CA2364596A1 - Plant ligand-gated ion channels - Google Patents

Abstract

Recombinant plant proteins that are expected to function as ligand gated ion-channel proteins, such as GABA receptor proteins, are provided, as are nucleotide sequences encoding these proteins. The invention also provides recombinant vectors including the nucleotide sequences encoding the proteins described herein. Further provided are plant host cells that include the recombinant vectors described herein, transgenic plants and methods of using the nucleotide and amino acid sequences described herein, including methods of treating plants, method of expressing the proteins described herein, methods of modifying receptor activity in a plant and methods of regulating plant metabolism.

Description

PLANT LIGAND-GATED ION CHANNELS
CROSS-REFERENCE TO RELATED APPLICATIONS
s The present application claims the benefit of U.S. Provisional Patent Application Serial Number 60/122,506, filed on March 2, 1999,which is hereby incorporated by reference in its entirety.
BACKGROUND OF THE INVENTION
to The amino acid ~aminobutyric acid (GABA) is the major neurotransmitter in the mammalian central nervous system. Such neurotransmitters generally function in regulating the conductance of ions across neuronal membranes, typically in regulating influx of ions into a cell.
For example, GABA is considered an inhibitory neurotransmitter which acts is to inhibit synaptic transmission in both vertebrate and invertebrate nervous systems. As another example, glutamate is an excitatory neurotransmitter that depolarizes the postsynaptic membrane and acts to promote synaptic transmission. Both GAGA and glutamate affect synaptic transmission by binding to their respective receptors, also known as ligand-gated ion 2o channels.
These ligand-gated ion channels are present in neurons of insects and animals. Three general classes of GABA receptors, denoted GABAA, GABAB and GABAc, are present in animal neurons. GABA receptors have been implicated in mediating anxiety, seizures, cognitive function, addictive 2s disorders, sleep disorders and other disorders of the central nervous system. GABA receptors are the target of many pharmaceutical preparations which act on the central nervous system, including barbiturates and benzodiazepenes, and thus have therapeutic value.
Furthermore, compounds which affect the function of insect GABA
30 - receptors are commercially useful as insecticides.

Although GABA receptors have been found in insects and in the animal kingdom, they have yet to be discovered in the plant kingdom.
However, GABA has been shown to exert certain beneficial effects on plants. For example, GABA has been shown to increase plant growth and s productivity as shown in U.S. Patent No. 5,439,873 to Kinnersley.
Moreover, such beneficial effects have been increased when GABA is applied to plants along with a readily metabolized source of carbon, such as succinic acid (U.S. Patent No. 5,604,177). Moreover, GABA has been found to increase fertilizer efficiency when administered with glutamic acid to as described in U.S. Patent No. 5,840,656 to Kinnersley et al.
The mechanism of the above-described beneficial results of GABA
in plants has not yet been confirmed. A better understanding of the mechanism of GABA-mediated plant growth and productivity may lead to further methods for improving plant growth, productivity, and other Is beneficial effects.

SUMMARY OF THE INVENTION
Nucleotide sequences expected to encode ligand-gated ion channel proteins, such as glutamate and/or GABA receptor proteins, have been discovered in plants. Accordingly, the present invention provides these s purified plant proteins, including recombinant proteins, nucleotide sequences encoding the proteins and methods of using the nucleotide sequences and proteins.
In one aspect of the invention, methods of transforming a plant are provided. In one form of the invention, a method includes introducing into a io plant cell a nucleic acid molecule encoding a plant protein described herein.
In a second aspect of the invention, methods of treating a plant are provided that include providing a plant having an introduced nucleotide sequence encoding a plant protein described herein and treating the plant is with an effective amount of GABA. The plant may further be treated with a composition including GABA and a GABA agonist or may be treated only with a GABA antagonist or GABA agonist.
In a third aspect of the invention, methods of regulating plant metabolism include utilizing antisense DNA or RNA to reduce formation of 2o a plant protein or RNA transcript, such as a mRNA transcript. In one embodiment, the method includes introducing into a plant cell an antisense nucleic acid molecule having a nucleotide sequence that is complementary to the nucleotide sequences described herein, or portions thereof, that is expected to encode a plant GABA receptor. Alternatively, the antisense 2s nucleic acid molecule includes a nucleotide sequence complementary to an RNA sequence, preferably a mRNA sequence, transcribed from the sequences described herein. The antisense nucleotide sequence hybridizes to nucleic acid, including either the template strand or the RNA
transcript, of the plant to reduce formation of a plant protein described 3o herein.

In a fourth aspect of the invention, methods of identifying potential plant receptors are provided that include hybridizing to plant nucleic acid a probe having a nucleotide sequence encoding the proteins described herein.
In a fifth aspect of the invention, methods of expressing plant proteins described herein are provided. In one embodiment, a method includes introducing into a host cell a nucleotide sequence expected to encode a plant GABA receptor described herein and culturing under conditions to achieve expression of the protein receptor.
io In further embodiments, isolated nucleic acid molecules, including recombinant nucleic acid molecules, are provided that include nucleotide sequences encoding plant proteins as described herein. Plant host cells and transgenic plants are also provided that include nucleotide sequences encoding the plant proteins described herein. The molecules, plant cells is and transgenic plants further may include a foreign promoter sequence operably linked to a terminal 5' end of the plant nucleotide sequences described herein.

BRIEF DESCRIPTION OF THE FIGURES
FIG. 1 depicts a graph showing the effect of baclofen, a GABA
agonist, on duckweed growth as more fully described in example 1.
s FIG. 2 depicts a graph showing the effect of GABA antagonists picrotoxin and bicuculline on duckweed growth as more fully described in example 1.
io FIG. 3 depicts a graph showing the effect of GABA agonists and antagonists on GABA-mediated growth promotion in Duckweed as more fully described in example 1. BFN, baclofen; PIC, picrotoxin; 4-AB, y aminobutyric acid.
is FIG. 4 depicts the phylogeny of bacterial periplasmic binding proteins and eukaryotic receptors based on parsimony analysis of the N-terminal (approximately one-third) amino acid sequences. Sequences included in the phylogentic reconstruction were a bacterial periplasmic binding protein, the animal ionotropic glutamate (iGLR), metabotropic 2o glutamate (mGLR), and 'y aminobutyric acids (GABA-BR) receptors, and putative plant glutamate receptors (GLR). Lower case n designates N-terminal sequences from amino acid residues 80 to 320. The abbreviations and accession numbers for the mGLRs, GABA-BRs and the remaining plant GLRs are as follows: human metabotropic glutamate receptor 1 alpha 2s (hummgluri alpn, ACC# U31215), human metabotropic glutamate receptor 1 beta (hummglurl betn, ACC# U31216), human glutamate receptor, metabotropic 5 (hummglur5n, ACC# NM000842), rat metabotropic glutamate receptor mGIuR5 (ratmglur5n, ACC# D10891 ), human glutamate receptor, metabotropic 2 (hummglur2n, ACC# NM000839), human 3o glutamate receptor, metabotropic 3 (hummglur3n, ACC# NM000840), human glutamate receptor, metabotropic 8 (hummglur8n, ACC# U92459), mouse metabotropic glutamate receptor 8 (mousemglur8n, ACC# U17252), human metabotropic glutamate receptor 7 (hummglur7n, ACC# U92458), human metabotropic glutamate receptor 4 (hummglur4n, ACC# U92457), rat metabotropic glutamate receptor 4 (ratmglur4n, ACC# M90518), human s glutamate receptor, metabotropic 6 (hummglur6n, ACC# NM 000843), human GABAB receptor subunit 1 a (humGABA-BR1 an, ACC# AJ012185), rat GABAB receptor subunit 1 a (ratGABA-B1 an, ACC# Y10369), human GABAB receptor subunit 1 b (humGABA-BR1 bn, ACC# AJ012186), rat GABAB receptor subunit 1 b (ratGABA-B1 bn, ACC# Y10370), human io GABAB receptor subunit 2 (humGABA-BR2n, ACC# AJ012188), rat GABA-B R2 receptor (ratGABA-br2n2, ACC# AJ011318), rat GABA-B R2 receptor (ratGABA-br2nl, ACC# AF07442), Arabidopsis putative glutamate receptor 2a (glr2an, ACC# AF079999), Arabidopsis putative glutamate receptor 2b (glr2bn, ACC# AF038557), Arabidopsis putative glutamate receptor 5 is (glr5n, ACC# AL022604), Arabidopsis putative glutamate receptor 6 (glr6n, ACC# AL022604), and Arabidopsis putative glutamate receptor 7 (glr7n, ACC# AL031004). Other abbreviations are as defined in Chiu, J. et al.
( 1999) Mol. Biol. Evol. 16:826-838.
2o FIG. 5 shows a proposed evolutionary history of the bacterial periplasmic binding proteins (BPBP), plant glutamate receptor (GLRs), animal ionotropic glutamate (iGLR), metabotropic glutamate (mGLR), and gamma-aminobutyric acide (GABA-BR) receptor genes as discussed in example 4. 7-TMDP,a gene encoding a peptide with seven 2s transmembrane domains; GPCR-F4, family 4 of the G protein -coupled receptors.

DESCRIPTION OF THE PREFERRED EMBODIMENTS
For the purposes of promoting an understanding of the principles of the invention, reference will now be made to preferred embodiments and s specific language will be used to describe the same. It will nevertheless be understood that no limitation of the scope of the invention is thereby intended, such alterations and further modifications of the invention, and such further applications of the principles of the invention as illustrated herein, being contemplated as would normally occur to one skilled in the art to to which the invention relates.
A nucleotide sequence has been found in Arabidopsis thaliana that is expected to encode a plant GABA receptor protein. Accordingly, the present invention provides purified GABA receptor proteins. The invention further provides isolated nucleic acid molecules that include nucleotide is sequences encoding plant GABA receptor proteins. Recombinant nucleic acid molecules, plant host cells and transgenic plants are also provided that include the nucleotide sequences encoding the plant GABA receptor proteins. In other aspects of the invention, methods of expressing a protein, such as a GABA receptor protein, and methods of using the 2o nucleotide and amino acid sequences described herein are also provided.
In a first aspect of the invention, purified plant proteins expected to function as ligand-gated ion channel proteins in plants, such as GABA
receptor proteins, and therefore having the ability to regulate cellular ion influx, are provided. The polypeptide receptors are substantially pure (i.e., 2s the protein receptors are essentially free, e.g., at least about 95% free, from other proteins with which they naturally occur). In preferred embodiments, the amino acid sequence of a protein expected to function as a ligand-gated ion channel protein in a plant, originally found in Arabidopsis thaliana, is set forth in SEQ ID N0:1 or SEQ ID N0:2.
3o Although the invention is described with reference to Arabidopsis thaliana amino acid sequences, it is understood that the invention is not limited to the specific amino acid sequences set forth in SEQ ID NO:1 or SEQ ID N0:2. Skilled artisans will recognize that, through the process of mutation and/or evolution, polypeptides of different lengths and having differing constituents, e.g., with amino acid insertions, substitutions, s deletions, and the like, may arise that are related to, or sufficiently similar to, a sequence set forth herein by virtue of amino acid sequence homology and advantageous functionality as described herein. The term "GABA
receptor protein" is used herein to refer generally to a protein having the features described herein and preferred examples include polypeptides io having the amino acid sequences set forth in SEQ ID N0:1 or SEQ ID
N0:2. Further included within this definition, and in the scope of the invention, are variants of the polypeptide which function in regulating ion movement into a cell, as described herein. Preferred proteins are recombinant proteins.
is It is well known that plants of a wide variety of species commonly express and utilize homologous proteins, which include the insertions, substitutions and/or deletions discussed above, and yet which effectively provide similar function. For example, an amino acid sequence isolated from another species may differ to a certain degree from the sequences set 2o forth in SEQ ID NOS:1 and 2, and yet have similar functionality with respect to catalytic and regulatory function. Amino acid sequences comprising such variations are included within the scope of the present invention and are considered substantially or sufficiently similar to a reference amino acid sequence. Although not being limited by theory, it is believed that the 2s identity between amino acid sequences that is necessary to maintain proper functionality is related to maintenance of the tertiary structure of the polypeptide such that specific interactive sequences will be properly located and will have the desired activity. Although it is not intended that the present invention be limited by any theory by which it achieves its 3o advantageous result, it is contemplated that a polypeptide including these WO 00/52137 PCT/iJS00/05407 interactive sequences in proper spatial context will have good activity, even where alterations exist in other portions thereof.
In this regard, a variant of the proteins described herein is expected to be functionally similar to that set forth in SEQ ID N0:1 or SEQ ID N0:2, s for example, if it includes amino acids which are conserved among a variety of plant species or if it includes non-conserved amino acids which exist at a given location in another plant species that expresses the proteins described herein.
Another manner in which similarity may exist between two amino to acid sequences is where a given amino acid of one group (such as a non-polar amino acid, an uncharged polar amino acid, a charged polar acidic amino acid or a charged polar basic amino acid) is substituted with another amino acid from the same amino acid group. For example, it is known that the uncharged polar amino acid serine may commonly be substituted with is the uncharged polar amino acid threonine in a polypeptide without substantially altering the functionality of the polypeptide. Whether a given substitution will affect the functionality of the enzyme may be determined without undue experimentation using synthetic techniques and screening assays known in the art.
2o The invention therefore also encompasses amino acid sequences similar to the amino acid sequences set forth herein that have at least about 60% identity thereto that preferably function in regulating cellular ion influx. Preferably, inventive amino acid sequences have at least about 70% identity, further preferably at least about 80% identity, and most 2s preferably at least about 90% identity to these sequences.
Percent identity may be determined, for example, by comparing sequence information using the MacVector computer program, version 6Ø1, available from Oxford Molecular Group, Inc. (Beaverton, OR).
Briefly, the MacVector program defines identity as the number of identical 3o aligned symbols (i.e., nucleotides or amino acids), divided by the total number of symbols in the shorter of the two sequences. The program may be used to determine percent identity over the entire length of the proteins being compared. Preferred default parameters for the MacVector program include: for pairwise alignment: (1 ) matrix = BLOSUM30; (2) Alignment speed - fast; (3) Ktuple = 1; (4) Gap penalty = 1; Top diagonals = 5;
s Window size = 5; for multiple alignment: matrix = BLOSUM series, open gap penalty = 10; extended gap penalty = 0.1, delay divergent = 40%;
protein gap parameters: Gap separation distance = 8; residue-specific penalties = yes or on; hydrophilic residues = GPSNDQEKR.
In another aspect of the invention, isolated nucleic acid molecules, to originally isolated from Arabidopsis thaliana, are provided that encode a protein as described herein. The nucleotide sequences are set forth in SEQ ID NOS:1 and 2, and sequences complementary to the specific sequences shown therein are also encompassed in the invention. It is preferred that the nucleotide sequence includes nucleotides spanning is nucleotides 1 to 1305, 180 to 1050 or 240 to 960 in SEQ ID NO:1 or SEQ
ID N0:2, or sequences having substantial similarity thereto or the selected percent identities thereto as described below, as these regions have homology to GABA receptor domains in animal GABA receptors. In one form of the invention, an isolated nucleic acid molecule is provided that has 2o a nucleotide sequence encoding a protein having an amino acid sequence having at least about 60%, preferably at least about 70%, more preferably at least about 80% and most preferably at least about 90% identity to an amino acid sequence set forth in SEQ ID N0:1 or SEQ ID N0:2, or to an amino acid sequence that includes amino acid 1 to amino acid 435, amino 2s acid 60 to amino acid 350, and amino acid 80 to amino acid 320 in SEQ ID
N0:1 or SEQ ID N0:2. It is not intended that the present invention be limited to these exemplary nucleotide sequences, but include sequences having substantial similarity thereto and sequences which encode variant forms of the plant proteins described herein as discussed above and as 3o further discussed below.

The term "isolated nucleic acid," as used herein, is intended to refer to nucleic acid which is not in its native environment. For example, the nucleic acid is separated from other contaminants that naturally accompany it, such as proteins, lipids and other nucleic acid sequences. The term s includes nucleic acid which has been removed or purified from its naturally-occurring environment or clone library, and further includes recombinant or cloned nucleic acid isolates and chemically synthesized nucleic acid.
The term "nucleotide sequence," as used herein, is intended to refer to a natural or synthetic linear and sequential array of nucleotides and/or to nucleosides, including deoxyribonucleic acid, ribonucleic acid, and derivatives thereof. The terms "encoding" and "coding" refer to the process by which a nucleotide sequence, through the mechanisms of transcription and translation, provides the information to a cell from which a series of amino acids can be assembled into a specific amino acid sequence to is produce a functional polypeptide, such as, for example, an active enzyme or other protein that has a specific function. The process of encoding a specific amino acid sequence may involve DNA sequences having one or more base changes (i.e., insertions, deletions, substitutions) that do not cause a change in the encoded amino acid, or which involve base changes 2o which may alter one or more amino acids, but do not eliminate the functional properties of the polypeptide encoded by the DNA sequence.
It is therefore understood that the invention encompasses more than the specific exemplary nucleotide sequence encoding the proteins described herein. For example, nucleic acid sequences encoding variant 2s amino acid sequences, as discussed above, are within the scope of the invention. Modifications to a sequence, such as deletions, insertions, or substitutions in the sequence, which produce "silent" changes that do not substantially affect the functional properties of the resulting polypeptide molecule are expressly contemplated by the present invention. For 3o example, it is understood that alterations in a nucleotide sequence which reflect the degeneracy of the genetic code, or which result in the production of a chemically equivalent amino acid at a given site, are contemplated.
Thus, a codon for the amino acid alanine, a hydrophobic amino acid, may be substituted by a codon encoding another less hydrophobic residue, such as glycine, or a more hydrophobic residue, such as valine, leucine, or s isoleucine. Similarly, changes which result in substitution of one negatively charged residue for another, such as aspartic acid for glutamic acid, or one positively charged residue for another, such as lysine for arginine, can also be expected to produce a biologically equivalent product.
Nucleotide changes which result in alteration of the N-terminal and to C-terminal portions of the encoded polypeptide molecule would also not generally be expected to alter the activity of the polypeptide. In some cases, it may in fact be desirable to make mutations in the sequence in order to study the effect of alteration on the biological activity of the polypeptide. Each of the proposed modifications is well within the routine is skill in the art.
In one preferred embodiment, the nucleotide sequence has substantial similarity to the entire sequence set forth in SEQ ID N0:1 or SEQ ID N0:2, and preferably the sequence spanning nucleotides 1 to 1305 in SEQ ID N0:1 or SEQ ID N0:2, and variants described herein. The term 20 "substantial similarity" is used herein with respect to a nucleotide sequence to designate that the nucleotide sequence has a sequence sufficiently similar to a reference nucleotide sequence that it will hybridize therewith under moderately stringent conditions. This method of determining similarity is well known in the art to which the invention pertains. Briefly, 2s moderately stringent conditions are defined in Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd ed. Vol. 1, pp. 101-104, Cold Spring Harbor Laboratory Press (1989) as including the use of a prewashing solution of 5X SSC (a sodium chloride/sodium citrate solution), 0.5%
sodium dodecyl sulfate (SDS), 1.0 mM ethylene diaminetetraacetic acid 30 (EDTA) (pH 8.0) and hybridization and washing conditions of 55°C, 5x SSC. A further requirement of the inventive polynucleotide is that it must encode a polypeptide having similar functionality to the plant proteins described herein.
In yet another embodiment, nucleotide sequences having selected percent identities to specified regions of the nucleotide sequence set forth s in SEQ ID N0:1 or SEQ ID N0:2 are provided. In one preferred form, nucleotide sequences are provided that have at least about 70% identity, more preferably at least about 80% identity, and most preferably at least about 90% identity, to a nucleotide sequence of substantial length within the nucleotide set forth in either SEQ ID N0:1 or SEQ ID N0:2. For to example, such length may be no more than about 100, 200, 300, 800, 900 or 1400 nucleotides, or may be the entire sequence. In certain forms of the invention, the nucleotide sequences have the percent identities mentioned above to a nucleotide sequence spanning nucleotides 1 to 1305, 180 to 1050 or 240 to 960 as discussed above. A further requirement is that the is nucleotide sequence set forth in SEQ ID N0:1 and SEQ ID N0:2 encodes a protein that functions as described herein, i.e., one expected to regulate ion influx into plant cells. Candidate ions whose entry may be regulated include anions, such as chloride and cations, such as calcium, sodium, and potassium. The percent identity may be determined, for example, by ao comparing sequence information using the MacVector program, as described above with reference to amino acid identity. Preferred default parameters include: (1 ) for pairwise alignment parameters: (a) Ktuple = 1;
(b) Gap penalty = 1; (c) Window size = 4; and (2) for multiple alignment parameters: (a) Open gap penalty = 10; (b) Extended gap penalty = 5; (c) 2s Delay divergent = 40%; and (d) transitions = weighted.
A suitable DNA sequence may be obtained by cloning techniques using cDNA or genomic libraries of Arabidospis thaliana which are available commercially or which may be constructed using standard methods known in the art. Suitable nucleotide sequences may be isolated 3o from DNA libraries obtained from a wide variety of species by means of nucleic acid hybridization or polymerase chain reaction (PCR) procedures, using as probes or primers nucleotide sequences selected in accordance with the invention, such as those set forth in SEQ ID N0:1 and SEQ ID
N0:2, nucleotide sequences having substantial similarity thereto, or portions thereof. In preferred forms of the invention, the nucleotide s sequences provided herein are cDNA sequences.
Alternately, a suitable sequence may be made by techniques which are well known in the art. For example, nucleic acid sequences encoding a plant protein described herein may be constructed by recombinant DNA
technology, for example, by cutting or splicing nucleic acids using to restriction enzymes and DNA ligase. Furthermore, nucleic acid sequences may be constructed using chemical synthesis, such as solid-phase phosphoramidate technology, or PCR. PCR may also be used to increase the quantity of nucleic acid produced. Moreover, if the particular nucleic acid sequence is of a length which makes chemical synthesis of the entire is length impractical, the sequence may be broken up into smaller segments which may be synthesized and ligated together to form the entire desired sequence by methods known in the art.
In a further aspect of the invention, recombinant nucleic acid molecules, or recombinant vectors, are provided. In one embodiment, the 2o nucleic acid molecules include a nucleotide sequence encoding a protein described herein. The nucleotide sequence has selected percent identities described herein, or substantial similarity, both as defined above, to the nucleotide sequence set forth in SEQ ID N0:1 or SEQ ID N0:2, preferably the sequence spanning nucleotides 1 to 1305, 180 to 1050 or 240 to 960 in 2s SEQ ID N0:1 or SEQ ID N0:2. The protein produced has the amino acid sequence set forth in SEQ ID N0:1, SEQ ID N0:2, or variants thereof as described above.
A wide variety of vectors are known that have use in the invention.
For example, various plasmid and phage vectors are known that are ideally 3o suited for use in the invention, including AZap and pBluescript. In preferred embodiments, the vector may be a T-DNA vector. Representative T-DNA

vector systems are discussed in the following publications: An et al., (1986) EMBO J. 4:277; Herrera-Estrella et al., (1983) EMBO J. 2:987;
Herrera-Estrella et al., (1985) in Plant Genetic Engineering, New York:
Cambridge University Press, p. 63.
s In one embodiment, the desired recombinant vector may be constructed by ligating DNA linker sequences to the 5' and 3' ends of the desired nucleotide insert, cleaving the insert with a restriction enzyme that specifically recognizes sequences present in the linker sequences and the desired vector, cleaving the vector with the same restriction enzyme, to mixing the cleaved vector with the cleaved insert and using DNA ligase to incorporate the insert into the vector as known in the art.
The vectors may include other nucleotide sequences, such as those encoding selectable markers, including those for antibiotic resistance or color selection. The vectors also preferably include a promoter nucleotide is sequence. The desired nucleic acid insert is preferably operably linked to the promoter. A nucleic acid is "operably linked" to a another nucleic acid sequence, such as a promoter sequence, when it is placed in a specific functional relationship with the other nucleic acid sequence. The functional relationship between a promoter and a desired nucleic acid insert typically zo involves the nucleic acid and the promoter sequences being contiguous such that transcription of the nucleic acid sequence will be facilitated. Two nucleic acid sequences are further said to be operably linked if the nature of the linkage between the two sequences does not (1 ) result in the introduction of a frame-shift-mutation; (2) interfere with the ability of the 2s promoter region sequence to direct the transcription of the desired nucleotide sequence, or (3) interfere with the ability of the desired nucleotide sequence to be transcribed by the promoter sequence region.
Typically, the promoter element is generally upstream (i.e., at the 5' end) of the nucleic acid insert coding sequence.
so A wide variety of promoters are known in the art, including cell-specific promoters, inducible promoters, and constitutive promoters. Any promoter that directs transcription in plants cells may be used. The promoters may be of viral, bacterial or eukaryotic origin, including those from plants and plant viruses. For example, in certain preferred embodiments, the promoter may be of viral origin, including a cauliflower s mosaic virus promoter (CaMV), such as CaMV 35S or 19S, a figwort mosaic virus promoter (FMV 35S), or the coat protein promoter of tobacco mosaic virus (TMV). The promoter may further be, for example, a promoter for the small subunit of ribulose-1,3-diphosphate carboxylase.
Promoters of bacterial origin include the octopine synthase promoter, the to nopaline synthase promoter and other promoters derived from native Ti plasmids as discussed in Herrera-Estrella et al., Nature, 303:209-213 (1983).
The promoter may further be one that responds to various forms of environmental stresses, or other stimuli. For example, the promoter may is be one induced by abiotic stresses such as wounding, cold, dessication, ultraviolet-B [van Der Krol et al. (1999) Plant Physiol. 121:1153-1162], heat shock (Shinmyo et al., (1998) Biotechnol. Bioeng. 58:329-332] or other heat stress, drought stress or water stress. The promoter may further be one induced by biotic stresses including pathogen stress, such as stress 2o induced by a virus (Sohal et al. (1999) Plant Mol. Biol. 41:75-87] or fungi [Eulgem (1999) EMBO. J. 18:4689-4699], stresses induced as part of the plant defense pathway [Lebel (1998) Plant J. 16:223-233] or by other environmental signals, such as light [Ngai et al. (1997) Plant J. 12:1021-1034; Sohal et al. (1999) Plant Mol. Biol. 41:75-87], carbon dioxide [Kucho 2s et al. (1999) Plant Physiol 121:1329-1338], hormones or other signaling molecules such as auxin, hydrogen peroxide and salicylic acid [Chen and Singh (1999) Plant J. 19:667-677], sugars and gibberellin [Lu et al. (1998) J. Biol. Chem. 273:10120-10131 ] or abscissic acid and ethylene [Leubner-Metzger et al. (1998) Plant Mol. Biol. 38:785-795].
3o The promoters may further be selected such that they require activation by other elements known in the art, so that production of the protein encoded by the nucleic acid sequence insert may be regulated as desired. Preferred promoters are foreign promoters. A "foreign promoter"
is defined herein to mean a promoter other than the native, or natural, promoter which promotes transcription of a length of DNA.
s The vectors may further include other regulatory elements, such as enhancer sequences, which cooperate with the promoter to achieve transcription of the nucleic acid insert coding sequence. By "enhancer" is meant nucleotide sequence elements which can stimulate promoter activity in a cell, such as a plant host cell. The vectors may further include 3' to regulatory sequence elements known in the art, such as those, for example, that increase the stability of the RNA transcribed.
Moreover, the vectors may include another nucleotide sequence insert that encodes a peptide or polypeptide used as a tag to aid in purification of the desired protein encoded by the desired nucleotide is sequence. The additional nucleotide sequence is positioned in the vector such that a fusion, or chimeric, protein is obtained. For example, a protein described herein may be produced having at its C-terminal end linker amino acids, as known in the art, joined to the other protein that acts as a tag. After purification procedures known to the skilled artisan, the Zo additional amino acid sequence is cleaved with an appropriate enzyme.
The protein may then be isolated from the other proteins, or fragments thereof, by methods known in the art.
The inventive recombinant vectors may be used to transform a host cell. Accordingly, methods of transforming a plant are provided that include 2s introducing into a plant cell a nucleic acid molecule having a nucleotide sequence as described herein, such as one, for example, that encodes a protein having at least about 60% identity to the amino acid sequence set forth in SEQ ID N0:1 or SEQ ID N0:2. Methods of transforming a plant are well known in the art, and may be found in references including, for 3o example, Maniatis et al., Molecular Cloning: A Laboratory Manual, Cold Springs Laboratory, Cold Springs Harbor, New York (1982) and Current Protocols in Molecular Biology, John Wiley and Sons, edited by Ausubel et al. (1988). Plant gene transfer techniques may also be found in references including Fromm et al., (1985) Proc. Natl. Acad. Sci. USA , 82:5824-5828 (lipofection); Crossway et al., (1986) Mol. Gen. Genet. 202:179 s (microinjection); Hooykaas-Van Slogtern et al., (1984) Nature 311:763-764)(T-DNA mediated transformation of monocots); Rogers et al., (1986) Methods EnzymoL 118:627-641 (T-DNA mediated transformation of dicots); Bevan et al., (1982) Ann. Rev. Genet. 16:357-384) (T-DNA
mediated transformation of dicots); Klein et al., (1988) Proc. Natl. Acad. Sci to USA 85:4305-4309 (microprojectile bombardment); and Fromm et al., Nature (1986) 319:791-793 (electroporation). Once the desired nucleic acid has been introduced into the host cell, the host cell may produce the protein, or variants thereof, as described above. Accordingly, in yet another aspect of the invention, a host cell is provided that includes the is inventive recombinant vectors described above.
A wide variety of host cells may be used in the invention, including prokaryotic and eukaryotic host cells. Preferred host cells are eukaryotic and are further preferably plant cells, such as, for example, those derived from monocotyledons, such as duckweed, corn, turf (including rye grass, 2o Bermuda grass, Blue grass, Fescue), dicotyledons, including lettuce, cereals such as wheat, crucifers (such as rapeseed, radishes and cabbage), solanaceae (including green peppers, potatoes and tomatoes), and legumes such as soybeans and bush beans. In a further aspect of the invention, the host cells may be cultured as known in the art to produce a 2s transgenic plant.
In another aspect of the invention, methods of identifying plant proteins, such as those expected to be GABA receptors, are provided. In these methods, nucleotide sequences described above, and preferably portions thereof, may be used as probes to locate other, similar nucleotide 3o sequences that may encode other GABA receptors. General methods for screening for selected nucleotide sequences in a DNA or RNA sample are known to the art. For example, DNA may be isolated from selected plants, treated with various restrictions enzymes and analyzed by Southern blotting techniques utilizing a radioactively or fluorescently-labeled probe of interest. RNA fragments may be similarly analyzed by Northern blotting s techniques. Alternatively, commercially available cDNA or genomic libraries may be screened.
In a preferred embodiment, a probe nucleic acid molecule having a nucleotide sequence having at least about 70% identity to a nucleotide sequence having a length of about 25 to about 100 nucleotides, preferably l0 25 to about 400, and further preferably about 25 to about 800, and about 25 to about 1000 nucleotides within the nucleotide sequence set forth in SEQ ID N0:1 or SEQ ID N0:2, preferably from nucleotide 1 to nucleotide 1305, may be used as a probe. In more preferred embodiments, the probe encompasses the length of nucleotides from nucleotide 1 to nucleotide is 1305 in SEQ ID N0:1 or SEQ ID N0:2, but may also encompass the entire length of nucleotides set forth in SEQ ID N0:1 or SEQ ID N0:2. In other embodiments, the probe has a nucleotide sequence having at least about 80% identity, most preferably at least about 90% identity, to the length of nucleotides indicated directly above. The probe may be radioactively 20 labeled at its 5'end, for example, with polynucleotide kinase and 32P and hybridized to the isolated nucleic acid fragments.
In another aspect of the invention, methods of treating a plant are provided. In one embodiment, a method includes providing a plant having an introduced nucleic acid molecule described herein, such as one having 2s at least about 70% identity to the sequence set forth in SEQ ID N0:1 or SEQ ID N0:2 that encodes a protein described herein, and treating the plant with an effective amount of GABA. The introduced nucleic acid molecule may include a promoter, preferably a foreign promoter, operably linked to a terminal 5' end of the nucleotide sequence so that the sequence 3o is expressed, typically prior to treating the plant with GABA. Such treating of the plant may stimulate growth of the plant, as well as provide other beneficial results, including reducing the effects of plant stress.
Transgenic plants may be prepared as described above and treated with an effective amount of GABA. The effective amount of GABA is s typically an amount of GABA that will provide some advantages to the plant, including stimulation of plant growth and reduction of plant stress.
This amount may vary depending on the particular advantage provided to the plant, the number of introduced nucleotide sequences expressed, the type of plant, and the number of plants treated. However, plants are to typically treated with about 1 ppm to about 24,000 ppm [about 0.013 oz/acre (oz/A) to about 20 Ibs/A] [about 0.93 g/hectare (g/ha) to about 22 kg/ha], about 1 ppm to about 12,000 ppm (about 0.013 oz/A to about 10 Ibs/A) (about 0.93 g/ha to about 11 kg/ha), about 1 ppm to about 7,500 ppm (about 0.013 oz/A to about 6.3 Ibs/A) (about 0.93 g/ha to about 7.1 is kg/ha) and about 1 ppm to about 5,000 ppm (about 0.013 oz/A to about 4.2 Ibs/A) (about 0.93 g/ha to about 4.8 kg/ha). However, with respect to plant growth stimulation, concentrations of about 1 ppm to about 5,000 ppm, and as described in U.S. Patent No. 5,439,873 to Kinnersley are frequently employed. When reduction of plant stress is desired, concentrations of 2o GABA of from about 1 ppm to about 2,500 ppm (about 0.013 oz/A to about 2.1 Ibs/A) (about 0.93 g/ha to about 2.4 kg/ha) are typically employed, with about 150-600 ppm (about 1/8 Ib/A to about 1/2 Ib/A) (about 0.14 kg/ha to about 0.56 kg/ha) most frequently being employed. All amounts in ppm are on a weight/volume (g/ml) basis. Moreover, the application rates in 2s brackets or parentheses above are derived for a treatment utilizing a standard volume of 100 gallons of the specified solutions dispersed over 1 acre.
In yet other embodiments, the plant, in addition to being treated with GABA, may also be treated with a composition that includes GABA and a GABA
3o agonist. For example, plants may be treated with baclofen as well as other GABA agonists known to the art, including, for example, cis-4-aminopent-2-enoic acid (CACA), imidazole-4-acetic acid (IAA) and 4,5,6,7-tetrahydroisoxazolo[5,4-c]pyridin-3-of (THIP). Plants may also be treated with only a GABA antagonist, such as picrotoxin or bicuculline, or only a GABA agonist to regulate plant metabolism as desired.
s GABA, the GABA agonists or antagonists described are typically applied to the foliage of the plant but may also be administered as a soil drench. Furthermore, when plants are grown hydroponically, the compounds and compositions may be applied to the aqueous solution in which the plants are grown. The compositions are further preferably to applied by spraying. Moreover, the compounds and compositions may also be applied as a seed treatment.
GABA, the GABA agonists or GABA antagonists described above are preferably combined with a carrier medium as known in the art. The compounds and compositions may, for example, be combined with water, such as tap water is or with distilled water to which has been added selected minerals.
Alternatively, the compositions of the present invention may be applied as a solid. In such a form, the solid is preferably applied to the soil.
The compositions may further include agricultural additives or formulation aids known to those skilled in the art. Such additives or aids 2o may be used to ensure that the compositions disperse well in a spray tank, stick to or penetrate plant surfaces (particularly leaf or other foliage surfaces) as well as provide other benefits to the plant. For example, surfactants, dispersants, humectants, and binders may be used to disperse the compounds or compositions described herein in a spray tank as well as 2s to allow the compound or compositions to adhere to and/or penetrate the plant surfaces.
Methods of regulating plant metabolism are also provided.
Regulation of plant metabolism may include affecting nutrient utilization, such as nitrogen-assimilation, plant growth, plant productivity and 3o increasing the plant's resistance to the effects of plant stress. For example, in one form, an inventive method includes introducing into a plant cell an antisense nucleotide sequence having a nucleotide sequence complementary to the nucleotide sequences provided herein, such as one that is complementary to a nucleotide sequence having at least about 70%
identity, more preferably at least about 80% identity, most preferably at s least about 90% identity to a length of nucleotides within the nucleotide sequence set forth in SEQ ID N0:1 or SEQ ID N0:2, preferably from nucleotide 1 to nucleotide 1305. The antisense nucleotide may have a length of about 30 to about 400 nucleotides, about 30 to about 800 nucleotides, about 30 to about 1400 nucleotides and about 30 to about l0 1800 nucleotides. In more preferred embodiments, the antisense nucleotide sequence is as long as the entire length of the nucleotide sequence set forth in SEQ ID N0:1 or SEQ ID N0:2. The antisense nucleotide sequence may hybridize to the template strand, which serves as the strand from which RNA is produced, so that transcription will be is reduced. Alternatively, the antisense nucleotide sequence may be complementary to, and therefore hybridize to, the RNA sequence, such as the mRNA sequence, transcribed from the nucleotide sequences described herein, so that translation of the mRNA sequence to express the encoded protein, such as a GABA receptor, will be reduced. The antisense 2o nucleotide sequence may be either DNA or RNA. Such antisense sequences may be produced as described above for the nucleotide sequences and by further methods known in the art. Nucleotide sequences having substantial similarity to the above-described antisense nucleotide sequences are also encompassed in the invention.
2s In another form of a method of regulating plant metabolism, a method may include in vivo mutagenesis of the gene present in the plant genome encoding the plant GABA receptor protein described herein in order to alter its activity to provide the desired results. A plant may be mutated by methods known to the skilled artisan, including chemical 3o methods and DNA-insertion mutagenesis.

WO 00/52137 PCT/tJS00/05407 In another aspect of the invention, methods of modifying receptor activity in a plant are provided. In one form of the invention, a method includes introducing into a plant cell a nucleic acid molecule having a nucleotide sequence encoding a plant protein as described herein, such as s a plant protein having an amino acid sequence having at least about 60%
identity to the amino acid sequence set forth in SEQ ID N0:1 or SEQ ID
N0:2.
In yet another aspect of the invention, methods of expressing plant proteins expected to function as GABA receptors as described above are io provided. In one embodiment, the method includes providing a nucleotide sequence described above, or variants thereof, that encodes a protein described herein, and introducing the nucleotide sequence into a host cell, as described above. The desired nucleotide sequence may be advantageously incorporated into a vector to form a recombinant vector.
is The recombinant vector may then be introduced into a host cell according to known procedures in the art. Such host cells are then cultured under conditions, well known to the skilled artisan, effective to achieve expression of the plant protein. The protein may then be purified using conventional techniques.
2o Reference will now be made to specific examples illustrating the invention described above. It is to be understood that the examples are provided to illustrate preferred embodiments and that no limitation to the scope of the invention is intended thereby.

Effect of GABA Agonists and Antagonists on Duckweed GABA receptors in animals have been defined on the basis of their response to antagonists as described in Johnston, GAR (1997), Molecular Biology, Pharmacology and Physiology of the GABA~ Receptors, SJ Emna 3o and NG Bowery Eds., The GABA Receptors, Humana Press. GABAA
receptors are sensitive to the antagonist bicuculline and insensitive to the agonist baclofen and GABAB receptors are insensitive to bicuculline and sensitive to baclofen. GABAc receptors are insensitive to both bicuculline and baclofen. GABAc receptors are sensitive to the antagonist picrotoxin.
Bicuculline is specific for GABAA and picrotoxin is specific for both GABAA
s and GABA~ receptors.
Duckweed (Lemna Minor L) was grown following the general procedure described by Kinnersley (U.S. Patent No. 4,813,997) except that the culture media was Solu-Spray 20-20-20 fertilizer dissolved in tap water at 1 g/I and the pH was adjusted to 5.5 as discussed in U.S. Patent No.
l0 5,439,873 to Kinnersley. Duckweed was treated with, independently, the indicated concentrations of baclofen [(3-(aminomethyl)-4-chlorobenzenepropanoic acid] (FIG. 1 ), picrotoxin (cocculin) (FIG. 2), bicuculline ([R-(R*,S*)]-6-(5,6,7,8-tetrahydro-6-methyl-1,3-dioxolo[4,5-g]isoquinolin-5-yl)furo[3,4-a]-1,3-benzodioxol-8(6H)-one) (FIG. 2) or a is mixture of GABA and baclofen (FIG. 3).
As seen in FIG. 1, baclofen is active at promoting duckweed growth up to concentrations of about 1 mM. Moreover, as seen in FIG. 3, baclofen increases the growth-promoting effects of GABA when duckweed is treated with both GABA and baclofen. In contrast, the growth-promoting effects of 2o GABA are completely inhibited when bicuculline or picrotoxin was added to the culture media. This shows that compounds which affect GABA that act through GABA receptors in animals behave the same way in plants.
As seen in FIG. 2, when duckweed, grown as above, was treated independently with bicuculline and picrotoxin, an inhibitory effect on growth 2s was seen in the absence of GABA in the medium. This suggests that bicuculline and picrotoxin are having an effect on GABA that is being made by the plant.
The above results, taken together, provide evidence that GABA
receptors exist in plants, as experiments with chemicals that promote or so inhibit the activity of GABA receptors in animals have the same response in plants. As there is no published understanding of the role of GABA in plants, it is surprising that chemicals that effect the action of GABA
receptors in animals have the same response in plants.
Additionally, the above results, taken together with the discovery of nucleotide sequences encoding a protein whose N-terminal region has s homology to animal GABA receptors, provide even further evidence of the existence of GABA receptors in plants.

Isolation of a Full-length cDNA and Genomic DNA
to Protocol Arabidopsis thaiiana (L.) Heynh. Ecotype Columbia (Col-0) seeds were obtained from the Arabidopsis Biological Resource Center (Ohio State University, Columbus, OH). Arabidopsis seedlings were grown under aseptic conditions in flasks containing MS media (Murashige and Skook, is Physiol. Plant 15:485 (1962)] on a rotary shaker (150 rpm). Two-day-old seedlings were collected for total RNA isolation. Total RNA was isolated as described in Turano, F.J. et al.(1992) Plant Physiol. 100:374. Primers, 5'K/OGLR4Not1(5'GCCCGCGGCCGCATGGCGAAAGCAATCAGAGAGTT
GTG-3') and 3'IUOGLR4Notl 20 (5'GCCCGCGGCCGCTTAAGTAATTTCGCCATGTTGTGA-3') to GLR4, corresponding to GenBank ACC# AC000098, were commercially synthesized (Biosynthesis, Inc., Lewisville, TX) and used for RT-PCR
reactions. For the RT-PCR, a 5' RACE system (Life Technologies, Rockville, MD) was used to identify a full-length cDNA clone. The primer, 2s 3'IUOGLR4Notl was used to synthesize a first strand cDNA from 1 p.g of poly (A+)RNA isolated from two-day-old plants following the manufacturers instructions. One-fifth of the first strand cDNA synthesis was used as a template in a gene amplification reaction with both primers, 5'K/OGLR4Noti and 3'K/OGLR4Notl. Prior to the amplification, the components were 3o incubated at 95°C for 4 minutes. The gene amplification reaction was conducted at 94°C for 1 minute, 68°C for 1 minute and 72°C for 2 minutes, for 30 cycles followed by a 5 minute, 72°C extension.
Genomic DNA was isolated from leaves of 24 day old Arabidopsis as described in Turano, F.J. et al. (1992) Plant Physiol 100:374. For the s PCR reaction, 250 ng of each primer (5"K/OGLR4Notl and 3'K/OGLR4Notl) was used with approximately 500 ng of genomic DNA. Prior to the amplification reaction, the components were incubated at 95°C for 10 minutes. The gene amplification reaction was conducted at 94°C for 1 minutes, 70°C for 1 minute and 72°C for 3 minutes, for 30 cycles followed to by a 5 minute, 72°C extension.
Both the genomic DNA and cDNA fragments were cloned separately into PCR2.1 (Invitrogen Corp. Carlsbad, CA, USA) and sequenced using the Taq Dideoxy terminator cycle sequence (Applied Biosystems) method at the Center for Agricultural Biotechnology, University of Maryland, is College Park, MD. The data were analyzed with MacVector software on a Power Macintosh 6500/250.
Results A full-length cDNA clone encoding a ligand-gated ion channel was identified from total RNA isolated from 2 day old Arabidopsis. The 2o deduced amino acid sequence has high homology with 11 amino acid sequences derived from genomic sequences and three amino acid sequences deduced from full-length cDNA clones in Genbank. More specifically, the gene had homology to animal GABA receptors from nucleotides 1 to 1305 and had homology to animal glutamate receptors 2s from nucleotide 1306 to the end of the sequence. The large family of putative ligand-gated ion channels from Arabidopsis have homology with genes encoding glutamate ionotropic receptor proteins (Glu R) and, in some cases GABA receptor proteins, in invertebrates and vertebrates.
The gene encoded in the cDNA described herein was designated GLR4.
3o Northern blot and RT-PCR analyses demonstrated that the GLR4 transcript is approximately 2.8 kb and is readily detected in 2 and 4 day-old Arabidopsis and in meristems of 21 day-old plants. The data suggest that the genes are expressed in tissues undergoing rapid cell division.
Although not being limited by theory, it is believed the GABA, GABA
antagonists and GABA agonists will interact with the GABA-like domains at s the N-terminal region of the plant ligand-gated ion channel described herein. This theory is supported by recent experimental findings that demonstrate the N-terminal domain of the animal GABA-BRs is sufficient to specify agonist and antagonist binding in GABA-BRs [Malitschek (1999) Mol. Pharmacol. 56(2):448-454].
to Although the functions of all of the GLR genes are unknown, the presence of GLR genes, and genes having GABA receptor characteristics and glutamate receptor characteristics, in Arabidopsis provides molecular evidence for the biochemical machinery necessary for the transmission of electrical signals in higher plants.

Construction of an Antisense GLR4 Plant The entire open reading frame for GLR4, or portions thereof as small as about 25 base pairs, can be cloned into a plant transformation vector, 2o such as pB1121 (Clonetech, Palo Alto, CA) using PCR, RT-PCR or conventional cloning methods to make antisense constructs. Gene specific primers, 5'K/OGLR4Notl (5'-GCCCGCGGCCGCATGGCGAAAGCAATCAGAGTTGTG-3') and 3'K/OGLR4Notl (5'-2s GCCCGCGGCCGCTTAAGTAATTTCGCCATGTTGTGA-3') (corresponding to GenBank GLR4, ACC # AC000098) can be commercially synthesized (Biosynthesis Inc., Lewisville, TX, USA) and used for PCR or RT-PCR reactions. For example the PCR reactions can use, 250 ng of each primer with approximately 500 ng of genomic DNA.
3o Prior to the amplification reaction, the components can be incubated at 95°C for 2 min. The gene amplification reaction can be conducted at 94°C

for 1 min, 65°C for 1 min and 72°C for 2 min, for 30 cycles followed by a 4 min 72°C extension. For the RT-PCR, a 5' RACE system (Life Technologies, Rockville, MD, USA) or a simpler reverse transcriptase (RT) based system, can be used to identify a full-length cDNA clone. The s primer, 3'K/OGLR4Notl, can be used to synthesize first strand cDNA from 1 pg from poly (A+) RNA isolated from 2 d-old plants following the manufacturer's instructions. One fifth of the first strand cDNA synthesis can be used as a template in a gene amplification reaction with both primers, 5'K/OGLR4Notl and 3'K/OGLR4Notl. Prior to the amplification, the to components can be incubation at 95°C for 2 min. The gene amplification reaction can be conducted at 94°C for 1 min, 58°C for 1 min and 72°C for 2 min, for 30 cycles followed by a 5 min 72°C extension.
The genomic DNA or cDNA fragments can be cloned into plant transformation vectors in an antisense (backwards) direction. The vectors is may contain constitutive promoters such as CaMV 35S promoter and the nopaline synthase terminator. The vectors can be modified to include promoters that can be induced by biotic [Sohal et al.,(1999) Plant Mol. Biol.
41:75-87] or abiotic stresss [Ngai et al., (1997) Plant J. 12:1021-1034;
van Der Krol et al., (1999) Plant Physiol. 121:1153-1162; Kucho et al., 20 (1999) Plant Physiol 121:1329-1338] and/or by hormones and other signaling molecules (Chen and Singh, (1999) Plant J. 19:667-677; Lu et al., (1998) J. BioL Chem. 273:10120-10131; Leubner-Metzger et al., (1998) Plant Mol. Biol. 38:785-795. The orientation of the cloned constructs can be confirmed by restriction endonuclease and PCR analyses.
2s Upon completion of cloning, the binary vector construct can be transferred into a disarmed strain of Agrobacterium tumefaciens, such as EHA105, and subsequently into Arabidopsis (Ws ecotype) using the vacuum infiltration method [Bechtold and Bouchez (1995) In planta Agrobacterium-mediated transformation of adult Arabidopsis thaliana plants 3o by vacuum infiltration, in Gene Transfer to Plants, I. Potrykus and G.
Spangenberg, Eds. (Springer-Verlag, Heidelberg) pp. 19-23] with one modification [i.e., the addition of 0.02% (v/v) Silwet to the infiltration media].
Seeds collected from the transformed plants can be germinated and selected for kanamycin resistance.
s EXAMPLE 4 Evolutionary Origin of Glutamate and GABA Receptors Parsimony and nearest neighbor analyses were used to examine evolutionary relationships between eight putative plant GLR sequences, the iGLRs and members of family 4 of the GPCRs, specifically the mGLRs to and GABA-BRs (FIG. 4). The possibility of a recombination event during the evolutionary history of the loci was considered and, therefore, the analyses of the peptides were separated into two; comparing the approximate first one-third (N-terminal regions), and the last two-thirds (C-terminal regions) of the peptides separately.
is Experimental The tree is one of four equally parsimonious trees generated from heuristic analysis (length = 6186 steps, consistency index = 0.649, retention index = 0.753, and rescaled consistency index = 0.488). A strict consensus tree generated from the four equally parsimonious trees was 2o identical to the tree shown with the exception that hummglur7n was placed between hummglur6n and ratmglur4n. Support of the more important Glades is indicated by bootstrap values using 500 permutations of the aligned data set. Ecoliginh was used as an outgroup. Similar results were obtained with nearest neighbor analyses (not shown). The abbreviations 2s and accession numbers for the bacterial periplasmic binding proteins, animal iGLRs and plant GLRs (1, 3, and 4) sequences are identical to those used by Chiu, J. et al. (1999) Mol. Biol. Evol. 16:826-838.
Results It was concluded that the amino acid sequences in the N-terminal 3o regions of the plant GLRs are related to members of GPCRs (family 4 of the G-protein-coupled receptors) superfamily and not to members of the iGLRs. However, the C-terminal regions of the plant GLRs are related to members of the iGLRs superfamily and not to members of the GPCRs.
Similar inferences were made from results comparing the entire peptide sequences (data not shown). The results from the present analysis of the s C-terminal regions are in agreement with those of a recently published phylogenetic analysis [Chiu, J. et al. (1999) Mol. Biol. Evol. 16:826-838]. It can be concluded from the results of both the present study, along with the published study, that the C-terminal regions of the Arabidopsis GLRs and iGLRs evolved from a common ancestral locus that predated the io divergence of animal kainate/AMPA and NMDA receptors. However, the analyses of the N-terminal regions herein support a different scenario. The N-terminal regions of the Arabidopsis GLRs are homologous to GABA-BRs and mGLRs, which are members of family 4 of the GPCRs. These loci share a common ancestry that predates the divergence of plants and is animals.
Collectively, it was concluded that the iGLRs and the two members of family 4 of the GPCRs evolved from distinct regions of the GLRs prior to the divergence of the plant and animal kingdoms. Therefore, the ancestors to extant GLRs are the evolutionary progenitors to both the iGLRs and 2o members of family 4 of the GPCRs, and thus represent a previously unidentified evolutionary link between the two superfamilies of receptors.
As seen in FIG. 5, an ancestral plant GLR evolves from a BPBP.
The ancestral GLR evolves into plant GLRs, iGLRs and members of family 4 of the G-protein coupled receptors (GPCR-F4), via distinct evolutionary 2s routes. The GLRs and iGLRs evolve by a series of point mutations and selection. An ancestral GPCR-F4 arose from a gene conversion or recombination event between the 5'-end of an ancestral plant GLR and a gene encoding for a peptide with seven-transmembrane domains (7-TMDP), perhaps a gene encoding for a GPCR-like protein. [Josefsson, L.G.
3o et al., (1997) Eur. J. Biochem. 249:415-420; Plakidou-Dymock, S. et al.
(1998) Curr. Biol. 8:315-324; Josefsson, LG. (1999) Gene 239:333-340].

The ancestral GPCR-F4 evolves into mGLRS and GABA-BRs by a series of point mutations and selection.
While the invention has been illustrated and described in detail in the drawings and foregoing description, the same is to be considered as illustrative and not restrictive in character, it being understood that only the preferred embodiment has been shown and described and that all changes and modifications that come within the spirit of the invention are desired to be protected. In addition, all references cited herein are indicative of the to level of skill in the art and are hereby incorporated by reference in their entirety.

SEQUENCE LISTING
<110> Kinnersely, Alan _M_ Turano, Frank J
<120> Plant Ligand-Gated Ion Channels <130> 7224-38 <140> Unknown <141> 2000-03-02 <150> US 60/122,506 <151> 1999-03-02 <160> 2 <170> PatentIn Ver. 2.1 <210> 1 <211> 2784 <212> DNA
<213> Arabidopsis thaliana <220>
<400> 1 atg gcg aaa gca atc aga gtt gtg ttg tta tgt ctt tct gtc ttg tgg 48 Met Ala Lys Ala Ile Arg Val Val Leu Leu Cys Leu Ser Val Leu Trp gtc gtt cca aag gaa tgt get tgt aga agt aat tac tca aga aac tcc 96 Val Val Pro Lys Glu Cys Ala Cys Arg Ser Asn Tyr Ser Arg Asn Ser tct tct tct tct tct tct tct ttg ccg cca tta aca cag agg cca agc 144 Ser Ser Ser Ser Ser Ser Ser Leu Pro Pro Leu Thr Gln Arg Pro Ser tct_gtg aat gtt gga get ctg ttt act tac gat tct ttc atc gga aga 192 Ser Val Asn Val Gly Ala Leu Phe Thr Tyr Asp Ser Phe Ile G1y Arg gcg get aaa ccc gcg gtt aaa gcg get atg gat gat gtt aat get gac 240 Ala Ala Lys Pro Ala Val Lys Ala Ala Met Asp Asp Val Asn Ala Asp caa act gta ct= aag ggc atc aag cta aat atc atc ttt caa gac tca 288 Gln Thr Val Leu Lys Gly Ile Lys Leu Asn Ile Ile Phe Gln Asp Ser aat tgc agt gga ttt ata gge acc atg gga get ttg cag ctg atg gaa 336 Asn Cys Ser Gly Phe Ile Gly Thr Met Gly Ala Leu Gln Leu Met Glu aac aaa gtg gtt gca gcc att gat cca caa tct tca ggg att get cac 384 Asn Lys Val Val Ala Ala Ile Asp Pro Gln Ser Ser Gly Ile Ala His atg atc tcc tat gta get aat gag ctt cat gta cct ctc ttg tca ttt 432 Met Ile Ser Tyr Val Ala Asn Glu Leu His Val Pro Leu Leu Ser Phe gga gca acg gat ccg act ctc tcc tct ttg caa ttt cct tat ttc ctc 480 Gly Ala Thr Asp Pro Thr Leu Ser Ser Leu Gln Phe Pro Tyr Phe Leu cgc acc acg cag aat gat tac ttc caa atg cat gcg atc gca gat ttt 528 Arg Thr Thr Gln Asn Asp Tyr Phe Gln Met His Ala Ile Ala Asp Phe cta tca tat tcc gga tgg aga caa gtc att acg ata ttc gtt gat gat 576 Leu Ser Tyr Ser Gly Trp Arg Gln Val Ile Thr Ile Phe Val Asp Asp gag tgt ggc agg aac ggg ata tct gtc cta ggt gat gta tta gcc aag 624 G1u Cys Gly Arg ~.sn Gly Ile Ser Val Leu Gly Asp Val Leu Ala Lys aaa cgc tcg agg atc tct tac aaa get gca att act cct ggt gca gat 672 Lys Arg Ser Arg Ile Ser Tyr Lys Ala Ala Ile Thr Pro Gly Ala Asp tct agc tcc atc aga gac ttg ttg gtt tct gtt aat ctg atg gaa tct 720 Ser Ser Ser Ile Arg Asp Leu Leu Val Ser Val Asn Leu Met Glu Ser cgg_gtt ttt gtt gtc cat gtg aat cct gac tct ggt tta aac gtt ttc 768 Arg Val Phe Val Val His Val Asn Pro Asp Ser Gly Leu Asn Val Phe tct gtg get aaa tct ctt gga atg atg gca agt ggt tat gtt tgg atc 816 Ser Val Ala Lys Ser Leu Gly Met Met Ala Ser Gly Tyr Val Trp Ile gca aca gac tgg ctt cct aca get atg gat tcc atg gag cac gtg gat 80'4 Ala Thr Asp Trp Leu Pro Thr Ala rtet Asp Ser Met Glu His Val Aso 275 280 285 _ tca gac acg atg gat ctc ttg caa gga gtg gtt get ttt cgc cac tac 912 Ser Asp Thr Met Asp Leu Leu Gln Gly Val Val Ala Phe Arg His Tyr aca atc gag agt agt gtc aaa aga cag ttt atg gcg aga tgg aag aat 960 Thr Ile Glu Ser Ser Val Lys Arg Gln Phe Met Ala Arg Trp Lys Asn ctt aga cca aat gat ggc ttc aac tct tat gcg atg tac get tac gat 1008 Leu Arg Pro Asn Asp Gly Phe Asn Ser Tyr Ala Met Tyr Ala Tyr Asp tct gtt tgg tta gtt get cgt gcc ctc gat gtt ttc ttc aga gaa aac 1056 Ser Val Trp Leu Val Ala Arg Ala Leu Asp Val Phe Phe Arg Glu Asn aat aac ata act ttc tcc aac gat cca aat ctg cac aaa aca aat ggt 1104 Asn Asn Ile Thr Phe Ser Asn Asp Pro Asn Leu His Lys Thr Asn Gly agc act att cag cta tca get cta agt gtt ttc aat gaa gga gag aaa 1152 Ser Thr Ile Gln Leu Ser Ala Leu Ser Val Phe Asn Glu Gly Glu Lys ttt atg aag atc att ctt ggg atg aat caa act ggt gtg acg ggc cca 1200 Phe Met Lys Ile Ile Leu Gly Met Asn Gln Thr Gly Val Thr Gly Pro atc cag ttt gat tca gat aga aac cgg gtt aat ccg get tat gaa gtt 1248 Ile Gln Phe Asp Ser Asp Arg Asn Arg Val Asn Pro Ala Tyr Glu Val cta aac tta gaa ggt aca get cca cgc aca gtc ggg tac tgg tca aat 1296 Leu Asn Leu Glu Gly Thr Ala Pro Arg Thr Val Gly Tyr Trp Ser Asn cat_tcg ggt ctc tct gtg gtc cat cca gag acc ttg tac tct agg cct 1344 His Ser Gly Leu Ser Val Val His Pro Glu Thr Leu Tyr Ser Arg Pro cca aac aca tct aca gca aac cag cgt ctt aaa gga atc ata tat cca 1392 Pro Asn Thr Ser Thr Ala Asn Gln Arg Leu Lys Gly I1e Ile Tyr Pro gga gaa gta act aag cct cct cgt ggt tgg gtg ttt cct aat aat gga 1440 Gly Glu Val Thr Lys Pro Pro Arg Gly Trp Val Phe Pro Asn Asn Gly aaa ccg ctc aga atc ggg gtg cct aac cgt gtg agc tat aca gat tac 1488 Lys Pro Leu Arg Ile G1y Val Pro Asn Arg Val Ser Tyr Thr Asp Tyr gtt tct aag gat aaa aac ccg cct ggc gtt aga ggc tac tgc att gat 1536 Val Ser Lys Asp Lys Asn Pro Pro Gly Va1 Arg Gly Tyr Cys Ile Asp gtc ttt gaa gcc get att gaa ttg ctt cca tat cct gtt cca cgt act 1584 Val Phe Glu Ala Ala Ile Glu Leu Leu Pro Tyr Pro Val Pro Arg Thr tat ata cta tat gga gac ggg aag aga aat cct tct tat gat agc ctc 1632 Tyr Ile Leu Tyr Gly Asp Gly Lys Arg Asn Pro Ser Tyr Asp Ser Leu gtc aat gaa gtt gtt gcg gat aat ttt gat gta get gta gga gat atc 1680 Val Asn Glu Val Val Ala Asp Asn Phe Asp Val Ala Val Gly Asp Ile aca atc gtc aca aac aga aca aga tat gta gat ttc aca caa ccg ttt 1728 Thr Ile Val Thr Asn Arg Thr Arg Tyr Val Asp Phe Thr Gln Pro Phe ata gaa tca ggg ctt gtg gtg gtg get ccg gtt aag gag gcc aag tct 1776 Ile Glu Ser G1y Leu Val Val Va1 Ala Pro Val Lys Glu Ala Lys Ser agt cct tgg tca ttc ctg aaa cca ttc act ata gag atg tgg get gtc 1824 Ser Pro Trp Ser Phe Leu Lys Pro Phe Thr Ile Glu Met Tr~_ Ala Val act gga ggc ttc ttt ctc ttt gtg gga gcc acg gtc tgg att ctc gaa 1872 Thr Gly Gly Phe Phe Leu Phe Val Gly Ala Thr Val Trp Ile Leu Glu cac_cgc ttc aac caa gaa ttc cgt ggc cct cct agg cgt caa ctc att 1920 His Arg Phe Asn Gln Glu Phe Arg Gly Pro Pro Arg Arg Gln Leu I1e acc atc ttc tgg ttt agc ttc tca aca atg ttc ttc tct cat agg gag 1968 Thr Ile Phe Trp Phe Ser Phe Ser Thr Met Phe Phe Ser His Arg Glu aac acg gtg agt tca ctg ggg agg ttt gtg ctg atc att tgg tta ttc 2016 Asn Thr Val Ser Ser Leu Gly Arg Phe Val Leu Ile Ile T-o Leu Phe 660 6'05 670 gtg gtt ctg atc atc aac tcg agc tac acg gcc agt ctc act tcg atc 2064 Val Val Leu Ile Ile Asn Ser Ser Tyr Thr Ala Ser Leu Thr Ser Ile cta acc att cga cag ctg aca tct cgg att gaa gga ata gat agc ttg 2112 Leu Thr Ile Arg Gln Leu Thr Ser Arg Ile Glu Gly Ile Asp Ser Leu gta acg agc aat gaa cca att gga gtt caa gac ggt acc ttt get cgg 2160 VaI Thr Ser Asn Glu Pro Ile Gly Val Gln Asp Gly Thr Phe Ala Arg aac tat cta atc aac gag ctt aac ata cta cct tca agg att gtt cct 2208 Asn Tyr Leu Ile Asn Glu Leu Asn Ile Leu Pro Ser Arg Ile Val Pro ctg aaa gac gaa gaa cag tac ctt tct get ctg caa cgc ggt ccc aac 2256 Leu Lys Asp Glu Glu Gln Tyr Leu Ser Ala Leu Gln Arg Gly Pro Asn get ggc ggt gtg gca gcc att gta gat gag ctt cet tac atc gaa gtt 2304 Ala Gly Gly Val Ala Ala Ile Val Asp Glu Leu Pro Tyr Ile Glu Val ctt ttg aca aat agc aac tgc aaa ttc cgt aca gta ggg caa gag ttc 2352 Leu Leu Thr Asn Ser Asn Cys Lys Phe Arg Thr Val Gly Gln Glu Phe aca cge aca ggc tgg ggt ttc gca ttc cag aga gat tcc cct tta get 2400 Thr Arg Thr Gly Trp G1y Phe Ala Phe Gln Arg Asp Ser Pro Leu Ala gta gac atg tca acg get atc ttg caa cta tct gaa gaa ggc gag ctc 2448 Val Asp Met Ser Thr Ala Ile Leu Gln Leu Ser Glu Glu Gly Glu Leu gag aaa atc cat agg aaa tgg ctt aac tac aag cat gaa tgc tcg atg 2496 Glu Lys Ile His Arg Lys Trp Leu Asn Tyr Lys His Glu Cys Ser Met cag atc tca aac agt gag gac tct cag ctt tca cta aag agt ttc tgg 2544 Gln Ile Ser Asn Ser G1u Asp Ser Gln Leu Ser Leu Lys Ser Phe Trp gga ctc ttc ctt atc tgt ggc atc act tgc ttc atg gca ctc act gtc 2592 Gly Leu Phe Leu Ile Cys Gly Ile Thr Cys Phe Met Ala Leu Thr Val 850 355 80'0 ttc ttc tgg agg gtt ttc tgg caa tac cag agg ttg cta cca gaa agt 2640 Phe Phe Trp Arg Val Phe Trp Gln Tyr Gln Arg Leu Leu Pro Glu Ser gcg gac gag gaa agg gca ggc gaa gtg tct gag cca tct cga tca ggg 2688 Ala Asp Glu Glu Arg Ala Gly Glu Val Ser Glu Pro Ser Arg Ser Gly aga ggt tca cga gca ccg agt ttc aag gaa ttg ata aaa gtt gtg gat 2736 Arg Gly Ser Arg Ala Pro Ser Phe Lys Glu Leu Ile Lys Val Val Asp aag agg gaa gca gag atc aag gag ata ctt aag cag aag agt agc tag 2784 Lys Arg Glu Ala Glu Ile Lys Glu Ile Leu Lys Gln Lys Ser Ser <210> 2 <211> 2439 <212> DNA
<213> Arabidopsis thaliana <220>
<400> 2 atg gcg aaa gca atc aga gtt gtg ttg tta tgt ctt tct gtc ttg tgg 48 Met Ala Lys Ala Ile Arg Val Val Leu Leu Cys Leu Ser Val Leu Trp gtc gtt cca aag gaa tgt get tgt aga agt aat tac tca aga aac tcc 96 Val Val Pro Lys Glu Cys Ala Cys Arg Ser Asn Tyr Ser Arg Asn Ser tct tct tct tct tct tct tct ttg ccg cca tta aca cag agg cca agc 144 Ser_Ser Ser Ser Ser Ser Ser Leu Pro Pro Leu Thr Gln Arg Pro Ser tct gtg aat gtt gga get ctg ttt act tac gat tct ttc atc gga aga 192 Ser Val Asn Val Gly Ala Leu Phe Thr Tyr Asp Ser Phe Ile Gly Arg gcg get aaa ccc gcg gtt aaa gcg get atg gat gat gtt aat get gac 240 Ala Ala Lys Pro Ala Val Lys Ala Ala Met Asp Asp Val Asn Ala Asp caa act gta ctt aag ggc atc aag cta aat atc atc ttt caa gac tca 288 Gln Thr Val Leu Lys Gly Ile Lys Leu Asn Ile Ile Phe Gln Aso Ser aat tgc agt gga ttt ata ggc acc atg gga get ttg cag ctg atg gaa 336 Asn Cys Ser Gly Phe Ile Gly Thr Met Gly Ala Leu Gln Leu Met Glu aac aaa gtg gtt gca gcc att gat cca caa tct tca ggg att get cac 384 Asn Lys Val Val Ala Ala Ile Asp Pro Gln Ser Ser Gly Ile Ala His atg atc tcc tat gta get aat gag ctt cat gta cct ctc ttg tca ttt 432 Met Ile Ser Tyr Val Ala Asn Glu Leu His Val Pro Leu Leu Ser Phe gga gca acg gat ccg act ctc tcc tct ttg caa ttt cct tat ttc ctc 480 Gly Ala Thr Asp Pro Thr Leu Ser Ser Leu Gln Phe Pro Tyr Phe Leu cgc acc acg cag aat gat tac ttc caa atg cat gcg atc gca gat ttt 528 Arg Thr Thr Gln Asn Asp Tyr Phe Gln Met His Ala Ile Ala Aso Phe cta tca tat tcc gga tgg aga caa gtc att acg ata ttc gtt gat gat 576 Leu Ser Tyr Ser Gly Trp Arg Gln Val Ile Thr Ile Phe Val AsD_ Aso_ gag tgt ggc agg aac ggg ata tct gtc cta ggt gat gta tta gcc aag 624 Glu Cys Gly Arg Asn Gly Ile Ser Val Leu Gly Asp Val Leu Ala Lys aaa cgc tcg agg atc tct tac aaa get gca att act cct ggt gca gat 672 Lys Arg Ser Arg Ile Ser Tyr Lys Ala Ala Ile Thr Pro Gly Ala Asp tct agc tcc atc aga gac ttg ttg gtt tct gtt aat ctg atg gaa tct 720 Ser Ser Ser Ile Arg Asp Leu Leu Val Ser Val Asn Leu Met Glu Ser cgg gtt ttt gtt gtc cat gtg aat cct gac tct ggt tta aac gtt ttc 768 Arg Val Phe Val Val His Val Asn Pro Asp Ser G1y Leu Asn Val Phe tet gtg get aaa tct ctt gga atg atg gca agt ggt tat gtt tgg atc 316 Ser Va1 Ala Lys Ser Leu Gly Met Met Ala Ser Gly Tyr Val Trp Ile 20'0 265 270 gca aca gac tgg ctt cct aca get atg gat tec atg gag eac gtg gat 864 Ala Thr Asp Trp Leu Pro T:zr Ala Met Asp Ser Met Glu His Val Asp 275 280 2g5 tca gac acg atg gat ctc ttg caa gga gtg gtt get ttt cgc cac tac 912 Ser Asp Thr Met Asp Leu Leu Gln Gly Val Val Ala Phe Arg His Tyr aca atc gag agt agt gtc aaa aga cag ttt atg gcg aga tgg aag aat 960 Thr Ile Glu Ser Ser Val Lys Arg Gln Phe Met Ala Arg Trp Lys Asn ctt aga cca aat gat ggc ttc aac tct tat gcg atg tac get tac gat 1008 Leu Arg Pro Asn Asp Gly Phe Asn Ser Tyr Ala Met Tyr Ala Tyr Asp tct gtt tgg tta gtt get cgt gcc ctc gat gtt ttc ttc aga gaa aac 1056 Ser Val Trp Leu Val Ala Arg Ala Leu Asp Val Phe Phe Arg Glu Asn aat aac ata act ttc tcc aac gat cca aat ctg cac aaa aca aat ggt 1104 Asn Asn Ile Thr Phe Ser Asn Asp Pro Asn Leu His Lys Thr Asn Gly age act att cag eta tca get cta agt gtt ttc aat gaa gga gag aaa 1152 Ser Thr Ile Gln Leu Ser Ala Leu Ser Val Phe Asn Glu Gly Glu Lys ttt atg aag atc att ctt ggg atg aat caa act ggt gtg acg ggc cca 1200 Phe Met Lys Ile I1e Leu Gly Met Asn Gln Thr Gly Val Thr Gly Pro atc cag ttt gat tca gat aga aac cgg gtt aat ccg get tat gaa gtt 1248 Ile Gln Phe Asp Ser Asp Arg Asn Arg Val Asn Pro Ala Tyr Glu Val cta aac tta gaa ggt aca get cca cgc aca gtc ggg tae tgg tca aat 1296 Leu.Asn Leu Glu Gly Thr Ala Pro Arg Thr Val Gly Tyr Trp Ser Asn cat tcg ggt ctc tct gtg gtc cat cca gag acc ttg tac tct agg cct 1344 His Ser Gly Leu Ser Val Val His Pro Glu Thr Leu Tyr Ser Arg Pro cca aac aca tct aca gca aac cag cgt ctt aaa gga atc ata cat cca 1392 -Pro Asn Thr Ser Thr Aia Asn G1n Arg Leu Lys Gly Ile Its Tyr Pro gga gaa gta act aag cct cct cgt ggt tgg gtg ttt cct aat aat gga 1440 Gly Glu Val Thr Lys Pro Pro Arg Gly Trp Val Phe Pro Asn Asn Gly aaa ccg ctc aga atc ggg gtg cct aac cgt gtg agc tat aca gat tac 1488 Lys Pro Leu Arg Ile Gly Val Pro Asn Arg Val Ser Tyr Thr Asp Tyr gtt tct aag gat aaa aac ccg cct ggc gtt aga ggc tac tgc att gat 1536 Val Ser Lys Asp Lys Asn Pro Pro Gly Val Arg Gly Tyr Cys Ile Asp gtc ttt gaa gcc get att gaa ttg ctt cca tat cct gtt cca cgt act 1584 Val Phe Glu Ala Ala Ile Glu Leu Leu Pro Tyr Pro Val Pro Arg Thr tat ata cta tat gga gac ggg aag aga aat cct tct tat gat agc ctc 1632 Tyr Ile Leu Tyr Gly Asp Gly Lys Arg Asn Pro Ser Tyr Asp Ser Leu gtc aat gaa gtt gtt gcg gat aat ttt gat gta get gta gga gat atc 1680 Val Asn Glu Val Val Ala Asp Asn Phe Asp Val Ala Val Gly Asp Ile aca atc gtc aca aac aga aca aga tat gta gat ttc aca caa ccg ttt 1728 Thr Ile Val Thr Asn Arg Thr Arg Tyr Val Asp Phe Thr Gln Pro Phe ata gaa tca ggg ctt gtg gtg gtg get ccg gtt aag gag gcc aag tct 177'0 I1e Glu Ser Gly Leu Val Val Val Ala Pro Val Lys Glu Ala Lys Ser agt cct tgg tca ttc ctg aaa cca ttc act ata gag atg tgg get gtc 1824 Ser Pro Trp Ser Phe Leu Lys Pro Phe Thr Ile Glu Met Trp Ala Val act gga ggc ttc ttt ctc ttt gtg gga gcc acg gtc tgg att ctc gaa 1872 Thr_G1y Gly Phe Phe Leu Phe Val Gly Ala Thr Va1 Trp Ile Leu Glu cac cgc ttc aac caa gaa ttc cgt ggc cct cct agg cgt caa ctc att 1920 His Arg Phe Asn Gln Glu Phe Arg Gly Pro Pro Arg Arg Gln Leu Ile _ ;'.. _ __ ___ »~. -__ .. ..__ _~~ ~__ _ __c ___ a~a a-_ _ .. _ _~ ___ ___ ___ ___ __~ c=
____ _1 > ? =~ ==~ ?°_ ~ 7~_ - - _.
. _ ._ .__ ___ .
7~~
aac acg gtg agt tca c g ggg =gg ttt ' cc a_c a_.
g-g g __ tgg tt_ ._tc 20?5 ~:: TP_r Val Jer Ser _,_tl G1 V .r ~ ?~:? Val Le'1 _ 1 a .1 . 'lr~ Lell ?_1°_ X00 'J~~~

gtg gtt ctg atc atc aac tcg agc tac acg gcc agt ctc act tcg atc 2061 Val Val Leu Ile I12 ~sz S=_r Ser Tsrr Tar Vila Ser Leu Thr Se. T_le cta'acc att cga cag ctg aca tct cgg att gaa gga ata gat agc ttg 2112 Leu T'~r _Tle P~ g Gln Leu Thr S=r Arg Ile Glu Gly Ile ~s~ Ser Leu 690 0'95 gta aeg age aat gaa cca att gga gtt caa gac ggt acc ttt get cgg 2160 Va1 T':r Ser ~sn Glu ?r o I l a Gl y Val Gl n 3s? G l y Tr ?re ~ l a ~=g 71' 720 aac tat cta atc aac gag ctt aac ata cta cct tca agg att gtt cct 2203 Asz !yr L2u Ile 3sn Glu Leu mss:. Ile Leu Pro S=r arg _Tle Val ?=o ctg aaa gac gaa gaa cag tac ctt tct get ctg caa cgc ggt cce aac 2255 Leu Lys asp Glu Glu Gln Tyr L=a Ser ~1a Leu Glz ~.rg Gly Pro ~sn get ggc ggt 9tg gca gec att gta gat gag ett ect tac atc gaa gtt 2304 ~l a Gl :r Gly 'vat Vila .'-.l a =l a Val ~s~ Gl a Leu ?.o ~yr _Tle Gl a Val 755 76v ctt ttg aca aat agc aac tgc aaa t..c cgt eca gta ggg caa gag ttc 2352 ~ ~°-a '?'.~-r AS:1 Ser .'~.S.'1 CVS LyS ?~e J=g '='.._ Va~ G~ V G1:1 G1 i: ?~c=

aca cgc aca ggc tgg ggt ttc gta tgc att cca gag aga ttc ccc ttt 2400 Tzr Ar g Thr Gl y T-p Gly ?he Val Cys I l a ?r o Glu :~=g ?i:e ?r o ?ze agc tgt aga cat gtc aac ggc tat ctt gca act atc tgs 2439 ~r S__.Cys Arg. ::is Val as:z Gly Ty= Leu Vila T~_ Ile 305 8i0

Claims (38)

What is claimed is:

1. A method of transforming a plant, comprising introducing into a plant cell a nucleic acid molecule with a nucleotide sequence encoding a protein having an amino acid sequence having at least 60% identity to the amino acid sequence set forth in SEQ ID NO:1 or SEQ ID NO:2.

2. The method of claim 1, wherein said nucleotide sequence is comprised of a nucleotide sequence having at least about 70% identity to the nucleotide sequence set forth in SEQ ID NO:1 or SEQ ID NO:2.

3. The method of claim 2, wherein said nucleotide sequence has at least about 70% identity to the nucleotide sequence set forth in SEQ ID
NO:1 from nucleotide 1 to nucleotide 1305.

4. The method of claim 1, wherein said introduced nucleic acid molecule further comprises a foreign promoter operably linked to a terminal 5' end of said nucleotide sequence.

5. A method of identifying plant proteins, comprising hybridizing to plant nucleic acid a nucleic acid probe having a nucleotide sequence having at least about 70% identity to a nucleotide sequence set forth in SEQ ID NO:1 or SEQ ID NO:2 from nucleotide 1 to nucleotide 1305.

6. The method of claim 5, wherein said probe has a length of about 25 to about 800 nucleotides within the nucleotide sequence set forth in SEQ ID NO:1 or SEQ ID NO:2 from nucleotide 1 to nucleotide 1305.

7. A method of treating a plant, comprising:

(a) providing a plant with an introduced nucleic acid molecule having a nucleotide sequence encoding a protein having an amino acid sequence having at least 60% identity to the amino acid sequence set forth in SEQ ID NO:1 or SEQ ID NO:2; and (b) treating the plant with an effective amount of GABA.

8. The method of claim 7, wherein said method includes expressing said nucleotide sequence prior to said treating step.

9. The method of claim 7, wherein said nucleotide sequence is comprised of a nucleotide sequence having at least about 70% identity to the nucleotide sequence set forth in SEQ ID NO:1 or SEQ ID NO:2.

10. The method of claim 9, wherein said nucleotide sequence has at least about 80% identity to the nucleotide sequence set forth in SEQ ID
NO:1 from nucleotide 1 to nucleotide 1305.

11. The method of claim 7, wherein said plant is treated with a composition that includes GABA and a GABA agonist.

12. The method of claim 11, wherein said agonist is selected from the group consisting of baclofen, cis-4-aminopent-2-enoic acid, imidazole-4-acetic acid and 4,5,6,7-tetrahydroisoxazolo[5,4-c]pyridin-3-ol.

13. The method of claim 7, wherein said introduced nucleic acid molecule further comprises a foreign promoter operably linked to a terminal 5' end of said nucleotide sequence.

14. A method of regulating plant metabolism, comprising:
(a) introducing into a plant cell an antisense nucleic acid molecule comprising a nucleotide sequence complementary to a nucleotide sequence having at least about 70% identity to the nucleotide sequence set forth in SEQ ID NO:1 or SEQ ID NO:2, or a nucleotide sequence complementary to an RNA sequence transcribed from said sequence.
(b) culturing said plant cell under conditions effective for hybridization of said antisense nucleotide sequence to nucleic acid of said plant.

15. The method of claim 14, wherein either of said nucleotide sequences are about 30 to about 1400 nucleotides in length.

16. The method of claim 14, wherein either of said nucleotide sequences are about 30 to about 800 nucleotides in length.

17. A method of expressing a plant protein, said method comprising:
(a) introducing into a plant cell an isolated nucleic acid molecule having a nucleotide sequence encoding a plant protein having an amino acid sequence having at least about 60% identity to the amino acid sequence set forth in SEQ ID NO:1 or SEQ ID NO:2; and (b) culturing under conditions to achieve expression of said protein.

18. The method of claim 17, wherein said nucleic acid molecule has a nucleotide sequence having at least about 70% identity to the nucleotide sequence set forth set forth in SEQ ID NO:1 or SEQ ID NO:2.

19. The method of claim 17, further comprising inserting said nucleotide sequence into a vector prior to said introducing step.

20. The method of claim 19, wherein said vector is a plasmid vector.

21. A method of modifying receptor activity in a plant, comprising introducing into a plant cell a nucleic acid molecule having a nucleotide sequence encoding a plant protein having an amino acid sequence having at least about 60% identity to the amino acid sequence set forth in SEQ ID
NO:1 or SEQ ID NO:2.

22. An isolated nucleic acid molecule, comprising a nucleotide sequence consisting essentially of a protein-encoding nucleotide sequence, said nucleotide sequence encoding a plant protein having an amino acid sequence having at least about 60% identity to the amino acid sequence set forth in SEQ ID NO:1 or SEQ ID NO:2.

23. The molecule of claim 22, wherein said nucleotide sequence consists essentially of a protein-encoding nucleotide sequence having at least about 70% identity to the nucleotide sequence set forth in SEQ ID
NO:1 or SEQ ID NO:2.

24. The molecule of claim 23, wherein said nucleotide sequence consists essentially of a protein-encoding nucleotide sequence having at least about 80% identity to the nucleotide sequence set forth in SEQ ID
NO:1 or SEQ ID NO:2.

25. The molecule of claim 22, wherein said protein is comprised of an amino acid sequence having at least about 80% identity to the amino acid sequence set forth in SEQ ID NO:1 or SEQ ID NO:2.

26. A recombinant nucleic acid molecule, comprising (a) a nucleotide sequence consisting essentially of a protein-encoding nucleotide sequence, said nucleotide sequence encoding a plant protein having an amino acid sequence having at least about 60%

identity to the amino acid sequence set forth in SEQ ID NO:1 or SEQ ID
NO:2; and (b) a foreign promoter operably linked to a terminal 5' end of said nucleotide sequence.

27. The molecule of claim 26, wherein said nucleotide sequence is a cDNA sequence.

28. The molecule of claim 26, wherein said protein is comprised of an amino acid sequence having at least about 80% identity to the amino acid sequence set forth in SEQ ID NO:1 or SEQ ID NO:2.

29. The molecule of claim 26, wherein said promoter is selected from the group consisting of a constitutive promoter, an inducible promoter, and a cell-specific promoter.

30. A plant cell, comprising:
(a) an introduced nucleic acid molecule having a nucleotide sequence encoding a plant protein having an amino acid sequence having at least about 60% identity to the amino acid sequence set forth in SEQ ID
NO:1 or SEQ ID NO:2; and (b) a foreign promoter operably linked to a terminal 5' end of said nucleotide sequence.

31. The plant cell of claim 30, wherein said protein is comprised of an amino acid sequence having at least about 80% identity to the amino acid sequence set forth in SEQ ID NO:1 or SEQ ID NO:2.

32. The plant cell of claim 31, wherein said protein is comprised of an amino acid sequence set forth in SEQ ID NO:1 or SEQ ID NO:2.

33. A transgenic plant, comprising:
(a) an introduced nucleic acid molecule encoding a plant protein having an amino acid sequence having at least about 60% identity to the amino acid sequence set forth in SEQ ID NO:1 or SEQ ID NO:2; and (b) a foreign promoter operably linked to a terminal 5' end of said nucleotide sequence.

34. The transgenic plant of claim 33, wherein said protein is comprised of an amino acid sequence having at least 80% identity to the amino acid sequence set forth in SEQ ID NO:1 or SEQ ID NO:2.

35. The transgenic plant of claim 33, wherein said protein is comprised of an amino acid sequence set forth in SEQ ID NO:1 or SEQ ID
NO:2.

36. A recombinant protein, comprising a protein having an amino acid sequence having at least about 70% identity to the amino acid sequence set forth in SEQ ID NO:1 or SEQ ID NO:2.

37. The protein of claim 36, where said protein has an amino acid sequence having at least about 80% identity to the amino acid sequence set forth in SEQ ID NO:1 or SEQ ID NO:2.

38. The protein of claim 37, wherein said protein has an amino acid sequence having at least about 90% identity to the amino acid sequence set forth in SEQ ID NO:1 or SEQ ID NO:2.