WO2004074431A2

WO2004074431A2 - Plant ion channels and related methods

Info

Publication number: WO2004074431A2
Application number: PCT/US2004/001356
Authority: WO
Inventors: Alan M. Kinnersley; Frank J. Turano
Original assignee: Emerald Bioagriculture Corporation
Priority date: 2003-01-20
Filing date: 2004-01-20
Publication date: 2004-09-02
Also published as: WO2004074431A3

Abstract

Recombinant plant receptor proteins are provided, as are nucleotide sequences encoding these proteins. The invention also provides recombinant vectors including the nucleotide sequences encoding the proteins. Further provided are plant host cells that include the recombinant vectors, transgenic plants and methods of using the nucleotide and amino acid sequences described herein, including methods of treating plants, methods of expressing the proteins described herein, methods of modifying receptor activity in a plant and methods of regulating plant metabolism. Inventive plant receptor proteins are expected to function as effective modulators of the effects of GABA.

Description

PLANT ION CHANNELS AND RELATED METHODS

CROSS REFERENCE TO RELATED APPLICATIONS

The present application claims the benefit of U.S. Provisional Patent Application Number 60/441,457, filed January 20, 2003, which is hereby incorporated by reference herein in its entirety.

BACKGROUND OF THE INVENTION

The amino acid γ-aminobutyric acid (GABA) is the major neurotransmitter in the mammalian central nervous system. Such neurotransmitters generally function in regulating the conductance of ions across neuronal membranes, typically in regulating influx of ions into a cell. For example, GABA is considered an inhibitory neurotransmitter that acts to inhibit synaptic transmission in both vertebrate and invertebrate nervous systems. As another example, glutamate is an excitatory neurotransmitter that depolarizes the postsynaptic membrane and acts to promote synaptic transmission. Both GABA and glutamate affect synaptic transmission by binding to their respective receptors, also known as ligand-gated ion channels.

These ligand-gated ion channels are present in neurons of insects and animals. Three general classes of GABA receptors, denoted GABA_A, GABA_B and GABAc, are present in animal neurons. GABA receptors have been implicated in mediating anxiety, seizures, cognitive function, addictive disorders, sleep disorders and other disorders of the central nervous system. GABA receptors are the target of many pharmaceutical preparations that act on the central nervous system, including barbiturates and benzodiazepines, and thus have therapeutic value. Furthermore, compounds that affect the function of insect GABA receptors are commercially useful as insecticides. GABA receptors in animals are known as "central-type" benzodiazepine receptors (CBR's) and their location is in the central nervous system (CNS). Another type of animal receptor that binds to benzodiazepines is ubiquitously distributed in animal tissues with highest concentrations in mitochondrial membranes. The so-called peripheral type benzodiazepine receptors (PBR's) are thought to function in calcium signaling in animals. GABA has been shown to exert certain beneficial effects on plants. For example, GABA has been shown to increase plant growth and productivity as shown in U.S. Patent No. 5,439,873 to Kinnersley. Moreover, such beneficial effects have been increased when GABA is applied to plants along with a readily metabolized source of carbon, such as succinic acid (U.S. Patent No. 5,604,177). Moreover, GABA has been found to increase fertilizer efficiency when administered with glutamic acid as described in U.S. Patent No. 5,840,656 to Kinnersley et al. The inventors have recently discovered GABA-like receptor proteins in plants (U.S. Patent Application Serial No. 09/517,438, filed March 2, 2000). The present invention relates to the further discovery of PBR's in plants that interact with known animal PBR antagonists and with GABA. The invention also relates to the isolation of plant PBR-encoding nucleotides, and use thereof.

SUMMARY OF THE INVENTION

Although plants do not have nervous systems, physiological and genetic investigations have revealed GABA-like receptors in plants (U.S. Patent Application Serial No. 09/517,438, filed March 2, 2000). Physiological and genetic investigations have now been performed with chemicals and genetic sequences specifically related to animal PBR's. These investigations have led to the discovery, described herein, that plants possess PBR's with features in common with those of animal PBR's.

The present invention relates to the new discovery that plants respond to compounds known to act on animal mitochondrial receptor proteins, and the related discovery that plants express receptor proteins that respond to these compounds. In this regard, the invention provides nucleotide sequences that have been discovered in plants that encode benzodiazepine or benzodiazepine-like receptor proteins having significant sensitivity to benzodiazepines. Based upon the data presented herein, such proteins are believed to function as modulators of

GABA action in plants and, in particular, as ion channels, such as ligand-gated ion channels. Use of inventive methods to modulate expression of inventive benzodiazepine or benzodiazepine-like receptor proteins enables the controlled regulation of plant growth both positively and negatively. Furthermore, the proteins are believed to participate in stress-related physiological response of plants, and incorporation of nucleic acid molecules encoding the proteins into a plant is believed to enhance the plant's ability to withstand stresses. Accordingly, the present invention provides purified plant proteins, including recombinant proteins, nucleotide sequences encoding the proteins and methods of using the nucleotide sequences and proteins.

In one aspect of the invention, methods of transforming a plant are provided. In one form of the invention, a method includes introducing into a plant cell a nucleic acid molecule encoding a plant protein described herein.

In a second aspect of the invention, methods of treating a plant are provided that include providing a plant having an introduced nucleotide sequence encoding a plant protein described herein and treating the plant with an effective amount of GABA. In alternative embodiments, the plant is treated with a composition including GABA and a GABA agonist or is treated only with a GABA antagonist or GABA agonist. In a further embodiment, a plant is treated with agonists or antagonists of animal benzodiazepine receptors and including agonists or antagonists of peripheral benzodiazepine receptors in animals.

In a third aspect of the invention, methods of regulating plant metabolism are provided that include utilizing antisense DNA or RNA to reduce formation of a plant protein or RNA transcript, such as an mRNA transcript. In one embodiment, the method includes introducing into a plant cell an antisense nucleic acid molecule having a nucleotide sequence that is complementary to a coding nucleotide sequence described herein, or a portion thereof. Alternatively, the antisense nucleic acid molecule includes a nucleotide sequence complementary to an RNA sequence, preferably a mRNA sequence, transcribed from a sequence described herein. The antisense nucleotide sequence hybridizes to nucleic acid, including either the template strand or the RNA transcript, of the plant to reduce formation of a plant protein described herein.

In a fourth aspect of the invention, methods of identifying potential plant receptors are provided that include hybridizing to plant nucleic acid a probe having a nucleotide sequence encoding the proteins described herein or a portion thereof. In a fifth aspect of the invention, methods of expressing plant proteins described herein are provided. In one embodiment, a method includes introducing into a host cell a nucleotide sequence encoding a plant receptor protein as described herein and culturing under conditions to achieve expression of the receptor protein. In further embodiments, isolated nucleic acid molecules, including recombinant nucleic acid molecules, are provided that include nucleotide sequences encoding plant proteins as described herein. Plant host cells and transgenic plants are also provided that include nucleotide sequences encoding a plant protein described herein. The molecules, plant cells and transgenic plants further may include a foreign promoter sequence operably linked to a terminal 5' end of the plant nucleotide sequences described herein. BRIEF DESCRIPTION OF THE FIGURES

Although the characteristic features of this invention will be particularly pointed out in the claims, the invention itself, and the manner in which it may be made and used, may be better understood by referring to the following description taken in connection with the accompanying figures forming a part hereof.

FIG. 1 depicts a schematic showing the proposed roles of GABA in plant stress responses (hypothetical pathways by which GABA may function as a cellular barometer and transducer of environmental stress signals). FIG. 2 depicts a graph showing the effect of cyclosporin A on GABA- mediated growth promotion in duckweed as more fully described in Example 1.

FIG. 3 depicts a graph showing the effect of spermine on GABA-mediated growth promotion in duckweed as more fully described in Example 1.

FIG. 4 depicts a graph showing the effect of quinine on GABA-mediated growth promotion in duckweed as more fully described in Example 1.

FIG. 5 depicts a graph showing the effect of diazepam and PK11195 (isoquinoline carboxamide) on GABA-mediated growth promotion in duckweed as more fully described in Example 1.

FIG. 6 depicts an amino acid alignment of an amino acid sequence of SEQ ID NO:2 and an amino acid sequence of SEQ ID NO:4.

DESCRIPTION OF THE PREFERRED EMBODIMENTS

For the purposes of promoting an understanding of the principles of the invention, reference will now be made to preferred embodiments and specific language will be used to describe the same. It will nevertheless be understood that no limitation of the scope of the invention is thereby intended, such alterations and further modifications of the invention, and such further applications of the principles of the invention as described herein, being contemplated as would normally occur to one skilled in the art to which the invention relates.

The present invention relates to the discovery that plants respond to compounds that are known to act on animal mitochondrial receptor proteins, and the related discovery that plants express receptor proteins that respond to these compounds. The invention further relates to the discovery of nucleotide sequences in Arabidopsis thaliana and rice that encode plant benzodiazepine, and/or benzodiazepine-like, receptor proteins (hereinafter referred to collectively as "receptor protein"). The invention also relates to nucleotide sequences that encode analogous receptor proteins in other species and that exhibit similar functionality and have sequence identity to the exemplary Arabidopsis thaliana and rice sequences set forth herein. Accordingly, the present invention provides purified receptor proteins and isolated nucleic acid molecules comprising nucleotide sequences encoding plant receptor proteins. Recombinant nucleic acid molecules, plant host cells and transgenic plants are also provided that include the nucleotide sequences encoding the plant receptor proteins. In other aspects of the invention, methods of expressing a receptor protein, and methods of using the nucleotide and amino acid sequences described herein are also provided. In one aspect of the invention, purified plant benzodiazepine or benzodiazepine-like receptor proteins are provided. While it is not intended that the invention be limited by any theory whereby it achieves its advantageous result, it is believed that plant receptor proteins described herein function as ion channel proteins, such as ligand-gated ion-channel proteins in plants, and therefore have the ability to regulate cellular ion influx and/or transport ions within a cell. Candidate ions whose entry may be regulated include anions, such as chloride, and cations, such as calcium, sodium, and potassium. The receptors may, for example, release calcium ions from intracellular stores into the cytosol.

In the prior-filed International Patent Application No. PCT/US02/23180, the present inventors report a newly-discovered Arabidopsis thaliana receptor protein, and a nucleotide sequence encoding same. The Arabidopsis thaliana receptor protein forms one embodiment of the present invention. In this embodiment, an Arabidopsis thaliana receptor protein is provided that has the amino acid sequence as set forth in SEQ ID NO:2. The inventors have also now identified, and provide herein, a rice receptor protein that has the amino acid sequence set forth in SEQ ID NO:4.

Although the invention is described with reference to an Arabidopsis thaliana amino acid sequence and a rice amino acid sequence, it is understood that the invention is not limited to the specific amino acid sequences set forth in SEQ ID NO:2 and SEQ ID NO:4. Skilled artisans will recognize that, through the process of mutation and/or evolution, polypeptides of different lengths and having differing constituents, e.g., with amino acid insertions, substitutions, deletions, and the like, may arise that are related to, or sufficiently similar to, a sequence set forth herein by virtue of amino acid sequence homology and advantageous functionality as described herein. The terms "benzodiazepine receptor protein" and "benzodiazepine-like receptor protein" are used herein to refer generally to a protein having the features described herein, examples of which are polypeptides having the amino acid sequence set forth in SEQ ID NO: 2 and SEQ ID NO:4. Further included within this definition, and in the scope of the invention, are variants of the polypeptide which have the structural features and exhibit the functionality described herein.

It is well known that plants of a wide variety of species commonly express and utilize homologous proteins, which include the insertions, substitutions and/or deletions discussed above, and yet which effectively provide similar function. For example, an amino acid sequence isolated from another species may differ to a certain degree from the sequences set forth in SEQ ID NO: 2 and SEQ ID NO:4, and yet be readily recognizable by a person of ordinary skill in the art as an analogous protein expected to have similar functionality. Amino acid sequences comprising such variations that have similar functionality and that have a stated degree of identity are included within the scope of the present invention.

Although it is not intended that the present invention be limited by any theory by which it achieves its advantageous result, it is believed that the identity between amino acid sequences that is necessary to maintain proper functionality is related to maintenance of the tertiary structure of the polypeptide such that specific interactive sequences will be properly located and will have the desired activity. It is contemplated that a polypeptide including these interactive sequences in proper spatial context will have good activity, even where alterations exist in other portions thereof. In this regard, a variant of a protein explicitly described herein is expected to be functionally similar to that set forth in SEQ ID NO: 2 or SEQ JD NO:4, for example, if it includes amino acids which are conserved among a variety of plant species or if it includes non-conserved amino acids which exist at a given location in another plant species that expresses a protein as described herein. In this regard, a person of ordinary skill in the art will recognize that the sequences of SEQ ID NO:2 and SEQ ID NO:4 have a plurality of regions exhibiting a relatively high degree of conservation. Fig. 6 sets forth an amino acid alignment of residues 11 to 193 of the Arabidopsis thaliana sequence set forth in SEQ ID NO:2 and residues 22 to 191 of the rice sequence set forth in SEQ ID NO:4. As shown in Fig. 6, a region including residues 36 to 54 of SEQ ID NO:2 has a high degree of similarity to a region including residues 39 to 58 of SEQ ID NO: 4. This region of each sequence is identified herein as "consensus region 1". Similarly, a region including residues 101 to 115 of SEQ ID NO:2 has a high degree of similarity to a region including residues 98 to 112 of SEQ ID NO: 4. This region of each sequence is identified herein as "consensus region 2". In addition, a region including residues 168 to 183 of SEQ ID NO:2 has a high degree of similarity to a region including residues 166 to 181 of SEQ ID NO: 4. This region of each sequence is identified herein as "consensus region 3". Another manner in which similarity may exist between two amino acid sequences is where a given amino acid of one group (such as a non-polar amino acid, an uncharged polar amino acid, a charged polar acidic amino acid or a charged polar basic amino acid) is substituted with another amino acid from the same amino acid group. For example, it is known that the uncharged polar amino acid serine may commonly be substituted with the uncharged polar amino acid threonine in a polypeptide without substantially altering the functionality of the polypeptide. Whether a given substitution will affect the functionality of the enzyme may be determined without undue experimentation using synthetic techniques and screening assays known in the art, including screens employing methods set forth in the Examples below. In one embodiment, the invention provides amino acid sequences that have at least about 60% identity to the amino acid sequence set forth in SEQ ID NO: 2 and that exhibit similar functionality as the amino acid sequence set forth in SEQ ID NO: 2. In another embodiment, the invention provides a receptor protein having an amino acid sequence that has at least about 70% identity to the amino acid sequence set forth in SEQ ID NO: 2 and that exhibits similar functionality as the amino acid sequence set forth in SEQ ID NO: 2. In another embodiment, the invention provides a receptor protein having an amino acid sequence that has at least about 80% identity to the amino acid sequence set forth in SEQ ID NO: 2 and that exhibits similar functionality as the amino acid sequence set forth in SEQ ID NO: 2. In another embodiment, the invention provides a receptor protein having an amino acid sequence that has at least about 90% identity to the amino acid sequence set forth in SEQ ID NO: 2 and that exhibits similar functionality as the amino acid sequence set forth in SEQ ID NO: 2.

Percent identity may be determined, for example, by comparing sequence information using the Mac Vector computer program, version 6.0.1, available from Oxford Molecular Group, Inc. (Beaverton, OR). Briefly, the Mac Vector program defines identity as the number of identical aligned symbols (i.e., nucleotides or amino acids), divided by the total number of symbols in the shorter of the two sequences. The program may be used to determine percent identity over the entire length of the proteins being compared. Preferred default parameters for the

Mac Vector program include: for pairwise alignment: (1) matrix = BLOSUM30; (2) Alignment speed - fast; (3) Ktuple = 1; (4) Gap penalty = 1; Top diagonals = 5; Window size = 5; for multiple alignment: matrix = BLOSUM series, open gap penalty = 10; extended gap penalty = 0.1, delay divergent = 40%; protein gap parameters: Gap separation distance = 8; residue-specific penalties = yes or on; hydrophilic residues = GPSNDQEKR.

The embodiments described in the preceding two paragraphs are described in previously filed International Patent Application No. PCT/US02/23180, referenced above. In view of the recent discovery of a rice protein expected to have the functionality described herein, another embodiment of the invention is an amino acid sequence having at least about 30% identity but less than about 60% identity to the amino acid sequence set forth in SEQ ID NO:2, and that exhibits functionality as described herein. In this regard, the sequences set forth in the alignment of Fig. 6 have about 36% identity to one another and about 53% similarity. Furthermore, these sequences have multiple regions that are highly conserved, such as, for example, the regions referred to above as "consensus region 1", "consensus region 2" and "consensus region 3". A person of ordinary skill in the art would therefore appreciate that the present invention provides sequences having less than 60% identity and at least about 30% identity to the amino acid set forth in SEQ ID NO: 2 in addition to sequences having at least about 60% identity thereto, as described in the prior application referenced above.

In another embodiment, an amino acid sequence is provided that includes a region of at least 15 amino acid residues having at least about 50% identity to a 15- amino-acid region of SEQ ID NO:2 or SEQ ID NO:4. In yet another embodiment, an amino acid sequence is provided in accordance with the invention that includes two regions of at least 15 amino acid residues each, each region having at least about 50% identity to a 15-amino-acid region of SEQ ID NO:2 or SEQ ID NO:4. In still another embodiment, the invention provides an amino acid sequence that includes three regions of at least 15 amino acid residues each, each region having at least about 50% identity to a 15-amino-acid region of SEQ ID NO:2 or SEQ ID NO:4. In additional embodiments, each of the recited regions has at least about 60% identity to a region of SEQ ID NO:2 or SEQ ID NO:4. In other embodiments, these regions are selected from the group consisting of consensus region 1, consensus region 2 and consensus region 3 of SEQ ED NO:2 or SEQ ID NO:4. It is understood that another feature of an inventive sequence is that it exhibits functionality as described herein. The invention also provides an amino acid sequence having at least about

30% identity to the sequence set forth in SEQ ID NO:4 and having the described function. In another embodiment an amino acid sequence is provided having at least about 40% identity to the sequence of SEQ ID NO:4 and that exhibits functionality as described herein. In further alternative embodiments, sequences are provided that have at least about 50%, at least about 60%, at least about 70%, at least about 80% or at least about 90% identity to the sequence of SEQ ID NO:4.

In another embodiment, an amino acid sequence has at least about 30% identity to the amino acid sequence set forth in SEQ ID NO:4, and also includes a region of at least 15 amino acid residues having at least about 50% identity to a 15- amino-acid region of SEQ ID NO:4. In yet another embodiment, an amino acid sequence is provided in accordance with the invention that has at least about 30% identity to the amino acid sequence set forth in SEQ ID NO:4 and also includes two regions of at least 15 amino acid residues each, each region having at least about 50% identity to a 15-amino-acid region of SEQ ID NO:4. In still another embodiment, the invention provides an amino acid sequence that has at least about 30% identity to the amino acid sequence set forth in SEQ ID NO:4, and also includes three regions of at least 15 amino acid residues each, each region having at least about 50% identity to a 15-amino-acid region of SEQ ID NO:4. In additional embodiments, these regions have at least about 60% identity to the regions of SEQ ID NO:4. In other embodiments, these regions are selected from the group consisting of consensus region 1, consensus region 2 and consensus region 3. Inventive sequences also exhibit functionality as described herein.

The present invention also provides an amino acid sequence having at least about 30% identity to a member selected from the group consisting of SEQ ID NO:2 and SEQ JD NO:4. As described above, the sequence of SEQ ID NO:2 has been isolated from the species Arabidopsis thaliana, which is a dicot plant species, and the sequence of SEQ ID NO:4 has been isolated from rice, which is a monocot species. While it is not intended that the invention be limited by any theory, it is believed that further work may reveal that dicot species generally have a greater degree of identity to other dicot species than to monocot species, and that monocot species generally have a greater degree of identity to other monocot species than do dicot species. In another embodiment, the invention provides an amino acid sequence having at least about 40% identity to a member selected from the group consisting of SEQ ID NO:2 and SEQ ID NO:4. In alternative embodiments, amino acid sequences are provided having at least about 50% identity, at least about 60% identity, at least about 70% identity, at least about 80% identity, or at least about 90% identity to a member selected from the group consisting of SEQ ID NO: 2 and SEQ ID NO:4.

In another embodiment, an amino acid sequence has at least about 30% identity to a member selected from the group consisting of the sequence of SEQ ED NO:2 and SEQ ID NO:4, and that also includes a region of at least 15 amino acid residues having at least about 50% identity to a member selected from the group consisting of a 15-amino-acid region of SEQ ID NO:2 and a 15-amino-acid region of SEQ ID NO:4. In yet another embodiment, an amino acid sequence is provided in accordance with the invention that has at least about 30% identity to a member selected from the group consisting of the sequence of SEQ ED NO: 2 and SEQ ED NO:4, and that also includes two regions of at least 15 amino acid residues each, each region having at least 50% identity to a member selected from the group consisting of a 15-amino-acid region of SEQ ID NO:2 and a 15-amino-acid region of SEQ ID NO:4. In still another embodiment, the invention provides an amino acid sequence that has at least about 30% identity to a member selected from the group consisting of SEQ ID NO: 2 and SEQ ID NO:4, and also includes three regions of at least 15 amino acid residues each, each having at least about 50% identity to a member selected from the group consisting of a 15-amino-acid region of SEQ ID NO: 2 and a 15-amino-acid region of SEQ ED NO: 4. In other embodiments, these regions are selected from the group consisting of Arabidopsis consensus region 1, Arabidopsis consensus region 2, Arabidopsis consensus region 3, rice consensus region 1, rice consensus region 2, and rice consensus region 3.

In another aspect of the invention, a variety of isolated nucleic acid molecules are provided that encode proteins as described herein. In one embodiment, the invention provides a nucleotide sequence, originally isolated from Arabidopsis thaliana, as set forth in SEQ ID NO: 1. In another embodiment, the invention provides a nucleotide sequence, isolated from rice, as set forth in SEQ ED NO:3. It is to be understood that sequences complementary to the specific sequences shown therein are also encompassed in the invention. In addition, it is not intended that the present invention be limited to these exemplary nucleotide sequences, but include sequences having substantial similarity thereto and sequences which encode variant forms of the plant receptor proteins described herein as discussed above and as further discussed below.

The term "isolated nucleic acid," as used herein, is intended to refer to nucleic acid that is not in its native environment. For example, this term refers to nucleic acid that is separated from other contaminants that naturally accompany it, such as proteins, lipids and other nucleic acid sequences. The term includes nucleic acid that has been removed or purified from its naturally occurring environment or clone library, and further includes recombinant or cloned nucleic acid isolates and chemically synthesized nucleic acid.

The term "nucleotide sequence," as used herein, is intended to refer to a natural or synthetic linear and sequential array of nucleotides and/or nucleosides, including deoxyribonucleic acid, ribonucleic acid, and derivatives thereof. The terms "encoding" and "coding" refer to the process by which a nucleotide sequence, through the mechanisms of transcription and translation, provides the information to a cell from which a series of amino acids can be assembled into a specific amino acid sequence to produce a functional polypeptide, such as, for example, an active enzyme or other protein that has a specific function. The process of encoding a specific amino acid sequence may involve DNA sequences having one or more base changes (i.e., insertions, deletions, substitutions) that do not cause a change in the encoded amino acid, or which involve base changes which may alter one or more amino acids, but do not eliminate the functional properties of the polypeptide encoded by the DNA sequence.

It is therefore understood that the invention encompasses more than the specific exemplary nucleotide sequences set forth in SEQ ED NO:l and SEQ ED NO:3. For example, nucleic acid sequences encoding variant amino acid sequences, as discussed above, are within the scope of the invention. Modifications to a sequence, such as deletions, insertions, or substitutions in the sequence, which produce "silent" changes that do not substantially affect the functional properties of the resulting polypeptide molecule are expressly contemplated by the present invention. For example, it is understood that alterations in a nucleotide sequence which reflect the degeneracy of the genetic code, or which result in the production of a chemically equivalent amino acid at a given site, are contemplated. Thus, a codon for the amino acid alanine, a hydrophobic amino acid, may be substituted by a codon encoding another less hydrophobic residue, such as glycine, or a more hydrophobic residue, such as valine, leucine, or isoleucine. Similarly, changes which result in substitution of one negatively charged residue for another, such as aspartic acid for glutamic acid, or one positively charged residue for another, such as lysine for arginine, are also contemplated by the present invention when the nucleotide sequence having such changes is expected to produce a biologically equivalent product.

Nucleotide changes which result in alteration of the N-terminal and C- terminal portions of the encoded polypeptide molecule would also not generally be expected to alter the activity of the polypeptide. In some cases, it may in fact be desirable to make mutations in the sequence in order to study the effect of alteration on the biological activity of the polypeptide. Each of the proposed modifications is well within the routine skill in the art.

In alternative preferred embodiments, the present invention provides a nucleotide sequence that has substantial similarity to the entire sequence set forth in SEQ ID NO:l, a nucleotide sequence that has substantial similarity to the entire sequence set forth in SEQ ID NO:3, and variants described herein. The term "substantial similarity" is used herein with respect to a nucleotide sequence to designate that the nucleotide sequence has a sequence sufficiently similar to a reference nucleotide sequence that it will hybridize therewith under moderately stringent conditions. This method of determining similarity is well known in the art to which the invention pertains. Briefly, moderately stringent conditions are defined in Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd ed. Vol. 1, pp. 101-104, Cold Spring Harbor Laboratory Press (1989) as including the use of a prewashing solution of 5X SSC (a sodium chloride/sodium citrate solution), 0.5% sodium dodecyl sulfate (SDS), 1.0 mM ethylene diaminetetraacetic acid (EDTA) (pH 8.0) and hybridization and washing conditions of 55°C, 5x SSC. A further requirement of the inventive polynucleotide is that it must encode a polypeptide having similar functionality to the plant proteins described herein.

In yet other embodiments, nucleotide sequences having selected percent identities to specified regions of the nucleotide sequences set forth in SEQ ED NO:l or SEQ ED NO: 3 are provided. In one form of the invention, nucleotide sequences are provided that have at least about 50% identity to a nucleotide sequence of substantial length within the nucleotide set forth in SEQ ED NO:l or SEQ ED NO:3. In another embodiment, the invention provides a nucleotide sequence that has at least about 60% identity to a nucleotide sequence of substantial length within the nucleotide set forth in SEQ ID NO:l or SEQ ED NO:3. In another embodiment, the invention provides a nucleotide sequence that has at least about 70% identity to a nucleotide sequence of substantial length within the nucleotide set forth in SEQ ED NO:l or SEQ ED NO:3. In another embodiment, the invention provides a nucleotide sequence that has at least about 80% identity to a nucleotide sequence of substantial length within the nucleotide set forth in SEQ ID NO:l or SEQ ED NO.3. In another embodiment, the invention provides a nucleotide sequence that has at least about 90% identity to a nucleotide sequence of substantial length within the nucleotide set forth in SEQ ID NO:l or SEQ ID NO:3.

In one embodiment, "substantial length" refers to a length of at least about 50 nucleotides. In another embodiment, the substantial length is a length of at least about 100 nucleotides. In another embodiment, the substantial length is a length of at least about 200 nucleotides. In another embodiment, the substantial length is a length of at least about 300 nucleotides. In another embodiment, the substantial length is a length of at least about 400 nucleotides. In another embodiment, the substantial length is a length of at least about 500 nucleotides. In another embodiment, the substantial length is the entire sequence set forth in SEQ ID NO: 1 or SEQ ID NO.3. The percent identity may be determined, for example, by comparing sequence information using the Mac Vector program, as described above with reference to amino acid identity. Preferred default parameters include: (1) for pairwise alignment parameters: (a) Ktuple = 1; (b) Gap penalty = 1; (c) Window size = 4; and (2) for multiple alignment parameters: (a) Open gap penalty = 10; (b) Extended gap penalty = 5; (c) Delay divergent = 40%; and (d) transitions = weighted. A further requirement of a nucleotide sequence in accordance with the invention is that it encodes a protein that functions as described herein. In one form of the invention, as described in the previously filed International Patent Application No. PCT/US02/23180, an isolated nucleic acid molecule is provided that has a nucleotide sequence encoding a protein having an amino acid sequence having at least about 60% identity to the amino acid sequence set forth in SEQ ED NO: 2 and that exhibits similar functionality as the amino acid sequence set forth in SEQ ED NO: 2. In another embodiment, the invention provides an isolated nucleic acid molecule that has a nucleotide sequence encoding a protein having an amino acid sequence having at least about 70% identity to the amino acid sequence set forth in SEQ ID NO: 2 and that exhibits similar functionality as the amino acid sequence set forth in SEQ ED NO: 2. In another embodiment, the invention provides an isolated nucleic acid molecule that has a nucleotide sequence encoding a protein having an amino acid sequence having at least about 80% identity to the amino acid sequence set forth in SEQ ED NO: 2 and that exhibits similar functionality as the amino acid sequence set forth in SEQ ID NO: 2. In another embodiment, the invention provides an isolated nucleic acid molecule that has a nucleotide sequence encoding a protein having an amino acid sequence having at least about 90% identity to the amino acid sequence set forth in SEQ ED NO: 2 and that exhibits similar functionality as the amino acid sequence set forth in SEQ ID NO: 2.

In alternative forms of the invention, isolated nucleic acid molecules are also provided that have nucleotide sequences encoding the various other amino acid sequences described herein. As various amino acid sequence embodiments of the invention are set forth in detail above, they are not repeated here; however, for each amino acid sequence embodiment set forth above, the present invention contemplates corresponding nucleic acid molecule embodiments that encode the same. It is readily understood by a person of ordinary skill in the art that, in view of know codon degeneracy, a wide variety of polynucleotides can be envisioned that encode a given protein. Although each such variant is not explicitly recited herein, it is well within the purview of a skilled artisan to recognize such variants as if each were individually set forth in the appended Sequence Listing.

A suitable DNA sequence in accordance with the invention may be obtained by cloning techniques using cDNA or genomic libraries of Arabidopsis thaliana, rice or other species, which are available commercially or which may be constructed using standard methods known in the art. Suitable nucleotide sequences may be isolated from DNA libraries obtained from a wide variety of species by means of nucleic acid hybridization or polymerase chain reaction (PCR) procedures, using as probes or primers nucleotide sequences selected in accordance with the invention, such as those set forth in SEQ ED NO:l or SEQ ED NO:3, nucleotide sequences having substantial similarity thereto, or portions thereof. In preferred forms of the invention, the nucleotide sequences provided herein are cDNA sequences. Alternately, a suitable sequence may be made by techniques that are well known in the art. For example, nucleic acid sequences encoding a plant protein described herein may be constructed by recombinant DNA technology, for example, by cutting or splicing nucleic acids using restriction enzymes and DNA ligase. Furthermore, nucleic acid sequences may be constructed using chemical synthesis, such as solid-phase phosphoramidate technology, or PCR. PCR may also be used to increase the quantity of nucleic acid produced. Moreover, if the particular nucleic acid sequence is of a length which makes chemical synthesis of the entire length impractical, the sequence may be broken up into smaller segments which may be synthesized and ligated together to form the entire desired sequence by methods known in the art. In a further aspect of the invention, recombinant nucleic acid molecules, or recombinant vectors, are provided. In one embodiment, a nucleic acid molecule is provided that includes a nucleotide sequence as described herein. The protein encoded by the nucleotide sequence has an amino acid sequence set forth in SEQ ID NO:2, SEQ ED NO:4, or variants thereof as described above. A wide variety of vectors are known that have use in the invention. For example, various plasmid and phage vectors are known that are ideally suited for use in the invention, including λZap and pBluescript. In preferred embodiments, the vector may be a T-DNA vector. Representative T-DNA vector systems are discussed in the following publications: An et al., (1986) EMBO J. 4:277; Herrera- Estrella et al., (1983) EMBO J. 2:987; Herrera-Estrella et al, (1985) in Plant Genetic Engineering, New York: Cambridge University Press, p. 63.

In one embodiment, the desired recombinant vector may be constructed by ligating DNA linker sequences to the 5' and 3' ends of the desired nucleotide insert, cleaving the insert with a restriction enzyme that specifically recognizes sequences present in the linker sequences and the desired vector, cleaving the vector with the same restriction enzyme, mixing the cleaved vector with the cleaved insert and using DNA ligase to incorporate the insert into the vector as known in the art.

The vectors may include other nucleotide sequences, such as those encoding selectable markers, including those for antibiotic resistance or color selection. The vectors also preferably include a promoter nucleotide sequence. The desired nucleic acid insert is preferably operably linked to the promoter. A nucleic acid is "operably linked" to another nucleic acid sequence, such as a promoter sequence, when it is placed in a specific functional relationship with the other nucleic acid sequence. The functional relationship between a promoter and a desired nucleic acid insert typically involves the nucleic acid and the promoter sequences being contiguous such that transcription of the nucleic acid sequence will be facilitated. Two nucleic acid sequences are further said to be operably linked if the nature of the linkage between the two sequences does not (1) result in the introduction of a frame-shift-mutation; (2) interfere with the ability of the promoter region sequence to direct the transcription of the desired nucleotide sequence, or (3) interfere with the ability of the desired nucleotide sequence to be transcribed by the promoter sequence region. Typically, the promoter element is generally upstream (i.e., at the 5' end) of the nucleic acid insert coding sequence. A wide variety of promoters are known in the art, including cell-specific promoters, inducible promoters, and constitutive promoters. Such promoters that direct transcription in plants cells may be used. The promoters may be of viral, bacterial or eukaryotic origin, including those from plants and plant viruses. For example, in certain preferred embodiments, the promoter may be of viral origin, including a cauliflower mosaic virus promoter (CaMV), such as CaMV 35S or 19S, a figwort mosaic virus promoter (FMV 35S), or the coat protein promoter of tobacco mosaic virus (TMV). The promoter may further be, for example, a promoter for the small subunit of ribulose-l,3-diphosphate carboxylase. Promoters of bacterial origin include the octopine synthase promoter, the nopaline synthase promoter and other promoters derived from native Ti plasmids as discussed in Herrera-Estrella et al., Nature, 303:209-213 (1983).

The promoter may further be one that responds to various forms of environmental stresses, or other stimuli. For example, the promoter may be one induced by abiotic stresses such as wounding, cold, dessication, ultraviolet-B [van Der Krol et al. (1999) Plant Physiol. 121:1153-1162], heat shock [Shinmyo et al, (1998) Biotechnol. Bioeng. 58:329-332] or other heat stress, drought stress or water stress. The promoter may further be one induced by biotic stresses including pathogen stress, such as stress induced by a virus [Sohal et al. (1999) Plant Mol. Biol. 41:75-87] or fungi [Eulgem (1999) EMBO. J. 18:4689-4699], stresses induced as part of the plant defense pathway [Lebel (1998) Plant J. 16:223-233] or by other environmental signals, such as light [Ngai et al. (1997) Plant J. 12:1021- 1034; Sohal et al. (1999) Plant Mol. Biol. 41:75-87], carbon dioxide [Kucho et al. (1999) Plant Physiol 121:1329-1338], hormones or other signaling molecules such as auxin, hydrogen peroxide and salicylic acid [Chen and Singh (1999) Plant J. 19:667-677], sugars and gibberellin [Lu et al. (1998) J. Biol. Chem. 273:10120- 10131] or abscissic acid and ethylene [Leubner-Metzger et al. (1998) Plant Mol. Biol. 38:785-795].

The promoters may further be selected such that they require activation by other elements known in the art, so that production of the protein encoded by the nucleic acid sequence insert may be regulated as desired. In one embodiment, the promoter is a foreign promoter. A "foreign promoter" is defined herein to mean a promoter other than the native, or natural, promoter that promotes transcription of a length of DNA.

The vectors may further include other regulatory elements, such as enhancer sequences, which cooperate with the promoter to achieve transcription of the nucleic acid insert coding sequence. By "enhancer" is meant nucleotide sequence elements that can stimulate promoter activity in a cell, such as a plant host cell. The vectors may further include 3' regulatory sequence elements known in the art, such as those, for example, that increase the stability of the RNA transcribed.

Moreover, the vectors may include another nucleotide sequence insert that encodes a peptide or polypeptide used as a tag to aid in purification of the desired protein encoded by the desired nucleotide sequence or that encodes another functional protein. With respect to inclusion of a tag, the additional nucleotide sequence can be positioned in the vector such that a fusion, or chimeric, protein is obtained. For example, a protein described herein may be produced having at its C-terminal end linker amino acids, as known in the art, joined to the other protein that acts as a tag. After purification procedures known to the skilled artisan, the additional amino acid sequence is cleaved with an appropriate enzyme. The protein may then be isolated from the other proteins, or fragments thereof, by methods known in the art. In another embodiment, a vector includes a second nucleotide sequence that encodes another functional protein, such as, for example, a plant GAD enzyme, as described in the inventors' copending U.S. patent application, Serial No. 10/006,852, which is hereby incorporated herein by reference. Alternatively, plants can be transformed in accordance with the invention with two different vectors, one including a DNA construct for expression of a GAD enzyme, by way of example, and the other for expression of a plant receptor protein as described herein. It is expected that overexpression of a GAD enzyme and a receptor protein in a plant will result in a plant with excellent features, such as, for example, enhanced stress resistance.

The inventive recombinant vectors may be used to transform a host cell. Accordingly, methods of transforming a cell or a plant are provided that include introducing into a plant cell a nucleic acid molecule having an inventive nucleotide sequence. A wide variety of methods of transforming a cell or a plant are well known in the art, and may be found in references including, for example, Maniatis et al., Molecular Cloning: A Laboratory Manual, Cold Springs Laboratory, Cold Springs Harbor, New York (1982) and Current Protocols in Molecular Biology, John Wiley and Sons, edited by Ausubel et al. (1988). Plant gene transfer techniques may also be found in references including Fromm et al., (1985) Proc. Natl. Acad. Sci. USA , 82:5824-5828 (lipofection); Crossway et al., (1986) Mol. Gen. Genet. 202:179 (microinjection); Hooykaas-Van Slogtern et al., (1984) Nature 311 :763-764)(T-DNA mediated transformation of monocots); Rogers et al., (1986) Methods Enzymol. 118:627-641 (T-DNA mediated transformation of dicots); Bevan et al., (1982) Ann. Rev. Genet. 16:357-384) (T-DNA mediated transformation of dicots); Klein et al., (1988) Proc. Natl. Acad. Sci USA 85:4305- 4309 (microprojectile bombardment); and Fromm et al., Nature (1986) 319:791- 793 (electroporation). The introduced polynucleotide, in an appropriate vector, is advantageously integrated into the plant genome, but may remain episomal in other forms of the invention. Once the desired nucleic acid has been introduced into a host cell or a host plant, the host cell expresses the protein. Accordingly, in yet another aspect of the invention, a host cell is provided that includes the inventive recombinant vectors described above. A wide variety of host cells may be used in the invention, including prokaryotic and eukaryotic host cells. Preferred host cells are eukaryotic and are further preferably plant cells, such as, for example, those derived from monocotyledons, such as rice, duckweed, corn, turf (including rye grass, Bermuda grass, Blue grass, Fescue), dicotyledons, including lettuce, cereals such as wheat, crucifers (such as rapeseed, radishes and cabbage), solanaceae (including green peppers, potatoes and tomatoes), and legumes such as soybeans and bush beans. In a further aspect of the invention, the host cells may be cultured as known in the art to produce a transgenic plant. A transformed plant can be made, for example, by transforming a cell, tissue or organ from a host plant with an inventive nucleic acid molecule; selecting a transformed cell, cell callus, somatic embryo, or seed which contains the nucleic acid molecule; regenerating a whole plant from the selected transformed cell, cell callus, somatic embryo, or seed; and selecting a regenerated whole plant that expresses the nucleotide sequence. In another aspect of the invention, methods of identifying plant proteins, such as those expected to be benzodiazepine or benzodiazepine-like receptors, are provided. In these methods, nucleotide sequences described above, or portions thereof, are used as probes to locale other, similar nucleotide sequences that may encode other benzodiazepine or benzodiazepine-like receptors. General methods for screening for selected nucleotide sequences in a DNA or RNA sample are known to the art. For example, DNA may be isolated from selected plants, treated with various restrictions enzymes and analyzed by Southern blotting techniques utilizing a radioactively or fluorescently-labeled probe of interest. RNA fragments may be similarly analyzed by Northern blotting techniques. Alternatively, commercially available cDNA or genomic libraries may be screened.

In one embodiment, a nucleic acid molecule used as a probe has a nucleotide sequence having at least about 60% identity to a nucleotide sequence having a length of about 25 to about 100 nucleotides within the nucleotide sequence set forth in SEQ ED NO: 1 or SEQ ED NO:3. In another embodiment, a nucleic acid molecule used as a probe has a nucleotide sequence having at least about 60% identity to a nucleotide sequence having a length of about 25 to about 400 nucleotides within the nucleotide sequence set forth in SEQ ED NO:l or SEQ ED NO:3. In another embodiment, a nucleic acid molecule used as a probe has a nucleotide sequence having at least about 60% identity to a nucleotide sequence having a length of about 25 to about 500 nucleotides within the nucleotide sequence set forth in SEQ ED NO:l or SEQ ED NO:3. In another embodiment, the probe has a nucleotide sequence having at least about 60% identity to the entire length of nucleotides set forth in SEQ ID NO: 1 or SEQ ID NO:3. In another embodiment, the probe has a nucleotide sequence having at least about 70% identity to the length of nucleotides indicated directly above. In another embodiment, the probe has a nucleotide sequence having at least about 80% identity to the length of nucleotides indicated directly above. In another embodiment, the probe has a nucleotide sequence having at least about 90% identity to the length of nucleotides indicated directly above. The probe may be radioactively labeled at its 5 'end, for example, with polynucleotide kinase and ³²P and hybridized to the isolated nucleic acid fragments.

In another aspect of the invention, methods of treating a plant are provided. In one embodiment, a method includes providing a plant having an introduced nucleic acid molecule described herein, wherein the plant expresses the encoded receptor protein, and treating the plant with an effective amount of GABA. Such treating of the plant is expected to advantageously stimulate growth of the plant, as well as provide other beneficial results, including reducing the effects of plant stress.

In one embodiment, transgenic plants are prepared as described above and treated with an effective amount of GABA. As used herein, "effective amount" refers to an amount of GABA that will provide one or more advantages to the plant, such as, for example, promotion or inhibition of plant growth and/or reduction of plant stress. The amount may vary depending upon a wide variety of factors, including, for example, the particular advantage provided to the plant, the number of introduced nucleotide sequences expressed, the type of plant, the number of plants treated and the environmental conditions. In one embodiment, plants are treated with about 1 ppm to about 24,000 ppm GABA [about 0.013 oz/acre (oz/A) to about 20 lbs/ A] [about 0.93 g hectare (g/ha) to about 22 kg/ha]. In another embodiment, plants are treated with about 1 ppm to about 12,000 ppm GABA [about 0.013 oz/A to about 10 lbs/A] [about 0.93 g/ha to about 11 kg/ha]. In another embodiment, plants are treated with about 1 ppm to about 7,500 ppm GABA [about 0.013 oz/A to about 6.3 lbs/A] [about 0.93 g/ha to about 7.1 kg/ha]. In another embodiment, plants are treated with about 1 ppm to about 5,000 ppm GABA [about 0.013 oz/A to about 4.2 lbs/A] [about 0.93 g/ha to about 4.8 kg/ha]. With respect to plant growth stimulation, concentrations of about 1 ppm to about 5,000 ppm, as described in U.S. Patent No. 5,439,873 to Kinnersley, may be advantageously employed. When reduction of plant stress is desired, concentrations of GABA of from about 1 ppm to about 2,500 ppm [about 0.013 oz/A to about 2.1 lbs/ A] [about 0.93 g/ha to about 2.4 kg/ha] may be advantageously employed. About 150-600 ppm [about 1/8 lb/A to about 1/2 lb/ A] [about 0.14 kg/ha to about 0.56 kg/ha] employed in one embodiment of the invention. All amounts in ppm are on a weight/volume (g/ml) basis. Moreover, the application rates in brackets above are derived for a treatment utilizing a standard volume of 100 gallons of the specified solutions dispersed over 1 acre.

In yet other embodiments, the plant, in addition to being treated with GABA, may also be treated with a composition that includes GABA and a GABA agonist. For example, plants may be treated with baclofen as well as other GABA agonists known to the art, including, for example, cis-4-aminopent-2-enoic acid (CACA), imidazole-4-acetic acid (IAA) and 4,5,6,7-tetrahydroisoxazolo[5,4- c]pyridin-3-ol (THEP). Plants may also be treated with only a GABA antagonist, such as picrotoxin or bicuculline, or only a GABA agonist to regulate plant metabolism as desired. The plants may also be treated only with an agonist or antagonist of a benzodiazepine receptor, such as an animal peripheral benzodiazepine receptor. Such compounds include quinine and spermine, and other benzodiazepine receptor antagonists and agonists described herein. GABA, the GABA agonists or antagonists and other agonists and antagonists described herein are typically applied to the foliage of the plant but may also be administered as a soil drench. Furthermore, when plants are grown hydroponically, the compounds and compositions may be applied to the aqueous solution in which the plants are grown. The compositions are further preferably applied by spraying. Moreover, the compounds and compositions may also be applied as a seed treatment.

GABA, the GABA agonists or GABA antagonists, and other agonists and antagonists described herein are preferably combined with a carrier medium as known in the art. The compounds and compositions may, for example, be combined with water, such as tap water or with distilled water to which has been added selected minerals. Alternatively, the compositions of the present invention may be applied as a solid. In such a form, the solid is preferably applied to the soil. The compositions may further include agricultural additives or formulation aids known to those skilled in the art. Such additives or aids may be used to ensure that the compositions disperse well in a spray tank, stick to or penetrate plant surfaces (particularly leaf or other foliage surfaces) as well as provide other benefits to the plant. For example, surfactants, dispersants, humectants, and binders may be used to disperse the compounds or compositions described herein in a spray tank as well as to allow the compound or compositions to adhere to and/or penetrate the plant surfaces.

Methods of regulating plant metabolism are also provided by the present invention. Regulation of plant metabolism may include positively or negatively affecting nutrient utilization, such as nitrogen-assimilation, plant growth, plant productivity and the plant's resistance to the effects of plant stress. For example, in one form, an inventive method that may negatively affect plant productivity includes introducing into a plant cell an antisense nucleotide sequence having a sequence complementary to a coding nucleotide sequence provided herein. Accordingly, this invention also provides strategies for manipulating a gene involved in plant receptor protein production and thus is an invaluable tool for further research of cellular stress and/or developmental processes. For example, manipulation of a plant receptor protein gene can provide quantitative information on the role of GABA-related processes on metabolic fluxes, nutrient utilization and storage, cellular differentiation, growth, senescence, and signaling. Such manipulation also provides a method for increasing crop productivity through enhancing crop resistance to biotic and abiotic stresses. Crop quality and yield is improved by increasing tolerance to a variety of environmental stresses, including disease, which cause a decrease in photosynthetic and nitrogen efficiency of crop plants resulting in decreased yields. In one embodiment, the invention provides an antisense nucleotide sequence that is complementary to a nucleotide sequence having at least about 50% identity to a length of nucleotides within the nucleotide sequence set forth in SEQ ED NO:l or SEQ ED NO:3. In another embodiment, the invention provides an antisense nucleotide sequence that is complementary to a nucleotide sequence having at least about 60% identity to a length of nucleotides within the nucleotide sequence set forth in SEQ ID NO:l or SEQ ID NO:3. In another embodiment, the invention provides an antisense nucleotide sequence that is complementary to a nucleotide sequence having at least about 70% identity to a length of nucleotides within the nucleotide sequence set forth in SEQ ED NO:l or SEQ ED NO:3. In another embodiment, the invention provides an antisense nucleotide sequence that is complementary to a nucleotide sequence having at least about 80% identity to a length of nucleotides within the nucleotide sequence set forth in SEQ ID NO:l or SEQ ED NO:3. In another embodiment, the invention provides an antisense nucleotide sequence that is complementary to a nucleotide sequence having at least about 90% identity to a length of nucleotides within the nucleotide sequence set forth in SEQ ID NO:l or SEQ ED NO:3.

In one embodiment, the antisense nucleotide has a length of about 30 to about 100 nucleotides. In another embodiment, the antisense nucleotide has a length of about 30 to about 200 nucleotides. In another embodiment, the antisense nucleotide has a length of about 30 to about 300 nucleotides. In another embodiment, the antisense nucleotide has a length of and about 30 to about 400 nucleotides. In another embodiment, the antisense nucleotide sequence is as long as the entire length of the nucleotide sequence set forth in SEQ ED NO:l or SEQ ED NO:3. The antisense nucleotide sequence may hybridize to the template strand, which serves as the strand from which RNA is produced, so that transcription will be reduced. Alternatively, the antisense nucleotide sequence may be complementary to, and therefore hybridize to, the RNA sequence, such as the mRNA sequence, transcribed from the nucleotide sequences described herein, so that translation of the mRNA sequence to express the encoded protein will be reduced. The antisense nucleotide sequence may be either DNA or RNA. Preferred antisense oligonucleotides are complementary to the coding region of a particular polynucleotide, although the sequences may in addition bind to selected sequences in a non-coding region. In further preferred forms of the invention, the antisense oligonucleotides will bind to nucleotides adjacent to the ATG initiation codon. In another form of the invention, a method is provided for regulating plant metabolism by in vivo mutagenesis of the gene present in the plant genome encoding the plant receptor protein described herein in order to alter its activity to provide the desired positive or negative results as described above. A plant may be mutated by methods known to the skilled artisan, including chemical methods and DNA-insertion activation-tagged mutagenesis.

In another aspect of the invention, methods of modifying receptor activity in a plant are provided. In one form of the invention, a method includes introducing into a plant cell a nucleic acid molecule having a nucleotide sequence encoding a plant protein as described herein. In yet another aspect of the invention, methods of expressing plant proteins that function as benzodiazepine receptors as described above are provided. In one embodiment, the method includes providing a nucleotide sequence described above, or variants thereof, that encodes a protein described herein, and introducing the nucleotide sequence into a host cell, as described above. The desired nucleotide sequence may be advantageously incorporated into a vector to form a recombinant vector. The recombinant vector may then be introduced into a host cell according to known procedures in the art. Such host cells are then cultured under conditions, well known to the skilled artisan, effective to achieve expression of the plant protein. The protein may then be purified using conventional techniques. A wide variety of target plants are contemplated in accordance with the invention. In one embodiment, the target plant is selected from the group consisting of duckweed, rice, wheat, barley, rye, corn, Bermuda grass, Blue grass, fescue, rapeseed, potato, carrot, sweet potato, bean, pea, chicory, lettuce, cabbage, cauliflower, broccoli, turnip, radish, spinach, asparagus, onion, garlic, eggplant, pepper, celery, squash, pumpkin, zucchini, cucumber, apple, pear, quince, melon, plum, cherry, peach, nectarine, apricot, strawberry, grape, raspberry, blackberry, pineapple, avocado, papaya, mango, banana, soybean, bush beans, tobacco, tomato, green pepper, sorghum and sugarcane. Any experiments, experimental examples, or experimental results provided herein are intended to be illustrative of the present invention and should not be considered limiting or restrictive with regard to the invention scope. Further, any theory, mechanism of operation, or finding stated herein is meant to further enhance understanding of the present invention and is not intended to limit the present invention in any way to such theory, mechanism or finding. All publications, patents, and patent applications cited in this specification are herein incorporated by reference as if each individual publication, patent, or patent application were specifically and individually indicated to be incorporated by reference and set forth in its entirety herein. While the invention has been illustrated and described in detail in the drawings and foregoing description, the same is to be considered as illustrative and not restrictive in character, it being understood that only selected embodiments have been shown and described and that all changes, equivalents, and modifications that come within the spirit of the invention described herein or defined by the following claims are desired to be protected. Reference will now be made to specific examples illustrating the invention described above. It is to be understood that the examples are provided to illustrate preferred embodiments and that no limitation to the scope of the invention is intended thereby. EXAMPLE 1

Effect of Agonists and Antagonists of Animal Mitochondrial Benzodiazepine Receptor on GABA-Mediated Growth Promotion in Duckweed

Benzodiazepine receptors are sensitive to the agonist diazepam and the antagonists PK11195 (isoquinoline carboxamide), spermine, quinine and cyclosporin A.

Duckweed (Lemna Minor L) was grown following the general procedure described by Kinnersley (U.S. Patent No. 4,813,997) except that the culture media was Solu-Spray 20-20-20 fertilizer dissolved in tap water at 1 g/1 and the pH was adjusted to 5.5 as discussed in U.S. Patent No. 5,439,873 to Kinnersley. Duckweed was treated with, independently, the indicated concentrations of GABA and either cyclosporin A, spermine, quinine, diazepam or PK11195.

As seen in FIGS. 2, 3, and 4, respectively, when duckweed was treated independently with cyclosporin A, spermine, or quinine, in the presence of GABA in the medium, an inhibitory effect on growth was seen. Cyclosporin A is an immunosuppressant and has been shown to be the most potent pharmacological inhibitor of the PTP in animal mitochondria. The inhibitory activity of cyclosporin has been attributed to binding to mitochondrial cyclophilin in the mitochondrial imier membrane. In duckweed experiments, 3 μM cyclosporin A significantly inhibited plant growth in cultures containing 10 mM GABA. Relative to the respective controls, inhibition of GABA-mediated growth by cyclosporin A (FIG. 2), spermine (FIG. 3) and quinine (FIG. 4) was paradoxically greatest at highest levels of GABA. This is seen most clearly in FIG. 3, where dry weights in cultures with 10 mM GABA and 150 μM spermine was significantly less than cultures containing 150 μM spermine without any GABA. Addition ofthe benzodiazepine diazepam at 3 μM to cultures increased GABA-mediated growth (FIG. 5). The increase in growth was significant at P < 0.05.

Additionally, when duckweed was treated with PK11195, in the absence of GABA, an inhibitory effect on growth was seen as shown in Table 1 below.

PK11195 is a diagnostic ligand of the peripheral benzodiazepine receptor, which is associated with the PTP in animal mitochondria. PKl 1195 blocked GABA- mediated growth response at 50 μM (FIG. 5).

Table 1. Effect of PKl 1195 on dry weight of duckweed

*Standard Deviation

The data in Table 1 suggests that when low levels of GABA are present in a plant, such as endogenous GABA levels, a higher concentration of PKl 195 is needed to see an effect. As seen in FIG. 5, when duckweed, grown as above, was treated independently with diazepam, an excitatory effect on growth was seen in the presence of GABA in the medium. When duckweed was treated independently with PKl 1195, an inhibitory effect on growth was seen in the presence of GABA in the medium. An earlier study reported the effects of antagonists of animal GABA receptors on duckweed growth; however, the inhibitors reported in Table 2 below were up to 1000-fold more active than the GABA receptor antagonists used in the earlier study. This suggests that they are acting on a different class of receptors.

Table 2. Effect of pharmacological agents on activity of the mitochondrial permeability transition pore (PTP) and peripheral benzodiazepine receptor (PBR) in animals and on GABA-mediated growth activity in Lemna.

*Activity on animal mitochondrial benzodiazepine receptors The above results, taken together, provide evidence of benzodiazepine, or benzodiazepine-like, receptors in plants, as experiments with chemicals that promote or inhibit the activity of benzodiazepine receptors in animals have a similar response in plants.

EXAMPLE 2 Isolation of a Full-length cDNA and Genomic DNA Protocol

Arabidopsis thaliana (L.) Heynh. Ecotype Columbia (Col-0) seeds can be obtained from the Arabidopsis Biological Resource Center (Ohio State University, Columbus, OH). Arabidopsis seedlings are grown under aseptic conditions in flasks containing MS media [Murashige and Skook, Physiol. Plant 15:485 (1962)] on a rotary shaker (150 rpm). Two-day-old seedlings are collected for total RNA isolation. Total RNA are isolated as described in Turano, F.J. et al.(1992) Plant Physiol. 100:374. Primers, 5'EcoPBR(5'-

GCCCGAATTCATGGCCGAGACAGAGAGGAAAAGC-3') and 3'EcoPBR (5'- GCCCGAATTCTCACGCGACTGCAAGCTTTACATT -3') (SEQ ED NOS: 3 and 4, respectively) (corresponding to GenBank, unknown protein, gene # At2g47770, protein_id=AAC63632.1, db_xref=GI: 3738290) are commercially synthesized (Biosynthesis, Inc., Lewisville, TX) and used for RT-PCR reactions. For the RT-PCR, a 5' RACE system (Life Technologies, Rockville, MD) is used to identify a full-length cDNA clone. Primer 3'EcoPBR is used to synthesize a first strand cDNA from 1 μg of poly (A⁺)RNA isolated from two-day-old plants following the manufacturers instructions. One-fifth of the first strand cDNA synthesis is used as a template in a gene amplification reaction with both primers, 5'EcoPBR and 3'EcoPBR. Prior to the amplification, the components are incubated at 95°C for 4 minutes. The gene amplification reaction is conducted at 94°C for 1 minute, 68°C for 1 minute and 72°C for 2 minutes, for 30 cycles followed by a 5 minute, 72°C extension. Genomic DNA is isolated from leaves of 24 day old Arabidopsis as described in Turano, F.J. et al. (1992) Plant Physiol 100:374. For the PCR reaction, 250 ng of each primer (5'EcoPBR and 3'EcoPBR) is used with approximately 500 ng of genomic DNA. Prior to the amplification reaction, the components are incubated at 95°C for 10 minutes. The gene amplification reaction is conducted at 94°C for 1 minutes, 70°C for 1 minute and 72°C for 3 minutes, for 30 cycles followed by a 5 minute, 72°C extension.

Both the genomic DNA and cDNA fragments are cloned separately into PCR2.1 (Invitrogen Corp. Carlsbad, CA, USA) and sequenced using the Taq Dideoxy terminator cycle sequence (Applied Biosystems) method. The data is analyzed with Mac Vector software on a Power Macintosh 6500/250. Similar steps can be used to isolate and clone cDNA and genomic DNA from rice, as will be appreciated by a person of ordinary skill in the art.

EXAMPLE 3 Construction of a Transgenic Plant A transgenic plant that overexpresses a plant receptor protein, or one that overexpresses an antisense receptor protein is made as follows. The entire (e.g., 591 base pairs for the Arabidopsis protein or 582 base pairs for the rice protein) open reading frame for the sense (over-expression) or antisense (under-expression) of the receptor protein, or the portions thereof as small as about 25 base pairs (for antisense or RNAi only), is cloned into a plant transformation vector, such as pBI121(Clonetech, Palo Alto, CA) using PCR, RT-PCR or conventional cloning methods to make antisense constructs. Gene specific primers, 5'EcoPBR(5'- GCCCGAATTCATGGCCGAGACAGAGAGGAAAAGC-3') and 3'EcoPBR (5'- GCCCGAATTCTCACGCGACTGCAAGCTTTACATT -3') (corresponding to GenBank, unknown protein, gene # At2g47770, protein_id=AAC63632.1, db_xref=GI: 3738290) are commercially synthesized (Biosynthesis Inc., Lewisville, TX, USA) and used for PCR or RT-PCR reactions. For example, the PCR reactions use 250 ng of each primer with approximately 500 ng of genomic DNA. Prior to the amplification reaction, the components are incubated at 95°C for 2 min. The gene amplification reaction is conducted at 94°C for 1 min, 65°C for 1 min and 72°C for 2 min, for 30 cycles followed by a 4 min 72°C extension. For the RT-PCR, a 5' RACE system (Life Technologies, Rockville, MD, USA) or a simpler reverse transcriptase (RT) based system, is used to identify a full-length cDNA clone. Primer 3'EcoPBR is used to synthesize first strand cDNA from 1 μg from poly (A⁺) RNA isolated from 2 day old plants following the manufacturer's instructions. One fifth of the first strand cDNA synthesis is used as a template in a gene amplification reaction with both primers, 5'EcoPBR and 3'EcoPBR. Prior to the amplification, the components are incubated at 95°C for 2 min. The gene amplification reaction is conducted at 94°C for 1 min, 58°C for 1 min and 72°C for 2 min, for 30 cycles followed by a 5 min 72°C extension. The genomic DNA or cDNA fragments are cloned into plant transformation vectors in a sense (forward) or anti sense (backwards) direction, depending on the desired result. The vectors may contain constitutive promoters such as CaMV 35S promoter and the nopaline synthase terminator, or other promoters described herein and known to the art. The vectors may be modified to include promoters that can be induced by biotic [Sohal et al.,(1999) Plant Mol. Biol. 41:75-87] or abiotic stresses [Ngai et al., (1997) Plant J. 12:1021-1034; van Der Krol et al, (1999) Plant Physiol. 121:1153-1162; Kucho et al., (1999) Plant Physiol 121:1329-1338] and/or hormones and other signaling molecules [Chen and Singh, (1999) Plant J. 19:667- 677; Lu et al., (1998) /. Biol. Chem. 273:10120-10131; Leubner-Metzger et al., (1998) Plant Mol. Biol. 38:785-795]. The orientation of the cloned constructs is confirmed by restriction endonuclease and PCR analyses.

Upon completion of cloning, the binary vector construct can be transferred into a disarmed strain of Agrobacterium tumefaciens, such as EHA105, and subsequently into Arabidopsis (Ws ecotype) using the vacuum infiltration method [Bechtold, N. and Bouchez, D. (1995) In planta Agrobacterium-mediated transformation of adult Arabidopsis thaliana plants by vacuum infiltration. In Gene Transfer to Plants. I. Potrykus and G. Spangenberg Eds. Springer- Verlag, Heidelberg, pp. 19-23] with one modification (i.e., the addition of 0.02% (v/v) Silwet to the infiltration media). Seeds collected from the transformed plants are germinated and selected for kanamycin resistance. Similar protocols can be used to transform rice plants or other types of plants, as are well within the purview of a person of ordinary skill in the art

While the invention has been illustrated and described in detail in the figures and foregoing description, the same is to be considered as illustrative and not restrictive in character, it being understood that only the preferred embodiment has been shown and described and that all changes and modifications that come within the spirit of the invention are desired to be protected. In addition, all references cited herein are indicative of the level of skill in the art and are hereby incorporated by reference in their entirety.

Claims

CLAIMSWhat is claimed is:

1. A method of transforming a plant, comprising introducing into a plant cell a nucleic acid molecule with a nucleotide sequence encoding a plant protein having an amino acid sequence having at least 30% identity to a member selected from the group consisting of the amino acid sequence set forth in SEQ ID NO:2 and the amino acid sequence set forth in SEQ ED NO:4, and having the functionality thereof, said nucleic acid molecule having a promoter operably linked to a terminal 5' end of said nucleotide sequence; wherein the nucleic acid molecule is expressed in the plant cell.

2. The method of claim 1, wherein the protein has an amino acid sequence having less than 60% identity to the amino acid sequence set forth in SEQ ED NO:2.

3. The method of claim 1, wherein said amino acid sequence has at least about 60% identity to the amino acid sequence set forth in SEQ ID NO:2 or SEQ ID NO:4.

4. The method of claim 1, wherein said amino acid sequence includes at least one consensus region of at least 15 amino acid residues that has at least 50% identity to a nucleotide region selected from the group consisting of Arabidopsis consensus region 1, Arabidopsis consensus region 2, Arabidopsis consensus region 3, rice consensus region 1, rice consensus region 2 and rice consensus region 3.

5. The method of claim 4, wherein said amino acid sequence includes at least two consensus regions, each having at least 15 amino acid residues and having at least 50% identity to a nucleotide region selected from the group consisting of Arabidopsis consensus region 1, Arabidopsis consensus region 2, Arabidopsis consensus region 3, rice consensus region 1, rice consensus region 2 and rice consensus region 3.

6. The method of claim 4, wherein said amino acid sequence includes at least three consensus regions, each having at least 15 amino acid residues and having at least 50% identity to a nucleotide region selected from the group consisting of Arabidopsis consensus region 1, Arabidopsis consensus region 2, Arabidopsis consensus region 3, rice consensus region 1, rice consensus region 2 and rice consensus region 3.

7. The method of claim 1, wherein said nucleotide sequence has at least about 60% identity to the nucleotide sequence set forth in SEQ ID NO:l or the nucleotide sequence set forth in SEQ ED NO:3.

8. The method of claim 1 , wherein said promoter is selected from the group consisting of a constitutive promoter, an inducible promoter and a cell- specific promoter.

9. A method of identifying plant proteins, comprising hybridizing to plant nucleic acid a nucleic acid probe having a nucleotide sequence having at least about 60% identity to a nucleotide sequence set forth in SEQ ED NO:3.

10. The method of claim 9, wherein said probe has a nucleotide sequence having at least 60% identity to a region of SEQ ED NO:3 corresponding to rice consensus region 1, a region of SEQ ED NO: 3 corresponding to rice consensus region 2 or a region of SEQ ED NO: 3 corresponding to rice consensus region 3.

11. The method of claim 9, wherein the probe has a nucleotide sequence having less than 60% identity to the nucleotide sequence set forth in SEQ ED NO:l.

12. The method of claim 9, wherein said probe has a length of about 25 to about 500 nucleotides.

13. A method of treating a plant, comprising:

(a) providing a plant with an introduced nucleic acid molecule having a nucleotide sequence encoding a plant protein having an amino acid sequence having at least 30% identity to a member selected from the group consisting of the amino acid sequence set forth in SEQ ID NO: 2 and the amino acid sequence set forth in SEQ ID NO:4, and having the functionality thereof, said nucleic acid molecule having a promoter operably linked to a terminal 5' end of said nucleotide sequence; wherein the nucleic acid molecule is expressed in the plant; and

(b) treating the plant with an effective amount of GABA.

14. The method of claim 13, wherein said method includes expressing said nucleotide sequence prior to said treating step.

15. The method of claim 13, wherein the protein has an amino acid sequence having less than 60% identity to the amino acid sequence set forth in SEQ ID NO:2.

16. The method of claim 13, wherein said amino acid sequence has at least about 60% identity to the amino acid sequence set forth in SEQ ID NO:2 or SEQ ED NO:4.

17. The method of claim 13, wherein said amino acid sequence includes at least one consensus region of at least 15 amino acid residues that has at least 50% identity to a nucleotide region selected from the group consisting of Arabidopsis consensus region 1, Arabidopsis consensus region 2, Arabidopsis consensus region 3, rice consensus region 1, rice consensus region 2 and rice consensus region 3.

18. The method of claim 17, wherein said amino acid sequence includes at least two consensus regions, each having at least 15 amino acid residues and having at least 50% identity to a nucleotide region selected from the group consisting of Arabidopsis consensus region 1, Arabidopsis consensus region 2, Arabidopsis consensus region 3, rice consensus region 1, rice consensus region 2 and rice consensus region 3.

19. The method of claim 17, wherein said amino acid sequence includes at least three consensus regions, each having at least 15 amino acid residues and having at least 50% identity to a nucleotide region selected from the group consisting of Arabidopsis consensus region 1, Arabidopsis consensus region 2, Arabidopsis consensus region 3, rice consensus region 1, rice consensus region 2 and rice consensus region 3.

20. The method of claim 13, wherein said nucleotide sequence has at least about 60% identity to the nucleotide sequence set forth in SEQ D NO: 1 or the nucleotide sequence set forth in SEQ ED NO:3.

21. The method of claim 13, wherein said nucleotide sequence has less than 60% identity to the nucleotide sequence set forth in SEQ D NO:l.

22. The method of claim 13, wherein said plant is treated with a composition that includes GABA and a GABA agonist.

23. The method of claim 22, wherein said agonist is selected from the group consisting of baclofen, cis-4-aminopent-2-enoic acid, imidazole-4-acetic acid and 4,5,6,7-tetrahydroisoxazolo[5,4-c]pyridin-3-ol.

24. The method of claim 13, wherein said introduced nucleic acid molecule comprises a foreign promoter operably linked to a terminal 5' end of said nucleotide sequence.

25. A method of regulating plant metabolism, comprising:

(a) introducing into a plant cell an antisense nucleic acid molecule comprising a nucleotide sequence complementary to a nucleotide sequence having at least about 60% identity to the nucleotide sequence set forth in SEQ ID NO:l or SEQ ID NO:3, or a nucleotide sequence complementary to an RNA sequence transcribed from said sequence; and

(b) culturing said plant cell under conditions effective for hybridization of said antisense nucleotide sequence to nucleic acid of said plant.

26. The method of claim 25, wherein said antisense nucleotide sequences is from about 30 to about 400 nucleotides in length.

27. The method of claim 25, wherein said antisense nucleotide sequences is from about 30 to about 100 nucleotides in length.

28. A method of expressing a plant protein, said method comprising:

(a) introducing into a plant cell an isolated nucleic acid molecule having a nucleotide sequence encoding a plant protein having an amino acid sequence having at least 30% identity to a member selected from the group consisting of the amino acid sequence set forth in SEQ ID NO:2 and the amino acid sequence set forth in SEQ ID NO:4, and having the functionality thereof, said nucleic acid molecule having a promoter operably linked to a terminal 5' end of said nucleotide sequence; wherein the nucleic acid molecule is expressed in the plant cell; and

(b) culturing under conditions to achieve expression of said protein.

29. The method of claim 28, wherein the protein has an amino acid sequence having less than 60% identity to the amino acid sequence set forth in SEQ ID NO:2.

30. The method of claim 28, wherein said amino acid sequence has at least about 60% identity to the amino acid sequence set forth in SEQ ED NO:2 or SEQ ID NO:4.

31. The method of claim 28, wherein said amino acid sequence includes at least one consensus region of at least 15 amino acid residues that has at least

50% identity to a nucleotide region selected from the group consisting of Arabidopsis consensus region 1, Arabidopsis consensus region 2, Arabidopsis consensus region 3, rice consensus region 1, rice consensus region 2 and rice consensus region 3.

32. The method of claim 31, wherein said amino acid sequence includes at least two consensus regions, each having at least 15 amino acid residues and having at least 50% identity to a nucleotide region selected from the group consisting of Arabidopsis consensus region 1, Arabidopsis consensus region 2, Arabidopsis consensus region 3, rice consensus region 1, rice consensus region 2 and rice consensus region 3.

33. The method of claim 31, wherein said amino acid sequence includes at least three consensus regions, each having at least 15 amino acid residues and having at least 50% identity to a nucleotide region selected from the group consisting of Arabidopsis consensus region 1, Arabidopsis consensus region 2, Arabidopsis consensus region 3, rice consensus region 1, rice consensus region 2 and rice consensus region 3.

34. The method of claim 28, wherein said nucleotide sequence has at least about 60% identity to the nucleotide sequence set forth in SEQ ED NO:l or the nucleotide sequence set forth in SEQ ED NO: 3.

35. The method of claim 28, further comprising inserting said nucleotide sequence into a vector prior to said introducing step.

36. The method of claim 35, wherein said vector is a plasmid vector.

37. A method of modifying receptor activity in a plant, comprising introducing into a plant cell a nucleic acid molecule having a a nucleotide sequence encoding a plant protein having an amino acid sequence having at least 30% identity to a member selected from the group consisting of the amino acid sequence set forth in SEQ ED NO: 2 and the amino acid sequence set forth in SEQ ID NO:4, and having the functionality thereof, said nucleic acid molecule having a promoter operably linked to a terminal 5' end of said nucleotide sequence; wherein the nucleic acid molecule is expressed in the plant cell.

38. The method of claim 37, wherein the protein has an amino acid sequence having less than 60% identity to the amino acid sequence set forth in

SEQ ID NO:2.

39. An isolated nucleic acid molecule, comprising a protein-encoding nucleotide sequence, said nucleotide sequence encoding a plant protein having an amino acid sequence having at least 30% identity to a member selected from the group consisting of the amino acid sequence set forth in SEQ ED NO: 2 and the amino acid sequence set forth in SEQ ED NO:4, and having the functionality thereof, said nucleic acid molecule having a promoter operably linked to a terminal 5' end of said nucleotide sequence.

40. The molecule of claim 39, wherein the protein has an amino acid sequence having less than 60% identity to the amino acid sequence set forth in SEQ ID NO:2.

41. The molecule of claim 39, wherein said protein-encoding nucleotide sequence has at least about 60% identity to the nucleotide sequence set forth in SEQ ID NO: 1.

42. The molecule of claim 39, wherein said protein is comprised of an amino acid sequence having at least about 60% identity to the amino acid sequence set forth in SEQ ID NO:2.

43. A recombinant nucleic acid molecule, comprising

(a) a protein-encoding nucleotide sequence, said nucleotide sequence encoding a plant protein having an amino acid sequence having at least 30% identity to a member selected from the group consisting of the amino acid sequence set forth in SEQ ID NO: 2 and the amino acid sequence set forth in SEQ ID NO: 4, and having the functionality thereof; and

(b) a foreign promoter operably linked to a teπninal 5' end of said nucleotide sequence.

44. The molecule of claim 43, wherein said nucleotide sequence is a cDNA sequence.

45. The molecule of claim 43, wherein the protein has an amino acid sequence having less than 60% identity to the amino acid sequence set forth in SEQ ID NO:2.

46. The molecule of claim 43, wherein said protein is comprised of an amino acid sequence having at least about 60% identity to the amino acid sequence set forth in SEQ ID NO:2 or the amino acid sequence set forth in SEQ ID NO:4.

47. The molecule of claim 43, wherein said promoter is selected from the group consisting of a constitutive promoter, an inducible promoter, and a cell- specific promoter.

48. A transgenic plant cell, comprising:

(a) an introduced nucleic acid molecule having a nucleotide sequence encoding a plant protein having an amino acid sequence having at least 30% identity to a member selected from the group consisting of the amino acid sequence set forth in SEQ ID NO:2 and the amino acid sequence set forth in SEQ D NO:4, and having the functionality thereof; and

(b) a promoter operably linked to a terminal 5' end of said nucleotide sequence; wherein the nucleic acid molecule is expressed in the plant cell.

49. The plant cell of claim 48, wherein the protein has an amino acid sequence having less than 60% identity to the amino acid sequence set forth in SEQ ED NO:2.

50. The plant cell of claim 48, wherein said protein is comprised of an amino acid sequence having at least about 60% identity to the amino acid sequence set forth in SEQ ED NO:2 or the amino acid sequence set forth in SEQ ID NO:4.

51. The plant cell of claim 50, wherein said protein comprises the amino acid sequence set forth in SEQ ID NO:2 or the amino acid sequence set forth in SEQ ID NO:4.

52. A method of transforming a plant, comprising introducing into a plant cell a nucleic acid molecule with a nucleotide sequence encoding a plant protein having an amino acid sequence having at least 60% identity to the amino acid sequence set forth in SEQ ID NO:4, said nucleic acid molecule having a foreign promoter operably linked to a terminal 5' end of said nucleotide sequence.

53. The method of claim 52, wherein the protein has an amino acid sequence having less than 60% identity to the amino acid sequence set forth in

SEQ ID NO:2.

54. The method of claim 52, wherein said nucleotide sequence has at least about 60% identity to the nucleotide sequence set forth in SEQ ID NO:3.

55. The method of claim 52, wherein said promoter is selected from the group consisting of a constitutive promoter, an inducible promoter and a cell- specific promoter.

56. A method of treating a plant, comprising:

(a) providing a plant with an introduced nucleic acid molecule having a nucleotide sequence encoding a protein having an amino acid sequence having at least 60% identity to the amino acid sequence set forth in SEQ ED NO:4; and

(b) treating the plant with an effective amount of GABA.

57. The method of claim 56, wherein said method includes expressing said nucleotide sequence prior to said treating step.

58. The method of claim 56, wherein the protein has an amino acid sequence having less than 60% identity to the amino acid sequence set forth in

SEQ ID NO:2.

59. The method of claim 56, wherein said nucleotide sequence is comprised of a nucleotide sequence having at least about 60% identity to the nucleotide sequence set forth in SEQ ID NO:3.

60. The method of claim 59, wherein said nucleotide sequence has less than 60% identity to the nucleotide sequence set forth in SEQ ED NO:l.

61. The method of claim 56, wherein said plant is treated with a composition that includes GABA and a GABA agonist.

62. The method of claim 61, wherein said agonist is selected from the group consisting of baclofen, cis-4-aminopent-2-enoic acid, imidazole-4-acetic acid and 4,5,6,7-tetrahydroisoxazolo[5,4-c]pyridin-3-ol.

63. The method of claim 56, wherein said introduced nucleic acid molecule further comprises a foreign promoter operably linked to a terminal 5' end of said nucleotide sequence.

64. A method of regulating plant metabolism, comprising:

(a) introducing into a plant cell an antisense nucleic acid molecule comprising a nucleotide sequence complementary to a nucleotide sequence having at least about 60% identity to the nucleotide sequence set forth in SEQ ED NO:3, or a nucleotide sequence complementary to an RNA sequence transcribed from said sequence; and

65. The method of claim 64, wherein either of said nucleotide sequences are about 30 to about 100 nucleotides in length.

66. The method of claim 64, wherein either of said nucleotide sequences are about 30 to about 400 nucleotides in length.

67. A method of expressing a plant protein, said method comprising: (a) introducing into a plant cell an isolated nucleic acid molecule having a nucleotide sequence encoding a plant protein having an amino acid sequence having at least about 60% identity to the amino acid sequence set forth in SEQ ED NO:4; and (b) culturing under conditions to achieve expression of said protein.

68. The method of claim 67, wherein the protein has an amino acid sequence having less than 60% identity to the amino acid sequence set forth in SEQ ID NO:2.

69. The method of claim 67, wherein said nucleic acid molecule has a nucleotide sequence having at least about 60% identity to the nucleotide sequence set forth set forth in SEQ ED NO:3.

70. The method of claim 67, further comprising inserting said nucleotide sequence into a vector prior to said introducing step.

71. The method of claim 70 wherein said vector is a plasmid vector.

72. A method of modifying receptor activity in a plant, comprising introducing into a plant cell a nucleic acid molecule having a nucleotide sequence encoding a plant protein having an amino acid sequence having at least about 60% identity to the amino acid sequence set forth in SEQ ID NO:4.

73. The method of claim 72, wherein the protein has an amino acid sequence having less than 60% identity to the amino acid sequence set forth in SEQ ID NO:2.

74. An isolated nucleic acid molecule, comprising a protein-encoding nucleotide sequence, said nucleotide sequence encoding a plant protein having an amino acid sequence having at least about 60% identity to the amino acid sequence set forth in SEQ ID NO:4, said nucleic acid molecule having a promoter operably linked to a terminal 5' end of said nucleotide sequence.

75. The molecule of claim 74, wherein the protein has an amino acid sequence having less than 60% identity to the amino acid sequence set forth in

SEQ ED NO:2.

76. The molecule of claim 74, wherein said protein-encoding nucleotide sequence has at least about 60% identity to the nucleotide sequence set forth in SEQ ID NO:3.

77. A recombinant nucleic acid molecule, comprising

(a) a protein-encoding nucleotide sequence, said nucleotide sequence encoding a plant protein having an amino acid sequence having at least about 60% identity to the amino acid sequence set forth in SEQ ID NO:4; and

(b) a foreign promoter operably linked to a terminal 5' end of said nucleotide sequence.

78. The molecule of claim 77, wherein said nucleotide sequence is a cDNA sequence.

79. The molecule of claim 78, wherein the protein has an amino acid sequence having less than 60% identity to the amino acid sequence set forth in SEQ ID NO:2.

80. The molecule of claim 77, wherein said promoter is selected from the group consisting of a constitutive promoter, an inducible promoter, and a cell- specific promoter.

81. A transgenic plant cell, comprising: (a) an introduced nucleic acid molecule having a nucleotide sequence encoding a plant protein having an amino acid sequence having at least about 60% identity to the amino acid sequence set forth in SEQ ID NO:4; and

82. The plant cell of claim 81, wherein the protein has an amino acid sequence having less than 60% identity to the amino acid sequence set forth in SEQ ED NO:2.

83. The plant cell of claim 81 , wherein said protein comprises the amino acid sequence set forth in SEQ ED NO:4.