EP1147189A2 - Ribozymotherapie destinee au traitement et/ou a la prevention de la restenose - Google Patents

Ribozymotherapie destinee au traitement et/ou a la prevention de la restenose

Info

Publication number
EP1147189A2
EP1147189A2 EP99968074A EP99968074A EP1147189A2 EP 1147189 A2 EP1147189 A2 EP 1147189A2 EP 99968074 A EP99968074 A EP 99968074A EP 99968074 A EP99968074 A EP 99968074A EP 1147189 A2 EP1147189 A2 EP 1147189A2
Authority
EP
European Patent Office
Prior art keywords
ribozyme
cell
vector
nucleic acid
dna
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP99968074A
Other languages
German (de)
English (en)
Inventor
Richard Tritz
Peter J. Welch
Jack R. Barber
Joan M. Robbins
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Immusol Inc
Original Assignee
Immusol Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Immusol Inc filed Critical Immusol Inc
Publication of EP1147189A2 publication Critical patent/EP1147189A2/fr
Withdrawn legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1137—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/12—Type of nucleic acid catalytic nucleic acids, e.g. ribozymes
    • C12N2310/121—Hammerhead
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/12—Type of nucleic acid catalytic nucleic acids, e.g. ribozymes
    • C12N2310/122—Hairpin
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/35—Nature of the modification
    • C12N2310/353—Nature of the modification linked to the nucleic acid via an atom other than carbon
    • C12N2310/3531—Hydrogen

Definitions

  • the present invention relates generally to therapeutics, and more specifically, to compositions and methods which may be utilized in the treatment and/or prevention of restenosis.
  • restenosis is a major complication following angioplasty, occurring in 30%-60% of patients. Indeed, restenosis is the single most significant problem in interventional cardiology and costs the health care system in excess of $ 1 billion per year.
  • SMCs migrate into the vascular intima and begin to proliferate and produce extracellular matrix (ECM), resulting in the formation of a fibrocellular mass which can obstruct blood flow. Further, injury has been shown to induce the expression of a variety of oncogenes that are believed to play a role in the cellular response to this injury.
  • ECM extracellular matrix
  • this invention provides ribozymes and ribozyme delivery systems which are able to inhibit abnormal smooth muscle cell proliferation in vascular tissue, and in particular, are suitable for treating or preventing restenosis.
  • Methods of producing ribozymes and gene therapy utilizing these ribozymes also are provided.
  • the present invention ribozymes having the ability to inhibit a cyclin or cell-cycle dependent kinase, with the proviso that said cell- cycle dependent kinase is not CDK1, PCNA or Cyclin Bl .
  • Particularly preferred cyclins or cell-cycle dependent kinases include CDK4, CDK2, and Cyclin D.
  • the ribozyme is a hammerhead or hairpin ribozyme, representative examples of which recognize the target site sequences set forth below, and in the Examples. Representative recognition sites are provided in Sequence LD. Nos. 1 - 4119 and 4125 - 4377.
  • the present invention also provides nucleic acid molecule encoding such ribozymes; further preferably, the nucleic acid is DNA or cDNA. Even further preferably, the nucleic acid molecule is under the control of a promoter to transcribe the nucleic acid.
  • the present invention provides host cells containing the ribozymes described herein, vectors comprising the nucleic acid encoding the ribozymes described herein, and host cells comprising such a vector.
  • the vector is a plasmid, a virus, retro transposon, a cosmid or a retrovirus.
  • the nucleic acid molecule encoding the ribozyme under the control of a promoter which is preferably a pol III promoter, further preferably a human tRNA Val promoter or an adeno virus VA1 promoter, is inserted between the 5' and 3' long terminal repeat sequences of the retrovirus.
  • the present invention also provides a host cell stably transformed with such a retroviral vector.
  • the host cell is a murine or a human cell.
  • the present invention provides methods for producing a ribozyme, the ribozyme being able to treat or prevent restenosis, which method comprises providing a nucleic acid molecule (e.g., DNA) encoding the ribozyme under the transcriptional control of a promoter, and transcribing the nucleic acid molecule to produce the ribozyme.
  • the method further comprises purifying the ribozyme produced.
  • the ribozyme may be produced in vitro, in vivo or ex vivo.
  • the present invention provides methods of treating or preventing restenosis, which method comprises introducing into the cell an effective amount of the ribozymes described herein.
  • such methods comprise introducing into the cell an effective amount of DNA encoding a ribozyme as described herein and transcribing the DNA to produce the ribozyme.
  • the cell is a human cell.
  • the present invention provides methods of treating or preventing restenosis, which methods comprise introducing into the cell an effective amount of a nucleic acid molecule (e.g., DNA) encoding a ribozyme as described herein and transcribing the DNA to produce the ribozyme.
  • a nucleic acid molecule e.g., DNA
  • the cell is a human cell.
  • the methods further comprise administering the cell transduced with a retroviral vector to a mammal of the same species as that from which the transduced cell was obtained.
  • the cell transduced with the retroviral vector has been obtained from the mammal receiving the transduced cell.
  • Figure 1 is a schematic illustration of which shows the general structure of a chimeric DNA/RNA ribozyme (SEQ ID NOs: 4385 and 4386).
  • Figure 2 is a photograph of a gel which shows the stability of chimeric ribozymes PN30003, 30004, and 30005 in human vascular smooth muscle cell lysate.
  • Figure 3 is a photograph of a gel which shows the stability of chimeric ribozymes PN30003 and 30005 in serum.
  • Figure 4 is a schematic illustration of vector pLNT-Rz.
  • Figure 5 is a schematic illustration of a representative hairpin ribozyme (SEQ ID NOs: 4387 and 4388).
  • Figure 6 is a graph which illustrates the effects of ribozymes on a balloon injured rat carotid artery.
  • Figure 7 is a graph which illustrates the effects of ribozymes on a balloon injured rat carotid artery.
  • Ribozyme refers to a nucleic acid molecule which is capable of cleaving a specific nucleic acid sequence. Ribozymes may be composed of RNA, DNA, nucleic acid analogues (e.g., phosphorothioates), or any combination of these (e.g., DNA/RNA chimerics). Within particularly preferred embodiments, a ribozyme should be understood to refer to RNA molecules that contain anti-sense sequences for specific recognition, and an RNA-cleaving enzymatic activity.
  • Ribozyme gene refers to a nucleic acid molecule (e.g., DNA) consisting of the ribozyme sequence which, when transcribed into RNA, will yield the ribozyme.
  • Vector refers to an assembly which is capable of expressing a ribozyme of interest.
  • the vector may be composed of either deoxyribonucleic acids ("DNA”) or ribonucleic acids ("RNA").
  • the vector may include a polyadenylation sequence, one or more restriction sites, as well as one or more selectable markers such as neomycin phosphotransferase, hygromycin phosphotransferase or puromycin-N-acetyl-transferase.
  • nucleic acid or “nucleic acid molecule” refers to any of deoxyribonucleic acid (DNA), ribonucleic acid (RNA), oligonucleotides, fragments generated by the polymerase chain reaction (PCR), and fragments generated by any of ligation, scission, endonuclease action, and exonuclease action.
  • Nucleic acids can be composed of monomers that are naturally-occurring nucleotides (such as deoxyribonucleotides and ribonucleotides), or analogs of naturally-occurring nucleotides (e.g., ⁇ -enantiomeric forms of naturally-occurring nucleotides), or a combination of both.
  • Modified nucleotides can have modifications in sugar moieties and/or in pyrimidine or purine base moieties.
  • Sugar modifications include, for example, replacement of one or more hydroxyl groups with halogens, alkyl groups, amines, and azido groups, or sugars can be functionalized as ethers or esters.
  • the entire sugar moiety can be replaced with sterically and electronically similar structures, such as aza-sugars and carbocyclic sugar analogs.
  • modifications in a base moiety include alkylated purines and pyrimidines, acylated purines or pyrimidines, or other well-known heterocyclic substitutes.
  • Nucleic acid monomers can be linked by phosphodiester bonds or analogs of such linkages. Analogs of phosphodiester linkages include phosphorothioate, phosphorodithioate, phosphoroselenoate, phosphorodiselenoate, phosphoroanilothioate, phosphoranilidate, phosphoramidate, and the like.
  • nucleic acid also includes so-called “peptide nucleic acids,” which comprise naturally-occurring or modified nucleic acid bases attached to a polyamide backbone. Nucleic acids can be either single stranded or double stranded.
  • isolated nucleic acid molecule is a nucleic acid molecule that is not integrated in the genomic DNA of an organism.
  • a DNA molecule that encodes a gene that has been separated from the genomic DNA of a eukaryotic cell is an isolated DNA molecule.
  • Another example of an isolated nucleic acid molecule is a chemically-synthesized nucleic acid molecule that is not integrated in the genome of an organism.
  • Promoter is a nucleotide sequence that directs the transcription of a structural gene. Typically, a promoter is located in the 5' region of a gene, proximal to the transcriptional start site of a structural gene. If a promoter is an inducible promoter, then the rate of transcription increases in response to an inducing agent. In contrast, the rate of transcription is not regulated by an inducing agent if the promoter is a constitutive promoter.
  • Restenosis is a major clinical problem and as the result of a need for repeat hospitalization, repeat angioplasty or bypass surgery, restenosis costs the nation's health care system in excess of $1 billion per year. Restenosis is believed to comprise three important components. First, myointimal proliferation of vascular smooth muscle cells and the subsequent deposition of ECM results in a fibrocellular mass which can encroach upon the vascular lumen. Second, following acute angioplasty, there may be significant elastic recoil of the artery which contributes to a late loss of luminal dimension. Finally, platelets and thrombus adherent to the vascular wall may, over time, organize into a fibrocellular mass.
  • This invention accomplishes such by providing ribozymes and methods of using ribozymes that directly block cell cycle control following vascular injury.
  • ribozyme targets include cdkl ribozyme binding sites (SEQ ID NOS: 1-149); cdk2 ribozyme binding sites (SEQ ID NOS: 150-3010); cdk3 ribozyme binding sites (SEQ ID NOS: 302-405); cdk4 ribozyme binding sites (SEQ ID NOS: 406-526); cdk6 ribozyme binding sites (SEQ ID NOS: 527-665); cdk7 ribozyme binding sites (SEQ ID NOS: 666-866); cdk8 ribozyme binding sites (SEQ ID NOS: 867-1112); cdk-we-hu ribozyme binding sites (SEQ ID NOS: 1113-1408); cyclin A2 ribozyme binding sites (SEQ ID NOS: 1409- 1614); cyclin C ribozyme binding sites (SEQ ID NOS: 1615-1819); cyclin D
  • the present invention provides ribozymes having the ability to cleave or otherwise inhibit nucleic acid molecules which are either directly, or indirectly (e.g., they encode proteins) involved in cell-cycle control (e.g. recognition sites of Sequence LD. Nos. 1 - 4119 and 4125 - 4377.
  • ribozymes may be constructed for use within the present invention, including for example, hammerhead ribozymes (Rossi, J.J. et al., Pharmac. Ther.
  • Cech et al. (U.S. Patent No. 4,987,071, issued January 22, 1991) has disclosed the preparation and use of ribozymes which are based on the properties of the Tetrahymena ribosomal RNA self-splicing reaction. These ribozymes require an eight base pair target site and free guanosine (or guanosine derivatives). A temperature optimum of 50°C is reported for the endoribonuclease activity. The fragments that arise from cleavage contain 5 '-phosphate and 3 '-hydroxyl groups and a free guanosine nucleotide added to the 5'-end of the cleaved RNA.
  • particularly preferred ribozymes of the present invention hybridize efficiently to target sequences at physiological temperatures, making them suitable for use in vivo, and not merely as research tools (see column 15, lines 18 to 42, of Cech et al., U.S. Patent No. 4,987,071).
  • particularly preferred ribozymes for use within the present invention include hairpin ribozymes (for example, as described by Hampel et al., European Patent Publication No. 0 360 257, published March 26, 1990) and hammerhead ribozymes.
  • sequence requirement for the hairpin ribozyme is any RNA sequence consisting of NNNBN*GUC(N) X (Sequence ID Nos. 4120-4124) (where x is any number from 6 to 10, N*G is the cleavage site, B is any of G, C, or U, and N is any of G, U, C, or A).
  • Representative examples of recognition or target sequences for hairpin ribozymes are set forth below in the Examples.
  • the backbone or common region of the hairpin ribozyme can be designed using the nucleotide sequence of the native hairpin ribozyme (Hampel et al., Nucl. Acids Res.
  • RNA sequence consisting of NUH where N is any of G, U, C, or A and H represents C, U, or A
  • GUC hairpin leader sequence
  • the additional nucleotides of the hammerhead ribozyme or hairpin ribozyme is determined by the target flanking nucleotides and the hammerhead consensus sequence (see Ruffner et al., Biochemistry 29:10695-10702, 1990). This information, along with the sequences and disclosure provided herein, enables the production of hairpin ribozymes of this invention.
  • ribozymes of this invention can be chemically synthesized using methods well known in the art for the synthesis of nucleic acid molecules (see e.g., Heidenreich et al., J. FASEB 70(l):90-6, 1993; Sproat, Curr. Opin. Biotechnol. (l):20-28, 1993).
  • commercial suppliers such as Promega, Madison, Wis., USA, provide a series of protocols suitable for the production of nucleic acid molecules such as ribozymes.
  • ribozymes are prepared from a DNA molecule or other nucleic acid molecule (which, upon transcription, yields an RNA molecule) operably linked to an RNA polymerase promoter, e.g., the promoter for T7 RNA polymerase or SP6 RNA polymerase.
  • an RNA polymerase promoter e.g., the promoter for T7 RNA polymerase or SP6 RNA polymerase.
  • nucleic acid molecules e.g., DNA or cDNA, coding for the ribozymes of this invention.
  • the vector also contains an RNA polymerase promoter operably linked to the DNA molecule, the ribozyme can be produced in vitro upon incubation with the RNA polymerase and appropriate nucleotides.
  • the DNA may be inserted into an expression cassette, such as described in Cotten and Birnstiel, EMBO J. 5(12):3861-3866, 1989, and in Hempel et al., Biochemistry 25:4929-4933, 1989.
  • an expression cassette such as described in Cotten and Birnstiel, EMBO J. 5(12):3861-3866, 1989, and in Hempel et al., Biochemistry 25:4929-4933, 1989.
  • a more detailed discussion of molecular biology methodology is disclosed in Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, 1989.
  • the ribozyme can be modified by ligation to a DNA molecule having the ability to stabilize the ribozyme and make it resistant to RNase (Rossi et al., Pharmac. Ther. 50:245-254, 1991).
  • the ribozyme can be modified to a phosphothio-analog for use in liposome delivery systems. This modification also renders the ribozyme resistant to endonuclease activity.
  • ribozymes to treat restenosis involves introduction of functional ribozyme to the infected cell of interest. This can be accomplished by either synthesizing functional ribozyme in vitro prior to delivery, or, by delivery of DNA capable of driving ribozyme synthesis in vivo. More specifically, within other aspects of the invention the ribozyme gene may be constructed within a vector which is suitable for introduction to a host cell (e.g., prokaryotic or eukaryotic cells in culture or in the cells of an organism). Appropriate prokaryotic and eukaryotic cells can be transfected with an appropriate transfer vector containing the nucleic acid molecule encoding a ribozyme of this invention.
  • a host cell e.g., prokaryotic or eukaryotic cells in culture or in the cells of an organism.
  • Appropriate prokaryotic and eukaryotic cells can be transfected with an appropriate transfer vector containing the nucleic acid molecule encoding a
  • nucleotide sequences coding for ribozymes are preferably placed under the control of a eukaryotic promoter such as pol III (e.g., tRNA or VA-1 from adenovirus), CMV, SV40 late, or SV40 early promoters.
  • a eukaryotic promoter such as pol III (e.g., tRNA or VA-1 from adenovirus), CMV, SV40 late, or SV40 early promoters.
  • the promoter may be a tissue or cell-specific promoter. Ribozymes may thus be produced directly from the transfer vector in vivo.
  • vectors may be utilized within the context of the present invention, including for example, plasmids, viruses, retrotransposons and cosmids.
  • Representative examples include adenoviral vectors (e.g., WO 94/26914, WO 93/9191 ; Yei et al., Gene Therapy 7:192-200, 1994; Kolls et al, PNAS 9i(l):215-219, 1994; Kass-Eisler et al., PNAS 90(24): 11498-502, 1993; Guzman et al., Circulation 55(6):2838-48, 1993; Guzman et al., Cir. Res.
  • adenoviral vectors e.g., WO 94/26914, WO 93/9191 ; Yei et al., Gene Therapy 7:192-200, 1994; Kolls et al, PNAS 9i(l):215-219, 1994; Kass-Eisler et al.,
  • vectors having more than one nucleic acid molecule encoding a ribozyme of this invention each molecule under the control of a separate eukaryotic promoter (or, an Internal Ribosome Entry Site or "IRES") or alternatively, under the control of single eukaryotic promoter.
  • interferon e.g., alpha, beta or gamma
  • facilitators which assist or aid ribozymes in cleaving a target sequence by unwinding or otherwise limiting secondary folding which might otherwise inhibit the ribozyme (see Example 4).
  • Host prokaryotic and eukaryotic cells stably harboring the vectors described above also are provided by this invention.
  • Suitable host cells include bacterial cells, rat cells, mouse cells, and human cells.
  • ribozyme molecules may be introduced into a host cell utilizing a vehicle, or by various physical methods.
  • Representative examples of such methods include transformation using calcium phosphate precipitation (Dubensky et al., PNAS 57:7529-7533, 1984), direct microinjection of such nucleic acid molecules into intact target cells (Acsadi et al., Nature 352:815-818, 1991), and electroporation whereby cells suspended in a conducting solution are subjected to an intense electric field in order to transiently polarize the membrane, allowing entry of the nucleic acid molecules.
  • nucleic acid molecules linked to an inactive adenovirus include the use of nucleic acid molecules linked to an inactive adenovirus (Cotton et al., PNAS 59:6094, 1990), lipofection (Feigner et al., Proc. Natl. Acad. Sci. USA 54:7413-7417, 1989), microprojectile bombardment (Williams et al, PNAS 55:2726-2730, 1991), polycation compounds such as polylysine, receptor specific ligands, liposomes entrapping the nucleic acid molecules, spheroplast fusion whereby E.
  • coli containing the nucleic acid molecules are stripped of their outer cell walls and fused to animal cells using polyethylene glycol, viral transduction, (Cline et al., Pharmac. Ther. 29:69, 1985; and Friedmann et al, Science 244:1215, 1989), and DNA ligand (Wu et al, J. of Biol. Chem. 264: 16985- 16987, 1989).
  • the ribozyme is introduced into the host cell using a liposome.
  • additional therapeutic molecules e.g., interferon
  • facilitators may be delivered utilizing the methods described herein. Such delivery may be either simultaneous to, or before or after the delivery of a ribozyme or vector expressing ribozymes.
  • compositions also are provided by this invention.
  • These compositions contain any of the above described ribozymes, DNA molecules, vectors or host cells, along with a pharmaceutically or physiologically acceptable carrier, excipient, or, diluent.
  • a pharmaceutically or physiologically acceptable carrier such as ascorbic acid, low molecular weight (less than about 10 residues) polypeptides, proteins, amino acids, carbohydrates including glucose, sucrose or dextrins, chelating agents such as EDTA, glutathione and other stabilizers and excipients.
  • Neutral buffered saline or saline mixed with nonspecific serum albumin are exemplary appropriate diluents.
  • Particularly preferred carriers include cholesterols such as DOTAPxholesterol.
  • compositions of the present invention may also be prepared to contain, or express (e.g., if a vector), one or more additional therapeutic molecules (e.g., interferon) or facilitators.
  • additional therapeutic molecules e.g., interferon
  • compositions of the present invention may be prepared for administration by a variety of different routes, including for example, intravenously (e.g., into a vein by balloon catheter), or [on the outside of the vein].
  • pharmaceutical compositions of the present invention may be placed within containers, along with packaging material which provides instructions regarding the use of such pharmaceutical compositions.
  • such instructions will include a tangible expression describing the reagent concentration, as well as within certain embodiments, relative amounts of excipient ingredients or diluents (e.g., water, saline or PBS) which may be necessary to reconstitute the pharmaceutical composition
  • Pharmaceutical compositions are useful for both diagnostic or therapeutic purposes.
  • restenosis may be treated or prevented by administering to a warm-blooded animal (e.g., a human) a therapeutically effective amount of ribozyme, and/or, nucleic acid molecule or vector which encodes the ribozyme.
  • a warm-blooded animal e.g., a human
  • nucleic acid molecule or vector which encodes the ribozyme.
  • such methods may be utilized to treat restenosis in vascular tissue; however, other tissues where stenosis is a problem may similarly be treated.
  • Such methods require contacting desired cells with an effective amount of ribozyme of this invention or, alternatively, by transducing the cell with an effective amount of vector having a nucleic acid molecule encoding the ribozyme.
  • a suitable "therapeutically effective amount” will depend on the nature and extent of diseased tissue being treated, or, if a medical procedure is contemplated in which restenosis can be expected, prevented. Such "therapeutically effective amounts” can be readily determined by those of skill in the art using well known methodology, and suitable animal models (e.g. a rat or porcine model), or, based upon clinical trials. As utilized herein, a patient is deemed “treated” if restenosis is reversed or inhibited within a patient in a quantifiable manner.
  • RNA molecule can be embedded within a stable RNA molecule or in another form of protective environment, such as a liposome.
  • the RNA can be embedded within RNase-resistant DNA counterparts.
  • the target cell is transduced under conditions favoring insertion of the vector into the target cell and stable expression of the nucleic acid encoding the ribozyme.
  • the target cell can include but is not limited to vascular smooth muscle cells.
  • Ribozymes, ribozyme genes, and vectors encoding such genes may readily be delivered to a desired site by a variety of methods, including for example, by balloon catheter, by stent, or by microinjection (see, e.g., U.S. Patent Nos. 5,840,064, 5,836,905 and 5,833,659). Further, the ribozyme, gene, or vector may be delivered transluminally, within the smooth muscle cells of the lumen, or exoluminally. In addition, the ribozyme, ribozyme gene or vector may be readily incorporated into a biodegradable polymer, sphere, pleuroinc gel, or the like to aid incorporation into cells.
  • Hairpin ribozymes suitable for use within the present invention preferably recognize the following sequence of RNA: NN BNGUCNNXtsfNNNN (SEQ ID NO:4122) wherein the ribozyme is constructed so as to be complementary to the underlined sequences, and wherein B is C, G or U.
  • the sequence GUC must be conserved for all hairpin ribozymes described below.
  • Other nucleotides (“N" as underlined above) preferably have a high degree of sequence conservation in order to limit the need for multiple ribozymes against the same target site. Representative GUC hairpin ribozyme recognition sites for various genes are provided below in Tables 1-4.
  • Hammerhead ribozymes suitable for use within the present invention preferably recognize the sequence NUH, wherein N is any of G, U, C, or A and H is C, U, or A.
  • Representative hammerhead target sites include:
  • Two single-stranded DNA oligonucleotides are chemically synthesized such that, when combined and converted into double-stranded DNA, they contain the entire hairpin ribozyme, including nucleotides complementary to the target site.
  • restriction enzyme recognition sites may be placed on either end to facilitate subsequent cloning. More specifically, the oligonucleotides are hybridized together and converted to double-stranded DNA using either Klenow DNA polymerase or Taq DNA polymerase. The resulting DNA is cleaved with restriction enzymes BamHl and Mlul, purified and cloned into vectors for in vitro transcription (pGEM, ProMega.
  • ribozymes are set forth below (note that the underlined sequences indicate the sites wherein the ribozyme binds the target sequence):
  • Cycl i n Bl 281 (Sequence I . D . No . 4379) 5 ' CTGGCTCAAGAACTGGACCAGAGAAACACACG ⁇ GTGGTATA ⁇ ACCTGGTA 3 '
  • Lysyl Oxi dase 333 (Sequence I . D . No . 4380 )
  • PCNA 158 (Sequence I . D . No . 4381 )
  • Defective ribozymes for use as controls may be constructed as described above, with the exception that the sequence AAA is changed to a UGC as shown in Figure 2.
  • EXAMPLE 3 CONSTRUCTION OF HAMMERHEAD RIBOZYMES
  • Chimeric hammerhead ribozymes are designed to have an appropriate NUH sequence for ribozyme cleavage.
  • Ribozymes are chemically synthesized with the general structure shown in figure 1.
  • the binding arms bases and stem loop comprise DNA, and the catalytic domain comprises RNA and/or 2'0 methyl RNA bases.
  • Specific examples of synthetic human hammerhead ribozymes targeting PCNA are shown below (DNA bases shown in upper case, RNA bases as lower case, and 2' O methyl RNA as lower case italics):
  • RNA bases enhances the stability of the chimeric ribozymes in human vascular smooth muscle cell lysate, and in serum.
  • the assay consists of incubating 10 ⁇ g of ribozyme with 100 ⁇ l of human vascular smooth muscle cell lysate at 37°C for times ranging from 30 seconds to 240 minutes, then separating the intact ribozyme from degradation products on a 15% PAGE, staining with SYBRgreen (Molecular Probes, Eugene, OR), and quantifying by phosphorimager analysis (Molecular Dynamics).
  • the half-life in cell lysate was increased sequentially from approximately 2.5 hours for PN30003, to 3.5 hours for PN30004, and to greater than 10 hours for PN30005 (figure 2).
  • the half-life of PN30003 is less than 30 seconds.
  • Specific base modifications to ribozyme PN30005 increased the half-life in serum to greater than 4 hours (figure 3).
  • a scrambled sequence polynucleotide including the same composition of ribonucleotides and deoxyribonucleotides is also synthesized for each ribozyme to serve as a control with no catalytic activity.
  • Lipofectin may be utilized to enhance the uptake of ribozyme into the cells.
  • Plasmid pMJT (Yu et al., Proc. Nat 'I Acad. Sci. USA 90:6340-6344,
  • Hairpin or hammerhead ribozymes are tested for cleavage activity in an in vitro assay.
  • Ribozyme and substrate synthesis is achieved by a new method of plasmid-independent in vitro transcription (Welch et al 1997). Briefly, oligonucleotides are synthesized (Retrogen, San Diego CA) with the T7 RNA polymerase promoter sequence contiguous with the ribozyme or substrate sequences, to allow for in vitro transcription of annealed oligonucleotides without the need for plasmid cloning.
  • Liposomes are used to encapsulate the ribozymes for delivery at the site of injury.
  • Preferred liposomes include
  • the histopathology sections are then subsequently analyzed by quantitative histology.
  • the lumen area, area of the intima and area of the media are measured and intimal area to medial area ration is calculated. All values are expressed as mean ⁇ standard deviation and mean ⁇ standard errors of mean. A statistical comparison for each of these parameters is performed between all the groups. Results of the quantitative histology are shown in Figures 6 and 7 and summarized in Table 12. Briefly, both the cross-sectional area of the intima and the ratio of the intimal area to medial area were significantly reduced in the ribozyme treated arteries compared with those treated with scrambled-sequence polynucleotides or with normal saline. The intimal hyperplasia was inhibited by the CDC-2 kinase ribozyme, the PCNA ribozyme and their combination. The combination did not seem to have any additive effect.
  • SMC Smooth muscle cells
  • MTT assay This is a quantitative colorimetric assay for cell proliferation and survival. Rat SMC's (passage 4-8) are seeded into 96 well plate (1500 cells/well) one day before treatment. Cells are then treated with 2 mM of
  • CDC-2 kinase/PCNA ribozyme and 4 mM lipofectin for 1 hour.
  • a second dose of ribozyme (4 mM) is added on day 2.
  • 10 mL of MTT is added into each well for 4 hours.
  • the dye in the cells is extracted in DMSO after washing off any supernatant dye from the well. The OD is measured with microplate reader at 590 mM.
  • the MTT assay using PCNA ribozyme demonstrates significant inhibition of cell proliferation in cell culture as measured by uptake of MTT in comparison to scrambled sequence treated cells and control cells.
  • RNA-PCR is then performed utilizing RNA-PCR kit from Perkin Elmer.
  • An appropriated primer sequence for CDC-2 kinase or PCNA is used for analysis.
  • a beta-actin primer is used to ensure that the amount of RNA loaded in each well is approximately equal.
  • CDC-2 kinase mRNA at 2 hours and further reduction at 6 hours in comparison to controls.
  • RT-PCR is performed using a primer for beta-actin which shows similar levels of beta-actin mRNA in each group.
  • Protein Expression Three types of protein assays may also be accomplished, including a) Western blotting; b) Biosynthetic labeling with 35S labeled methionine followed by immunoprecipitation of radiolabelled protein as a measure of newly synthesized target protein; and c) Histone HI kinase assay for CDC-2 kinase.
  • the Histone HI kinase assay is a functional assay for CDC-2 kinase and measures the amount of p32 labeled phosphate transferred from ATP to Histone H 1.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Organic Chemistry (AREA)
  • Chemical & Material Sciences (AREA)
  • Biotechnology (AREA)
  • Molecular Biology (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Virology (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Physics & Mathematics (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Acyclic And Carbocyclic Compounds In Medicinal Compositions (AREA)

Abstract

Pour permettre une thérapie efficace contre la resténose, la présente invention concerne des ribozymes et des systèmes d'administration de ces ribozymes qui sont utiles pour le traitement et pour la prévention de la resténose. Cette invention concerne aussi des méthodes de production de ribozymes et une thérapie génique qui utilise ces ribozymes.
EP99968074A 1998-12-04 1999-12-06 Ribozymotherapie destinee au traitement et/ou a la prevention de la restenose Withdrawn EP1147189A2 (fr)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US11095498P 1998-12-04 1998-12-04
US110954P 1998-12-04
PCT/US1999/028772 WO2000032765A2 (fr) 1998-12-04 1999-12-06 Ribozymotherapie destinee au traitement et/ou a la prevention de la restenose

Publications (1)

Publication Number Publication Date
EP1147189A2 true EP1147189A2 (fr) 2001-10-24

Family

ID=22335836

Family Applications (1)

Application Number Title Priority Date Filing Date
EP99968074A Withdrawn EP1147189A2 (fr) 1998-12-04 1999-12-06 Ribozymotherapie destinee au traitement et/ou a la prevention de la restenose

Country Status (3)

Country Link
EP (1) EP1147189A2 (fr)
AU (1) AU2476200A (fr)
WO (1) WO2000032765A2 (fr)

Families Citing this family (14)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6770633B1 (en) 1999-10-26 2004-08-03 Immusol, Inc. Ribozyme therapy for the treatment of proliferative skin and eye diseases
JP2003530309A (ja) * 1999-10-26 2003-10-14 イミューソル インコーポレイテッド 増殖性皮膚疾患又は増殖性眼疾患を治療するリボザイム療法
US6492173B1 (en) * 2001-08-01 2002-12-10 Isis Pharmaceuticals, Inc. Antisense inhibition of cyclin D2 expression
US9839649B2 (en) 2002-11-14 2017-12-12 Thermo Fisher Scientific Inc. Methods and compositions for selecting siRNA of improved functionality
US9879266B2 (en) 2002-11-14 2018-01-30 Thermo Fisher Scientific Inc. Methods and compositions for selecting siRNA of improved functionality
US9228186B2 (en) 2002-11-14 2016-01-05 Thermo Fisher Scientific Inc. Methods and compositions for selecting siRNA of improved functionality
US10011836B2 (en) 2002-11-14 2018-07-03 Thermo Fisher Scientific Inc. Methods and compositions for selecting siRNA of improved functionality
US9719092B2 (en) 2002-11-14 2017-08-01 Thermo Fisher Scientific Inc. RNAi targeting CNTD2
US9771586B2 (en) 2002-11-14 2017-09-26 Thermo Fisher Scientific Inc. RNAi targeting ZNF205
WO2006006948A2 (fr) 2002-11-14 2006-01-19 Dharmacon, Inc. Methodes et compositions permettant de selectionner des arnsi presentant une fonctionnalite amelioree
US9719094B2 (en) 2002-11-14 2017-08-01 Thermo Fisher Scientific Inc. RNAi targeting SEC61G
WO2004060346A2 (fr) 2002-12-30 2004-07-22 Angiotech International Ag Liberation de medicaments a partir d'une composition polymere a gelification rapide
US8029984B2 (en) 2003-08-08 2011-10-04 Licentia, Ltd. Materials and methods for colorectal cancer screening, diagnosis and therapy
US7427605B2 (en) * 2005-03-31 2008-09-23 Calando Pharmaceuticals, Inc. Inhibitors of ribonucleotide reductase subunit 2 and uses thereof

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5821234A (en) * 1992-09-10 1998-10-13 The Board Of Trustees Of The Leland Stanford Junior University Inhibition of proliferation of vascular smooth muscle cell
US5834440A (en) * 1994-03-07 1998-11-10 Immusol Incorporated Ribozyme therapy for the inhibition of restenosis

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO0032765A3 *

Also Published As

Publication number Publication date
WO2000032765A2 (fr) 2000-06-08
AU2476200A (en) 2000-06-19
WO2000032765A3 (fr) 2000-11-16
WO2000032765A9 (fr) 2002-08-29

Similar Documents

Publication Publication Date Title
Christoffersen et al. Ribozymes as human therapeutic agents
Birikh et al. The structure, function and application of the hammerhead ribozyme
US5817796A (en) C-myb ribozymes having 2'-5'-linked adenylate residues
US6770633B1 (en) Ribozyme therapy for the treatment of proliferative skin and eye diseases
US20050227937A1 (en) Method and reagent for the treatment of diseases or conditions related to levels of vascular endothelial growth factor receptor
JP2011513238A (ja) 平滑筋の増殖および分化を調節するマイクロｒｎａならびにこれらの使用
EP1147189A2 (fr) Ribozymotherapie destinee au traitement et/ou a la prevention de la restenose
US5834440A (en) Ribozyme therapy for the inhibition of restenosis
WO2017087828A1 (fr) Procédé permettant de moduler la différenciation de cellules de muscles lisses
WO2008099396A1 (fr) Utilisation d'agents à base d'acides nucléiques réduisant h19 au silence pour traiter la resténose
EP1223950B1 (fr) Therapie ribozymique destinee au traitement de maladies proliferativess des yeux
EP1385948B1 (fr) Acides nucleiques pour inhiber l'expression de proteines hairless et leurs methodes d'utilisation
US6656731B1 (en) Nucleic acid catalysts with endonuclease activity
EP1086212A2 (fr) Procede et reactifs pour le traitement de maladies ou d'affections associees a des molecules impliquees dans les reactions angiogeniques
JP2002541795A (ja) 核酸分子を用いるリプレッサー遺伝子の制御
EP0750503A1 (fr) Therapie a base de ribozymes pour traiter la restenose
AU3986201A (en) Method and reagent for the inhibition of grid
AU769175B2 (en) Method and reagent for the treatment of diseases or conditions related to levels of vascular endothelial growth factor receptor
EP1676915A2 (fr) Therapie ribozymique pour le traitement des maladies proliferatives de la peau
Simons Antisense approach to restenosis
WO1999055856A2 (fr) Enzyme d'acide nucleique de coupure d'un arn
EP1025221A2 (fr) RIBOZYMES CIBLEES SUR ErbB-4
MXPA00009431A (es) Metodos y reactivos para el tratamiento de enfermedades o condiciones relacionadas con moleculas involucradas en respuestas angiogenicas
AU2005203307A1 (en) Proliferative skin diseases

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20010809

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE

AX Request for extension of the european patent

Free format text: AL;LT;LV;MK;RO;SI

17Q First examination report despatched

Effective date: 20040310

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20050826