EP1144659A2 - Facteurs trans-activateurs de levures - Google Patents

Facteurs trans-activateurs de levures

Info

Publication number
EP1144659A2
EP1144659A2 EP00900689A EP00900689A EP1144659A2 EP 1144659 A2 EP1144659 A2 EP 1144659A2 EP 00900689 A EP00900689 A EP 00900689A EP 00900689 A EP00900689 A EP 00900689A EP 1144659 A2 EP1144659 A2 EP 1144659A2
Authority
EP
European Patent Office
Prior art keywords
yeast
ura
trans
gene
acting
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP00900689A
Other languages
German (de)
English (en)
Inventor
Agustin Aranda Fernandez
Ingo Harald Greger
Nicholas Jarvis Proudfoot
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Oxford University Innovation Ltd
Original Assignee
Oxford University Innovation Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Oxford University Innovation Ltd filed Critical Oxford University Innovation Ltd
Publication of EP1144659A2 publication Critical patent/EP1144659A2/fr
Withdrawn legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
    • C12N15/81—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/37—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from fungi
    • C07K14/39—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from fungi from yeasts
    • C07K14/395—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from fungi from yeasts from Saccharomyces

Definitions

  • the present invention is concerned with methods to identify trans-acting factors that modulate termination of transcription in yeast and DNA constructs which are useful for such methods.
  • RNA polymerase II Transcriptional termination of RNA polymerase II is an important event in the transcription of protein- coding genes in eukaryotes.
  • Two main signals are involved in this process: an upstream polyadenylation (poly (A)) signal and a downstream element (DSE) .
  • poly (A) signals have been demonstrated to play a central role in transcription termination, the mechanism by which they regulate this process is still largely unclear. Transcription of a gene by RNA polymerase II progresses downstream of the transcription unit of the gene, generating an extended pre-mRNA transcript. Poly (A) signals have been shown to activate trans-acting factors which cleave and polyadenylate this pre-mRNA. Recent evidence has suggested that poly (A) signals may induce RNA polymerase II to terminate transcription as a consequence of the cleavage reaction (Birse et al . (1998) 28: 298-301) . DSEs, which are located in the region where transcription terminates, act as RNA polymerase II pausing signals increasing the efficiency of transcriptional termination. Their ability to pause RNA polymerase II may be either intrinsic to their DNA sequence, whereby the sequence induces a particular structural feature in the DNA itself (Kerppola et al.
  • DSEs may also be described as pause elements .
  • RNA polymerase II continues transcription beyond the normal termination site and may reach a downstream gene. This can result in "transcriptional interference", with inhibition of binding of transcription factors to the promoter of the downstream gene and consequent partial or complete suppression of its expression (Irniger et al (1991) Nucleic Acids Res. 20: 4733-4739; Cullen et al. (1984) Nature 307: 241-245). Impairment of transcription termination has also been shown to inhibit transmission of eukaryotic chromosomes (Hill et al.(1987) Mol. Cell. Biol. 7: 2397-2405) and meiotic gene conversion (Rocco et al . (1992) Proc. Natl. Acad. Sci. USA 89: 12068-12072).
  • Yeast is particularly sensitive to transcriptional interference because of the very compressed nature of its genome (Oliver et al . (1992) Nature 357: 38-46). Knowledge of the factors that regulate transcription termination and of the genes from which these are encoded would thus be particularly useful for the development of new anti- fungal chemicals.
  • the present inventors have thus developed genetic constructs and yeast transformed therewith which can be used in the identification of such factors and the elucidation of the transcription termination regulatory process in yeast.
  • the present invention provides improved methods to identify trans-acting factors that modulate transcription termination of RNA polymerase II in yeast.
  • the particular embodiments of the invention utilise the GAL1 , GAL1 0, GAL 7 gene cluster and the ura 4 gene of Sa ccharomyces which have been modified so that they can signal changes in transcription termination events.
  • trans-acting factor refers to a protein which is involved in the regulation of the termination of transcription performed by polymerase II in yeast.
  • polymerase II refers to yeast RNA polymerase II which transcribes protein encoding genes, often referred to as "PolII" genes.
  • reporter gene refers to a yeast gene wherein the specific expression or non-expression generates an early selectable phenotype.
  • cis-mutation or "cis-acting mutation” refers to a mutation that modulates termination of transcription of the gene in which it occurs.
  • trans-mutation or "trans-acting mutation” refers to a mutation that modulates termination of transcription of a gene different from that in which it occurs.
  • synthetic intron refers to a sequence of nucleotides that, although does not correspond to the sequence any known naturally occurring intron, when it is inserted into a gene behaves as an intron, being removed from the transcipt and thus leading to the production of a functional mRNA from said gene.
  • GAL1 , GAL10 and GAL 7 form the GAL gene cluster in S. cerevisiae and are responsible for the metabolic conversion of galactose to glucose-6-phosphate . It has been previously demonstrated that, in Saccharomyces cerevisiae, deletions in the GAL10 polyadenylation signal causes transcriptional interference and dramatically reduces GAL7 expression (Greger, I. H. and Proudfoot, N. J. (1998) EMBO J. 17: 4771-4779) . Yeast cells in which GAL 7 expression has been abolished are not viable on a galactose- containing medium because of the toxic effect of the metabolic intermediate galactose-1-phosphate (Douglas, H.C. et al. (1964) Genetics 49: 837-844).
  • the present inventors have made use of the existence of transcriptional interference between GAL7 and GAL10 genes and have developed a method that allows isolation of trans-acting factors involved in transcriptional termination.
  • the invention provides a method for identifying trans-acting factors capable of modulating termination of transcription in yeast which method comprises:
  • step (c) screening said revertants for the presence of cis-acting mutations or trans-acting mutations, (d) preparing (i) a plasmid library of genome fragments from revertants comprising transacting mutations and/or (ii) a plasmid library of genome fragments from the Saccharomyces strain of step (a) ,
  • step (e) transforming (i) each member of the plasmid library of step (d) (i) into a Saccharomyces strain as provided in step (a) and/or (ii) each member of the plasmid library of step (d) (ii) into Saccharomyces revertants containing transacting mutations identified in step (c) ,
  • step (f) screening the transformants of step (e) for capability of growth on galactose
  • any transformant from step (e) (i) capable of growth on galactose will comprise a mutated variant of a DNA encoding a trans-acting factor capable of modulating termination of transcription
  • any transformant of step (e) (ii) incapable of growth on galactose will comprise a DNA encoding a trans-acting factor capable of modulating termination of transcription in yeast.
  • This method of the invention will be hereinafter referred to as the GAL method.
  • the Saccharomyces strain to be used in the GAL method may be obtained by transforming a gall 0 ' /gal 7 ⁇ strain with a plasmid comprising a GAL 7 gene and a termination signal-defective GAL10 gene.
  • a plasmid comprising a GAL 7 gene and a termination signal-defective GAL10 gene.
  • transcription termination of the GAL10 gene has been impaired by partial or complete deletion of the polyadenylation signal.
  • Any plasmid suitable for transformation in yeast cells may be utilised to construct the Sa ccharomyces strain.
  • the GAL 7-10 insert is introduced into the plasmid using standard techniques well known in the art and described in Sambrook et al. (1989) Molecular Cloning: A Laboratory Manual; Cold Spring Harbor Press.
  • the plasmid may be transformed into yeast cells employing any standard technique known in the art.
  • Revertants which are identified by their ability to grow in the presence of galactose, may be obtained by incorporating a mutagen, for example ethidium bromide, into the culture medium. This chemical also blocks aerobic respiration and thus facilitates discrimination between GAL7 + and GAL 7 ' yeast cells. However, spontaneous revertants may also be obtained in the absence of any mutagen.
  • a mutagen for example ethidium bromide
  • Revertant strains may arise from mutations in the GAL10- 7 region (cis-acting) or as a result of mutations in genes that indirectly prevent transcriptional interference of GAL 7 ( trans-acting) . Any method known in the art may be used to screen revertants for the presence of cis- or trans- mutations. For example, if the starting yeast strain used in step (a) contains a plasmid comprising a GAL10- 7 insert then the plasmid may be isolated from the revertants and transformed into a gall 0 ⁇ /gal 7 ' strain.
  • the ability of the transformed strain to grow on a galactose-containing medium may then be assayed, the GAL 7 + phenotype being indicative of a cis-mutation whilst a GAL7 ' phenotype is indicative of a transmutation.
  • Revertants containing trans-acting mutations may be further analysed in order to identify the mutant gene or genes which may encode trans-acting factors associated with transcriptional termination. Two different procedures which may be used for this purpose are described below. The first procedure is particularl suitable for use when the revertant carries a dominant mutation, the second when the revertant carries a recessive mutation.
  • a genomic library most preferably a plasmid-based genomic library, is prepared from a revertant containing a trans-acting mutation and this is transformed back into the starting Saccharomyces strain, described above.
  • the phenotype of the transformed Sa ccharomyces strain is then assessed.
  • Colonies that show a GAL + phenotype will contain a plasmid comprising a mutated variant of a DNA encoding a trans-acting factor capable of modulating termination of transcription, the mutated variant carrying a dominant trans-acting mutation.
  • a genomic library most preferably a plasmid-based genomic library, is prepared from the starting Saccharomyces strain described above and transformed into the revertants carrying trans-acting mutations. The ability of the transformants to grow on galactose is then assessed. Colonies showing a GAL ' phenotype will contain a plasmid comprising a DNA encoding a trans-acting factor capable of modulating termination of transcription. This method allows the identification of trans-acting factors from revertants characterised by recessive trans-acting mutations. In both procedures, the plasmid is purified and the genomic fragment contained therein sequenced in order to identify the relevant gene.
  • the revertant may first be analysed to determine whether the mutation is dominant or recessive.
  • the mutation may be introduced into a diploid strain by mating the revertant haploid strain with the starting haploid Sa ccharomyces strain described above and the phenotype of the resulting diploid strain assessed. Diploids with a mutant phenotype, capable of growing on galactose, are indicative of the presence of a dominant mutation while diploids with a wild-type phenotype, incapable of growing on galactose, are indicative of the presence of a recessive mutation.
  • the invention in a second aspect relates to DNA constructs comprising a yeast reporter gene into which is inserted means of prematurely terminating transcription of the reporter gene when said construct is transformed into a yeast cell.
  • a DNA construct which comprises a yeast reporter gene having inserted within an intron thereof a polyadenylation signal and downstream of said polyadenylation signal at least one yeast polymerase II pause element.
  • the intron may be one which naturally occurs in the reporter gene or may be artificially inserted into the reporter gene by a recombination event, which is always the case when the reporter gene does not contain any intron.
  • An intron suitable for insertion into the reporter gene may be either isolated from another yeast gene or artificially constructed.
  • a suitable synthetic intron is one having the sequence of nucleotides set forth in Figure 1 but comprising a polyadenylation signal inserted into the Stu I site and a polymerase II pause element inserted into the Xho I site.
  • a polyadenylation signal that may be used in the DNA construct of the invention is a ura 4 polyadenylation signal which may be obtained, as an example, by amplifying ura 4 DNA with the following primers : 5' -TTTGGTTGGTTATTGAAA 5' -CTACATGGTATTTTACAT and digesting the amplification product with the restriction enzymes Styl and Rsa l.
  • yeast polymerase II pause element is inserted in the intron downstream of the polyadenylation signal in forward orientation.
  • Suitable yeast polymerase II pause elements may be derived from the yeast ura 4 or nmt2 gene.
  • Such polymerase II pause elements have the following sequences : ura 4 : 5' -ATGTAAAATACCATGTAG nmt2 :
  • the DNA construct comprises as a yeast reporter gene the ura 4 gene of Saccharomyces pombe (described in Humphrey et al. (1994) EMBO J. 13: 2331-2451) into which the above described intron has been introduced, for example, into the unique Stul site.
  • Preferred DNA constructs comprising the ura 4 gene are, for example, the pUIpA+ura4 or pUIpA+n/nt2 constructs described in Example 1.
  • a DNA construct which comprises a single yeast reporter gene having inserted therein a synthetic intron, said synthetic intron containing a yeast polyadenylation signal which is ineffective at preventing transcription of the full reporter gene.
  • said synthetic intron has a restriction site downstream of said polyadenylation signal suitable for the insertion of a yeast polymerase II pause element.
  • a suitable synthetic intron is, for example, one having the sequence cf nucleotides set forth in Figure 1 but comprising a polyadenylation signal inserted into a Stul site.
  • a suitable yeast polyadenylation signal is the ura 4 polyadenylation signal described above. As will be demonstrated in Example 2 below, when this polyadenylation signal is inserted into an intron its terminating activity is reduced to a minimal level and termination of transcription does not occur unless a polymerase II pause element is inserted downstream thereof.
  • the yeast reporter gene is the ura 4 gene of Sa ccharomyces pombe into which a synthetic intron has been introduced, for example, into a Stul site.
  • a preferred DNA construct is the pUIpA construct described in Example 1.
  • the invention also provides yeast cells, preferably S . pombe cells, lacking a functional genomic copy of a reporter gene that have been transformed with the above described DNA constructs containing said reporter gene.
  • the reporter gene is ura 4
  • ura 4 ' Sa ccharomyces cells are utilised, preferably ura 4 ' Sa ccharomyces pombe cells.
  • the ura 4 gene encodes for the enzyme orotidine 5' -phosphate decarboxylase that is essential for the biosynthesis of uracil.
  • 5-fluoro orotic acid an analog of its natural substrate
  • the enzyme leads to the production of 5- fluoro uracil, which is toxic to the yeast cells.
  • an expressed or non-expressed ura4 gene provides the necessary selectable phenotype.
  • yeast cells are able to grow in the absence of galactose but die in the presence 5-FOA if the enzyme is correctly expressed while they die in the absence of exogenous uracil but can grow in the presence of 5- FCA if expression of the enzyme is inhibited.
  • the invention provides a method for the identification of trans-acting factors capable of modulating transcription in yeast which method comprises:
  • step (d) preparing (i) a plasmid library of genome fragments from revertants comprising transacting mutations and/or (ii) a plasmid library of genome fragments from the Saccharomyces strain of step (a) ,
  • step (e) transforming (i) each member of the plasmid library of step (d) (i) into a Sa ccharomyces strain as provided in step (a) and/or (ii) each member of the library of step (d) (ii) into Saccharomyces revertants containing trans-acting mutations identified in step
  • step (e) screening the transfor ants of step (e) for the presence of ura + or ura ⁇ phenotype by culturing them in the absence of uracil or/and in the presence of uracil and 5-FOA,
  • any reverted transformant of step (e) (i) that displays a ura 4 + phenotype will contain a plasmid comprising a mutated variant of a DNA encoding a trans-acting factor capable of modulating termination of transcription in yeast whereas any transformant of step (e) (ii) that displays a ura 4 ⁇ phenotype will contain a wild-type DNA encoding a trans-acting factor capable of modulating termination of transcription in yeast .
  • a preferred Saccharomyces strain for use in the ura4 method is Saccharomyces pombe .
  • revertants capable of growing in the absence of uracil are obtained by incorporating in the medium a mutagen such as ethidium bromide.
  • spontaneous revertants may also be obtained in the absence of any mutagen .
  • the reporter gene DNA construct may be isolated from said revertants and transformed into a ura 4 ⁇ Saccharomyces strain. The apability of the transformed strain to grow in the absence of uracil may then be assayed, a ura 4 + phenotype being indicative of a cis-mutation whilst a ura 4 ⁇ phenotype is indicative of a trans-mutation.
  • revertants containing trans-acting mutations may be further analysed in order to identify the mutant gene or genes, which may encode trans- acting factors associated with transcriptional termination.
  • the following procedures may be used for this purpose, the choice of procedure depending on the dominant or recessive nature of the trans-mutation.
  • a genomic library most preferably a plasmid-based genomic library, is prepared from revertants containing trans-mutations and this is transformed into the starting Saccharomyces strain described above.
  • the phenotype of the the transformed Sa ccharomyces strain is then assessed.
  • Colonies that display a ura 4 + phenotype will contain a plasmid comprising a mutated variant of a DNA encoding a trans-acting factor capable of modulating termination of transcription.
  • a genomic library again most preferably a plasmid-based genomic library, is prepared from the Sa ccharomyces strain described above and this is transformed into revertants found to contain a trans-mutation. The capability of the transformants to grow in the absence of uracil is then assessed. Colonies showing a ura ⁇ phenotype will contain a plasmid comprising a DNA encoding a transacting factor capable of modulating termination of transcription.
  • the plasmid is then purified and the genomic fragment contained therein sequenced in order to identify the relevant gene or genes.
  • a variant ura4 method may be developed in order to identify trans-acting factors that modulate transcription at the level of poly (A) signals. Accordingly, in a further aspect the invention provides a method for the identification of transacting factors capable of modulating termination of transcription in yeast which method comprises:
  • step (d) preparing (i) a plasmid library of genome fragments from revertants comprising transacting mutations and/or (ii) a plasmid library of genome fragments from the Sa ccharomyces strain of step (a) ,
  • step (e) transforming (i) each member of the plasmid library of step (d) (i) into a Sa ccharomyces strain as provided in step (a) and/or (ii) each member of the plasmid library of step (d) (ii) into a Sa ccharomyces revertant containing trans-acting mutations identified i step (c) ,
  • step (e) screening the transformants of step (e) for the presence of a ura ⁇ or ura ⁇ phenotype by culturing them in the absence of uracil or/and in the presence of uracil and 5-FOA,
  • any reverted transformant of step (e) (i) that displays a ura 4 ⁇ phenotype will contain a plasmid comprising a mutated variant of a DNA encoding a trans-acting factor capable of modulating termination of transcription in yeast whereas any transformant of step (e) (ii) that displays a ura 4 ⁇ phenotype will contain a DNA encoding a trans-acting factor capable of modulating termination of transcription in yeast.
  • This method will be hereinafter referred to as the variant ura4 method.
  • a preferred Saccharomyces strain for use in the variant ura4 method is Saccharomyces pombe .
  • revertants are obtained by incorporating into the medium a mutagen such as ethidium bromide.
  • spontaneous revertants may also be obtained in the absence of any mutagen.
  • Different techniques may be used to screen revertants for the presence of cis-acting or transacting mutations.
  • the DNA construct may be isolated from the revertants and transformed into the transformed ura 4 ' Sa ccharomyces strain described above. The ability of the transformed strain to grow on a medium including uracil and 5-FOA may then be assayed, a ura 4 ⁇ phenotype being indicative of a cis- acting mutation whilst a ura 4 + phenotype is indicative of a trans-acting mutation.
  • revertants containing trans-acting mutations may be further analysed in order to identify the mutant gene or genes, which may encode transacting factors associated with transcriptional termination.
  • the following procedures may be used for this purpose, the choice of procedure depending on the dominant or recessive nature of the trans-mutation.
  • a genomic library most preferably a plasmid-based genomic library, is prepared from a revertant containing a trans-acting mutation and this is transformed into the Saccharomyces strain displaying a wild type phenotype described above.
  • the phenotype of the transformed Saccharomyces strain is then assessed wherein colonies that show a ura 4 ⁇ phenotype will contain a plasmid comprising a mutated variant of a DNA encoding a trans-acting factor capable of modulating termination of transcription in yeast, the mutated variant carrying a dominant mutation.
  • a genomic library again most preferably a plasmid-based genomic library, is prepared from the Saccharomyces strain described above and transformed into revertants found to contain a trans-acting mutation. The phenotype of the transformants is then assessed. Colonies showing a ura 4 ⁇ phenotype will contain a plasmid comprising a DNA encoding a trans-acting factor capable of modulating termination of transcription in yeast.
  • the plasmid is then purified and the genomic fragment contained therein sequenced in order to identify the relevant gene or genes.
  • Methods similar to the ura4 method or the variant ura4 method may be developed utilising constructs comprising as a yeast reporter gene any other gene the specific expression or non-expression of which generates an early selectable phenotype.
  • the Gal, ura4 and variant ura4 methods can also be used in combination in order to identify with greater reliability trans-acting factors capable of modulating termination of transcription in yeast. Accordingly, in a futher aspect the invention provides a method for the identification of transacting factors capable of modulating termination of transcription in yeast comprising:
  • step (b) transforming a ura 4 ⁇ Sa ccharomyces strain as provided in step (a) of the ura4 method with a plasmid comprising a nucleic acid encoding a trans-acting factor which as been identified in step (a) , and
  • step (c) screening the transformants of step (b) for reversion to ura 4 + phenotype by culturing them in the absence of uracil .
  • the invention provides a methods for the identification of trans-acting factors capable of modulating termination of transcription in yeast comprising:
  • step (b) transforming a ura 4 ⁇ Sa ccharomyces strain as provided in step (a) of the variant ura4 method with a plasmid comprising a nucleic acid encoding a trans-acting factor which has been identified in step (a) , and
  • step (c) screening the transformants of step (b) for reversion to ura 4 ' phenotype by culturing them in the presence of uracil and 5-FOA.
  • the invention provides a method for the identification of trans-acting factors capable of modulating termination of transcription in yeast comprising:
  • step (a) carrying out the variant ura4 method, (b) transforming a Sa ccharomyces strain which has defect in the transcription termination signal of the GAL1 0 gene with a plasmid comprising a nucleic acid encoding the trans-acting factor identified in step (a) , and
  • the invention provides trans-acting factors capable of modulating termination of transcription which have been identified by any of the above described methods.
  • the identification of a trans-acting factor as being involved in modulating termination of transcription with any of the above- described methods is an indication that the factor is yeast-specific and therefore a potential target for anti-fungal intervention.
  • genes and nucleic acids encoding the above described transacting factors are also provided by the invention.
  • the main advantage of using a ⁇ library transformation' approach to identify the gene or genes which are mutated in a trans-revertant identified using the GAL method, the ura4 method or the variant ura4 method is that it leads directly to the isolation of a fragment of yeast genomic DNA containing the relevant gene or genes.
  • One particular trans-acting factor which the inventors have identified using the Ura4 screening method of the invention is the Sa ccha romyces pombe homologue of the well known cleavage/ polyadenylation factor CstF64 (see Figure 3).
  • CstF64 is the protein product of the S .
  • pombe gene designated SPBC3B9.11c.
  • the protein sequence is available under Genbank accession number 2950466, SPTREMBL: 043040.
  • the C-terminal region of CstF64 which is conserved in a wide range of eukaryotic species, may have an important role in transcriptional termination.
  • the inventors In order to investigate the function of the C-terminal domain of the S .
  • pombe CstF64 homologue the inventors have performed a conventional yeast two-hybrid experiment using this region of the protein and have thereby identified a number of proteins which interact with this domain. It is postulated that interactions between the C-terminal domain of the S .
  • pombe CstF64 protein and other proteins which have been shown to directly interact with this domain of the protein may be important in the process of transcription termination. Consequently, chemical compounds which prevent, disrupt or enhance such interactions and thereby modulate the termination of transcription in yeast may have potential antifungal activity.
  • the invention provides a method of identifying compounds which are capable of inhibiting, enhancing or disrupting the binding of the CstF64 protein of Saccharomyces pombe to an interacting protein previously identified as binding to the C-terminal domain of the said CstF64 protein, which method comprises: providing a host cell containing a DNA construct comprising a reporter gene or a counter-selectable marker gene operably linked to a promoter regulated by a transcription factor having a DNA binding domain and an activating domain; expressing in said host cell a first hybrid DNA sequence encoding a first hybrid protein comprising the CstF64 protein or a C-terminal fragment thereof fused in-frame to either the DNA binding domain or the activating domain of the said transcription factor; expressing in said host cell a second hybrid DNA sequence encoding a second hybrid protein comprising an interacting protein or a fragment thereof fused in-frame to either the DNA binding domain or the activating domain of the said transcription factor, such that when the first fusion protein
  • the method of the invention can be carried out using the CstF64 protein, or a fragment thereof including the conserved C-terminal domain (see Figure 3) and any protein or polypeptide which has previously been identified as interacting with the C-terminal domain of CstF64 (referred to hereinafter as an
  • interacting protein or "interacting polypeptide” , or a fragment thereof which includes the region required for interaction with CstF64.
  • the interacting protein will be a protein product of one of the S . pombe genes listed in Table 1, see below. These proteins were identified as interacting with the C-terminal domain of CstF64 using yeast two-hybrid analysis. Nucleotide sequences for each of the genes listed in Table 1, and also amino acid sequences for the corresponding protein products, are all deposited in publicly accessible sequence databases. A list of accession numbers is provided below.
  • the screening method of the invention is itself based upon yeast two-hybrid methodology.
  • yeast two-hybrid system described by Chien et al . , Proc. Natl. Acad. Sci. USA., 88, 9578-9582,
  • yeast two-hybrid system can be used to screen for compounds that inhibit or enhance the interaction between two proteins.
  • a typical screen might be based on the use of a lacZ reporter gene under the control of the gal4 promoter, the read-out of the screen being ⁇ -galactosidase activity which can be easily measured using an appropriate fluorescent or luminescent substrate.
  • This strain also contains the wild-type CYH2 allele under the transcriptional control of the GAL1 promoter.
  • Expression of the wild-type GAL4 protein is sufficient to restore growth sensitivity to cycloheximide.
  • Growth sensitivity towards cycloheximide is also restored by the co-expression of the avian c-Rel protein and its I ⁇ B- counterpart, p40, as GAL4 fusion proteins.
  • Restoration of growth sensitivity towards cycloheximide requires the association of c-REL and p40 at the GAL1 promoter and correlates with the ability of the c-REL/p40 interaction to activate expression from the GAL1 promoter (Leanna and Hannink, 1996, NAR 24:3341-3347)
  • URA3 which encodes orotidine-5 ' -phosphate decarboxylase, an enzyme required for the biosynthesis of uracil.
  • URA3 + phenotype media lacking uracil
  • the ura3-encoded decarboxylase can also catalyze the conversion of a non-toxic analogue, 5-fluorooritic acid (FOA) into a toxic product, 5-fluoroacil (Boeke et al., 1984, Mol. Gen. Genet. 197:345-346).
  • a third reversed yeast two-hybrid is based on the GAL80 gene as relay gene.
  • GAL80 encodes a protein that binds to and masks the activation domain of a transcriptional activator, such as GAL4.
  • the reporter genes which will provide the transcriptional read-out (HIS3 or LACZ), are dependent upon the functional GAL4 for expression.
  • Gal4 function as a transcriptional activator, providing a positive transcriptional read-out for molecules that inhibit the two-hybrid protein-protein interaction.
  • An important feature of this reverse two-hybrid system is that the basal level and the half-time of the relay protein, GAL80, can be fine-tuned to provide maximum sensitivity (Powers and Erickson, 1996, WO95/26400) .
  • DNA constructs comprising a ura4 gene having inserted therein a synthetic intron comprising a polyadenylation signal which is ineffective at preventing transcription of the full reporter gene (described above and used in the variant ura4 method) may advantageously be employed to identify polymerase II pause elements from other eukaryotic genes.
  • the invention provides a method of identifying polymerase II pause elements from eukaryotic genes comprising:
  • Saccharomyces said strain having been transformed with a plasmid incorporating a DNA construct comprising a ura 4 gene having inserted within an intron thereof a polyadenylation signal ineffective at preventing transcription of the full ura 4 gene, with a plasmid comprising the DNA construct prepared in step (a) ,
  • the putative polymerase II pause element is introduced in the intron downstream of the polyadenylation signal.
  • the intron inserted into the ura 4 gene is a synthetic intron having the sequence of nucleotides set forth in Figure 1 but comprising the ura 4 polyadenylation signal described above inserted into the Stul site.
  • the putative polymerase II pause element to be tested in the method of the invention is then inserted into the Xhol site.
  • a suitable DNA construct for use in the method is, for example, the pUIpA construct described in Example 1.
  • the invention provides a novel yeast polymerase II pause element that the present inventors have identified in the 3' region of the nmt2 gene of S . pombe using the above-described method. Accordingly, the invention provides a yeast polymerase II pause element of the nmt2 gene of S . Pombe having the nucleotide sequence: TTAAAAAAACTATTGATAGTA AATCGTAAGGAC or the complement thereof. The invention further provides a yeast polymerase pause element from the ura 4 gene of S . pombe having the nucleotide sequence:
  • DNA molecules comprising the above-identified nmt2 and ura 4 polymerase II pause elements are also provided by the invention.
  • the DNA molecules of the invention will preferably be double-stranded.
  • DNA molecules comprising the ura 4 pause element it is to be understood that these molecules should preferably not contain any further nucleotide sequences from the ura 4 DSE (Birse et al . EMBO J. , 16: 3633-3643 (1997)) contiguous with the 18bp ura 4 pause element sequence identified herein.
  • Birse et al . identified a 49bp ura 4 DSE fragment which functions as a transcriptional pause element.
  • the inventors have now identified a core 18bp fragment of the DSE (ATGTAAAATACCATGTAG) which is a functional polymerase II pause element. The whole of this fragment is required to achieve full pausing activity.
  • Figure 1 shows the nucleotide sequence of a synthetic intron used in the construction of pUI and hence pUIpA, pUIpA+ura4 and pUIpA+nmt2.
  • the splicing consensus sequences and the Stul and Xhol restriction sites are indicated.
  • Figure 2 shows a Northern Blot analysis of the mRNA transcripts obtained from pURA4, pUI, pUIpA, pUIpA+ura4, pUIpA+nmt2, pUIpA+ura4R and pUIpA+nmt2R.
  • the arrows indicate the position of the unspliced (U) , wild-type (WT) or truncated (T) transcript.
  • WT wild-type
  • T truncated transcript.
  • the ability or inability of the transformed cells to grow in a medium without uracil is indicated for each transformant as + or -, respectively.
  • Figure 3 illustrates the identity of the mutant gene present in the S . pombe termination mutant strain m70 as that of the cleavage/polyadenylation factor CstF64.
  • Schematic representations of the Human, Xenopus, S . cerevisiae and S . pombe CstF64 homologues are shown.
  • RBD denotes RNA binding domain' which is known to be required for 3 1 cleavage activity.
  • Dark and light grey shaded boxes denote homology between the 4 eukaryotic species.
  • the mutation causing the mutant phenotype in the m70 strain is a nonsense mutation towards the C-terminus of CstF64.
  • a synthetic intron shown in Figure 1, was obtained by annealing the following complementary oligonucleotides : 5' -GTAGGTGCTATTTTAGGCCTCGAGTATTTTACTAACTTCTTTTAG 5' -CTAAAAGAAGTTAGTAAAATACTCGAGGCCTAAAATAGCACCTAC
  • This intron was then introduced into the unique Stul site of pURA4 (described in Humphrey et al. (1994) EMBO J. 13: 2331-2451), generating pUI.
  • a minimal ura4 polyadenylation signal was obtained by amplifying ura 4 DNA with the following primers :
  • the amplification products were digested with the restriction enzymes Styl and Rsal and the 134bp blunt ended Styl-Rsal fragment was cloned into a Stul site within the intronic sequence of pUI, creating pUIpA.
  • Ura 4 and nmt2 yeast polymerase II pause elements were obtained by annealing the following complementary oligonucleotide pairs:
  • pUIpA was then digested with Xhol, blunt ended and the ura 4 or nmt2 yeast polymerase II pause element was introduced, generating pUIpA+ura4 or pUIpA+nmt2, respectively. All constructs were confirmed by DNA sequencing.
  • EXAMPLE 2 ANALYSIS OF TRANSCRIPTION TERMINATION IN pUIpA, pUIpA+ura4 AND pUIpA+nmt2.
  • pUI, pUIpA, pUIpA+ura4 and pUIpA+nmt2 were transformed into ura 4 ⁇ S .
  • Pombe cells following the DMSO-enhanced method described in Hill et al. (1991) Nucleic Acids Res. 19: 5791, but adding 20 ⁇ g of boiled salmon sperm carrier DNA together with the transforming plasmid. The transformants were tested for their ability to grow on a medium not containing uracil.
  • Total RNA was extracted according to the method described in Kohrer et al. (1991) Methods Enzymol. 194: 398-405. A Northern blot analysis was performed as described in Humphrey et al.
  • RNA was separated in a 1.5% formaldehyde gel, blotted onto a nylon membrane and hybridised with a 1.2kb HincII-EcoRV random primer labelled probe.
  • pURA4 plasmid positive control
  • pUIpA+ura4R and pUIpA+nmt2R plasmids negative constrols
  • ura 4 transcripts can be produced from the pUIpA, pUIpA+ura4 and pUIpA+nmt2 plasmids, depending on the efficacy of the termination signals. If the termination signals are recognised by the transcription machinery a short, truncated transcript (T) would be produced. Otherwise, an unspliced mRNA (US) would be formed. This may then be processed to give the wild-type ura4 mRNA (WT) .
  • Figure 2 shows that if the polyadenylation signal is present alone, as in the case of pUIpA, most of the transcript is correctly spliced and a wild-type ura4 mRNA is produced. Addition of a yeast polymerase II pause element in forward orientation, as in the case of PUIpA+ura4 and PUIpA+nmt2, leads to efficient transcription termination and the production of only the truncated mRNA.
  • EXAMPLE 3 DETECTION OF TRANS-ACTING FACTORS MODULATING TRANSCRIPTION TERMINATION WITH THE GAL METHOD.
  • a pYClC-7 plasmid, constructed by inserting a GAL10-7 fragment into the BamHI site of YCplac22 was transformed into a gall O ' /gal l ' S . Cerevisiae deletion strain. Both the plasmid and the deletion strain have been previously described in Greger et al (1998) EMBO J. 17:4771-4779.
  • the transformants were grown on agar plates in the presence of galactose and ethidium bromide. Colonies of revertants, capable of growing on galactose, were identified. The revertants were then screened to verify if they carried a trans- or cis- mutation by isolating the pYC10-7 plasmid from them, transforming it into the gal l O ' /gal l ' S . Cerevisiae strain and culturing the transformed cells in the presence of galactose.
  • the ability of the transformed cells to grow on galactose was considered as being indicative of the presence of a cis-acting mutation whereas an inability to grow on galactose was considered as being indicative of the presence of a trans-acting mutation.
  • Revertants carrying a trans-acting mutation were then analysed to determine if the mutation was dominant or recessive.
  • the mutation was introduced into a diploid strain by mating the revertant haploid strain with the pYC10-7-transformed gall O ' /gal l ' S. Cerevisiae strain and the transformants were cultured in galactose.
  • a plasmid genomic library was prepared from revertants carrying a dominant trans-acting mutation and transformed into pYC10-7-transformed gall O ' /gal l ' S . Cerevisiae cells. Cells capable of growth on galactose were selected and DNA fragments encoding putative trans-acting factors were purified from these cells and sequenced. A database search was performed with the identified sequence.
  • trans mutants which express significant levels of gal7p (protein) but still fail to make detectable levels of GAL 1 mRNA. It is likely that these trans mutants may result from the mutation of genes associated with translation initiation or termination that allow for translational initiation on the internal GAL 1 cistron. Such mutant genes may identify functions unique to yeast gene expression, since in these highly compressed eukaryotic genomes internal translational initiation on polycistronic mRNAs may prove to be a more general phenomenon. The products of these genes may be potential targets for anti-fungal intervention.
  • EXAMPLE 4 DETECTION OF TRANS-ACTING FACTORS MODULATING TRANSCRIPTION TERMINATION WITH THE URA4 METHOD
  • the revertants were screened to verify if they carried a trans- or cis- mutation by isolating the pUIpA+ura4 plasmid, transforming it into ura 4 ' S . pombe cells and culturing the transformed cells in the absence of uracil.
  • the ability of the transformed cells to grow in the absence of uracil was considered as being indicative of the presence of a cis-mutation whereas an inability to grow in the absence of uracil was considered as being indicative of the presence of a trans-mutation.
  • Revertants carrying a trans-mutation were then analysed to determine if the mutation was dominant or recessive.
  • the mutation was introduced into a diploid strain by mating the revertant haploid strain with the pUIpA+ura4-transformed ura 4 ' S . pombe strain and the transformants were cultured in the absence of uracil.
  • the ability of the transformed cells to grow in the absence of uracil was considered as being indicative of the presence of dominant mutation whereas an inability to grow in the absence of uracil was considered as being indicative of the presence of a recessive mutation.
  • a plasmid genomic library was prepared from revertants carrying a dominant trans-mutation and transformed into pUIpA+ura4-transformed ura 4 ⁇ S . pombe cells. Cells capable of growth in the absence of uracil were selected and DNA fragments encoding for putative trans-acting factors were purified from these cells and sequenced. A database search was performed with the identified sequence.
  • FIG. 3 illustrates the identity of this mutant gene as that of a well known cleavage/polyadenylation factor called CstF64.
  • the mutation in this gene that causes the mutant phenotype is a nonsense mutation towards the carboxyl terminus of the S . pombe CstF64 gene homologue. This stop codon effectively results in a C-terminal truncation of CstF64, deleting a region of the polypeptide sequence that has no previously ascribed function.
  • This domain of the protein is however conserved in sequence between other eukaryotes raising the possibility that it has an important role in transcriptional termination, possibly by interacting with the transcriptional apparatus .
  • Yeast 2 Hybrid analysis (described by Chien et al Proc. Natl. Acad. Sci. USA 88, 9578-9582, 1991), a widely employed technique in molecular genetics.
  • this procedure involves production of a yeast strain containing a ⁇ -gal and HIS3 reporter gene, both controlled by promoters containing multiple binding sites for the transcription factor Gal4p.
  • Gal4p contains two functional domains, a DNA binding domain that interacts with the specific promoter sequence and an activation domain that activates transcription by interacting with and so recruiting RNA polymerase initiation complexes.
  • the reporter strain is also transformed with a plasmid that expresses a fusion protein combining the Gal4p DNA binding domain and the C-terminal domain of the S . pombe CstF64 as described above (the so called bait sequence) .
  • this hybrid protein binds to the reporter promoters it cannot activate the reporter gene since it lacks the Gal4p activation domain.
  • this yeast strain by transforming this yeast strain with a plasmid library in which a DNA sequence coding for the Gal4 activation domain is fused to a random mixture of S . pombe cDNA sequences, some of the transformed yeast express ⁇ -gal and HIS3. These positive yeast colonies result from expression of protein domains (so called prey sequences) in the S .
  • res2 protein is described by Zhu, Y. et al . , EMBO J, 16, 1023, 1997.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Mycology (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biophysics (AREA)
  • Zoology (AREA)
  • Molecular Biology (AREA)
  • Wood Science & Technology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Medicinal Chemistry (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Peptides Or Proteins (AREA)

Abstract

L'invention concerne des méthodes de criblage génétique destinées à être utilisées pour l'identification de facteurs trans-activateurs associés à la terminaison de transcription chez les levures. L'invention concerne également des constructions d'ADN destinées à être utilisées dans le cadre desdites méthodes. Les facteurs trans-activateurs identifiés d'après les méthodes selon l'invention peuvent permettre d'obtenir des nouvelles cibles d'intervention antifongique
EP00900689A 1999-01-15 2000-01-17 Facteurs trans-activateurs de levures Withdrawn EP1144659A2 (fr)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
GB9900919 1999-01-15
GB9900919 1999-01-15
PCT/GB2000/000111 WO2000042204A2 (fr) 1999-01-15 2000-01-17 Facteurs trans-activateurs de levures

Publications (1)

Publication Number Publication Date
EP1144659A2 true EP1144659A2 (fr) 2001-10-17

Family

ID=10845982

Family Applications (1)

Application Number Title Priority Date Filing Date
EP00900689A Withdrawn EP1144659A2 (fr) 1999-01-15 2000-01-17 Facteurs trans-activateurs de levures

Country Status (3)

Country Link
EP (1) EP1144659A2 (fr)
JP (1) JP2002534127A (fr)
WO (1) WO2000042204A2 (fr)

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO0042204A3 *

Also Published As

Publication number Publication date
JP2002534127A (ja) 2002-10-15
WO2000042204A2 (fr) 2000-07-20
WO2000042204A3 (fr) 2000-11-16

Similar Documents

Publication Publication Date Title
Chang et al. Identification of Aspergillus brlA response elements (BREs) by genetic selection in yeast.
Huang et al. The ubiquitin-conjugating enzyme Rad6 (Ubc2) is required for silencing in Saccharomyces cerevisiae
Muro‐Pastor et al. The GATA factor AreA is essential for chromatin remodelling in a eukaryotic bidirectional promoter
Apone et al. Yeast TAF (II) 90 is required for cell-cycle progression through G2/M but not for general transcription activation.
Moqtaderi et al. TBP-associated factors are not generally required for transcriptional activation in yeast
JP3258635B2 (ja) 相補性によるクローニングおよび関連方法
Mahoney et al. The HML mating-type cassette of Saccharomyces cerevisiae is regulated by two separate but functionally equivalent silencers
US5885779A (en) Repressed trans-activator system for characterization of protein-protein interactions
Percival-Smith et al. Characterization and mutational analysis of a cluster of three genes expressed preferentially during sporulation of Saccharomyces cerevisiae
Blanton et al. PRP38 encodes a yeast protein required for pre-mRNA splicing and maintenance of stable U6 small nuclear RNA levels
EP0915976A2 (fr) Procedes d'identification de composes pour la rupture des interactions entre proteines
Laman et al. Disturbance of normal cell cycle progression enhances the establishment of transcriptional silencing in Saccharomyces cerevisiae
Dombek et al. Cyclic AMP-dependent protein kinase inhibits ADH2 expression in part by decreasing expression of the transcription factor gene ADR1
Gray et al. Isolation and analysis of the yeast TEA1 gene, which encodes a zinc cluster Ty enhancer-binding protein
Edelman et al. Exceptional codon recognition by the glutamine tRNAs in Saccharomyces cerevisiae.
EP2959001B1 (fr) Séquence à réplication autonome fonctionnant dans un large spectre de levures
Breeden et al. Three independent forms of regulation affect expression of HO, CLN1 and CLN2 during the cell cycle of Saccharomyces cerevisiae.
EP1803812A1 (fr) Méthode de criblage de gène à l'aide d'une levure comportant une ergostérol synthase à expression inductible
US9212359B2 (en) Systems for induction of gene expression and protein depletion in yeast
EP2591121B1 (fr) Lignée cellulaire productrice
EP1144659A2 (fr) Facteurs trans-activateurs de levures
JP2001513989A (ja) 酵母における調節した遺伝子発現
AU2002229532B2 (en) Promoter for the functional characterisation of g-protein coupled receptors in the yeast saccharomyces cerevisiae
Gainey et al. Isolation and expression of the acetate-inducible isocitrate lyase gene (acu-3) from Neurospora crassa: evidence for a second constitutive isozyme
Briggs et al. RNA polymerase III defects suppress a conditional-lethal poly (A) polymerase mutation in Saccharomyces cerevisiae

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20010806

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE

17Q First examination report despatched

Effective date: 20040608

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20041019