and apoptosis
Guillermo et al. H3K27 modifiers regulate lifespan in C. elegans in a context-dependent manner
AU780574B2 (en) Compound screening method
US5919997A (en) Transgenic mice having modified cell-cycle regulation
Neal et al. A forward genetic screen for molecules involved in pheromone-induced dauer formation in Caenorhabditis elegans
Davies Signalling via cGMP: lessons from Drosophila
WO2000063426A2 (en) Compound screening methods
US7125687B1 (en) Presenilin enhancers assays
Hsu et al. C. elegans orthologs MUT-7/CeWRN-1 of Werner syndrome protein regulate neuronal plasticity
González et al. PFTK1 kinase regulates axogenesis during development via RhoA activation
WO2006012304A2 (en) Increasing life span by modulation of smek
GB2359361A (en) Compound screening method
Lees et al. Molecular mechanisms of premature ageing in a worm model of human Werner syndrome
Kuang Enhancer Binding Site Architecture Regulates Cell-specific Notch Signal Strength and Transcription
Chien et al. A Canal-Associated Neuron cAMP signalling pathway that regulates C. elegans larval development
Di Monaco Molecular mechanisms and transcriptional regulation of starvation induced autophagy in drosophila
US20060008800A1 (en) Unc-13 in the modulation of neurotransmission and secretion events

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20011112

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE

AX Request for extension of the european patent

Free format text: AL;LT;LV;MK;RO;SI

17Q First examination report despatched

Effective date: 20040123

RAP1 Party data changed (applicant data changed or rights of an application transferred)

Owner name: DEVGEN NV

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20060607