EP1158849A2 - Plant ligand-gated ion channels - Google Patents

Plant ligand-gated ion channels

Info

Publication number
EP1158849A2
EP1158849A2 EP00917697A EP00917697A EP1158849A2 EP 1158849 A2 EP1158849 A2 EP 1158849A2 EP 00917697 A EP00917697 A EP 00917697A EP 00917697 A EP00917697 A EP 00917697A EP 1158849 A2 EP1158849 A2 EP 1158849A2
Authority
EP
European Patent Office
Prior art keywords
seq
nucleotide sequence
plant
amino acid
protein
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP00917697A
Other languages
German (de)
French (fr)
Other versions
EP1158849A4 (en
Inventor
Alan M. Kinnersley
Frank J. Turano
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Emerald Bioagriculture Corp
US Department of Agriculture USDA
Original Assignee
Emerald Bioagriculture Corp
US Department of Agriculture USDA
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Emerald Bioagriculture Corp, US Department of Agriculture USDA filed Critical Emerald Bioagriculture Corp
Publication of EP1158849A2 publication Critical patent/EP1158849A2/en
Publication of EP1158849A4 publication Critical patent/EP1158849A4/en
Withdrawn legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/415Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241Phenotypically and genetically modified plants via recombinant DNA technology
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • YGENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02ATECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A40/00Adaptation technologies in agriculture, forestry, livestock or agroalimentary production
    • Y02A40/10Adaptation technologies in agriculture, forestry, livestock or agroalimentary production in agriculture
    • Y02A40/146Genetically Modified [GMO] plants, e.g. transgenic plants

Definitions

  • GABA amino acid ⁇ -aminobutyric acid
  • GABA is the major neurotransmitter in the mammalian central nervous system. Such neurotransmitters generally function in regulating the conductance of ions across neuronal membranes, typically in regulating influx of ions into a cell.
  • GABA is considered an inhibitory neurotransmitter which acts to inhibit synaptic transmission in both vertebrate and invertebrate nervous systems.
  • glutamate is an excitatory neurotransmitter that depolarizes the postsynaptic membrane and acts to promote synaptic transmission. Both GABA and glutamate affect synaptic transmission by binding to their respective receptors, also known as ligand-gated ion channels.
  • GABA receptors have been implicated in mediating anxiety, seizures, cognitive function, addictive disorders, sleep disorders and other disorders of the central nen/ous system. GABA receptors are the target of many pharmaceutical preparations which act on the central nervous system, including barbiturates and benzodiazepenes, and thus have therapeutic value. Furthermore, compounds which affect the function of insect GABA receptors are commercially useful as insecticides. Although GABA receptors have been found in insects and in the animal kingdom, they have yet to be discovered in the plant kingdom. However, GABA has been shown to exert certain beneficial effects on plants. For example, GABA has been shown to increase plant growth and productivity as shown in U.S. Patent No. 5,439,873 to Kinnersley.
  • GABA has been found to increase fertilizer efficiency when administered with glutamic acid as described in U.S. Patent No. 5,840,656 to Kinnersley et al.
  • Nucleotide sequences expected to encode ligand-gated ion channel proteins such as glutamate and/or GABA receptor proteins, have been discovered in plants. Accordingly, the present invention provides these purified plant proteins, including recombinant proteins, nucleotide sequences encoding the proteins and methods of using the nucleotide sequences and proteins.
  • a method includes introducing into a plant cell a nucleic acid molecule encoding a plant protein described herein.
  • methods of treating a plant include providing a plant having an introduced nucleotide sequence encoding a plant protein described herein and treating the plant with an effective amount of GABA.
  • the plant may further be treated with a composition including GABA and a GABA agonist or may be treated only with a GABA antagonist or GABA agonist.
  • methods of regulating plant metabolism include utilizing antisense DNA or RNA to reduce formation of a plant protein or RNA transcript, such as a mRNA transcript.
  • the method includes introducing into a plant cell an antisense nucleic acid molecule having a nucleotide sequence that is complementary to the nucleotide sequences described herein, or portions thereof, that is expected to encode a plant GABA receptor.
  • the antisense nucleic acid molecule includes a nucleotide sequence complementary to an RNA sequence, preferably a mRNA sequence, transcribed from the sequences described herein.
  • the antisense nucleotide sequence hybridizes to nucleic acid, including either the template strand or the RNA transcript, of the plant to reduce formation of a plant protein described herein.
  • methods of identifying potential plant receptors include hybridizing to plant nucleic acid a probe having a nucleotide sequence encoding the proteins described herein.
  • methods of expressing plant proteins described herein are provided.
  • a method includes introducing into a host cell a nucleotide sequence expected to encode a plant GABA receptor described herein and culturing under conditions to achieve expression of the protein receptor.
  • isolated nucleic acid molecules including recombinant nucleic acid molecules, are provided that include nucleotide sequences encoding plant proteins as described herein.
  • Plant host cells and transgenic plants are also provided that include nucleotide sequences encoding the plant proteins described herein.
  • the molecules, plant cells and transgenic plants further may include a foreign promoter sequence operably linked to a terminal 5' end of the plant nucleotide sequences described herein.
  • FIG. 1 depicts a graph showing the effect of baclofen, a GABA agonist, on duckweed growth as more fully described in example 1.
  • FIG. 2 depicts a graph showing the effect of GABA antagonists picrotoxin and bicuculline on duckweed growth as more fully described in example 1.
  • FIG. 3 depicts a graph showing the effect of GABA agonists and antagonists on GABA-mediated growth promotion in Duckweed as more fully described in example 1.
  • BFN baclofen
  • PIC picrotoxin
  • 4-AB ⁇ - aminobutyric acid.
  • FIG. 4 depicts the phylogeny of bacterial periplasmic binding proteins and eukaryotic receptors based on parsimony analysis of the N- terminal (approximately one-third) amino acid sequences. Sequences included in the phylogentic reconstruction were a bacterial periplasmic binding protein, the animal ionotropic glutamate (iGLR), metabotropic glutamate (mGLR), and ⁇ -aminobutyric acids (GABA-BR) receptors, and putative plant glutamate receptors (GLR). Lower case n designates N- terminal sequences from amino acid residues 80 to 320.
  • iGLR animal ionotropic glutamate
  • mGLR metabotropic glutamate
  • GABA-BR ⁇ -aminobutyric acids
  • GABA-BR putative plant glutamate receptors
  • human metabotropic glutamate receptor 1 alpha (hummglurlalpn, ACC# U31215)
  • human metabotropic glutamate receptor 1 beta (hummglurl betn, ACC# U31216)
  • human glutamate receptor, metabotropic 5 (hummglur ⁇ n, ACC# NM000842)
  • rat metabotropic glutamate receptor mGluR5 (ratmglur ⁇ n, ACC# D10891)
  • human glutamate receptor, metabotropic 2 (hummglur2n, ACC# NM000839)
  • human glutamate receptor, metabotropic 3 (hummglur3n, ACC# NM000840)
  • human glutamate receptor, metabotropic 8 (hummglur ⁇ n, ACC# U92459)
  • mouse metabotropic glutamate receptor 8 mouse metabotropic glutamate receptor 8 (mousemglur ⁇ n, ACC# U17252)
  • human metabotropic glutamate receptor 1 alpha (hummglur
  • FIG. 5 shows a proposed evolutionary history of the bacterial periplasmic binding proteins (BPBP), plant glutamate receptor (GLRs), animal ionotropic glutamate (iGLR), metabotropic glutamate (mGLR), and gamma-aminobutyric acid B (GABA-BR) receptor genes as discussed in example 4.
  • BPBP bacterial periplasmic binding proteins
  • GLRs plant glutamate receptor
  • iGLR animal ionotropic glutamate
  • mGLR metabotropic glutamate
  • GABA-BR gamma-aminobutyric acid B
  • a nucleotide sequence has been found in Arabidopsis thaliana that is expected to encode a plant GABA receptor protein. Accordingly, the present invention provides purified GABA receptor proteins. The invention further provides isolated nucleic acid molecules that include nucleotide sequences encoding plant GABA receptor proteins. Recombinant nucleic acid molecules, plant host cells and transgenic plants are also provided that include the nucleotide sequences encoding the plant GABA receptor proteins. In other aspects of the invention, methods of expressing a protein, such as a GABA receptor protein, and methods of using the nucleotide and amino acid sequences described herein are also provided.
  • purified plant proteins expected to function as ligand-gated ion channel proteins in plants such as GABA receptor proteins, and therefore having the ability to regulate cellular ion influx.
  • the polypeptide receptors are substantially pure (i.e., the protein receptors are essentially free, e.g., at least about 95% free, from other proteins with which they naturally occur).
  • the amino acid sequence of a protein expected to function as a ligand-gated ion channel protein in a plant, originally found in Arabidopsis thaliana is set forth in SEQ ID NO:1 or SEQ ID NO:2.
  • GABA receptor protein is used herein to refer generally to a protein having the features described herein and preferred examples include polypeptides having the amino acid sequences set forth in SEQ ID NO:1 or SEQ ID NO:2. Further included within this definition, and in the scope of the invention, are variants of the polypeptide which function in regulating ion movement into a cell, as described herein. Preferred proteins are recombinant proteins. It is well known that plants of a wide variety of species commonly express and utilize homologous proteins, which include the insertions, substitutions and/or deletions discussed above, and yet which effectively provide similar function.
  • an amino acid sequence isolated from another species may differ to a certain degree from the sequences set forth in SEQ ID NOS:1 and 2, and yet have similar functionality with respect to catalytic and regulatory function.
  • Amino acid sequences comprising such variations are included within the scope of the present invention and are considered substantially or sufficiently similar to a reference amino acid sequence.
  • identity between amino acid sequences that is necessary to maintain proper functionality is related to maintenance of the tertiary structure of the polypeptide such that specific interactive sequences will be properly located and will have the desired activity.
  • the present invention be limited by any theory by which it achieves its advantageous result, it is contemplated that a polypeptide including these interactive sequences in proper spatial context will have good activity, even where alterations exist in other portions thereof.
  • a variant of the proteins described herein is expected to be functionally similar to that set forth in SEQ ID NO:1 or SEQ ID NO:2, for example, if it includes amino acids which are conserved among a variety of plant species or if it includes non-conserved amino acids which exist at a given location in another plant species that expresses the proteins described herein.
  • Another manner in which similarity may exist between two amino acid sequences is where a given amino acid of one group (such as a non- polar amino acid, an uncharged polar amino acid, a charged polar acidic amino acid or a charged polar basic amino acid) is substituted with another amino acid from the same amino acid group.
  • a given amino acid of one group such as a non- polar amino acid, an uncharged polar amino acid, a charged polar acidic amino acid or a charged polar basic amino acid
  • the uncharged polar amino acid serine may commonly be substituted with the uncharged polar amino acid threonine in a polypeptide without substantially altering the functionality of the polypeptide.
  • Whether a given substitution will affect the functionality of the enzyme may be determined without undue experimentation using synthetic techniques and screening assays known in the art.
  • inventive amino acid sequences similar to the amino acid sequences set forth herein that have at least about 60% identity thereto that preferably function in regulating cellular ion influx.
  • inventive amino acid sequences have at least about 70% identity, further preferably at least about 80% identity, and most preferably at least about 90% identity to these sequences.
  • Percent identity may be determined, for example, by comparing sequence information using the MacVector computer program, version 6.0.1 , available from Oxford Molecular Group, Inc. (Beaverton, OR). Briefly, the MacVector program defines identity as the number of identical aligned symbols (i.e., nucleotides or amino acids), divided by the total number of symbols in the shorter of the two sequences. The program may be used to determine percent identity over the entire length of the proteins being compared.
  • nucleic acid molecules originally isolated from Arabidopsis thaliana, are provided that encode a protein as described herein.
  • the nucleotide sequences are set forth in SEQ ID NOS:1 and 2, and sequences complementary to the specific sequences shown therein are also encompassed in the invention. It is preferred that the nucleotide sequence includes nucleotides spanning nucleotides 1 to 1305, 180 to 1050 or 240 to 960 in SEQ ID NO:1 or SEQ ID NO:2, or sequences having substantial similarity thereto or the selected percent identities thereto as described below, as these regions have homology to GABA receptor domains in animal GABA receptors.
  • an isolated nucleic acid molecule having a nucleotide sequence encoding a protein having an amino acid sequence having at least about 60%, preferably at least about 70%, more preferably at least about 80% and most preferably at least about 90% identity to an amino acid sequence set forth in SEQ ID NO:1 or SEQ ID NO:2, or to an amino acid sequence that includes amino acid 1 to amino acid 435, amino acid 60 to amino acid 350, and amino acid 80 to amino acid 320 in SEQ ID NO:1 or SEQ ID NO:2. It is not intended that the present invention be limited to these exemplary nucleotide sequences, but include sequences having substantial similarity thereto and sequences which encode variant forms of the plant proteins described herein as discussed above and as further discussed below.
  • isolated nucleic acid is intended to refer to nucleic acid which is not in its native environment.
  • the nucleic acid is separated from other contaminants that naturally accompany it, such as proteins, lipids and other nucleic acid sequences.
  • the term includes nucleic acid which has been removed or purified from its naturally- occurring environment or clone library, and further includes recombinant or cloned nucleic acid isolates and chemically synthesized nucleic acid.
  • nucleotide sequence is intended to refer to a natural or synthetic linear and sequential array of nucleotides and/or nucleosides, including deoxyribonucleic acid, ribonucleic acid, and derivatives thereof.
  • encoding and coding refer to the process by which a nucleotide sequence, through the mechanisms of transcription and translation, provides the information to a cell from which a series of amino acids can be assembled into a specific amino acid sequence to produce a functional polypeptide, such as, for example, an active enzyme or other protein that has a specific function.
  • the process of encoding a specific amino acid sequence may involve DNA sequences having one or more base changes (i.e., insertions, deletions, substitutions) that do not cause a change in the encoded amino acid, or which involve base changes which may alter one or more amino acids, but do not eliminate the functional properties of the polypeptide encoded by the DNA sequence. It is therefore understood that the invention encompasses more than the specific exemplary nucleotide sequence encoding the proteins described herein. For example, nucleic acid sequences encoding variant amino acid sequences, as discussed above, are within the scope of the invention.
  • Modifications to a sequence such as deletions, insertions, or substitutions in the sequence, which produce "silent" changes that do not substantially affect the functional properties of the resulting polypeptide molecule are expressly contemplated by the present invention.
  • alterations in a nucleotide sequence which reflect the degeneracy of the genetic code, or which result in the production of a chemically equivalent amino acid at a given site are contemplated.
  • a codon for the amino acid alanine, a hydrophobic amino acid may be substituted by a codon encoding another less hydrophobic residue, such as glycine, or a more hydrophobic residue, such as valine, leucine, or isoleucine.
  • changes which result in substitution of one negatively charged residue for another such as aspartic acid for glutamic acid, or one positively charged residue for another, such as lysine for arginine, can also be expected to produce a biologically equivalent product.
  • Nucleotide changes which result in alteration of the N-terminal and C-terminal portions of the encoded polypeptide molecule would also not generally be expected to alter the activity of the polypeptide. In some cases, it may in fact be desirable to make mutations in the sequence in order to study the effect of alteration on the biological activity of the polypeptide. Each of the proposed modifications is well within the routine skill in the art.
  • the nucleotide sequence has substantial similarity to the entire sequence set forth in SEQ ID NO:1 or SEQ ID NO:2, and preferably the sequence spanning nucleotides 1 to 1305 in SEQ ID NO:1 or SEQ ID NO:2, and variants described herein.
  • the term "substantial similarity" is used herein with respect to a nucleotide sequence to designate that the nucleotide sequence has a sequence sufficiently similar to a reference nucleotide sequence that it will hybridize therewith under moderately stringent conditions. This method of determining similarity is well known in the art to which the invention pertains.
  • moderately stringent conditions are defined in Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd ed. Vol. 1 , pp. 101-104, Cold Spring Harbor Laboratory Press (1989) as including the use of a prewashing solution of 5X SSC (a sodium chloride/sodium citrate solution), 0.5% sodium dodecyl sulfate (SDS), 1.0 mM ethylene diaminetetraacetic acid (EDTA) (pH 8.0) and hybridization and washing conditions of 55°C, 5x SSC.
  • 5X SSC sodium chloride/sodium citrate solution
  • SDS sodium dodecyl sulfate
  • EDTA 1.0 mM ethylene diaminetetraacetic acid
  • nucleotide sequences having selected percent identities to specified regions of the nucleotide sequence set forth in SEQ ID NO:1 or SEQ ID NO:2 are provided.
  • nucleotide sequences are provided that have at least about 70% identity, more preferably at least about 80% identity, and most preferably at least about 90% identity, to a nucleotide sequence of substantial length within the nucleotide set forth in either SEQ ID NO:1 or SEQ ID NO:2.
  • such length may be no more than about 100, 200, 300, 800, 900 or 1400 nucleotides, or may be the entire sequence.
  • the nucleotide sequences have the percent identities mentioned above to a nucleotide sequence spanning nucleotides 1 to 1305, 180 to 1050 or 240 to 960 as discussed above.
  • a further requirement is that the nucleotide sequence set forth in SEQ ID NO:1 and SEQ ID NO:2 encodes a protein that functions as described herein, i.e., one expected to regulate ion influx into plant cells.
  • Candidate ions whose entry may be regulated include anions, such as chloride and cations, such as calcium, sodium, and potassium.
  • the percent identity may be determined, for example, by comparing sequence information using the MacVector program, as described above with reference to amino acid identity.
  • a suitable DNA sequence may be obtained by cloning techniques using cDNA or genomic libraries of Arabidospis thaliana which are available commercially or which may be constructed using standard methods known in the art.
  • Suitable nucleotide sequences may be isolated from DNA libraries obtained from a wide variety of species by means of nucleic acid hybridization or polymerase chain reaction (PCR) procedures, using as probes or primers nucleotide sequences selected in accordance with the invention, such as those set forth in SEQ ID NO:1 and SEQ ID NO:2, nucleotide sequences having substantial similarity thereto, or portions thereof.
  • the nucleotide sequences provided herein are cDNA sequences.
  • nucleic acid sequences encoding a plant protein described herein may be constructed by recombinant DNA technology, for example, by cutting or splicing nucleic acids using restriction enzymes and DNA ligase.
  • nucleic acid sequences may be constructed using chemical synthesis, such as solid-phase phosphoramidate technology, or PCR. PCR may also be used to increase the quantity of nucleic acid produced.
  • the particular nucleic acid sequence is of a length which makes chemical synthesis of the entire length impractical, the sequence may be broken up into smaller segments which may be synthesized and ligated together to form the entire desired sequence by methods known in the art.
  • nucleic acid molecules include a nucleotide sequence encoding a protein described herein.
  • the nucleotide sequence has selected percent identities described herein, or substantial similarity, both as defined above, to the nucleotide sequence set forth in SEQ ID NO:1 or SEQ ID NO:2, preferably the sequence spanning nucleotides 1 to 1305, 180 to 1050 or 240 to 960 in SEQ ID NO:1 or SEQ ID NO:2.
  • the protein produced has the amino acid sequence set forth in SEQ ID NO:1 , SEQ ID NO:2, or variants thereof as described above.
  • the vector may be a T-DNA vector.
  • Representative T-DNA vector systems are discussed in the following publications: An et al., (1986) EMBO J. 4:277; Herrera-Estrella et al., (1983) EMBO J. 2:987; Herrera-Estrella et al., (1985) in Plant Genetic Engineering, New York: Cambridge University Press, p. 63.
  • the desired recombinant vector may be constructed by ligating DNA linker sequences to the 5' and 3' ends of the desired nucleotide insert, cleaving the insert with a restriction enzyme that specifically recognizes sequences present in the linker sequences and the desired vector, cleaving the vector with the same restriction enzyme, mixing the cleaved vector with the cleaved insert and using DNA ligase to incorporate the insert into the vector as known in the art.
  • the vectors may include other nucleotide sequences, such as those encoding selectable markers, including those for antibiotic resistance or color selection.
  • the vectors also preferably include a promoter nucleotide sequence.
  • the desired nucleic acid insert is preferably operably linked to the promoter.
  • a nucleic acid is "operably linked" to a another nucleic acid sequence, such as a promoter sequence, when it is placed in a specific functional relationship with the other nucleic acid sequence.
  • the functional relationship between a promoter and a desired nucleic acid insert typically involves the nucleic acid and the promoter sequences being contiguous such that transcription of the nucleic acid sequence will be facilitated.
  • Two nucleic acid sequences are further said to be operably linked if the nature of the linkage between the two sequences does not (1 ) result in the introduction of a frame-shift-mutation; (2) interfere with the ability of the promoter region sequence to direct the transcription of the desired nucleotide sequence, or (3) interfere with the ability of the desired nucleotide sequence to be transcribed by the promoter sequence region.
  • the promoter element is generally upstream (i.e., at the 5' end) of the nucleic acid insert coding sequence.
  • a wide variety of promoters are known in the art, including cell- specific promoters, inducible promoters, and constitutive promoters. Any promoter that directs transcription in plants cells may be used.
  • the promoters may be of viral, bacterial or eukaryotic origin, including those from plants and plant viruses.
  • the promoter may be of viral origin, including a cauliflower mosaic virus promoter (CaMV), such as CaMV 35S or 19S, a figwort mosaic virus promoter (FMV 35S), or the coat protein promoter of tobacco mosaic virus (TMV).
  • CaMV cauliflower mosaic virus promoter
  • FMV 35S figwort mosaic virus promoter
  • TMV tobacco mosaic virus
  • the promoter may further be, for example, a promoter for the small subunit of ribulose-1 ,3-diphosphate carboxylase.
  • Promoters of bacterial origin include the octopine synthase promoter, the nopaline synthase promoter and other promoters derived from native Ti plasmids as discussed in Herrera-Estrella et al., Nature, 303:209-213 (1983).
  • the promoter may further be one that responds to various forms of environmental stresses, or other stimuli.
  • the promoter may be one induced by abiotic stresses such as wounding, cold, dessication, ultraviolet-B [van Der Krol et al. (1999) Plant Physiol. 121 :1153-1 162], heat shock [Shinmyo et al., (1998) Biotechnol. Bioeng. 58:329-332] or other heat stress, drought stress or water stress.
  • the promoter may further be one induced by biotic stresses including pathogen stress, such as stress induced by a virus [Sohal et al. (1999) Plant Mol. Biol. 41 :75-87] or fungi [Eulgem (1999) EMBO.
  • the promoters may further be selected such that they require activation by other elements known in the art, so that production of the protein encoded by the nucleic acid sequence insert may be regulated as desired.
  • Preferred promoters are foreign promoters.
  • a "foreign promoter" is defined herein to mean a promoter other than the native, or natural, promoter which promotes transcription of a length of DNA.
  • the vectors may further include other regulatory elements, such as enhancer sequences, which cooperate with the promoter to achieve transcription of the nucleic acid insert coding sequence.
  • nucleotide sequence elements which can stimulate promoter activity in a cell, such as a plant host cell.
  • the vectors may further include 3' regulatory sequence elements known in the art, such as those, for example, that increase the stability of the RNA transcribed.
  • the vectors may include another nucleotide sequence insert that encodes a peptide or polypeptide used as a tag to aid in purification of the desired protein encoded by the desired nucleotide sequence.
  • the additional nucleotide sequence is positioned in the vector such that a fusion, or chimeric, protein is obtained.
  • a protein described herein may be produced having at its C-terminal end linker amino acids, as known in the art, joined to the other protein that acts as a tag. After purification procedures known to the skilled artisan, the additional amino acid sequence is cleaved with an appropriate enzyme. The protein may then be isolated from the other proteins, or fragments thereof, by methods known in the art.
  • inventive recombinant vectors may be used to transform a host cell.
  • methods of transforming a plant include introducing into a plant cell a nucleic acid molecule having a nucleotide sequence as described herein, such as one, for example, that encodes a protein having at least about 60% identity to the amino acid sequence set forth in SEQ ID NO:1 or SEQ ID NO:2.
  • Methods of transforming a plant are well known in the art, and may be found in references including, for example, Maniatis et al., Molecular Cloning: A Laboratory Manual, Cold Springs Laboratory, Cold Springs Harbor, New York (1982) and Current Protocols in Molecular Biology, John Wiley and Sons, edited by Ausubel et al. (1988).
  • Plant gene transfer techniques may also be found in references including Fromm et al., (1985) Proc. Natl. Acad. Sci. USA , 82:5824-5828 (lipofection); Crossway et al., (1986) Mol. Gen. Genet. 202:179 (microinjection); Hooykaas-Van Slogtem et al., (1984) Nature 311 :763- 764)(T-DNA mediated transformation of monocots); Rogers et al., (1986) Methods Enzymol. 118:627-641 (T-DNA mediated transformation of dicots); Bevan et al., (1982) Ann. Rev. Genet.
  • a host cell that includes the inventive recombinant vectors described above.
  • host cells may be used in the invention, including prokaryotic and eukaryotic host cells.
  • Preferred host cells are eukaryotic and are further preferably plant cells, such as, for example, those derived from monocotyledons, such as duckweed, corn, turf (including rye grass, Bermuda grass, Blue grass, Fescue), dicotyledons, including lettuce, cereals such as wheat, crucifers (such as rapeseed, radishes and cabbage), solanaceae (including green peppers, potatoes and tomatoes), and legumes such as soybeans and bush beans.
  • the host cells may be cultured as known in the art to produce a transgenic plant.
  • nucleotide sequences described above, and preferably portions thereof, may be used as probes to locate other, similar nucleotide sequences that may encode other GABA receptors.
  • General methods for screening for selected nucleotide sequences in a DNA or RNA sample are known to the art. For example, DNA may be isolated from selected plants, treated with various restrictions enzymes and analyzed by Southern blotting techniques utilizing a radioactively or fluorescently-labeled probe of interest. RNA fragments may be similarly analyzed by Northern blotting techniques. Alternatively, commercially available cDNA or genomic libraries may be screened.
  • the probe encompasses the length of nucleotides from nucleotide 1 to nucleotide 1305 in SEQ ID NO:1 or SEQ ID NO:2, but may also encompass the entire length of nucleotides set forth in SEQ ID NO:1 or SEQ ID NO:2.
  • the probe has a nucleotide sequence having at least about 80% identity, most preferably at least about 90% identity, to the length of nucleotides indicated directly above.
  • the probe may be radioactively labeled at its 5'end, for example, with polynucleotide kinase and 32 P and hybridized to the isolated nucleic acid fragments.
  • a method includes providing a plant having an introduced nucleic acid molecule described herein, such as one having at least about 70% identity to the sequence set forth in SEQ ID NO:1 or SEQ ID NO:2 that encodes a protein described herein, and treating the plant with an effective amount of GABA.
  • the introduced nucleic acid molecule may include a promoter, preferably a foreign promoter, operably linked to a terminal 5' end of the nucleotide sequence so that the sequence is expressed, typically prior to treating the plant with GABA.
  • Such treating of the plant may stimulate growth of the plant, as well as provide other beneficial results, including reducing the effects of plant stress.
  • Transgenic plants may be prepared as described above and treated with an effective amount of GABA.
  • the effective amount of GABA is typically an amount of GABA that will provide some advantages to the plant, including stimulation of plant growth and reduction of plant stress. This amount may vary depending on the particular advantage provided to the plant, the number of introduced nucleotide sequences expressed, the type of plant, and the number of plants treated.
  • plants are typically treated with about 1 ppm to about 24,000 ppm [about 0.013 oz/acre (oz/A) to about 20 lbs/A] [about 0.93 g/hectare (g/ha) to about 22 kg/ha], about 1 ppm to about 12,000 ppm (about 0.013 oz/A to about 10 lbs/A) (about 0.93 g/ha to about 11 kg/ha), about 1 ppm to about 7,500 ppm (about 0.013 oz/A to about 6.3 lbs/A) (about 0.93 g/ha to about 7 ⁇ kg/ha) and about 1 ppm to about 5,000 ppm (about 0.013 oz/A to about 4.2 lbs/A) (about 0.93 g/ha to about 4.8 kg/ha).
  • concentrations of about 1 ppm to about 5,000 ppm, and as described in U.S. Patent No. 5,439,873 to Kinnersley are frequently employed.
  • concentrations of GABA of from about 1 ppm to about 2,500 ppm (about 0.013 oz/A to about 2J lbs/A) (about 0.93 g/ha to about 2.4 kg/ha) are typically employed, with about 150-600 ppm (about 1/8 lb/A to about 1/2 lb/A) (about 0J4 kg/ha to about 0.56 kg/ha) most frequently being employed. All amounts in ppm are on a weight/volume (g/ml) basis.
  • the application rates in brackets or parentheses above are derived for a treatment utilizing a standard volume of 100 gallons of the specified solutions dispersed over 1 acre.
  • the plant in addition to being treated with GABA, may also be treated with a composition that includes GABA and a GABA agonist.
  • plants may be treated with baclofen as well as other
  • GABA agonists known to the art including, for example, cis-4-aminopent-2-enoic acid (CACA), imidazole-4-acetic acid (IAA) and 4,5,6,7-tetrahydroisoxazolo[5,4- c]pyridin-3-ol (THIP).
  • Plants may also be treated with only a GABA antagonist, such as picrotoxin or bicuculline, or only a GABA agonist to regulate plant metabolism as desired.
  • GABA, the GABA agonists or antagonists described are typically applied to the foliage of the plant but may also be administered as a soil drench.
  • the compounds and compositions may be applied to the aqueous solution in which the plants are grown.
  • the compositions are further preferably applied by spraying.
  • the compounds and compositions may also be applied as a seed treatment.
  • GABA the GABA agonists or GABA antagonists described above are preferably combined with a carrier medium as known in the art.
  • the compounds and compositions may, for example, be combined with water, such as tap water or with distilled water to which has been added selected minerals.
  • the compositions of the present invention may be applied as a solid. In such a form, the solid is preferably applied to the soil.
  • compositions may further include agricultural additives or formulation aids known to those skilled in the art.
  • additives or aids may be used to ensure that the compositions disperse well in a spray tank, stick to or penetrate plant surfaces (particularly leaf or other foliage surfaces) as well as provide other benefits to the plant.
  • surfactants, dispersants, humectants, and binders may be used to disperse the compounds or compositions described herein in a spray tank as well as to allow the compound or compositions to adhere to and/or penetrate the plant surfaces.
  • an inventive method includes introducing into a plant cell an antisense nucleotide sequence having a nucleotide sequence complementary to the nucleotide sequences provided herein, such as one that is complementary to a nucleotide sequence having at least about 70% identity, more preferably at least about 80% identity, most preferably at least about 90% identity to a length of nucleotides within the nucleotide sequence set forth in SEQ ID NO:1 or SEQ ID NO:2, preferably from nucleotide 1 to nucleotide 1305.
  • the antisense nucleotide may have a length of about 30 to about 400 nucleotides, about 30 to about 800 nucleotides, about 30 to about 1400 nucleotides and about 30 to about 1800 nucleotides.
  • the antisense nucleotide sequence is as long as the entire length of the nucleotide sequence set forth in SEQ ID NO:1 or SEQ ID NO:2.
  • the antisense nucleotide sequence may hybridize to the template strand, which serves as the strand from which RNA is produced, so that transcription will be reduced.
  • the antisense nucleotide sequence may be complementary to, and therefore hybridize to, the RNA sequence, such as the mRNA sequence, transcribed from the nucleotide sequences described herein, so that translation of the mRNA sequence to express the encoded protein, such as a GABA receptor, will be reduced.
  • the antisense nucleotide sequence may be either DNA or RNA.
  • Such antisense sequences may be produced as described above for the nucleotide sequences and by further methods known in the art. Nucleotide sequences having substantial similarity to the above-described antisense nucleotide sequences are also encompassed in the invention.
  • a method may include in vivo mutagenesis of the gene present in the plant genome encoding the plant GABA receptor protein described herein in order to alter its activity to provide the desired results.
  • a plant may be mutated by methods known to the skilled artisan, including chemical methods and DNA-insertion mutagenesis.
  • methods of modifying receptor activity in a plant are provided.
  • a method includes introducing into a plant cell a nucleic acid molecule having a nucleotide sequence encoding a plant protein as described herein, such as a plant protein having an amino acid sequence having at least about 60% identity to the amino acid sequence set forth in SEQ ID NO:1 or SEQ ID NO:2.
  • the method includes providing a nucleotide sequence described above, or variants thereof, that encodes a protein described herein, and introducing the nucleotide sequence into a host cell, as described above.
  • the desired nucleotide sequence may be advantageously incorporated into a vector to form a recombinant vector.
  • the recombinant vector may then be introduced into a host cell according to known procedures in the art. Such host cells are then cultured under conditions, well known to the skilled artisan, effective to achieve expression of the plant protein.
  • the protein may then be purified using conventional techniques.
  • GABA receptors in animals have been defined on the basis of their response to antagonists as described in Johnston, GAR (1997), Molecular
  • GABA A receptors are sensitive to the antagonist bicuculline and insensitive to the agonist baclofen and GABAB receptors are insensitive to bicuculline and sensitive to baclofen.
  • GABAc receptors are insensitive to both bicuculline and baclofen.
  • GABAc receptors are sensitive to the antagonist picrotoxin. Bicuculline is specific for GABA A and picrotoxin is specific for both GABAA and GABAc receptors.
  • Duckweed (Lemna Minor L) was grown following the general procedure described by Kinnersley (U.S. Patent No. 4,813,997) except that the culture media was Solu-Spray 20-20-20 fertilizer dissolved in tap water at 1 g/l and the pH was adjusted to 5.5 as discussed in U.S. Patent No. 5,439,873 to Kinnersley. Duckweed was treated with, independently, the indicated concentrations of baclofen [ ⁇ -(aminomethyl)-4- chlorobenzenepropanoic acid] (FIG. 1 ), picrotoxin (cocculin) (FIG.
  • baclofen is active at promoting duckweed growth up to concentrations of about 1 mM.
  • baclofen increases the growth-promoting effects of GABA when duckweed is treated with both GABA and baclofen.
  • the growth-promoting effects of GABA are completely inhibited when bicuculline or picrotoxin was added to the culture media. This shows that compounds which affect GABA that act through GABA receptors in animals behave the same way in plants.
  • Arabidopsis thaliana (L.) Heynh. Ecotype Columbia (Col-0) seeds were obtained from the Arabidopsis Biological Resource Center (Ohio State University, Columbus, OH). Arabidopsis seedlings were grown under aseptic conditions in flasks containing MS media [Murashige and Skook, Physiol Plant 15:485 (1962)] on a rotary shaker (150 rpm). Two-day-old seedlings were collected for total RNA isolation. Total RNA was isolated as described in Turano, F.J. et al.(1992) Plant Physiol. 100:374.
  • Primers 5'K/OGLR4Notl(5'GCCCGCGGCCGCATGGCGAAAGCAATCAGAGAGTT GTG-3') and 3'K/OGLR4Notl (5'GCCCGCGGCCGCTTAAGTAATTTCGCCATGTTGTGA-3') to GLR4, corresponding to GenBank ACC# AC000098, were commercially synthesized (Biosynthesis, Inc., Lewisville, TX) and used for RT-PCR reactions.
  • a 5' RACE system Life Technologies, Rockville, MD was used to identify a full-length cDNA clone.
  • the primer, 3'K/OGLR4Notl was used to synthesize a first strand cDNA from 1 ⁇ g of poly (A + )RNA isolated from two-day-old plants following the manufacturers instructions.
  • One-fifth of the first strand cDNA synthesis was used as a template in a gene amplification reaction with both primers, 5'K/OGLR4Noti and 3'K/OGLR4Notl.
  • the components Prior to the amplification, the components were incubated at 95°C for 4 minutes.
  • the gene amplification reaction was conducted at 94°C for 1 minute, 68°C for 1 minute and 72°C for 2 minutes, for 30 cycles followed by a 5 minute, 72°C extension.
  • Genomic DNA was isolated from leaves of 24 day old Arabidopsis as described in Turano, F.J. et al. (1992) Plant Physiol 100:374.
  • 250 ng of each primer 5"K/OGLR4Notl and 3'K/OGLR4Notl was used with approximately 500 ng of genomic DNA.
  • the components Prior to the amplification reaction, the components were incubated at 95°C for 10 minutes.
  • the gene amplification reaction was conducted at 94°C for 1 minutes, 70°C for 1 minute and 72°C for 3 minutes, for 30 cycles followed by a 5 minute, 72°C extension.
  • a full-length cDNA clone encoding a ligand-gated ion channel was identified from total RNA isolated from 2 day old Arabidopsis.
  • the deduced amino acid sequence has high homology with 11 amino acid sequences derived from genomic sequences and three amino acid sequences deduced from full-length cDNA clones in Genbank. More specifically, the gene had homology to animal GABA receptors from nucleotides 1 to 1305 and had homology to animal glutamate receptors from nucleotide 1306 to the end of the sequence.
  • the large family of putative ligand-gated ion channels from Arabidopsis have homology with genes encoding glutamate ionotropic receptor proteins (Glu R) and, in some cases GABA receptor proteins, in invertebrates and vertebrates.
  • the gene encoded in the cDNA described herein was designated GLR4.
  • Northern blot and RT-PCR analyses demonstrated that the GLR4 transcript is approximately 2.8 kb and is readily detected in 2 and 4 day-old Arabidopsis and in meristems of 21 day-old plants. The data suggest that the genes are expressed in tissues undergoing rapid cell division.
  • GABA GABA-like domains at the N-terminal region of the plant ligand-gated ion channel described herein.
  • This theory is supported by recent experimental findings that demonstrate the N-terminal domain of the animal GABA-BRs is sufficient to specify agonist and antagonist binding in GABA-BRs [Malitschek (1999) Mol. Pharmacol. 56(2):448-454].
  • GLR genes are unknown, the presence of GLR genes, and genes having GABA receptor characteristics and glutamate receptor characteristics, in Arabidopsis provides molecular evidence for the biochemical machinery necessary for the transmission of electrical signals in higher plants.
  • GLR4 The entire open reading frame for GLR4, or portions thereof as small as about 25 base pairs, can be cloned into a plant transformation vector, such as pBI121 (Clonetech, Palo Alto, CA) using PCR, RT-PCR or conventional cloning methods to make antisense constructs.
  • a plant transformation vector such as pBI121 (Clonetech, Palo Alto, CA) using PCR, RT-PCR or conventional cloning methods to make antisense constructs.
  • GCCCGCGGCCGCATGGCGAAAGCAATCAGAGTTGTG-3' and 3'K/OGLR4Notl (5'- GCCCGCGGCCGCTTAAGTAATTTCGCCATGTTGTGA-3') (corresponding to GenBank GLR4, ACC # AC000098) can be commercially synthesized (Biosynthesis Inc., Lewisville, TX, USA) and used for PCR or RT-PCR reactions.
  • the PCR reactions can use, 250 ng of each primer with approximately 500 ng of genomic DNA.
  • the components Prior to the amplification reaction, the components can be incubated at
  • the gene amplification reaction can be conducted at 94°C for 1 min, 65°C for 1 min and 72°C for 2 min, for 30 cycles followed by a 4 min 72°C extension.
  • a 5' RACE system (Life Technologies, Rockville, MD, USA) or a simpler reverse transcriptase (RT) based system, can be used to identify a full-length cDNA clone.
  • the primer, 3'K/OGLR4Notl can be used to synthesize first strand cDNA from 1 ⁇ g from poly (A + ) RNA isolated from 2 d-old plants following the manufacturer's instructions.
  • One fifth of the first strand cDNA synthesis can be used as a template in a gene amplification reaction with both primers, 5'K/OGLR4Notl and 3'K/OGLR4Notl.
  • the components Prior to the amplification, the components can be incubation at 95°C for 2 min.
  • the gene amplification reaction can be conducted at 94°C for 1 min, 58°C for 1 min and 72°C for 2 min, for 30 cycles followed by a 5 min 72°C extension.
  • the genomic DNA or cDNA fragments can be cloned into plant transformation vectors in an antisense (backwards) direction.
  • the vectors may contain constitutive promoters such as CaMV 35S promoter and the nopaline synthase terminator.
  • the vectors can be modified to include promoters that can be induced by biotic [Sohal et al.,(1999) Plant Mol. Biol. 41 :75-87] or abiotic stresss [Ngai et al., (1997) Plant J. 12:1021 -1034; van Der Krol et al., (1999) Plant Physiol.
  • the binary vector construct can be transferred into a disarmed strain of Agrobacterium tumefaciens, such as EHA105, and subsequently into Arabidopsis (Ws ecotype) using the vacuum infiltration method [Bechtold and Bouchez (1995) In planta Agrobacterium-mediated transformation of adult Arabidopsis thaliana plants by vacuum infiltration, in Gene Transfer to Plants, I. Potrykus and G. Spangenberg, Eds. (Springer-Verlag, Heidelberg) pp. 19-23] with one modification [i.e., the addition of 0.02% (v/v) Silwet to the infiltration media]. Seeds collected from the transformed plants can be germinated and selected for kanamycin resistance.
  • Parsimony and nearest neighbor analyses were used to examine evolutionary relationships between eight putative plant GLR sequences, the iGLRs and members of family 4 of the GPCRs, specifically the mGLRs and GABA-BRs (FIG. 4).
  • the possibility of a recombination event during the evolutionary history of the loci was considered and, therefore, the analyses of the peptides were separated into two; comparing the approximate first one-third (N-terminal regions), and the last two-thirds (C- terminal regions) of the peptides separately.
  • a strict consensus tree generated from the four equally parsimonious trees was identical to the tree shown with the exception that hummglur7n was placed between hummglur6n and ratmglur4n. Support of the more important clades is indicated by bootstrap values using 500 permutations of the aligned data set. Ecoliginh was used as an outgroup. Similar results were obtained with nearest neighbor analyses (not shown).
  • the ancestors to extant GLRs are the evolutionary progenitors to both the iGLRs and members of family 4 of the GPCRs, and thus represent a previously unidentified evolutionary link between the two superfamilies of receptors.
  • an ancestral plant GLR evolves from a BPBP.
  • the ancestral GLR evolves into plant GLRs, iGLRs and members of family 4 of the G-protein coupled receptors (GPCR-F4), via distinct evolutionary routes.
  • the GLRs and iGLRs evolve by a series of point mutations and selection.
  • An ancestral GPCR-F4 arose from a gene conversion or recombination event between the 5'-end of an ancestral plant GLR and a gene encoding for a peptide with seven-transmembrane domains (7- TMDP), perhaps a gene encoding for a GPCR-like protein. [Josefsson, L.G. et al., (1997) Eur. J. Biochem.

Landscapes

  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biomedical Technology (AREA)
  • Zoology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Cell Biology (AREA)
  • Botany (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Peptides Or Proteins (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

Recombinant plant proteins that are expected to function as ligand gated ion-channel proteins, such as GABA receptor proteins, are provided, as are nucleotide sequences encoding these proteins. The invention also provides recombinant vectors including the nucleotide sequences encoding the proteins described herein. Further provided are plant host cells that include the recombinant vectors described herein, transgenic plants and methods of using the nucleotide and amino acid sequences described herein, including methods of treating plants, method of expressing the proteins described herein, methods of modifying receptor activity in a plant and methods of regulating plant metabolism.

Description

PLANT LIGAND-GATED ION CHANNELS
CROSS-REFERENCE TO RELATED APPLICATIONS The present application claims the benefit of U.S. Provisional Patent
Application Serial Number 60/122,506, filed on March 2, 1999,which is hereby incorporated by reference in its entirety.
BACKGROUND OF THE INVENTION The amino acid γ-aminobutyric acid (GABA) is the major neurotransmitter in the mammalian central nervous system. Such neurotransmitters generally function in regulating the conductance of ions across neuronal membranes, typically in regulating influx of ions into a cell. For example, GABA is considered an inhibitory neurotransmitter which acts to inhibit synaptic transmission in both vertebrate and invertebrate nervous systems. As another example, glutamate is an excitatory neurotransmitter that depolarizes the postsynaptic membrane and acts to promote synaptic transmission. Both GABA and glutamate affect synaptic transmission by binding to their respective receptors, also known as ligand-gated ion channels.
These ligand-gated ion channels are present in neurons of insects and animals. Three general classes of GABA receptors, denoted GABAA, GABAB and GABAc, are present in animal neurons. GABA receptors have been implicated in mediating anxiety, seizures, cognitive function, addictive disorders, sleep disorders and other disorders of the central nen/ous system. GABA receptors are the target of many pharmaceutical preparations which act on the central nervous system, including barbiturates and benzodiazepenes, and thus have therapeutic value. Furthermore, compounds which affect the function of insect GABA receptors are commercially useful as insecticides. Although GABA receptors have been found in insects and in the animal kingdom, they have yet to be discovered in the plant kingdom. However, GABA has been shown to exert certain beneficial effects on plants. For example, GABA has been shown to increase plant growth and productivity as shown in U.S. Patent No. 5,439,873 to Kinnersley.
Moreover, such beneficial effects have been increased when GABA is applied to plants along with a readily metabolized source of carbon, such as succinic acid (U.S. Patent No. 5,604,177). Moreover, GABA has been found to increase fertilizer efficiency when administered with glutamic acid as described in U.S. Patent No. 5,840,656 to Kinnersley et al.
The mechanism of the above-described beneficial results of GABA in plants has not yet been confirmed. A better understanding of the mechanism of GABA-mediated plant growth and productivity may lead to further methods for improving plant growth, productivity, and other beneficial effects.
SUMMARY OF THE INVENTION
Nucleotide sequences expected to encode ligand-gated ion channel proteins, such as glutamate and/or GABA receptor proteins, have been discovered in plants. Accordingly, the present invention provides these purified plant proteins, including recombinant proteins, nucleotide sequences encoding the proteins and methods of using the nucleotide sequences and proteins.
In one aspect of the invention, methods of transforming a plant are provided. In one form of the invention, a method includes introducing into a plant cell a nucleic acid molecule encoding a plant protein described herein.
In a second aspect of the invention, methods of treating a plant are provided that include providing a plant having an introduced nucleotide sequence encoding a plant protein described herein and treating the plant with an effective amount of GABA. The plant may further be treated with a composition including GABA and a GABA agonist or may be treated only with a GABA antagonist or GABA agonist.
In a third aspect of the invention, methods of regulating plant metabolism include utilizing antisense DNA or RNA to reduce formation of a plant protein or RNA transcript, such as a mRNA transcript. In one embodiment, the method includes introducing into a plant cell an antisense nucleic acid molecule having a nucleotide sequence that is complementary to the nucleotide sequences described herein, or portions thereof, that is expected to encode a plant GABA receptor. Alternatively, the antisense nucleic acid molecule includes a nucleotide sequence complementary to an RNA sequence, preferably a mRNA sequence, transcribed from the sequences described herein. The antisense nucleotide sequence hybridizes to nucleic acid, including either the template strand or the RNA transcript, of the plant to reduce formation of a plant protein described herein. In a fourth aspect of the invention, methods of identifying potential plant receptors are provided that include hybridizing to plant nucleic acid a probe having a nucleotide sequence encoding the proteins described herein. In a fifth aspect of the invention, methods of expressing plant proteins described herein are provided. In one embodiment, a method includes introducing into a host cell a nucleotide sequence expected to encode a plant GABA receptor described herein and culturing under conditions to achieve expression of the protein receptor. In further embodiments, isolated nucleic acid molecules, including recombinant nucleic acid molecules, are provided that include nucleotide sequences encoding plant proteins as described herein. Plant host cells and transgenic plants are also provided that include nucleotide sequences encoding the plant proteins described herein. The molecules, plant cells and transgenic plants further may include a foreign promoter sequence operably linked to a terminal 5' end of the plant nucleotide sequences described herein.
BRIEF DESCRIPTION OF THE FIGURES
FIG. 1 depicts a graph showing the effect of baclofen, a GABA agonist, on duckweed growth as more fully described in example 1.
FIG. 2 depicts a graph showing the effect of GABA antagonists picrotoxin and bicuculline on duckweed growth as more fully described in example 1.
FIG. 3 depicts a graph showing the effect of GABA agonists and antagonists on GABA-mediated growth promotion in Duckweed as more fully described in example 1. BFN, baclofen; PIC, picrotoxin; 4-AB, γ- aminobutyric acid.
FIG. 4 depicts the phylogeny of bacterial periplasmic binding proteins and eukaryotic receptors based on parsimony analysis of the N- terminal (approximately one-third) amino acid sequences. Sequences included in the phylogentic reconstruction were a bacterial periplasmic binding protein, the animal ionotropic glutamate (iGLR), metabotropic glutamate (mGLR), and γ-aminobutyric acids (GABA-BR) receptors, and putative plant glutamate receptors (GLR). Lower case n designates N- terminal sequences from amino acid residues 80 to 320. The abbreviations and accession numbers for the mGLRs, GABA-BRs and the remaining plant GLRs are as follows: human metabotropic glutamate receptor 1 alpha (hummglurlalpn, ACC# U31215), human metabotropic glutamate receptor 1 beta (hummglurl betn, ACC# U31216), human glutamate receptor, metabotropic 5 (hummglurδn, ACC# NM000842), rat metabotropic glutamate receptor mGluR5 (ratmglurδn, ACC# D10891), human glutamate receptor, metabotropic 2 (hummglur2n, ACC# NM000839), human glutamate receptor, metabotropic 3 (hummglur3n, ACC# NM000840), human glutamate receptor, metabotropic 8 (hummglurδn, ACC# U92459), mouse metabotropic glutamate receptor 8 (mousemglurδn, ACC# U17252), human metabotropic glutamate receptor 7 (hummglur7n, ACC# U92458), human metabotropic glutamate receptor 4 (hummglur4n, ACC# U92457), rat metabotropic glutamate receptor 4 (ratmglur4n, ACC# M90518), human glutamate receptor, metabotropic 6 (hummglurδn, ACC# NM_000843), human GABAB receptor subunit 1 a (humGABA-BR1 an, ACC# AJ012185), rat GABAB receptor subunit 1 a (ratGABA-B1 an, ACC# Y10369), human GABAB receptor subunit 1 b (humGABA-BR1 bn, ACC# AJ012186), rat GABAB receptor subunit 1 b (ratGABA-B1 bn, ACC# Y10370), human GABAB receptor subunit 2 (humGABA-BR2n, ACC# AJ012188), rat GABA- B R2 receptor (ratGABA-br2n2, ACC# AJ01 1318), rat GABA-B R2 receptor (ratGABA-br2n1 , ACC# AF07442), Arabidopsis putative glutamate receptor 2a (glr2an, ACC# AF079999), Arabidopsis putative glutamate receptor 2b (glr2bn, ACC# AF038557), Arabidopsis putative glutamate receptor 5 (glrδn, ACC# AL022604), Arabidopsis putative glutamate receptor 6 (glrβn, ACC# AL022604), and Arabidopsis putative glutamate receptor 7 (glr7n, ACC# AL031004). Other abbreviations are as defined in Chiu, J. et al. (1999) Mol. Biol. Evol. 16:826-838.
FIG. 5 shows a proposed evolutionary history of the bacterial periplasmic binding proteins (BPBP), plant glutamate receptor (GLRs), animal ionotropic glutamate (iGLR), metabotropic glutamate (mGLR), and gamma-aminobutyric acidB (GABA-BR) receptor genes as discussed in example 4. 7-TMDP,a gene encoding a peptide with seven transmembrane domains; GPCR-F4, family 4 of the G protein -coupled receptors. DESCRIPTION OF THE PREFERRED EMBODIMENTS
For the purposes of promoting an understanding of the principles of the invention, reference will now be made to preferred embodiments and specific language will be used to describe the same. It will nevertheless be understood that no limitation of the scope of the invention is thereby intended, such alterations and further modifications of the invention, and such further applications of the principles of the invention as illustrated herein, being contemplated as would normally occur to one skilled in the art to which the invention relates.
A nucleotide sequence has been found in Arabidopsis thaliana that is expected to encode a plant GABA receptor protein. Accordingly, the present invention provides purified GABA receptor proteins. The invention further provides isolated nucleic acid molecules that include nucleotide sequences encoding plant GABA receptor proteins. Recombinant nucleic acid molecules, plant host cells and transgenic plants are also provided that include the nucleotide sequences encoding the plant GABA receptor proteins. In other aspects of the invention, methods of expressing a protein, such as a GABA receptor protein, and methods of using the nucleotide and amino acid sequences described herein are also provided. In a first aspect of the invention, purified plant proteins expected to function as ligand-gated ion channel proteins in plants, such as GABA receptor proteins, and therefore having the ability to regulate cellular ion influx, are provided. The polypeptide receptors are substantially pure (i.e., the protein receptors are essentially free, e.g., at least about 95% free, from other proteins with which they naturally occur). In preferred embodiments, the amino acid sequence of a protein expected to function as a ligand-gated ion channel protein in a plant, originally found in Arabidopsis thaliana, is set forth in SEQ ID NO:1 or SEQ ID NO:2. Although the invention is described with reference to Arabidopsis thaliana amino acid sequences, it is understood that the invention is not limited to the specific amino acid sequences set forth in SEQ ID NO:1 or SEQ ID NO:2. Skilled artisans will recognize that, through the process of mutation and/or evolution, polypeptides of different lengths and having differing constituents, e.g., with amino acid insertions, substitutions, deletions, and the like, may arise that are related to, or sufficiently similar to, a sequence set forth herein by virtue of amino acid sequence homology and advantageous functionality as described herein. The term "GABA receptor protein" is used herein to refer generally to a protein having the features described herein and preferred examples include polypeptides having the amino acid sequences set forth in SEQ ID NO:1 or SEQ ID NO:2. Further included within this definition, and in the scope of the invention, are variants of the polypeptide which function in regulating ion movement into a cell, as described herein. Preferred proteins are recombinant proteins. It is well known that plants of a wide variety of species commonly express and utilize homologous proteins, which include the insertions, substitutions and/or deletions discussed above, and yet which effectively provide similar function. For example, an amino acid sequence isolated from another species may differ to a certain degree from the sequences set forth in SEQ ID NOS:1 and 2, and yet have similar functionality with respect to catalytic and regulatory function. Amino acid sequences comprising such variations are included within the scope of the present invention and are considered substantially or sufficiently similar to a reference amino acid sequence. Although not being limited by theory, it is believed that the identity between amino acid sequences that is necessary to maintain proper functionality is related to maintenance of the tertiary structure of the polypeptide such that specific interactive sequences will be properly located and will have the desired activity. Although it is not intended that the present invention be limited by any theory by which it achieves its advantageous result, it is contemplated that a polypeptide including these interactive sequences in proper spatial context will have good activity, even where alterations exist in other portions thereof.
In this regard, a variant of the proteins described herein is expected to be functionally similar to that set forth in SEQ ID NO:1 or SEQ ID NO:2, for example, if it includes amino acids which are conserved among a variety of plant species or if it includes non-conserved amino acids which exist at a given location in another plant species that expresses the proteins described herein.
Another manner in which similarity may exist between two amino acid sequences is where a given amino acid of one group (such as a non- polar amino acid, an uncharged polar amino acid, a charged polar acidic amino acid or a charged polar basic amino acid) is substituted with another amino acid from the same amino acid group. For example, it is known that the uncharged polar amino acid serine may commonly be substituted with the uncharged polar amino acid threonine in a polypeptide without substantially altering the functionality of the polypeptide. Whether a given substitution will affect the functionality of the enzyme may be determined without undue experimentation using synthetic techniques and screening assays known in the art. The invention therefore also encompasses amino acid sequences similar to the amino acid sequences set forth herein that have at least about 60% identity thereto that preferably function in regulating cellular ion influx. Preferably, inventive amino acid sequences have at least about 70% identity, further preferably at least about 80% identity, and most preferably at least about 90% identity to these sequences.
Percent identity may be determined, for example, by comparing sequence information using the MacVector computer program, version 6.0.1 , available from Oxford Molecular Group, Inc. (Beaverton, OR). Briefly, the MacVector program defines identity as the number of identical aligned symbols (i.e., nucleotides or amino acids), divided by the total number of symbols in the shorter of the two sequences. The program may be used to determine percent identity over the entire length of the proteins being compared. Preferred default parameters for the MacVector program include: for pairwise alignment: (1) matrix = BLOSUM30; (2) Alignment speed - fast; (3) Ktuple = 1 ; (4) Gap penalty = 1 ; Top diagonals = 5; Window size = 5; for multiple alignment: matrix = BLOSUM series, open gap penalty = 10; extended gap penalty = 0.1 , delay divergent = 40%; protein gap parameters: Gap separation distance = 8; residue-specific penalties = yes or on; hydrophilic residues = GPSNDQEKR.
In another aspect of the invention, isolated nucleic acid molecules, originally isolated from Arabidopsis thaliana, are provided that encode a protein as described herein. The nucleotide sequences are set forth in SEQ ID NOS:1 and 2, and sequences complementary to the specific sequences shown therein are also encompassed in the invention. It is preferred that the nucleotide sequence includes nucleotides spanning nucleotides 1 to 1305, 180 to 1050 or 240 to 960 in SEQ ID NO:1 or SEQ ID NO:2, or sequences having substantial similarity thereto or the selected percent identities thereto as described below, as these regions have homology to GABA receptor domains in animal GABA receptors. In one form of the invention, an isolated nucleic acid molecule is provided that has a nucleotide sequence encoding a protein having an amino acid sequence having at least about 60%, preferably at least about 70%, more preferably at least about 80% and most preferably at least about 90% identity to an amino acid sequence set forth in SEQ ID NO:1 or SEQ ID NO:2, or to an amino acid sequence that includes amino acid 1 to amino acid 435, amino acid 60 to amino acid 350, and amino acid 80 to amino acid 320 in SEQ ID NO:1 or SEQ ID NO:2. It is not intended that the present invention be limited to these exemplary nucleotide sequences, but include sequences having substantial similarity thereto and sequences which encode variant forms of the plant proteins described herein as discussed above and as further discussed below. The term "isolated nucleic acid," as used herein, is intended to refer to nucleic acid which is not in its native environment. For example, the nucleic acid is separated from other contaminants that naturally accompany it, such as proteins, lipids and other nucleic acid sequences. The term includes nucleic acid which has been removed or purified from its naturally- occurring environment or clone library, and further includes recombinant or cloned nucleic acid isolates and chemically synthesized nucleic acid.
The term "nucleotide sequence," as used herein, is intended to refer to a natural or synthetic linear and sequential array of nucleotides and/or nucleosides, including deoxyribonucleic acid, ribonucleic acid, and derivatives thereof. The terms "encoding" and "coding" refer to the process by which a nucleotide sequence, through the mechanisms of transcription and translation, provides the information to a cell from which a series of amino acids can be assembled into a specific amino acid sequence to produce a functional polypeptide, such as, for example, an active enzyme or other protein that has a specific function. The process of encoding a specific amino acid sequence may involve DNA sequences having one or more base changes (i.e., insertions, deletions, substitutions) that do not cause a change in the encoded amino acid, or which involve base changes which may alter one or more amino acids, but do not eliminate the functional properties of the polypeptide encoded by the DNA sequence. It is therefore understood that the invention encompasses more than the specific exemplary nucleotide sequence encoding the proteins described herein. For example, nucleic acid sequences encoding variant amino acid sequences, as discussed above, are within the scope of the invention. Modifications to a sequence, such as deletions, insertions, or substitutions in the sequence, which produce "silent" changes that do not substantially affect the functional properties of the resulting polypeptide molecule are expressly contemplated by the present invention. For example, it is understood that alterations in a nucleotide sequence which reflect the degeneracy of the genetic code, or which result in the production of a chemically equivalent amino acid at a given site, are contemplated. Thus, a codon for the amino acid alanine, a hydrophobic amino acid, may be substituted by a codon encoding another less hydrophobic residue, such as glycine, or a more hydrophobic residue, such as valine, leucine, or isoleucine. Similarly, changes which result in substitution of one negatively charged residue for another, such as aspartic acid for glutamic acid, or one positively charged residue for another, such as lysine for arginine, can also be expected to produce a biologically equivalent product.
Nucleotide changes which result in alteration of the N-terminal and C-terminal portions of the encoded polypeptide molecule would also not generally be expected to alter the activity of the polypeptide. In some cases, it may in fact be desirable to make mutations in the sequence in order to study the effect of alteration on the biological activity of the polypeptide. Each of the proposed modifications is well within the routine skill in the art.
In one preferred embodiment, the nucleotide sequence has substantial similarity to the entire sequence set forth in SEQ ID NO:1 or SEQ ID NO:2, and preferably the sequence spanning nucleotides 1 to 1305 in SEQ ID NO:1 or SEQ ID NO:2, and variants described herein. The term "substantial similarity" is used herein with respect to a nucleotide sequence to designate that the nucleotide sequence has a sequence sufficiently similar to a reference nucleotide sequence that it will hybridize therewith under moderately stringent conditions. This method of determining similarity is well known in the art to which the invention pertains. Briefly, moderately stringent conditions are defined in Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd ed. Vol. 1 , pp. 101-104, Cold Spring Harbor Laboratory Press (1989) as including the use of a prewashing solution of 5X SSC (a sodium chloride/sodium citrate solution), 0.5% sodium dodecyl sulfate (SDS), 1.0 mM ethylene diaminetetraacetic acid (EDTA) (pH 8.0) and hybridization and washing conditions of 55°C, 5x SSC. A further requirement of the inventive polynucleotide is that it must encode a polypeptide having similar functionality to the plant proteins described herein.
In yet another embodiment, nucleotide sequences having selected percent identities to specified regions of the nucleotide sequence set forth in SEQ ID NO:1 or SEQ ID NO:2 are provided. In one preferred form, nucleotide sequences are provided that have at least about 70% identity, more preferably at least about 80% identity, and most preferably at least about 90% identity, to a nucleotide sequence of substantial length within the nucleotide set forth in either SEQ ID NO:1 or SEQ ID NO:2. For example, such length may be no more than about 100, 200, 300, 800, 900 or 1400 nucleotides, or may be the entire sequence. In certain forms of the invention, the nucleotide sequences have the percent identities mentioned above to a nucleotide sequence spanning nucleotides 1 to 1305, 180 to 1050 or 240 to 960 as discussed above. A further requirement is that the nucleotide sequence set forth in SEQ ID NO:1 and SEQ ID NO:2 encodes a protein that functions as described herein, i.e., one expected to regulate ion influx into plant cells. Candidate ions whose entry may be regulated include anions, such as chloride and cations, such as calcium, sodium, and potassium. The percent identity may be determined, for example, by comparing sequence information using the MacVector program, as described above with reference to amino acid identity. Preferred default parameters include: (1) for pairwise alignment parameters: (a) Ktuple = 1 ; (b) Gap penalty = 1 ; (c) Window size = 4; and (2) for multiple alignment parameters: (a) Open gap penalty = 10; (b) Extended gap penalty = 5; (c) Delay divergent = 40%; and (d) transitions = weighted.
A suitable DNA sequence may be obtained by cloning techniques using cDNA or genomic libraries of Arabidospis thaliana which are available commercially or which may be constructed using standard methods known in the art. Suitable nucleotide sequences may be isolated from DNA libraries obtained from a wide variety of species by means of nucleic acid hybridization or polymerase chain reaction (PCR) procedures, using as probes or primers nucleotide sequences selected in accordance with the invention, such as those set forth in SEQ ID NO:1 and SEQ ID NO:2, nucleotide sequences having substantial similarity thereto, or portions thereof. In preferred forms of the invention, the nucleotide sequences provided herein are cDNA sequences.
Alternately, a suitable sequence may be made by techniques which are well known in the art. For example, nucleic acid sequences encoding a plant protein described herein may be constructed by recombinant DNA technology, for example, by cutting or splicing nucleic acids using restriction enzymes and DNA ligase. Furthermore, nucleic acid sequences may be constructed using chemical synthesis, such as solid-phase phosphoramidate technology, or PCR. PCR may also be used to increase the quantity of nucleic acid produced. Moreover, if the particular nucleic acid sequence is of a length which makes chemical synthesis of the entire length impractical, the sequence may be broken up into smaller segments which may be synthesized and ligated together to form the entire desired sequence by methods known in the art.
In a further aspect of the invention, recombinant nucleic acid molecules, or recombinant vectors, are provided. In one embodiment, the nucleic acid molecules include a nucleotide sequence encoding a protein described herein. The nucleotide sequence has selected percent identities described herein, or substantial similarity, both as defined above, to the nucleotide sequence set forth in SEQ ID NO:1 or SEQ ID NO:2, preferably the sequence spanning nucleotides 1 to 1305, 180 to 1050 or 240 to 960 in SEQ ID NO:1 or SEQ ID NO:2. The protein produced has the amino acid sequence set forth in SEQ ID NO:1 , SEQ ID NO:2, or variants thereof as described above.
A wide variety of vectors are known that have use in the invention. For example, various plasmid and phage vectors are known that are ideally suited for use in the invention, including λZap and pBluescript. In preferred embodiments, the vector may be a T-DNA vector. Representative T-DNA vector systems are discussed in the following publications: An et al., (1986) EMBO J. 4:277; Herrera-Estrella et al., (1983) EMBO J. 2:987; Herrera-Estrella et al., (1985) in Plant Genetic Engineering, New York: Cambridge University Press, p. 63. In one embodiment, the desired recombinant vector may be constructed by ligating DNA linker sequences to the 5' and 3' ends of the desired nucleotide insert, cleaving the insert with a restriction enzyme that specifically recognizes sequences present in the linker sequences and the desired vector, cleaving the vector with the same restriction enzyme, mixing the cleaved vector with the cleaved insert and using DNA ligase to incorporate the insert into the vector as known in the art.
The vectors may include other nucleotide sequences, such as those encoding selectable markers, including those for antibiotic resistance or color selection. The vectors also preferably include a promoter nucleotide sequence. The desired nucleic acid insert is preferably operably linked to the promoter. A nucleic acid is "operably linked" to a another nucleic acid sequence, such as a promoter sequence, when it is placed in a specific functional relationship with the other nucleic acid sequence. The functional relationship between a promoter and a desired nucleic acid insert typically involves the nucleic acid and the promoter sequences being contiguous such that transcription of the nucleic acid sequence will be facilitated. Two nucleic acid sequences are further said to be operably linked if the nature of the linkage between the two sequences does not (1 ) result in the introduction of a frame-shift-mutation; (2) interfere with the ability of the promoter region sequence to direct the transcription of the desired nucleotide sequence, or (3) interfere with the ability of the desired nucleotide sequence to be transcribed by the promoter sequence region. Typically, the promoter element is generally upstream (i.e., at the 5' end) of the nucleic acid insert coding sequence. A wide variety of promoters are known in the art, including cell- specific promoters, inducible promoters, and constitutive promoters. Any promoter that directs transcription in plants cells may be used. The promoters may be of viral, bacterial or eukaryotic origin, including those from plants and plant viruses. For example, in certain preferred embodiments, the promoter may be of viral origin, including a cauliflower mosaic virus promoter (CaMV), such as CaMV 35S or 19S, a figwort mosaic virus promoter (FMV 35S), or the coat protein promoter of tobacco mosaic virus (TMV). The promoter may further be, for example, a promoter for the small subunit of ribulose-1 ,3-diphosphate carboxylase. Promoters of bacterial origin include the octopine synthase promoter, the nopaline synthase promoter and other promoters derived from native Ti plasmids as discussed in Herrera-Estrella et al., Nature, 303:209-213 (1983).
The promoter may further be one that responds to various forms of environmental stresses, or other stimuli. For example, the promoter may be one induced by abiotic stresses such as wounding, cold, dessication, ultraviolet-B [van Der Krol et al. (1999) Plant Physiol. 121 :1153-1 162], heat shock [Shinmyo et al., (1998) Biotechnol. Bioeng. 58:329-332] or other heat stress, drought stress or water stress. The promoter may further be one induced by biotic stresses including pathogen stress, such as stress induced by a virus [Sohal et al. (1999) Plant Mol. Biol. 41 :75-87] or fungi [Eulgem (1999) EMBO. J. 18:4689-4699], stresses induced as part of the plant defense pathway [Lebel (1998) Plant J. 16:223-233] or by other environmental signals, such as light [Ngai et al. (1997) Plant J. 12:1021 - 1034; Sohal et al. (1999) Plant Mol. Biol. 41 :75-87], carbon dioxide [Kucho et al. (1999) Plant Physiol 121 : 1329-1338], hormones or other signaling molecules such as auxin, hydrogen peroxide and salicylic acid [Chen and Singh (1999) Plant J. 19:667-677], sugars and gibberellin [Lu et al. (1998) J. Biol. Chem. 273:10120-10131 ] or abscissic acid and ethylene [Leubner- Metzger et ai. (1998) Plant Mol. Biol. 38:785-795]. The promoters may further be selected such that they require activation by other elements known in the art, so that production of the protein encoded by the nucleic acid sequence insert may be regulated as desired. Preferred promoters are foreign promoters. A "foreign promoter" is defined herein to mean a promoter other than the native, or natural, promoter which promotes transcription of a length of DNA. The vectors may further include other regulatory elements, such as enhancer sequences, which cooperate with the promoter to achieve transcription of the nucleic acid insert coding sequence. By "enhancer" is meant nucleotide sequence elements which can stimulate promoter activity in a cell, such as a plant host cell. The vectors may further include 3' regulatory sequence elements known in the art, such as those, for example, that increase the stability of the RNA transcribed.
Moreover, the vectors may include another nucleotide sequence insert that encodes a peptide or polypeptide used as a tag to aid in purification of the desired protein encoded by the desired nucleotide sequence. The additional nucleotide sequence is positioned in the vector such that a fusion, or chimeric, protein is obtained. For example, a protein described herein may be produced having at its C-terminal end linker amino acids, as known in the art, joined to the other protein that acts as a tag. After purification procedures known to the skilled artisan, the additional amino acid sequence is cleaved with an appropriate enzyme. The protein may then be isolated from the other proteins, or fragments thereof, by methods known in the art.
The inventive recombinant vectors may be used to transform a host cell. Accordingly, methods of transforming a plant are provided that include introducing into a plant cell a nucleic acid molecule having a nucleotide sequence as described herein, such as one, for example, that encodes a protein having at least about 60% identity to the amino acid sequence set forth in SEQ ID NO:1 or SEQ ID NO:2. Methods of transforming a plant are well known in the art, and may be found in references including, for example, Maniatis et al., Molecular Cloning: A Laboratory Manual, Cold Springs Laboratory, Cold Springs Harbor, New York (1982) and Current Protocols in Molecular Biology, John Wiley and Sons, edited by Ausubel et al. (1988). Plant gene transfer techniques may also be found in references including Fromm et al., (1985) Proc. Natl. Acad. Sci. USA , 82:5824-5828 (lipofection); Crossway et al., (1986) Mol. Gen. Genet. 202:179 (microinjection); Hooykaas-Van Slogtem et al., (1984) Nature 311 :763- 764)(T-DNA mediated transformation of monocots); Rogers et al., (1986) Methods Enzymol. 118:627-641 (T-DNA mediated transformation of dicots); Bevan et al., (1982) Ann. Rev. Genet. 16:357-384) (T-DNA mediated transformation of dicots); Klein et al., (1988) Proc. Natl. Acad. Sci USA 85:4305-4309 (microprojectile bombardment); and Fromm et al., Nature (1986) 319:791 -793 (electroporation). Once the desired nucleic acid has been introduced into the host cell, the host cell may produce the protein, or variants thereof, as described above. Accordingly, in yet another aspect of the invention, a host cell is provided that includes the inventive recombinant vectors described above.
A wide variety of host cells may be used in the invention, including prokaryotic and eukaryotic host cells. Preferred host cells are eukaryotic and are further preferably plant cells, such as, for example, those derived from monocotyledons, such as duckweed, corn, turf (including rye grass, Bermuda grass, Blue grass, Fescue), dicotyledons, including lettuce, cereals such as wheat, crucifers (such as rapeseed, radishes and cabbage), solanaceae (including green peppers, potatoes and tomatoes), and legumes such as soybeans and bush beans. In a further aspect of the invention, the host cells may be cultured as known in the art to produce a transgenic plant.
In another aspect of the invention, methods of identifying plant proteins, such as those expected to be GABA receptors, are provided. In these methods, nucleotide sequences described above, and preferably portions thereof, may be used as probes to locate other, similar nucleotide sequences that may encode other GABA receptors. General methods for screening for selected nucleotide sequences in a DNA or RNA sample are known to the art. For example, DNA may be isolated from selected plants, treated with various restrictions enzymes and analyzed by Southern blotting techniques utilizing a radioactively or fluorescently-labeled probe of interest. RNA fragments may be similarly analyzed by Northern blotting techniques. Alternatively, commercially available cDNA or genomic libraries may be screened.
In a preferred embodiment, a probe nucleic acid molecule having a nucleotide sequence having at least about 70% identity to a nucleotide sequence having a length of about 25 to about 100 nucleotides, preferably 25 to about 400, and further preferably about 25 to about 800, and about 25 to about 1000 nucleotides within the nucleotide sequence set forth in SEQ ID NO:1 or SEQ ID NO:2, preferably from nucleotide 1 to nucleotide 1305, may be used as a probe. In more preferred embodiments, the probe encompasses the length of nucleotides from nucleotide 1 to nucleotide 1305 in SEQ ID NO:1 or SEQ ID NO:2, but may also encompass the entire length of nucleotides set forth in SEQ ID NO:1 or SEQ ID NO:2. In other embodiments, the probe has a nucleotide sequence having at least about 80% identity, most preferably at least about 90% identity, to the length of nucleotides indicated directly above. The probe may be radioactively labeled at its 5'end, for example, with polynucleotide kinase and 32P and hybridized to the isolated nucleic acid fragments.
In another aspect of the invention, methods of treating a plant are provided. In one embodiment, a method includes providing a plant having an introduced nucleic acid molecule described herein, such as one having at least about 70% identity to the sequence set forth in SEQ ID NO:1 or SEQ ID NO:2 that encodes a protein described herein, and treating the plant with an effective amount of GABA. The introduced nucleic acid molecule may include a promoter, preferably a foreign promoter, operably linked to a terminal 5' end of the nucleotide sequence so that the sequence is expressed, typically prior to treating the plant with GABA. Such treating of the plant may stimulate growth of the plant, as well as provide other beneficial results, including reducing the effects of plant stress.
Transgenic plants may be prepared as described above and treated with an effective amount of GABA. The effective amount of GABA is typically an amount of GABA that will provide some advantages to the plant, including stimulation of plant growth and reduction of plant stress. This amount may vary depending on the particular advantage provided to the plant, the number of introduced nucleotide sequences expressed, the type of plant, and the number of plants treated. However, plants are typically treated with about 1 ppm to about 24,000 ppm [about 0.013 oz/acre (oz/A) to about 20 lbs/A] [about 0.93 g/hectare (g/ha) to about 22 kg/ha], about 1 ppm to about 12,000 ppm (about 0.013 oz/A to about 10 lbs/A) (about 0.93 g/ha to about 11 kg/ha), about 1 ppm to about 7,500 ppm (about 0.013 oz/A to about 6.3 lbs/A) (about 0.93 g/ha to about 7Λ kg/ha) and about 1 ppm to about 5,000 ppm (about 0.013 oz/A to about 4.2 lbs/A) (about 0.93 g/ha to about 4.8 kg/ha). However, with respect to plant growth stimulation, concentrations of about 1 ppm to about 5,000 ppm, and as described in U.S. Patent No. 5,439,873 to Kinnersley are frequently employed. When reduction of plant stress is desired, concentrations of GABA of from about 1 ppm to about 2,500 ppm (about 0.013 oz/A to about 2J lbs/A) (about 0.93 g/ha to about 2.4 kg/ha) are typically employed, with about 150-600 ppm (about 1/8 lb/A to about 1/2 lb/A) (about 0J4 kg/ha to about 0.56 kg/ha) most frequently being employed. All amounts in ppm are on a weight/volume (g/ml) basis. Moreover, the application rates in brackets or parentheses above are derived for a treatment utilizing a standard volume of 100 gallons of the specified solutions dispersed over 1 acre.
In yet other embodiments, the plant, in addition to being treated with GABA, may also be treated with a composition that includes GABA and a GABA agonist. For example, plants may be treated with baclofen as well as other
GABA agonists known to the art, including, for example, cis-4-aminopent-2-enoic acid (CACA), imidazole-4-acetic acid (IAA) and 4,5,6,7-tetrahydroisoxazolo[5,4- c]pyridin-3-ol (THIP). Plants may also be treated with only a GABA antagonist, such as picrotoxin or bicuculline, or only a GABA agonist to regulate plant metabolism as desired. GABA, the GABA agonists or antagonists described are typically applied to the foliage of the plant but may also be administered as a soil drench. Furthermore, when plants are grown hydroponically, the compounds and compositions may be applied to the aqueous solution in which the plants are grown. The compositions are further preferably applied by spraying. Moreover, the compounds and compositions may also be applied as a seed treatment.
GABA, the GABA agonists or GABA antagonists described above are preferably combined with a carrier medium as known in the art. The compounds and compositions may, for example, be combined with water, such as tap water or with distilled water to which has been added selected minerals. Alternatively, the compositions of the present invention may be applied as a solid. In such a form, the solid is preferably applied to the soil.
The compositions may further include agricultural additives or formulation aids known to those skilled in the art. Such additives or aids may be used to ensure that the compositions disperse well in a spray tank, stick to or penetrate plant surfaces (particularly leaf or other foliage surfaces) as well as provide other benefits to the plant. For example, surfactants, dispersants, humectants, and binders may be used to disperse the compounds or compositions described herein in a spray tank as well as to allow the compound or compositions to adhere to and/or penetrate the plant surfaces.
Methods of regulating plant metabolism are also provided. Regulation of plant metabolism may include affecting nutrient utilization, such as nitrogen-assimilation, plant growth, plant productivity and increasing the plant's resistance to the effects of plant stress. For example, in one form, an inventive method includes introducing into a plant cell an antisense nucleotide sequence having a nucleotide sequence complementary to the nucleotide sequences provided herein, such as one that is complementary to a nucleotide sequence having at least about 70% identity, more preferably at least about 80% identity, most preferably at least about 90% identity to a length of nucleotides within the nucleotide sequence set forth in SEQ ID NO:1 or SEQ ID NO:2, preferably from nucleotide 1 to nucleotide 1305. The antisense nucleotide may have a length of about 30 to about 400 nucleotides, about 30 to about 800 nucleotides, about 30 to about 1400 nucleotides and about 30 to about 1800 nucleotides. In more preferred embodiments, the antisense nucleotide sequence is as long as the entire length of the nucleotide sequence set forth in SEQ ID NO:1 or SEQ ID NO:2. The antisense nucleotide sequence may hybridize to the template strand, which serves as the strand from which RNA is produced, so that transcription will be reduced. Alternatively, the antisense nucleotide sequence may be complementary to, and therefore hybridize to, the RNA sequence, such as the mRNA sequence, transcribed from the nucleotide sequences described herein, so that translation of the mRNA sequence to express the encoded protein, such as a GABA receptor, will be reduced. The antisense nucleotide sequence may be either DNA or RNA. Such antisense sequences may be produced as described above for the nucleotide sequences and by further methods known in the art. Nucleotide sequences having substantial similarity to the above-described antisense nucleotide sequences are also encompassed in the invention. In another form of a method of regulating plant metabolism, a method may include in vivo mutagenesis of the gene present in the plant genome encoding the plant GABA receptor protein described herein in order to alter its activity to provide the desired results. A plant may be mutated by methods known to the skilled artisan, including chemical methods and DNA-insertion mutagenesis. In another aspect of the invention, methods of modifying receptor activity in a plant are provided. In one form of the invention, a method includes introducing into a plant cell a nucleic acid molecule having a nucleotide sequence encoding a plant protein as described herein, such as a plant protein having an amino acid sequence having at least about 60% identity to the amino acid sequence set forth in SEQ ID NO:1 or SEQ ID NO:2.
In yet another aspect of the invention, methods of expressing plant proteins expected to function as GABA receptors as described above are provided. In one embodiment, the method includes providing a nucleotide sequence described above, or variants thereof, that encodes a protein described herein, and introducing the nucleotide sequence into a host cell, as described above. The desired nucleotide sequence may be advantageously incorporated into a vector to form a recombinant vector. The recombinant vector may then be introduced into a host cell according to known procedures in the art. Such host cells are then cultured under conditions, well known to the skilled artisan, effective to achieve expression of the plant protein. The protein may then be purified using conventional techniques. Reference will now be made to specific examples illustrating the invention described above. It is to be understood that the examples are provided to illustrate preferred embodiments and that no limitation to the scope of the invention is intended thereby.
EXAMPLE 1
Effect of GABA Agonists and Antagonists on Duckweed
GABA receptors in animals have been defined on the basis of their response to antagonists as described in Johnston, GAR (1997), Molecular
Biology, Pharmacology and Physiology of the GABAC Receptors, SJ Emna and NG Bowery Eds., The GABA Receptors, Humana Press. GABAA receptors are sensitive to the antagonist bicuculline and insensitive to the agonist baclofen and GABAB receptors are insensitive to bicuculline and sensitive to baclofen. GABAc receptors are insensitive to both bicuculline and baclofen. GABAc receptors are sensitive to the antagonist picrotoxin. Bicuculline is specific for GABAA and picrotoxin is specific for both GABAA and GABAc receptors.
Duckweed (Lemna Minor L) was grown following the general procedure described by Kinnersley (U.S. Patent No. 4,813,997) except that the culture media was Solu-Spray 20-20-20 fertilizer dissolved in tap water at 1 g/l and the pH was adjusted to 5.5 as discussed in U.S. Patent No. 5,439,873 to Kinnersley. Duckweed was treated with, independently, the indicated concentrations of baclofen [β-(aminomethyl)-4- chlorobenzenepropanoic acid] (FIG. 1 ), picrotoxin (cocculin) (FIG. 2), bicuculline ([R-(R*,S*)]-6-(5,6,7,8-tetrahydro-6-methyl-1 ,3-dioxolo[4,5- g]isoquinolin-5-yl)furo[3,4-e]-1 ,3-benzodioxol-8(6H)-one) (FIG. 2) or a mixture of GABA and baclofen (FIG. 3).
As seen in FIG. 1 , baclofen is active at promoting duckweed growth up to concentrations of about 1 mM. Moreover, as seen in FIG. 3, baclofen increases the growth-promoting effects of GABA when duckweed is treated with both GABA and baclofen. In contrast, the growth-promoting effects of GABA are completely inhibited when bicuculline or picrotoxin was added to the culture media. This shows that compounds which affect GABA that act through GABA receptors in animals behave the same way in plants.
As seen in FIG. 2, when duckweed, grown as above, was treated independently with bicuculline and picrotoxin, an inhibitory effect on growth was seen in the absence of GABA in the medium. This suggests that bicuculline and picrotoxin are having an effect on GABA that is being made by the plant.
The above results, taken together, provide evidence that GABA receptors exist in plants, as experiments with chemicals that promote or inhibit the activity of GABA receptors in animals have the same response in plants. As there is no published understanding of the role of GABA in plants, it is surprising that chemicals that effect the action of GABA receptors in animals have the same response in plants.
Additionally, the above results, taken together with the discovery of nucleotide sequences encoding a protein whose N-terminal region has homology to animal GABA receptors, provide even further evidence of the existence of GABA receptors in plants.
EXAMPLE 2 Isolation of a Full-length cDNA and Genomic DNA Protocol
Arabidopsis thaliana (L.) Heynh. Ecotype Columbia (Col-0) seeds were obtained from the Arabidopsis Biological Resource Center (Ohio State University, Columbus, OH). Arabidopsis seedlings were grown under aseptic conditions in flasks containing MS media [Murashige and Skook, Physiol Plant 15:485 (1962)] on a rotary shaker (150 rpm). Two-day-old seedlings were collected for total RNA isolation. Total RNA was isolated as described in Turano, F.J. et al.(1992) Plant Physiol. 100:374. Primers, 5'K/OGLR4Notl(5'GCCCGCGGCCGCATGGCGAAAGCAATCAGAGAGTT GTG-3') and 3'K/OGLR4Notl (5'GCCCGCGGCCGCTTAAGTAATTTCGCCATGTTGTGA-3') to GLR4, corresponding to GenBank ACC# AC000098, were commercially synthesized (Biosynthesis, Inc., Lewisville, TX) and used for RT-PCR reactions. For the RT-PCR, a 5' RACE system (Life Technologies, Rockville, MD) was used to identify a full-length cDNA clone. The primer, 3'K/OGLR4Notl was used to synthesize a first strand cDNA from 1 μg of poly (A+)RNA isolated from two-day-old plants following the manufacturers instructions. One-fifth of the first strand cDNA synthesis was used as a template in a gene amplification reaction with both primers, 5'K/OGLR4Noti and 3'K/OGLR4Notl. Prior to the amplification, the components were incubated at 95°C for 4 minutes. The gene amplification reaction was conducted at 94°C for 1 minute, 68°C for 1 minute and 72°C for 2 minutes, for 30 cycles followed by a 5 minute, 72°C extension.
Genomic DNA was isolated from leaves of 24 day old Arabidopsis as described in Turano, F.J. et al. (1992) Plant Physiol 100:374. For the PCR reaction, 250 ng of each primer (5"K/OGLR4Notl and 3'K/OGLR4Notl) was used with approximately 500 ng of genomic DNA. Prior to the amplification reaction, the components were incubated at 95°C for 10 minutes. The gene amplification reaction was conducted at 94°C for 1 minutes, 70°C for 1 minute and 72°C for 3 minutes, for 30 cycles followed by a 5 minute, 72°C extension.
Both the genomic DNA and cDNA fragments were cloned separately into PCR2J (Invitrogen Corp. Carlsbad, CA, USA) and sequenced using the Taq Dideoxy terminator cycle sequence (Applied Biosystems) method at the Center for Agricultural Biotechnology, University of Maryland, College Park, MD. The data were analyzed with MacVector software on a Power Macintosh 6500/250. Results
A full-length cDNA clone encoding a ligand-gated ion channel was identified from total RNA isolated from 2 day old Arabidopsis. The deduced amino acid sequence has high homology with 11 amino acid sequences derived from genomic sequences and three amino acid sequences deduced from full-length cDNA clones in Genbank. More specifically, the gene had homology to animal GABA receptors from nucleotides 1 to 1305 and had homology to animal glutamate receptors from nucleotide 1306 to the end of the sequence. The large family of putative ligand-gated ion channels from Arabidopsis have homology with genes encoding glutamate ionotropic receptor proteins (Glu R) and, in some cases GABA receptor proteins, in invertebrates and vertebrates. The gene encoded in the cDNA described herein was designated GLR4. Northern blot and RT-PCR analyses demonstrated that the GLR4 transcript is approximately 2.8 kb and is readily detected in 2 and 4 day-old Arabidopsis and in meristems of 21 day-old plants. The data suggest that the genes are expressed in tissues undergoing rapid cell division.
Although not being limited by theory, it is believed the GABA, GABA antagonists and GABA agonists will interact with the GABA-like domains at the N-terminal region of the plant ligand-gated ion channel described herein. This theory is supported by recent experimental findings that demonstrate the N-terminal domain of the animal GABA-BRs is sufficient to specify agonist and antagonist binding in GABA-BRs [Malitschek (1999) Mol. Pharmacol. 56(2):448-454]. Although the functions of all of the GLR genes are unknown, the presence of GLR genes, and genes having GABA receptor characteristics and glutamate receptor characteristics, in Arabidopsis provides molecular evidence for the biochemical machinery necessary for the transmission of electrical signals in higher plants.
EXAMPLE 3 Construction of an Antisense GLR4 Plant
The entire open reading frame for GLR4, or portions thereof as small as about 25 base pairs, can be cloned into a plant transformation vector, such as pBI121 (Clonetech, Palo Alto, CA) using PCR, RT-PCR or conventional cloning methods to make antisense constructs. Gene specific primers, 5'K/OGLR4Notl (5'-
GCCCGCGGCCGCATGGCGAAAGCAATCAGAGTTGTG-3') and 3'K/OGLR4Notl (5'- GCCCGCGGCCGCTTAAGTAATTTCGCCATGTTGTGA-3') (corresponding to GenBank GLR4, ACC # AC000098) can be commercially synthesized (Biosynthesis Inc., Lewisville, TX, USA) and used for PCR or RT-PCR reactions. For example the PCR reactions can use, 250 ng of each primer with approximately 500 ng of genomic DNA. Prior to the amplification reaction, the components can be incubated at
95°C for 2 min. The gene amplification reaction can be conducted at 94°C for 1 min, 65°C for 1 min and 72°C for 2 min, for 30 cycles followed by a 4 min 72°C extension. For the RT-PCR, a 5' RACE system (Life Technologies, Rockville, MD, USA) or a simpler reverse transcriptase (RT) based system, can be used to identify a full-length cDNA clone. The primer, 3'K/OGLR4Notl, can be used to synthesize first strand cDNA from 1 μg from poly (A+) RNA isolated from 2 d-old plants following the manufacturer's instructions. One fifth of the first strand cDNA synthesis can be used as a template in a gene amplification reaction with both primers, 5'K/OGLR4Notl and 3'K/OGLR4Notl. Prior to the amplification, the components can be incubation at 95°C for 2 min. The gene amplification reaction can be conducted at 94°C for 1 min, 58°C for 1 min and 72°C for 2 min, for 30 cycles followed by a 5 min 72°C extension.
The genomic DNA or cDNA fragments can be cloned into plant transformation vectors in an antisense (backwards) direction. The vectors may contain constitutive promoters such as CaMV 35S promoter and the nopaline synthase terminator. The vectors can be modified to include promoters that can be induced by biotic [Sohal et al.,(1999) Plant Mol. Biol. 41 :75-87] or abiotic stresss [Ngai et al., (1997) Plant J. 12:1021 -1034; van Der Krol et al., (1999) Plant Physiol. 121 :1 153-1 162; Kucho et al., (1999) Plant Physiol 121 : 1329-1338] and/or by hormones and other signaling molecules (Chen and Singh, (1999) Plant J. 19:667-677; Lu et al., (1998) J. Biol. Chem. 273:10120-10131 ; Leubner-Metzger et al., (1998) Plant Mol. Biol. 38:785-795. The orientation of the cloned constructs can be confirmed by restriction endonuclease and PCR analyses. Upon completion of cloning, the binary vector construct can be transferred into a disarmed strain of Agrobacterium tumefaciens, such as EHA105, and subsequently into Arabidopsis (Ws ecotype) using the vacuum infiltration method [Bechtold and Bouchez (1995) In planta Agrobacterium-mediated transformation of adult Arabidopsis thaliana plants by vacuum infiltration, in Gene Transfer to Plants, I. Potrykus and G. Spangenberg, Eds. (Springer-Verlag, Heidelberg) pp. 19-23] with one modification [i.e., the addition of 0.02% (v/v) Silwet to the infiltration media]. Seeds collected from the transformed plants can be germinated and selected for kanamycin resistance.
EXAMPLE 4
Evolutionary Origin of Glutamate and GABA Receptors
Parsimony and nearest neighbor analyses were used to examine evolutionary relationships between eight putative plant GLR sequences, the iGLRs and members of family 4 of the GPCRs, specifically the mGLRs and GABA-BRs (FIG. 4). The possibility of a recombination event during the evolutionary history of the loci was considered and, therefore, the analyses of the peptides were separated into two; comparing the approximate first one-third (N-terminal regions), and the last two-thirds (C- terminal regions) of the peptides separately. Experimental
The tree is one of four equally parsimonious trees generated from heuristic analysis (length = 6186 steps, consistency index = 0.649, retention index = 0.753, and rescaled consistency index = 0.488). A strict consensus tree generated from the four equally parsimonious trees was identical to the tree shown with the exception that hummglur7n was placed between hummglur6n and ratmglur4n. Support of the more important clades is indicated by bootstrap values using 500 permutations of the aligned data set. Ecoliginh was used as an outgroup. Similar results were obtained with nearest neighbor analyses (not shown). The abbreviations and accession numbers for the bacterial periplasmic binding proteins, animal iGLRs and plant GLRs (1 , 3, and 4) sequences are identical to those used by Chiu, J. et al. (1999) Mol. Biol. Evol. 16:826-838.
Results It was concluded that the amino acid sequences in the N-terminal regions of the plant GLRs are related to members of GPCRs (family 4 of the G-protein-coupled receptors) superfamily and not to members of the iGLRs. However, the C-terminal regions of the plant GLRs are related to members of the iGLRs superfamily and not to members of the GPCRs. Similar inferences were made from results comparing the entire peptide sequences (data not shown). The results from the present analysis of the C-terminal regions are in agreement with those of a recently published phylogenetic analysis [Chiu, J. et al. (1999) Mol. Biol. Evol. 16:826-838]. It can be concluded from the results of both the present study, along with the published study, that the C-terminal regions of the Arabidopsis GLRs and iGLRs evolved from a common ancestral locus that predated the divergence of animal kainate/AMPA and NMDA receptors. However, the analyses of the N-terminal regions herein support a different scenario. The N-terminal regions of the Arabidopsis GLRs are homologous to GABA-BRs and mGLRs, which are members of family 4 of the GPCRs. These loci share a common ancestry that predates the divergence of plants and animals.
Collectively, it was concluded that the iGLRs and the two members of family 4 of the GPCRs evolved from distinct regions of the GLRs prior to the divergence of the plant and animal kingdoms. Therefore, the ancestors to extant GLRs are the evolutionary progenitors to both the iGLRs and members of family 4 of the GPCRs, and thus represent a previously unidentified evolutionary link between the two superfamilies of receptors.
As seen in FIG. 5, an ancestral plant GLR evolves from a BPBP. The ancestral GLR evolves into plant GLRs, iGLRs and members of family 4 of the G-protein coupled receptors (GPCR-F4), via distinct evolutionary routes. The GLRs and iGLRs evolve by a series of point mutations and selection. An ancestral GPCR-F4 arose from a gene conversion or recombination event between the 5'-end of an ancestral plant GLR and a gene encoding for a peptide with seven-transmembrane domains (7- TMDP), perhaps a gene encoding for a GPCR-like protein. [Josefsson, L.G. et al., (1997) Eur. J. Biochem. 249:415-420; Plakidou-Dymock, S. et al. (1998) Curr. Biol. 8:315-324; Josefsson, LG. (1999) Gene 239:333-340]. The ancestral GPCR-F4 evolves into mGLRS and GABA-BRs by a series of point mutations and selection.
While the invention has been illustrated and described in detail in the drawings and foregoing description, the same is to be considered as illustrative and not restrictive in character, it being understood that only the preferred embodiment has been shown and described and that all changes and modifications that come within the spirit of the invention are desired to be protected. In addition, all references cited herein are indicative of the level of skill in the art and are hereby incorporated by reference in their entirety.

Claims

CLAIMSWhat is claimed is:
1. A method of transforming a plant, comprising introducing into a plant cell a nucleic acid molecule with a nucleotide sequence encoding a protein having an amino acid sequence having at least 60% identity to the amino acid sequence set forth in SEQ ID NO:1 or SEQ ID NO:2.
2. The method of claim 1 , wherein said nucleotide sequence is comprised of a nucleotide sequence having at least about 70% identity to the nucleotide sequence set forth in SEQ ID NO:1 or SEQ ID NO:2.
3. The method of claim 2, wherein said nucleotide sequence has at least about 70% identity to the nucleotide sequence set forth in SEQ ID
NO:1 from nucleotide 1 to nucleotide 1305.
4. The method of claim 1 , wherein said introduced nucleic acid molecule further comprises a foreign promoter operably linked to a terminal 5' end of said nucleotide sequence.
5. A method of identifying plant proteins, comprising hybridizing to plant nucleic acid a nucleic acid probe having a nucleotide sequence having at least about 70% identity to a nucleotide sequence set forth in SEQ ID NO:1 or SEQ ID NO:2 from nucleotide 1 to nucleotide 1305.
6. The method of claim 5, wherein said probe has a length of about 25 to about 800 nucleotides within the nucleotide sequence set forth in SEQ ID NO:1 or SEQ ID NO:2 from nucleotide 1 to nucleotide 1305.
7. A method of treating a plant, comprising: (a) providing a plant with an introduced nucleic acid molecule having a nucleotide sequence encoding a protein having an amino acid sequence having at least 60% identity to the amino acid sequence set forth in SEQ ID NO:1 or SEQ ID NO:2; and (b) treating the plant with an effective amount of GABA.
8. The method of claim 7, wherein said method includes expressing said nucleotide sequence prior to said treating step.
9. The method of claim 7, wherein said nucleotide sequence is comprised of a nucleotide sequence having at least about 70% identity to the nucleotide sequence set forth in SEQ ID NO:1 or SEQ ID NO:2.
10. The method of claim 9, wherein said nucleotide sequence has at least about 80% identity to the nucleotide sequence set forth in SEQ ID
NO:1 from nucleotide 1 to nucleotide 1305.
11. The method of claim 7, wherein said plant is treated with a composition that includes GABA and a GABA agonist.
12. The method of claim 1 1 , wherein said agonist is selected from the group consisting of baclofen, cis-4-aminopent-2-enoic acid, imidazole- 4-acetic acid and 4,5,6, 7-tetrahydroisoxazolo[5,4-c]pyridin-3-ol.
13. The method of claim 7, wherein said introduced nucleic acid molecule further comprises a foreign promoter operably linked to a terminal 5' end of said nucleotide sequence.
14. A method of regulating plant metabolism, comprising: (a) introducing into a plant cell an antisense nucleic acid molecule comprising a nucleotide sequence complementary to a nucleotide sequence having at least about 70% identity to the nucleotide sequence set forth in SEQ ID NO:1 or SEQ ID NO:2, or a nucleotide sequence complementary to an RNA sequence transcribed from said sequence.
(b) culturing said plant cell under conditions effective for hybridization of said antisense nucleotide sequence to nucleic acid of said plant.
15. The method of claim 14, wherein either of said nucleotide sequences are about 30 to about 1400 nucleotides in length.
16. The method of claim 14, wherein either of said nucleotide sequences are about 30 to about 800 nucleotides in length.
17. A method of expressing a plant protein, said method comprising:
(a) introducing into a plant cell an isolated nucleic acid molecule having a nucleotide sequence encoding a plant protein having an amino acid sequence having at least about 60% identity to the amino acid sequence set forth in SEQ ID NO:1 or SEQ ID NO:2; and (b) culturing under conditions to achieve expression of said protein.
18. The method of claim 17, wherein said nucleic acid molecule has a nucleotide sequence having at least about 70% identity to the nucleotide sequence set forth set forth in SEQ ID NO:1 or SEQ ID NO:2.
19. The method of claim 17, further comprising inserting said nucleotide sequence into a vector prior to said introducing step.
20. The method of claim 19, wherein said vector is a plasmid vector.
21. A method of modifying receptor activity in a plant, comprising introducing into a plant cell a nucleic acid molecule having a nucleotide sequence encoding a plant protein having an amino acid sequence having at least about 60% identity to the amino acid sequence set forth in SEQ ID NO:1 or SEQ ID NO:2.
22. An isolated nucleic acid molecule, comprising a nucleotide sequence consisting essentially of a protein-encoding nucleotide sequence, said nucleotide sequence encoding a plant protein having an amino acid sequence having at least about 60% identity to the amino acid sequence set forth in SEQ ID NO:1 or SEQ ID NO:2.
23. The molecule of claim 22, wherein said nucleotide sequence consists essentially of a protein-encoding nucleotide sequence having at least about 70% identity to the nucleotide sequence set forth in SEQ ID NO:1 or SEQ ID NO:2.
24. The molecule of claim 23, wherein said nucleotide sequence consists essentially of a protein-encoding nucleotide sequence having at least about 80% identity to the nucleotide sequence set forth in SEQ ID NO:1 o SEQ ID NO:2.
25. The molecule of claim 22, wherein said protein is comprised of an amino acid sequence having at least about 80% identity to the amino acid sequence set forth in SEQ ID NO:1 or SEQ ID NO:2.
26. A recombinant nucleic acid molecule, comprising
(a) a nucleotide sequence consisting essentially of a protein-encoding nucleotide sequence, said nucleotide sequence encoding a plant protein having an amino acid sequence having at least about 60% identity to the amino acid sequence set forth in SEQ ID NO:1 or SEQ ID NO:2; and
(b) a foreign promoter operably linked to a terminal 5' end of said nucleotide sequence.
27. The molecule of claim 26, wherein said nucleotide sequence is a cDNA sequence.
28. The molecule of claim 26, wherein said protein is comprised of an amino acid sequence having at least about 80% identity to the amino acid sequence set forth in SEQ ID NO:1 or SEQ ID NO:2.
29. The molecule of claim 26, wherein said promoter is selected from the group consisting of a constitutive promoter, an inducible promoter, and a cell-specific promoter.
30. A plant cell, comprising:
(a) an introduced nucleic acid molecule having a nucleotide sequence encoding a plant protein having an amino acid sequence having at least about 60% identity to the amino acid sequence set forth in SEQ ID NO:1 or SEQ ID NO:2; and
(b) a foreign promoter operably linked to a terminal 5' end of said nucleotide sequence.
31. The plant cell of claim 30, wherein said protein is comprised of an amino acid sequence having at least about 80% identity to the amino acid sequence set forth in SEQ ID NO:1 or SEQ ID NO:2.
32. The plant cell of claim 31 , wherein said protein is comprised of an amino acid sequence set forth in SEQ ID NO:1 or SEQ ID NO:2.
33. A transgenic plant, comprising:
(a) an introduced nucleic acid molecule encoding a plant protein having an amino acid sequence having at least about 60% identity to the amino acid sequence set forth in SEQ ID NO:1 or SEQ ID NO:2; and (b) a foreign promoter operably linked to a terminal 5' end of said nucleotide sequence.
34. The transgenic plant of claim 33, wherein said protein is comprised of an amino acid sequence having at least 80% identity to the amino acid sequence set forth in SEQ ID NO:1 or SEQ ID NO:2.
35. The transgenic plant of claim 33, wherein said protein is comprised of an amino acid sequence set forth in SEQ ID NO:1 or SEQ ID NO:2.
36. A recombinant protein, comprising a protein having an amino acid sequence having at least about 70% identity to the amino acid sequence set forth in SEQ ID NO:1 or SEQ ID NO:2.
37. The protein of claim 36, where said protein has an amino acid sequence having at least about 80% identity to the amino acid sequence set forth in SEQ ID NO:1 or SEQ ID NO:2.
38. The protein of claim 37, wherein said protein has an amino acid sequence having at least about 90% identity to the amino acid sequence set forth in SEQ ID NO:1 or SEQ ID NO:2.
EP00917697A 1999-03-02 2000-03-02 Plant ligand-gated ion channels Withdrawn EP1158849A4 (en)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US12250699P 1999-03-02 1999-03-02
US122506P 1999-03-02
PCT/US2000/005407 WO2000052137A2 (en) 1999-03-02 2000-03-02 Plant ligand-gated ion channels

Publications (2)

Publication Number Publication Date
EP1158849A2 true EP1158849A2 (en) 2001-12-05
EP1158849A4 EP1158849A4 (en) 2003-07-30

Family

ID=22403093

Family Applications (1)

Application Number Title Priority Date Filing Date
EP00917697A Withdrawn EP1158849A4 (en) 1999-03-02 2000-03-02 Plant ligand-gated ion channels

Country Status (8)

Country Link
EP (1) EP1158849A4 (en)
JP (1) JP2002541780A (en)
AU (1) AU776896B2 (en)
CA (1) CA2364596A1 (en)
IL (1) IL145233A0 (en)
MX (1) MXPA01008846A (en)
NZ (1) NZ514010A (en)
WO (1) WO2000052137A2 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104379746A (en) * 2012-08-13 2015-02-25 创世纪转基因技术有限公司 Cotton ion channel protein and coding genes and use thereof

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
IL159936A0 (en) * 2001-07-20 2004-06-20 Emerald Bioagriculture Corp Plant receptor proteins, methods for transforming plants using the same and plant cells containing the same
WO2004074431A2 (en) * 2003-01-20 2004-09-02 Emerald Bioagriculture Corporation Plant ion channels and related methods
CN107201399B (en) * 2017-05-16 2020-10-30 浙江海洋大学 Method for screening molecular markers associated with root growth of duckweed

Family Cites Families (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE4204103A1 (en) * 1992-02-12 1993-08-19 Hoechst Ag New gamma-amino butyric acid permease gene - for growth inhibition of microbial or plant cells or as selectable marker
US5487976A (en) * 1993-10-15 1996-01-30 Cornell Research Foundation, Inc. DNA encoding an insect gamma-aminobutyric acid (GABA) receptor subunit cells expressing it, and pesticide screening methods using such cells
US5840656A (en) * 1994-02-23 1998-11-24 Auxein Corporation Method for increasing fertilizer efficiency
US5439873A (en) * 1994-02-23 1995-08-08 Plant Growth Development Corporation Method for stimulating plant growth using GABA
US5767261A (en) * 1995-11-08 1998-06-16 Rhone -Poulenc Ag Company Lepidopteran GABA gated chloride channel and nucleic acids encoding subunits thereof

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
DATABASE GENEMBL [Online] 9 August 1999 (1999-08-09) MEYERHOFF,O. ET AL.: "Arabidopsis thaliana ligand-gated channel-like protein precursor (GLUR3) mRNA, complete cds." Database accession no. AF167355 XP002242841 *
See also references of WO0052137A2 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104379746A (en) * 2012-08-13 2015-02-25 创世纪转基因技术有限公司 Cotton ion channel protein and coding genes and use thereof
CN104379746B (en) * 2012-08-13 2017-08-18 创世纪种业有限公司 One cotton ion channel albuminoid and its encoding gene and application

Also Published As

Publication number Publication date
CA2364596A1 (en) 2000-09-08
MXPA01008846A (en) 2003-10-14
NZ514010A (en) 2004-02-27
EP1158849A4 (en) 2003-07-30
AU3863000A (en) 2000-09-21
AU776896B2 (en) 2004-09-23
IL145233A0 (en) 2002-06-30
WO2000052137A3 (en) 2001-02-15
JP2002541780A (en) 2002-12-10
WO2000052137A2 (en) 2000-09-08

Similar Documents

Publication Publication Date Title
US6441274B1 (en) Plant tryptophan synthase beta subunit
CN101883783A (en) Plants having enhanced yield-related traits and a method for making the same
US7692064B2 (en) Nitrogen transport metabolism
US7943753B2 (en) Auxin transport proteins
AU776896B2 (en) Plant ligand-gated ion channels
US6833492B2 (en) Nitrogen transport metabolism
US7485776B2 (en) Disease resistance factors
US20060008820A1 (en) Cell cycle genes in plants
WO2003007886A2 (en) Plant ion channels and methods
WO2004074431A2 (en) Plant ion channels and related methods
US7271318B2 (en) Plant genes encoding pantothenate synthetase
AU2002330901A1 (en) Plant ion channels and methods
US6916971B1 (en) Polynucleotides encoding aminolevulinic acid biosynthetic enzymes
US6583337B1 (en) Plant glucose-6-phosphate translocator
US6852910B1 (en) Plant recombination proteins
US6855867B1 (en) Plant glutamine amidotransferase homologs
EP1200568A2 (en) Purine metabolism genes in plants
MXPA00000336A (en) Methods and compositions for producing plants and microorganisms that express feedback insensitive threonine dehydratase/deaminase

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20011002

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE

AX Request for extension of the european patent

Free format text: AL;LT;LV;MK;RO;SI

RIC1 Information provided on ipc code assigned before grant

Ipc: 7C 07H 21/04 B

Ipc: 7C 12N 5/14 B

Ipc: 7A 01H 1/00 A

Ipc: 7C 07K 14/415 B

Ipc: 7C 12N 15/82 B

Ipc: 7C 12N 15/00 B

A4 Supplementary search report drawn up and despatched

Effective date: 20030618

17Q First examination report despatched

Effective date: 20031219

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20050920