EP1144448A2 - Tiam2 (t-cell lymphoma invasion and metastasis 2) nucleotide exchange factor - Google Patents

Tiam2 (t-cell lymphoma invasion and metastasis 2) nucleotide exchange factor

Info

Publication number
EP1144448A2
EP1144448A2 EP00902369A EP00902369A EP1144448A2 EP 1144448 A2 EP1144448 A2 EP 1144448A2 EP 00902369 A EP00902369 A EP 00902369A EP 00902369 A EP00902369 A EP 00902369A EP 1144448 A2 EP1144448 A2 EP 1144448A2
Authority
EP
European Patent Office
Prior art keywords
seq
amino acids
tiam2
polynucleotide
aal
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP00902369A
Other languages
German (de)
French (fr)
Other versions
EP1144448A3 (en
Inventor
David Duhl
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Novartis Vaccines and Diagnostics Inc
Original Assignee
Chiron Corp
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Chiron Corp filed Critical Chiron Corp
Publication of EP1144448A2 publication Critical patent/EP1144448A2/en
Publication of EP1144448A3 publication Critical patent/EP1144448A3/en
Withdrawn legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4702Regulators; Modulating activity
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents

Definitions

  • the present invention is in the field of molecular biology. More specifically, the present invention relates to a polynucleotide sequence and corresponding TIAM2 protein.
  • the TIAM1 gene and characteristics of the encoded protein are discussed in Habets et al., Cell 77:537-549 (1994); Hart, M.J. et al.. J. Biol Chem. 269:62-65 (1994); Haslam et al., Nature 565:309-310 (1993); and Mayer, B.J. et al.. Cell 75:629-630 (1993).
  • the invention relates to a polynucleotide comprising a polynucleotide of SEQ ID NO:8.
  • the invention also relates to a polypeptide encoded by SEQ ID NO:8.
  • the invention further relates to a polynucleotide having at least 80% sequence identity to SEQ ID NO:8.
  • the invention still further relates to a polynucleotide having at least 85% sequence identity to SEQ ID NO:8.
  • the invention also relates to a polynucleotide having at least 90% sequence identity to SEQ ID NO:8.
  • the invention further relates to a polynucleotide having at least 95% sequence identity to SEQ ID NO: 8.
  • the invention relates to a polynucleotide comprising a polynucleotide of SEQ ID NO:9.
  • the invention also relates to a polypeptide encoded by SEQ ID NO:9.
  • the invention further relates to a polynucleotide having at least 80% sequence identity to SEQ ID NO:9.
  • the invention still further relates to a polynucleotide having at least 85% sequence identity to SEQ ID NO:9.
  • the invention also relates to a polynucleotide having at least 90% sequence identity to SEQ ID NO:9.
  • the invention further relates to a polynucleotide having at least 95% sequence identity to SEQ ID NO:9.
  • the invention relates to a polynucleotide comprising a polynucleotide of SEQ ID NO:10.
  • the invention also relates to a polypeptide encoded by SEQ ID NO- 10.
  • the invention further relates to a polynucleotide having at least 80% sequence identity to SEQ ID NO: 10.
  • the invention still further relates to a polynucleotide having at least 85% sequence identity to SEQ ID NO: 10.
  • the invention also relates to a polynucleotide having at leasi 90% sequence identity to SEQ ID NO:l 0.
  • the invention further relates to a polynucleotide having at least 95% sequence identity to SEQ ID NO: 10.
  • the invention relates to a polypeptide having at least 80% sequence identity to the amino acid sequence of SEQ ID NO:l l, SEQ ID NO:12 or SEQ ID NO:13.
  • the invention also relates to a polypeptide having at least 85% sequence identity to the amino acid sequence of SEQ ID NO: l l, SEQ ID NO:12 or SEQ ID NO:13.
  • the invention further relates to a polypeptide having at least 90% sequence identity to the amino acid sequence of SEQ ID NO:l l , SEQ ID NO:12 or SEQ ID NO:13.
  • the invention still further relates to a polypeptide having at least 95% sequence identity to the amino acid sequence of SEQ ID NO: l l , SEQ ID NO:12 or SEQ ID NO: 13.
  • the invention further relates to an antibody capable of specifically binding to a polypeptide encoded by SEQ ID NO:8.
  • the invention further relates to an antibody capable of specifically binding to a polypeptide having the amino acid sequence of SEQ ID NO:l l .
  • the invention also relates to a method of detecting expression of a
  • TIAM2 expression product in a biological sample comprising obtaining polypeptides from the biological sample, contacting the polypeptides with an antibody capable of specifically binding to TIAM2. and detecting the presence or absence of antibody- polypeptide complexes.
  • the invention also relates to a method of obtaining a TIAM2 polypeptide. comprising expressing a polynucleotide having at least 80% sequence identity to SEQ ID NO:8, SEQ ID NO:9 or SEQ ID NO: 10.
  • the invention further relates to a vector comprising a polynucleotide having at least 80% sequence identity to SEQ ID NO:8, SEQ ID NO:9 or SEQ ID NO:10.
  • the invention still further relates to a vector comprising a polynucleotide having at least 80% sequence identity to SEQ ID NO:8, SEQ ID NO:9 or SEQ ID NO: 10. and at least one regulatory region.
  • the invention also relates to a host cell comprising a polynucleotide having at least 80% sequence identity to SEQ ID NO:8, SEQ ID NO:9 or SEQ ID NO: 10.
  • the invention further relates to a method of detecting a deletion of a region of chromosome 6q25 in ovarian cancer, comprising comparing the polynucleotide sequence of region of chromosome 6q25 of an ovarian tissue sample suspected of being cancerous with the polynucleotide sequence of SEQ ID NO:8, SEQ ID NO: 9 or SEQ ID NO: 10 and determining the presence or absence of the sequence in the polynucleotides of the tissue sample.
  • FIGURES Figure 1 Human brain-(A) and tissue-specific (B) blots containing
  • TIAM-specific probes that recognize both the long (TIAM and the short (TIAM S ) forms of TIAM2.
  • a probe derived from the 5 " end of the 4.4-Kb message hybridized to only the long form (C), while a S'-specific probe hybridized to both the long and the short forms (D). on the brain-specific Northerns.
  • FIG. 2 shows expression of TIAM2 and mRNA in mouse brain.
  • A Whole mount of a El 3.5 embryo brain. TIAM2 transcripts are expressed throughout the developing telencephalon (T).
  • B Parasagittal section through an El 3.5 telencephalon demonstrating that TIAM2 mRNA is localized to cells near the pial (P) surface; labeling is not seen near the ventricular surface (V).
  • C Coronal section through the adult mouse forebrain. TIAM2 transcripts are localized to the cerebral cortex (Ctx) and caudate putamen (CP), with intense labeling in the ependyma (small arrow) and in the indusium griseum (arrow).
  • Ctx cerebral cortex
  • CP caudate putamen
  • Figure 3 shows a comparison of the carboxy-terminus amino acid sequence of TIAM1 protein (amino acids 576-1591 ) with the amino acid sequence of TIAM2 L .
  • the EX domain, alternatively splice region. DHR domain, DH domain, and PH domain are underlined, and the initiator methionine for TIAM2 S (amino acid 452) is in boldface and designated with an arrow.
  • Figure 4 shows the results of a GDP-GTP exchange assay. Partially purified His-TIAM2 S protein was assayed for the ability to stimulate GDP-GTP exchange activity with immunoprecipitated Rac (A) or Ras (B) proteins.
  • Figure 5 shows the expression of TIAM2 mRNA in tumor tissue and normal tissues.
  • TIAM2 (DP-75), for T-cell lymphoma invasion and metastasis 2, relates to a novel DNA and amino acid sequence that has some sequence homology with TIAMl .
  • TIAMl is a member of a family GDP dissociation stimulators (GDSs) which are proteins that activate Rho-like and Rac-like GTPases. GDSs as well as Rho and Rac have oncogenic potential.
  • TIAM2 with high homology to TIAMl, has been identified.
  • TIAM2 is expressed as ⁇ 4.4- and ⁇ 3.3-kb messages that encode long (TIAM2 and short forms (TIAM2 S ) of the TIAM2 protein.
  • TIAM2 L begins in a region with identity to the coiled-coil region of TIAMl and includes both the EX and the PDZ domains found within TIAMl .
  • Both TIAM2 L and TIAM2 S contain regions of identity to the DH and carboxyl-terminal PH domains of TIAMl .
  • An additional level of complexity is added by alternative splicing of the -4.4- kb message, which leads to the insertion of 24 amino acids between the EX and the DHR domains.
  • His-tagged version of TIAM2 S was expressed in a baculovirus system, which is the preferred system for TIAM2 expression, and purified on a nickel column. His-TIAM2 S was compared to SOS and was shown to have GEF activity that prefers RAC over RAS.
  • TIAM2 may play a role in neural development.
  • the high level of TIAM2 expression throughout the El 3.5 telencephalon suggests that TIAM2 may play an important role in development of the forebrain.
  • TIAM2 expression during mouse embryogenesis may reveal a correlation with specific morphogenetic events or with specific GTP-ase family members, regulators, or effectors. It is likely that some of the specificity established during neural development is due to cell-type-specific expression of GTPase signaling pathway components such as TIAMl . RAC3, and TIAM2.
  • TIAM2 continues to be expressed at high levels in the adult forebrain.
  • the areas of high expression in the adult are regions of synaptic plasticity (cortex. hippocampus) or neurogenesis (dentate gyrus, ependyma/subependyma) in the adult (Gould et al.. Trends Cogn. Sci. 5:186-192. 1999; Temple. Curr. Biol 9:R397-399. 1999; Lowenstein and Parent. Science 253: 1 126-1 127, 1999).
  • TIAM2 may play a role in metastasis or tumor suppression. Radiation hybrid mapping of TIAM2 places it in a 4-cM region of chromosome 6q25 that is frequently deleted in ovarian cancer (Colitti et al., Oncogene 76:555-559, 1998). Since the majority of ovarian cancer is epithelial in nature, and since TIAMl (21q22.1 ; Chen and Antonarakis, Genomics 50:123-127, 1995) has been suggested to act as a tumor suppressor in epithelial cells, this might suggest a role for TIAM2 in ovarian cancer.
  • TIAM2 suggests distinct roles for TIAM2 L and TIAM2 S . Both the EX and the PDZ domains found in TIAM2 L have been suggested to play roles in protein-protein interactions and intracellular localization of proteins. Since TIAM2 S lacks both the EX and the PDZ domains of TIAM2, . the two forms may be localized to different regions of the cell. Understanding the alternate forms of TIAM2 extends knowledge of the complexity of this emerging family of GEFs and may ultimately yield insight into the divergent roles of TIAMl as both a promoter of invasiveness and a tumor suppressor.
  • TIAM2 may be useful to diagnose cancerous cells.
  • Many techniques may be used to diagnose whether tissue samples possess TIAM2-containing tumor tissue. For example, reverse transcription and PCR amplification of the RNA of a tumor sample to identify the presence of TIAM2 mRNA sequences (see Sambrook. et al. , Molecular Cloning; A Laboratory Manual, Second Edition (1989). chapter 14 or Gaugler et al. J. Exp. Med 779:921-930 (1994)).
  • immunohistochemical techniques or ELISA assays may be used to identify TIAM2-expressing tumors.
  • the TIAM2 protein can be recombinantly expressed and monoclonal antibodies can be prepared according to methods that are known in the art. For example, the methods shown in EP 174.204, Kohler and Milstein, Nature 256:495-497 (1975), Fong el al. J. Immun. Meth. 70:83-90 (1984), GB 2,086,937, 2,113.715, EP 57,107. 62.409, EP 118.893, EP 124.301, and EP 131,878 are suited to the present invention.
  • the anti-TIAM2 monoclonal antibodies can then be used in the standard assays recited above or those assays that are otherwise known in the art.
  • Monoclonal antibodies may also be used therapeutical ly.
  • Anti-TIAM2 monoclonal antibodies can be administered by means known in the art. Preferably, the antibodies are administered parenterally or subcutaneously, more preferably, they are administered intravenously.
  • the monoclonal antibodies can be administered in combination with other agents designed to promote the activity of the antibodies or to treat the underlying condition involving the TIAM2 expressing cell.
  • branched DNA testing may be performed to assay for TIAM2 DNA as shown in U.S. Patent Nos. 5,124.246, and 4.868.105 (hereby incorporated by reference in their entireties).
  • TIAM2 nucleic acid probe molecules for the branched DNA testing are preferably from 10 to 50 bases in length, more preferably, between 15 and 40 bases in length, most preferably, between 20 and 30 bases in length
  • Ribozymes may be designed to act on the TIAM2 sequence identified in SEQ ID NO: l .
  • SEQ ID NO:6 SEQ ID NO:8.
  • SEQ ID NO:9 SEQ ID NO:10 or fragments thereof.
  • the ribozyme gene is cloned into an available vector and transfected into the cells of choice.
  • Different vectors may be chosen based on the target cell to be infected.
  • respiratory cells may be targeted by an adeno or adeno associated virus
  • AAV vector AAV vector. Appropriate promoters may be inserted into these vectors to ensure regulatable expression. (Kashani-Cabet at p. 216).
  • Antisense molecules can be developed based on the TIAM2 sequence shown in SEQ ID NO:l, SEQ ID NO:6, SEQ ID NO:8. SEQ ID NO:9, or SEQ ID NO:10. For example, see U. S. Patent Nos. 5,491 ,133 and 5,271.941 which are hereby incorporated by reference in their entireties.
  • Antisense RNA sequences have been described as naturally occurring biological inhibitors of gene expression in both prokaryotes (Mizuno, T., Chou, M-Y, and Inouye, M. (1984), Proc. Natl. Acad. Sci. USA 81, (1966-1970)) and eukaryotes (Heywood, S. M. Nucleic Acids Res., If. 6771 -6772 (1986) and these sequences function by hybridizing to complementary mRNA sequences, resulting in hybridization arrest of translation (Paterson. B. M., Roberts. B. E.. and Kuff. E. L.. (1977) Proc Natl Acad. Sci. USA, 74. 4370-4374.
  • Antisense oligodeoxynucleotides are short synthetic nucleotide sequences formulated to be complementary to a specific gene or RNA message. Through the binding of these oligomers to a target DNA or mRNA sequence, transcription or translation of the gene can be selectively blocked and the disease process generated by that gene can be halted.
  • the cytoplasmic location of mRNA provides a target considered to be readily accessible to antisense oligodeoxynucleotides entering the cell; hence much of the work in the field has focused on RNA as a target.
  • Antisense therapy is the administration of oligonucleotides which bind to a target polynucleotide located within the cells. These oligonucleotides are usually exogenous, but they can be endogenously expressed.
  • the term “antisense” refers to the fact that such oligonucleotides are complementary to their intracellular targets, e g , TIAM2. See for example. Jack Cohen, Oligodeoxynucleotides, Antisense Inhibitors of Gene Expression. CRC Press, 1989: and Synthesis 7:1-5 (1988).
  • the TIAM2 antisense oligonucleotides of the present invention include derivatives such as S-oligonucleotides (phosphorothioate derivatives or S-oligos, see, Jack Cohen, supra) which exhibit enhanced cancer cell growth inhibitory action.
  • the TIAM2 antisense oligonucleotides of the present invention may be RNA or DNA which are complementary to and stably hybridize with the TIAM2 genome or the corresponding mRNA. Use of an oligonucleotide complementary to this region allows for the selective hybridization to TIAM2 mRNA and not to other mRNAs.
  • the TIAM2 antisense oligonucleotides of the present invention are 15 to 40-mer fragments of the antisense DNA molecules which hybridize to TIAM2 mRNA.
  • the preferred TIAM2 antisense oligonucleotide is a 20- to 30-mer oligonucleotide which is complementary to a region in TIAM2.
  • pharmaceutical compositions comprising an effective amount of at least one of the TIAM2 antisense oligonucleotides of the invention in combination with a pharmaceutically acceptable carrier.
  • a single TIAM2 antisense oligonucleotide is utilized.
  • two TIAM2 antisense oligonucleotides are utilized which are complementary to adjacent regions of the TIAM2 genome.
  • TIAM2 antisense oligonucleotides which are complementary to adjacent regions of the TIAM2 genome or corresponding mRNA may allow for more efficient inhibition of TIAM2 genomic transcription or mRNA translation, resulting in more effective inhibition of cancer cell growth.
  • the TIAM2 antisense oligonucleotide is coadministered with an agent which enhances the uptake of the antisense molecule by the cells.
  • the TIAM2 antisense oligonucleotide may be combined with a lipophilic cationic compound which may be in the form of liposomes.
  • liposomes to introduce nucleotides into cells is taught, for example, in U.S. Pat. Nos. 4.897,355 and 4,394.448, the disclosures of which are incorporated by reference in their entireties. See also U.S. Pat. N ' os. 4.235.871. 4.231.877, 4.224,179, 4,753,788, 4,673,567, 4,247.41 1 , 4.814.270 for general methods of preparing liposomes comprising biological materials.
  • the TIAM2 antisense oligonucleotide may be combined with a lipophilic carrier such as any one of a number of sterols including cholesterol, cholate and deoxycholic acid.
  • a preferred sterol is cholesterol.
  • the TIAM2 antisense oligonucleotide may be conjugated to a peptide that is ingested by cells. Examples of useful peptides include peptide hormones, antigens or antibodies, and peptide toxins. By choosing a peptide that is selectively taken up by the neoplastic cells, specific delivery of the antisense agent may be effected.
  • the TIAM2 antisense oligonucleotide may be covalently bound via the 5' H group by formation of an activated aminoalkyl derivative.
  • the peptide of choice may then be covalently attached to the activated TIAM2 antisense oligonucleotide via an amino and sulfhydryl reactive hetero bifunctional reagent. The latter is bound to a cysteine residue present in the peptide.
  • the peptidyl antisense agent Upon exposure of cells to the TIAM2 antisense oligonucleotide bound to the peptide, the peptidyl antisense agent is endocytosed and the TIAM2 antisense oligonucleotide binds to the target TIAM2 mRNA to inhibit translation. See PCT Application Publication No. PCT/US89/02363.1.
  • TIAM2 antisense oligonucleotides and the pharmaceutical compositions of the present invention may be administered by any means that achieve their intended purpose.
  • administration of the antisense compounds or other compounds of the present invention may be by parenteral, subcutaneous, intravenous, intramuscular, intra-peritoneal. or transdermal routes.
  • compositions within the scope of this invention include all compositions wherein the TIAM2 antisense oligonucleotide is contained in an amount which is effective to achieve inhibition of proliferation and/or stimulate differentiation of the subject cancer cells.
  • the TIAM2 antisense oligonucleotide may be administered to mammals, e.g , humans, at a dose of 0.005 to 1 mg/kg/day, or an equivalent amount of the pharmaceutically acceptable salt thereof, per day of the body weight of the mammal being treated.
  • the TIAM2 antisense oligonucleotides may be administered as part of a pharmaceutical preparation containing suitable pharmaceutically acceptable carriers comprising excipients and auxiliaries which facilitate processing of the TIAM2 antisense oligonucleotide into preparations which can be used pharmaceutically.
  • suitable pharmaceutically acceptable carriers comprising excipients and auxiliaries which facilitate processing of the TIAM2 antisense oligonucleotide into preparations which can be used pharmaceutically.
  • pharmaceutically acceptable refers to compounds and compositions which may be administered to mammals without undue toxicity.
  • Exemplary pharmaceutically acceptable salts include mineral acid salts such as hydrochlorides, hydrobromides, phosphates, sulfates, and the like; and the salts of organic acids such as acetates, propionates, malonates, benzoates. and the like.
  • Suitable formulations for parenteral administration include aqueous solutions of the TIAM2 antisense oligonucleotides in water-soluble form, for example. water-soluble salts.
  • suspensions of the active compounds as appropriate oily injection suspensions may be administered.
  • Suitable lipophilic solvents or vehicles include fatty oils, for example, sesame oil, or synthetic fatty acid esters, for example, ethyl oleate or triglycerides.
  • Aqueous injection suspensions may contain substances which increase the viscosity of the suspension include, for example, sodium carboxymethyl cellulose, sorbitol, and/or dextran.
  • the suspension may also contain stabilizers.
  • the antisense oligonucleotides of the present invention may be prepared according to any of the methods that are well known to those of ordinary skill in the art.
  • the antisense oligonucleotides are prepared by solid phase synthesis. See. Goodchild, J., Bioconjugate Chemistry, 7:165-167 (1990), for a review of the chemical synthesis of oligonucleotides.
  • the antisense oligonucleotides can be obtained from a number of companies which specialize in the custom synthesis of oligonucleotides.
  • TIAM2 polypeptides, polynucleotides, or antibodies can be administered orally, topically, or by parenteral means, including subcutaneous and intramuscular injection, implantation of sustained release depots, intravenous injection, intranasal administration, and the like.
  • parenteral means including subcutaneous and intramuscular injection, implantation of sustained release depots, intravenous injection, intranasal administration, and the like.
  • TIAM2 polypeptides, polynucleotides, or antibodies may be administered as a pharmaceutical composition comprising a pharmaceutically acceptable excipient.
  • compositions may be aqueous solutions, emulsions, creams, ointments, suspensions, gels, liposomal suspensions, and the like.
  • Suitable excipients include water, saline. Ringer's solution, dextrose solution, and solutions of ethanol, glucose, sucrose, dextran. mannose. mannitol. sorbitol. polyethylene glycol (PEG), phosphate, acetate, gelatin, collagen. Carbopol®, vegetable oils, and the like.
  • PEG polyethylene glycol
  • phosphate acetate
  • gelatin collagen
  • Carbopol® vegetable oils, and the like.
  • One may additionally include suitable preservatives, stabilizers, antioxidants, antimicrobials, and buffering agents, for example. BHA, BHT, citric acid, ascorbic acid, tetracycline, and the like.
  • Cream or ointment bases useful in formulation include lanolin, Silvadene® (Marion).
  • Other devices include indwelling catheters and devices such as the Alzet® minipump.
  • Ophthalmic preparations may be formulated using commercially available vehicles such as Sorbi-care® (Allergan), Neodecadron® (Merck, Sharp & Dohme), Lacrilube®, and the like, or may employ topical preparations such as that described in US 5,124.155. incorporated herein by reference.
  • TIAM2 polypeptide, polynucleotide, or antibody in solid form, especially as a lyophilized powder.
  • Lyophilized formulations typically contain stabilizing and bulking agents, for example human serum albumin, sucrose, mannitol. and the like. A thorough discussion of pharmaceutically acceptable excipients is available in Remington's Pharmaceutical Sciences (Mack Pub. Co.).
  • TIAM2 polypeptide, polynucleotide, or antibody required to treat any particular disorder will of course vary depending upon the nature and severity of the disorder, the age and condition of the subject, and other factors readily determined by one of ordinary skill in the art.
  • the appropriate dosage may be determined by one of ordinary skill in the art.
  • nucleic acid molecules described above i.e., the ribozyme or antisense molecules
  • vectors and techniques described below will be useful.
  • the following expression systems describe vectors, promoters and regulatory elements that are useful for gene therapy applications for the delivery of the above polynucleotides.
  • Vectors and expression systems useful for the present invention include viral and non-viral systems.
  • examples of viral delivery systems include retroviruses, adenoviruses, adeno-associated viruses (AAV), Sindbis and herpes viruses.
  • the viral vector is capable of integrating the above nucleic acid sequence into the host cell genome for long term expression.
  • retrovirus is a murine leukemia virus.
  • Non-viral vectors include naked DNA and DNA formulated with cationic lipids or liposomes.
  • a non-viral system that can be used is the T7/T7 system.
  • TIAM2 can be expressed by a baculovirus that has been transformed with a native or modified TIAM2 nucleic acid sequence.
  • the TIAM2 nucleic acid sequence useful in the present invention encodes a protein having an amino acid sequence that is substantially identical to the amino acid sequence of native TIAM2.
  • the TIAM2 nucleic acid or protein sequence will be homologous to the partial sequences listed below.
  • the above sequence will be greater than 80% homologous to SEQ ID NO:6, SEQ ID NO:8. SEQ ID NO:9.
  • SEQ ID NO: 10 or fragments thereof more preferably it will be greater than 85% homologous, more preferably greater than 90% homologous, even more preferably greater than 91 %, 92%, 93% . 94% or 95% homologous. Most preferably, it will be greater than 96%>, 97%, 98%o or 99% homologous.
  • Substantial identity means the sequences are identical or differ by one or more alterations (deletion, additions, substitutions) that do not adversely affect the activity of the protein. It is preferable that the protein sequences are homologous in the same percentages noted above. Percent identity or homology can be calculated using methods and algorithms known in the art. A suitable but non-limiting method is the Smith- Waterman homology search algorithm as implemented in MPSRCH program (Oxford Biomolecular) using an affine gap search with the following search parameters: gap open penalty of 12, and gap extension penalty of 1.
  • TIAM2 sequence can depend on a number of factors. As ionizable amino and carboxyl groups are present in the molecule, a particular protein may be obtained as a acidic or basic salt, or in neutral form. All such preparations which retain their activity when placed in suitable environmental conditions are included in the definition of proteins herein. Further, the primary amino acid sequence of the protein may be augmented by derivitization using sugar moieties (glycosylation) or by other supplementary molecules such as lipids, phosphate, acetyl groups and the like. Certain aspects of such augmentation are accomplished through post-translational processing systems of the producing host; other such modifications may be introduced in vitro.
  • modifications are included in the definition of protein herein so long as the activity of the protein is not destroyed. It is expected that such modifications may quantitatively or qualitatively affect the activity, either by enhancing or diminishing the activity of the protein, in the various assays. Further, individual amino acid residues in the chain may be modified by oxidation, reduction, or derivatization, and the protein may be cleaved to obtain fragments which retain activity. Such alterations which do not destroy activity do not remove the protein sequence from the definition of TIAM2 herein.
  • Modifications to the primary structure itself by deletion, addition, oi ⁇ alteration of the amino acids incorporated into the sequence during translation, can be made without destroying the activity of the protein.
  • site specific mutagenesis can enable specific changes in the DNA structure to effect a change in the polypeptide structure. See Mark et al. U. S. Pat. No. 4.959,314, and Sambrook. et al . supra. Volume 2. chapter 15 which is hereby incorporated by reference in its entirety.
  • the TIAM2 proteins include mutants, fragments, fusions, and the protein encoded by the sequence listed in SEQ ID NO: 1 , SEQ ID NO:6, SEQ ID NO:8. SEQ ID NO:9, SEQ ID NO: 10 or fragments thereof.
  • the native TIAM2 proteins are those that occur in nature.
  • the amino acid sequence of native polypeptides will comprise a sequence that varies slightly; typically, less than by 10-20 amino acids encoded by SEQ ID NO: l.
  • polynucleotide' or “nucleic acid sequence " ' as used herein refers to a polymer of nucleotides of any length, preferably deoxyribonucleotides. and is used interchangeably herein with the terms “oligonucleotide” and “oligomer.”
  • the term refers only to the primary structure of the molecule. Thus, this term includes double- and single-stranded DNA, as well as antisense polynucleotides. It also includes known types of modifications, for example, the presence of labels which are known in the art. methylation. end “ caps,” substitution of one or more of the naturally occurring nucleotides with an analog, internucleotide modifications such as.
  • uncharged linkages e.g. , methyl phosphonates, phosphotriesters, phosphoamidates, carbamates, etc.
  • charged linkages e.g , phosphorothioates, phosphorodithioates, etc.
  • pendant moieties such as, for example, proteins (including nucleases, toxins, antibodies, signal peptides, poly-L-lysine, etc.).
  • intercalators e.g.. acridine, psoralen, etc.
  • chelators e.g. , metals, radioactive species, boron, oxidative moieties, etc.
  • alkylators e g , alpha anomeric nucleic acids, etc.
  • a polynucleotide sequence encoding a native TIAM2 protein can be easily modified to encode other classes of TIAM2 proteins. It will be recognized in the art that some amino acid sequence of the TIAM2 polypeptide can be varied without significant effect on the structure or function of the protein. If such differences in sequence are contemplated, it should be remembered that there are critical areas on the protein which determine activity. In general, it is possible to replace residues that form the tertiary structure, provided that residues performing a similar function are used. In other instances, the type of residue may be completely unimportant if the alteration occurs at a non-critical region of the protein. The replacement of amino acids can also change the selectivity of binding to cell surface receptors.
  • the polypeptides of the present invention may include one or more amino acid substitutions, deletions or additions, either from natural mutations or human manipulation.
  • the invention further includes variations of the TIAM2 polypeptide which show substantial TIAM2 polypeptide activity or which include regions of TIAM2 protein such as the protein portions discussed below.
  • Such mutants include deletions, insertions, inversions, repeats, and type substitutions.
  • Amino acids in the polypeptides of the present invention that are essential for function can be identified by methods known in the art, such as site- directed mutagenesis or alanine-scanning mutagenesis (Cunningham and Wells, Science 244: 1081-1085 (1989)). The latter procedure introduces single alanine mutations at every residue in the molecule. The resulting mutant molecules are then tested for biological activity such as receptor binding or in vitro, or in vitro proliterative activity. Sites that are critical for ligand-receptor binding can also be determined by structural analysis such as crystallization, nuclear magnetic resonance or photoaffinity labeling (Smith et al., J. Mol Biol. 22-7:899-904 (1992) and de Vos et al.
  • mutants can be constructed by making conservative amino acid substitutions.
  • a subset of mutants, called muteins, is a group of polypeptides with the non-disulfide bond participating cysteines substituted with a neutral amino acid, generally, with serines. These mutants may be stable over a broader temperature range than native TIAM2 proteins.
  • changes are preferably of a minor nature, such as conservative amino acid substitutions that do not significantly affect the folding or activity of the protein.
  • the number of amino acid substitutions a skilled artisan would make depends on many factors, including those described above. Generally speaking, the number of substitutions for any given TIAM2 polypeptide will not be more than 50. 40. 30. 25. 20, 15. 10, 5 or 3.
  • the coding sequence of mutants can be constructed by in vitro mutagenesis of the native TIAM2 polypeptide coding sequences.
  • protein refers to a polymer of amino acids and does not refer to a specific length of the product: thus, peptides, oligopeptides. polypeptides, proteins, and polyproteins. as well as fragments of these, are included within this definition.
  • This term also does not refer to. or exclude, post expression modifications of the protein, for example, glycosylations, acetylations, phosphorylations and the like. Included within the definition are, for example, proteins containing one or more analogs of an amino acid (including, for example, unnatural amino acids, etc.), proteins with substituted linkages, as well as other modifications known in the art, both naturally occurring and non-naturally occurring.
  • a polypeptide or protein or amino acid sequence "derived from” or “coded by " or ''encoded by "” a designated nucleic acid sequence refers to a polypeptide having an amino acid sequence identical to that of a polypeptide encoded in the sequence, or a portion thereof wherein the portion consists of at least 3-5 consecutive amino acids, and more preferably at least 8-10 amino acids, and even more preferably at least 1 1-15 amino acids, or which is immunologically identifiable with a polypeptide encoded in the sequence. This terminology also includes a polypeptide expressed from a designated nucleic acid sequence.
  • purified and isolated mean, when referring to a polypeptide or nucleotide sequence, that the indicated molecule is present in the substantial absence of other biological macromolecules of the same type.
  • purified as used herein preferably means at least 75% by weight, more preferably at least 85%> by weight, more preferably still at least 95% by weight, and most preferably at least 98%> by weight, of biological macromolecules of the same type present (but water, buffers, and other small molecules, especially molecules having a molecular weight of less than 1000, can be present).
  • fragments of polynucleotides that encode the TIAM2 polypeptides disclosed herein may encode antigenic regions of the proteins or biologically functional regions of the proteins as described herein. Such fragments also encode polypeptide components of the fusion proteins disclosed herein. Fragments are also suitable for use as probes for identifying polynucleotides capable of hybridizing with SEQ ID NO:8, 9. and/or 10. Fragments can range in length from about 10 basepairs to the full length polynucleotide, which is 3344 basepairs for SEQ ID NO:8, 4590 basepairs for SEQ ID NO:9, and 4514 basepairs for SEQ ID NO: 10. Preferred fragments are 15. 20.
  • a particularly preferred fragment comprises nucleotides 1 -104 of SEQ ID NO:8.
  • Polypeptide fragments are amino and/or carboxyl terminal amino acid deletions of mutant or native TIAM2 proteins.
  • the number of amino acids that are truncated is not critical as long as the polypeptide fragment exhibits the desired sequence homology, immunological or biological activity.
  • Preferred fragments are 10. 15. 20. 25, 30, 35. 40. 45, 50, 55. 60. 65, 70. 75. 80. 85, 90. 95. 100, 125. 150, 175, 200, 250. 300, 350, 400, 450, 500, 550, 600 or 625 amino acids of SEQ ID NO:7. 1 1. 12 or 13; 650, 675. 700, 750. 800, 825.
  • Polypeptide fragments of immunological significance comprise, for example, at least one epitope shared by a native TIAM2 protein.
  • TIAM2 proteins may be only 5-15 amino acids in length.
  • Examples of amino acid sequence of fragments comprise amino acid number 1-8 (aal to aa8) of SEQ ID NO:7, 1 1. 12. or 13; aa2 to aa9 of SEQ ID NO:7, 1 1 , 12, or 13; aa3 to aalO of SEQ ID NO:7. 1 1 , 12.
  • Fusions are fragment, mutant, or native TIAM2 proteins with additional amino acids at either or both of the termini.
  • the additional amino acid sequence generally is not homologous to sequence found in native TIAM2 polypeptides.
  • the additional amino acid residues can facilitate expression, detection, or activity of the polypeptide, for example.
  • the additional amino acid sequence can also be used as linker to construct multimers of TIAM2 proteins. All fusion polypeptides exhibit the desired sequence homology. immunological or biological activity.
  • Recombinant TIAM2 fusion proteins can be produced using the preferred cell system, baculovirus. After inserting the TIAM2 DNA sequence into the transfer vector, the vector and the wild type viral genome are transfected into an insect host cell where the vector and viral genome are allowed to recombine.
  • the packaged recombinant virus is expressed and recombinant plaques are identified and purified.
  • Materials and methods for baculovirus/insect cell expression systems are commercially available in kit form from, inter alia. Invitrogen, San Diego CA ("MaxBac” kit). These techniques are generally known to those skilled in the art and fully described in Summers and Smith, Texas Agricultural Experiment Station Bulletin No. 1555 (1987).
  • the above-described components comprising a promoter, leader (if desired), coding sequence of interest, and transcription termination sequence, are usually assembled into an intermediate construct (transfer vector).
  • pAc373 the most commonly used transfer vector for introducing foreign genes into AcNPV.
  • Many other vectors known to those of skill in the art. have also been designed. These include, for example, pVL985 (which alters the polyhedrin start codon from ATG to ATT. and which introduces a BamHI cloning site 32 base pairs downstream from the ATT; see Luckow and Summers, Virology 77:31 (1989).
  • the plasmid usually also contains the polyhedron polyadenylation signal (Miller et al Ann. Rev. Microbiol, 42:177 (1988)) and a prokaryotic ampicillin- resistance (amp) gene and origin of replication for selection and propagation in E. coli.
  • polyhedron polyadenylation signal iller et al Ann. Rev. Microbiol, 42:177 (1988)
  • amp ampicillin- resistance
  • Baculovirus transfer vectors usually contain a baculovirus promoter.
  • a promoter will have a transcription initiation region which is usually placed proximal to the 5' end of the coding sequence. This transcription initiation region usually includes an RNA polymerase binding site and a transcription initiation site.
  • a baculovirus transfer vector may also have a second domain called an enhancer, which, if present, is usually distal to the structural gene. Expression may be either regulated or constitutive.
  • Structural genes abundantly transcribed at late times in a viral infection cycle, provide particularly useful promoter sequences. Examples include sequences derived from the gene encoding the viral polyhedron protein, Friesen et al, (1986) "The Regulation of Baculovirus Gene Expression, " in: The Molecular Biology of Baculoviruses (ed. Walter Doerfler); EPO Publ. Nos. 127 839 and 155 476; and the gene encoding the plO protein. Vlak et al , J. Gen. Virol 69:765 (1988).
  • DNA encoding suitable signal sequences can be derived from genes for secreted insect or baculovirus proteins, such as the baculovirus polyhedrin gene
  • IL-3 (Miyajima et al. Gene 58:272 ( 1987); and human glucocerebrosidase, Martin et al. DNA 7:99 (1988), can also be used to provide for secretion in insects.
  • an insect cell host is co-transformed with the heterologous DNA of the transfer vector and the genomic DNA of wild type baculovirus, usually by co-transfection.
  • Methods for introducing heterologous DNA into the desired site in the baculovirus virus are known in the art. (See Summers and Smith; Ju et al. (1987); Smith et al, Mol. Cell. Biol 5:2156 (1983); and Luckow and Summers (1989)).
  • the insertion can be into a gene such as the polyhedrin gene, by homologous double crossover recombination; insertion can also be into a restriction enzyme site engineered into the desired baculovirus gene. Miller et al. Bioessays 4:9 ⁇ (1989).
  • the newly formed baculovirus expression vector is subsequently packaged into an infectious recombinant baculovirus.
  • Methods to identify recombinant viruses are described in "Current Protocols in Microbiology” Vol. 2 (Ausubel et al eds) at 16.8 (Supp. 10, 1990); Summers and Smith; Miller et al. (1989).
  • Recombinant baculovirus expression vectors have been developed for infection into several insect cells. For example, recombinant baculoviruses have been developed for, inter alia: Aedes aegypti , Autographa californica, Bombyx mori. Drosophila melanogaster, Spodoptera frugiperda.
  • the TIAM2 protein can be used in an assay for inhibitors and for preparing antibodies directed to TIAM2. TIAM2 protein may also be useful as a factor that promotes the growth of cancer cells in culture.
  • the TIAM2 protein may be combined with the pharmaceutically acceptable carrier noted above for use with the
  • TIAM2 antisense molecule TIAM2 antisense molecule.
  • DP-75 377- nucleotide clone
  • TIAM2 T-cell lymphoma invasion and metastasis 2
  • Northern analysis with the DP-75 probe revealed a ⁇ -3.3-kb transcript in cerebral cortex, occipital pole, frontal lobe, and temporal lobe, and a ⁇ 4.4-kb transcript in testis and cerebellum ( Figures 1A and IB).
  • the compiled cDNA for the ⁇ 4.4-kb message is 4586 nucleotides long, without polyadenylation, and is predicted to encode the 1077-amino-acid-long form of the TIAM2 protein (TIAM2 L ).
  • the first ATG is at nucleotide 51 and is in good context for translation.
  • An alignment of the predicted protein to TIAMl ( Figure 3) shows significant identity beginning with the first methionine of TIAM2 and a methionine at position 576 of TIAMl, a region that corresponds to the last 14 amino acids of the coiled coil domain of TIAMl (aa 548-590).
  • EX domain extends from amino acid 599 to amino acid 691 of human TIAMl .
  • a comparison of the TIAMl /TIAM2 1 EX domains shows 62%> overall identity, but with 85% identity in a 60-aa subdomain.
  • alternative splicing of a 72-nucleotide miniexon leads to the presence or absence of a 24-amino acid sequence with no significant identity to TIAMl or SIF sequences.
  • TIAMl sequence with weak identity to TIAMl (18%)). but which contains the conserved residues of PDZ or DHR domains (Michiels et al.. Nature 375:338-340, 1995).
  • the remaining sequence contains identity to the DH catalytic region (70%) and the carboxyl-terminal PH domain (54%).
  • the compiled sequence for the ⁇ 3.3-kb message is 3344 nucleotides long and is predicted to encode a short form (626 aa) of TIAM2 (TIAM2 S ).
  • the ⁇ 3.3-kb message differs from the ⁇ 4.4-kb message in that the first 104 nucleotides are unique, suggesting that the ⁇ 3.3-kb message results from initiation at a promoter distinct from that of the ⁇ 4.4-kb message.
  • the initiator methionine at position 162 coincides with a methionine at amino acid 428 of the 4.4-kb TIAM2 predicted protein and for the remainder of the protein shows complete identity with TIAM2 L .
  • TIAMl Similar to what is seen with the TIAMl gene (Habets et al.. Cell 77:537-549, 1994), there are two upstream ATGs in the ⁇ 3.3-kb message that precede the long open reading frame (nucleotide 162), but only the start codon at nucleotide 162 is in good context for translation. A comparison with TIAMl shows that TIAM2 S . begins immediately upstream (24 aa) of the DH domain.
  • a Radiation Hybrid Mapping experiment was performed as follows. TIAM2-specif ⁇ c oligos AGTCCTACCTCATCAAGCCG (SEQ ID NO: 14) and TTAGTGCTTCCGTCAGGTGG (SEQ ID NO: 15) were synthesized and used with the G3 panel (Research Genetics) as per the manufacturer ' s instructions. The resulting PCR products were analyzed by gel electrophoresis, and the resulting data were analyzed according to methods of Stewart and Cox. In “Genome Mapping: A Practical Approach " (P. Dear et al. Ed.) pp. 73-93. Oxford Lniv. Press, Oxford. 1997. A two- point maximum-likelihood analysis showed that the markers were linked to D6S1556 (6q25 ) with a lod score of 1000.
  • Oligos designed from nucleotides 566-586 (AGTACAGAAGGTT- CTGGAGCG) and from nucleotides 1348-1367 (TACCAGGCGATCCTTACACG) of the human 3.3 kb TIAM2 cDNA were used to perform PCR on mouse brain cDNA (Clontech). Thirty cycles of PCR performed with an annealing temperature of 40° C led to the production of a product (MDP75) of the expected size (802 nt). Cloning and sequencing confirmed that MDP75 was 90% identical to human TIAM2 throughout the length of the clone.
  • TIAM-2 transcripts are present throughout the telencephalon ( Figure 2A). Parasagittal sections through the telencephalon demonstrate that expression is localized to the pial surface where early born postmitotic neurons are located ( Figure 2B). TIAM2 is not expressed in the proliferating neural precursor cells that line the ventricles.
  • TIAM2 continues to be expressed primarily in regions derived from the telencephalon ( Figures 2C-2G. Table 1). Areas of strong expression include the olfactory bulb, cerebral cortex, caudate putamen, and hippocampus. The hippocampus expression is highly specific in that cells of the dentate gyrus and regions derived from it. induseum griseum and fasciola cinerea; and pyramidal cells of one subregion of the CA fields (CA2) are labeled very strongly while CA1 and CA3 show very little expression. TIAM2 is also strongly expressed in the ependymal cells of the lateral surface of the lateral ventricles (Figure 2D). This region is a germinal zone where neurons are generated throughout adult life. The majority of neurons born in this region are believed to migrate to the olfactory bulb.
  • His-TIAM2 An amino-terminal HIS tagged version of the 3.3-kb TIAM S protein (His-TIAM2) was expressed in a baculovirus system. A protein of the predicted molecular mass (75.661 Da) was partially purified on a nickel column, and its identity was confirmed by amino-terminal sequencing and mass spectrometry. To generate the His-tagged TIAM2 s expression construct, a linker-adapter was produced such that it added an EcoRI site to the 5' end of the first 29 bp of the TIAM2 S sequence (GAATTCATGGAAGGACCGCGGGA-GAATCAGGATCC).
  • This kinased linker/adapter terminating in a BamHI site (bases 23-29 of the TIAM2 S sequence), was ligated to a cDNA clone DP-75#1 , which had been linearized by a BamHI fragment that encompassed the entire coding region of TIAM2 S .
  • a subsequent Sail digest liberated an -2000-bp Ec ⁇ Rl-Sall fragment that encompassed the entire coding region of TIAM2 S .
  • the fragment was isolated, purified, and ligated into ⁇ coRI-S ⁇ 7/I-digested pBlueBacHis2B vector (Invitrogen).
  • pHIS-TIAM2 s was introduced into SF9 cells, and clones expressing high levels of pHIS- TIAM2 S were identified by Western blot. Following clonal expansion, pHIS- TIAM2 -expressing cells were concentrated, lysed, and applied to a nickel column (Invitrogen). pHIS-TIAM2 s protein was purified from the column as per the manufacturer's recommendations except that following the 50 mM imidazole wash, the protein was directly eluted in 500 mM imidazole.
  • His-TIAM showed approximately fivefold stimulation of Rac exchange activity at 30 min relative to buffer alone, while SOS showed a modest stimulation (1.6 ⁇ ) at best ( Figure 4 A). Conversely, when His- TIAM2 S and SOS were incubated with RAS. SOS demonstrated a four- to fivefold stimulation of exchange activity while His-TIAM2 S had little or no effect (Figure 4B).
  • TIAM2 was hybridized to RNA from both cancerous and normal tissue.
  • the source of cancerous tissue include renal, thyroid, breast, colon, ureter, lung, nose, stomach, esophagus, liver, lymphoma. uterus, bladder, rectum, and brain.
  • the blots were from BioChain Institute, Inc.. San Leandro, California.
  • SEQ ID NOT mRNA levels were higher in the cancer than the normal samples.
  • SEQ ID NOT mRNA levels were higher in the cancer than the normal samples.
  • SEQ ID NOT (TIAM2) mRNA level were higher in the cancer than the normal sample.
  • SEQ ID NOT (TIAM2) mRNA level were higher in the cancer than the normal sample.
  • SEQ ID NO:6 was isolated from a frontal cortex library utilizing a phage vector Stratagene. La Jolla. California, USA). The library was probed with SEQ ID NOT. which was generated by a random primed label with a final radioactive count of approximately 1x10 6 cpm/ml. The probe was labeled according to manufacturer ' s instruction with a RediPrimeTM DNA labeling kit (Amersham, Arlington Heights. Illinois, USA).
  • the phage library was propagated and plated onto twenty plates according to the manufacturer's instructions with a 3.0-5.0 x 10 " plaques/plate.
  • the plaques were transferred to a nitrocellulose membranes.
  • Each membrane was incubated with the SEQ ID NOT probe for 2 hours at 65°C in ExpressHybTM hybridization solution purchased from Clontech, Palo Alto. California, USA.
  • the filters were washed according to the Clontech instruction. Film was exposed to the membranes to identify putative positive plaques containing the desired TIAM2 polynucleotide.
  • a second round of plating and hybridization was performed to identify a single positive plaque.
  • the positive plaques from the first round were propagated and plated onto agar medium according to the instructions provided by Stratagene.
  • the plaques were transferred to filters. These filters were incubated with the SEQ ID NOT probe.
  • the probe and hybridization conditions were the same as described above. Positive plaques were identified and propagated. According to manufacturer ' s instructions, a BlueScript plasmid was rescued from the phage vector.
  • the EcoRI insert from the plasmid was sequenced. The polynucleotide sequence is shown in SEQ ID NO:6.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Zoology (AREA)
  • Biophysics (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Toxicology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biochemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Enzymes And Modification Thereof (AREA)

Abstract

The present invention provides nucleic acid sequences encoding TIAM2 proteins. The invention also includes diagnostic assays, expression vectors, antisense molecules, ribozymes, and host cells to express the polypeptide encoded by the nucleic acid sequence. The present invention also includes claims to the polypeptide sequence encoded by the nucleic acid sequences.

Description

DNA ENCODING T-CELL LYMPHOMA INVASION AND METASTASIS 2 AND A PROCESS FOR ITS USE
FIELD OF THE INVENTION
The present invention is in the field of molecular biology. More specifically, the present invention relates to a polynucleotide sequence and corresponding TIAM2 protein.
BACKGROUND OF THE INVENTION
The TIAM1 gene and characteristics of the encoded protein are discussed in Habets et al., Cell 77:537-549 (1994); Hart, M.J. et al.. J. Biol Chem. 269:62-65 (1994); Haslam et al., Nature 565:309-310 (1993); and Mayer, B.J. et al.. Cell 75:629-630 (1993).
SUMMARY
The invention relates to a polynucleotide comprising a polynucleotide of SEQ ID NO:8. The invention also relates to a polypeptide encoded by SEQ ID NO:8.
The invention further relates to a polynucleotide having at least 80% sequence identity to SEQ ID NO:8.
The invention still further relates to a polynucleotide having at least 85% sequence identity to SEQ ID NO:8. The invention also relates to a polynucleotide having at least 90% sequence identity to SEQ ID NO:8.
The invention further relates to a polynucleotide having at least 95% sequence identity to SEQ ID NO: 8.
The invention relates to a polynucleotide comprising a polynucleotide of SEQ ID NO:9.
The invention also relates to a polypeptide encoded by SEQ ID NO:9. The invention further relates to a polynucleotide having at least 80% sequence identity to SEQ ID NO:9.
The invention still further relates to a polynucleotide having at least 85% sequence identity to SEQ ID NO:9. The invention also relates to a polynucleotide having at least 90% sequence identity to SEQ ID NO:9.
The invention further relates to a polynucleotide having at least 95% sequence identity to SEQ ID NO:9.
The invention relates to a polynucleotide comprising a polynucleotide of SEQ ID NO:10.
The invention also relates to a polypeptide encoded by SEQ ID NO- 10. The invention further relates to a polynucleotide having at least 80% sequence identity to SEQ ID NO: 10.
The invention still further relates to a polynucleotide having at least 85% sequence identity to SEQ ID NO: 10.
The invention also relates to a polynucleotide having at leasi 90% sequence identity to SEQ ID NO:l 0.
The invention further relates to a polynucleotide having at least 95% sequence identity to SEQ ID NO: 10. The invention relates to a polypeptide having at least 80% sequence identity to the amino acid sequence of SEQ ID NO:l l, SEQ ID NO:12 or SEQ ID NO:13.
The invention also relates to a polypeptide having at least 85% sequence identity to the amino acid sequence of SEQ ID NO: l l, SEQ ID NO:12 or SEQ ID NO:13.
The invention further relates to a polypeptide having at least 90% sequence identity to the amino acid sequence of SEQ ID NO:l l , SEQ ID NO:12 or SEQ ID NO:13. The invention still further relates to a polypeptide having at least 95% sequence identity to the amino acid sequence of SEQ ID NO: l l , SEQ ID NO:12 or SEQ ID NO: 13.
The invention further relates to an antibody capable of specifically binding to a polypeptide encoded by SEQ ID NO:8. SEQ ID NO:9 or SEQ ID NO: 10. or by a polynucleotide having at least 80% sequence identity to SEQ ID NO:8. SEQ ID NO:9 or SEQ ID NO:10.
The invention further relates to an antibody capable of specifically binding to a polypeptide having the amino acid sequence of SEQ ID NO:l l . SEQ ID NO: 12 or SEQ ID NO: 13.
The invention also relates to a method of detecting expression of a
TIAM2 expression product in a biological sample, comprising obtaining polypeptides from the biological sample, contacting the polypeptides with an antibody capable of specifically binding to TIAM2. and detecting the presence or absence of antibody- polypeptide complexes.
The invention also relates to a method of obtaining a TIAM2 polypeptide. comprising expressing a polynucleotide having at least 80% sequence identity to SEQ ID NO:8, SEQ ID NO:9 or SEQ ID NO: 10.
The invention further relates to a vector comprising a polynucleotide having at least 80% sequence identity to SEQ ID NO:8, SEQ ID NO:9 or SEQ ID NO:10.
The invention still further relates to a vector comprising a polynucleotide having at least 80% sequence identity to SEQ ID NO:8, SEQ ID NO:9 or SEQ ID NO: 10. and at least one regulatory region. The invention also relates to a host cell comprising a polynucleotide having at least 80% sequence identity to SEQ ID NO:8, SEQ ID NO:9 or SEQ ID NO: 10.
The invention further relates to a method of detecting a deletion of a region of chromosome 6q25 in ovarian cancer, comprising comparing the polynucleotide sequence of region of chromosome 6q25 of an ovarian tissue sample suspected of being cancerous with the polynucleotide sequence of SEQ ID NO:8, SEQ ID NO: 9 or SEQ ID NO: 10 and determining the presence or absence of the sequence in the polynucleotides of the tissue sample.
BRIEF DESCRIPTION OF THE FIGURES Figure 1 . Human brain-(A) and tissue-specific (B) blots containing
2 μg/lane of poly(A)^ mRNA were hybridized with TIAM-specific probes that recognize both the long (TIAM and the short (TIAMS) forms of TIAM2. A probe derived from the 5" end of the 4.4-Kb message hybridized to only the long form (C), while a S'-specific probe hybridized to both the long and the short forms (D). on the brain-specific Northerns.
Figure 2 shows expression of TIAM2 and mRNA in mouse brain. (A) Whole mount of a El 3.5 embryo brain. TIAM2 transcripts are expressed throughout the developing telencephalon (T). (B) Parasagittal section through an El 3.5 telencephalon demonstrating that TIAM2 mRNA is localized to cells near the pial (P) surface; labeling is not seen near the ventricular surface (V). (C) Coronal section through the adult mouse forebrain. TIAM2 transcripts are localized to the cerebral cortex (Ctx) and caudate putamen (CP), with intense labeling in the ependyma (small arrow) and in the indusium griseum (arrow). (D) Higher magnification view of labeling in the emendyma (arrowhead) lining the lateral ventricle (LV) below the corpus callosum. (CC). (E) TIAM2 transcripts in the olfactory bulb, glomerular layer (arrowhead), mitral cell layer (arrow). (F) Coronal section demonstrating labeling in the thalamus (arrowhead) and fasciola cinerea (arrow). (G) Hippocampal expression of TIAM2 shows expression in the granule cells of the dentate gyrus (DG) and the pyramidal cells of CA2. Figure 3 shows a comparison of the carboxy-terminus amino acid sequence of TIAM1 protein (amino acids 576-1591 ) with the amino acid sequence of TIAM2L. The EX domain, alternatively splice region. DHR domain, DH domain, and PH domain are underlined, and the initiator methionine for TIAM2S (amino acid 452) is in boldface and designated with an arrow. Figure 4 shows the results of a GDP-GTP exchange assay. Partially purified His-TIAM2S protein was assayed for the ability to stimulate GDP-GTP exchange activity with immunoprecipitated Rac (A) or Ras (B) proteins. (A) The average of three separate reactions in which Rac was incubated with [32P]GTP in the presence of His-TIAM2S (0), SOS (O), or buffer alone (D). (B) A representative experiment in which Ras was incubated with [32P]GTP in the presence of TIAM2S (•). SOS (A), or buffer alone (X).
Figure 5 shows the expression of TIAM2 mRNA in tumor tissue and normal tissues.
DETAILED DESCRIPTION OF THE INVENTION
TIAM2 (DP-75), for T-cell lymphoma invasion and metastasis 2, relates to a novel DNA and amino acid sequence that has some sequence homology with TIAMl . (Habets et al, Cell 77:537-749 (1994), and Habets et al. Oncogene 7 ( 1371- 1376 (1995)). Overexpression of full length or truncated forms of TIAMl increases the metastatic potential of lymphoma cells in mice. TIAMl is a member of a family GDP dissociation stimulators (GDSs) which are proteins that activate Rho-like and Rac-like GTPases. GDSs as well as Rho and Rac have oncogenic potential.
According to the invention, a novel protein. TIAM2, with high homology to TIAMl, has been identified. TIAM2 is expressed as ~4.4- and ~3.3-kb messages that encode long (TIAM2 and short forms (TIAM2S) of the TIAM2 protein. TIAM2L begins in a region with identity to the coiled-coil region of TIAMl and includes both the EX and the PDZ domains found within TIAMl . Both TIAM2L and TIAM2S contain regions of identity to the DH and carboxyl-terminal PH domains of TIAMl . An additional level of complexity is added by alternative splicing of the -4.4- kb message, which leads to the insertion of 24 amino acids between the EX and the DHR domains.
While analysis of the ~4.4-kb message identified an ATG at nucleotide 51 that is in good context for translation, further analysis revealed that the ORF can be extended 5" of the ATG through the first 51 nucleotides. This extended ORF could indicate that there are additional 5" sequences that would extend TIAM2L . Initiation likely begins at nucleotide 51 since the size of the clone cDNA (4586 nt) equals or exceeds the estimated size of the cerebellum message (~4.4-kb) and because, despite numerous attempts, additional 5" sequences were not identified. A His-tagged version of TIAM2S was expressed in a baculovirus system, which is the preferred system for TIAM2 expression, and purified on a nickel column. His-TIAM2S was compared to SOS and was shown to have GEF activity that prefers RAC over RAS.
The high similarity between TIAMl and TIAM2 protein coding sequences, expression patterns, and GEF activity suggest that, like TIAMl (Habets et al.. Cell 77:537-549, 1994; Hordijk et al., Science 278A46A1466, 1997; Ehler et al., Mol. Cell. Neurosci. 9: 1-12, 1997; van Leeuwen et al.. J. Cell Biol, 759:797-807, 1997), TIAM2 may play a role in neural development. The high level of TIAM2 expression throughout the El 3.5 telencephalon suggests that TIAM2 may play an important role in development of the forebrain. At El 3.5 postmitotic neurons are being produced: these cells must migrate to their correct positions within the developing brain and send out growth cones to establish contacts with their correct targets. These processes all require coordinating actin-based cytoskeletal rearrangements with environmental cues. There is strong evidence that the Rac/cdc42 GTPases play important roles in neuritogenesis and target recognition within the nervous system (Albertinazzi et al., J. Cell biol. 7^2:815-825, 1998; Hing et al., Cell 97:853-863, 1999; van Leewen et al., supra. 1997). Further analysis of TIAM2 expression during mouse embryogenesis may reveal a correlation with specific morphogenetic events or with specific GTP-ase family members, regulators, or effectors. It is likely that some of the specificity established during neural development is due to cell-type-specific expression of GTPase signaling pathway components such as TIAMl . RAC3, and TIAM2.
Unlike TIAMl , TIAM2 continues to be expressed at high levels in the adult forebrain. The areas of high expression in the adult are regions of synaptic plasticity (cortex. hippocampus) or neurogenesis (dentate gyrus, ependyma/subependyma) in the adult (Gould et al.. Trends Cogn. Sci. 5:186-192. 1999; Temple. Curr. Biol 9:R397-399. 1999; Lowenstein and Parent. Science 253: 1 126-1 127, 1999).
TIAM2 may play a role in metastasis or tumor suppression. Radiation hybrid mapping of TIAM2 places it in a 4-cM region of chromosome 6q25 that is frequently deleted in ovarian cancer (Colitti et al., Oncogene 76:555-559, 1998). Since the majority of ovarian cancer is epithelial in nature, and since TIAMl (21q22.1 ; Chen and Antonarakis, Genomics 50:123-127, 1995) has been suggested to act as a tumor suppressor in epithelial cells, this might suggest a role for TIAM2 in ovarian cancer.
The expression of alternative forms of TIAM2 suggests distinct roles for TIAM2L and TIAM2S. Both the EX and the PDZ domains found in TIAM2L have been suggested to play roles in protein-protein interactions and intracellular localization of proteins. Since TIAM2S lacks both the EX and the PDZ domains of TIAM2, . the two forms may be localized to different regions of the cell. Understanding the alternate forms of TIAM2 extends knowledge of the complexity of this emerging family of GEFs and may ultimately yield insight into the divergent roles of TIAMl as both a promoter of invasiveness and a tumor suppressor.
GDSs are implicated in various cancers and, based on the discussion herein, TIAM2 may be useful to diagnose cancerous cells. Many techniques may be used to diagnose whether tissue samples possess TIAM2-containing tumor tissue. For example, reverse transcription and PCR amplification of the RNA of a tumor sample to identify the presence of TIAM2 mRNA sequences (see Sambrook. et al. , Molecular Cloning; A Laboratory Manual, Second Edition (1989). chapter 14 or Gaugler et al. J. Exp. Med 779:921-930 (1994)). Also, immunohistochemical techniques or ELISA assays may be used to identify TIAM2-expressing tumors. For example, the TIAM2 protein can be recombinantly expressed and monoclonal antibodies can be prepared according to methods that are known in the art. For example, the methods shown in EP 174.204, Kohler and Milstein, Nature 256:495-497 (1975), Fong el al. J. Immun. Meth. 70:83-90 (1984), GB 2,086,937, 2,113.715, EP 57,107. 62.409, EP 118.893, EP 124.301, and EP 131,878 are suited to the present invention. The anti-TIAM2 monoclonal antibodies can then be used in the standard assays recited above or those assays that are otherwise known in the art.
Monoclonal antibodies may also be used therapeutical ly. Anti-TIAM2 monoclonal antibodies can be administered by means known in the art. Preferably, the antibodies are administered parenterally or subcutaneously, more preferably, they are administered intravenously. The monoclonal antibodies can be administered in combination with other agents designed to promote the activity of the antibodies or to treat the underlying condition involving the TIAM2 expressing cell.
Additionally, branched DNA testing may be performed to assay for TIAM2 DNA as shown in U.S. Patent Nos. 5,124.246, and 4.868.105 (hereby incorporated by reference in their entireties). TIAM2 nucleic acid probe molecules for the branched DNA testing are preferably from 10 to 50 bases in length, more preferably, between 15 and 40 bases in length, most preferably, between 20 and 30 bases in length
Ribozymes may be designed to act on the TIAM2 sequence identified in SEQ ID NO: l . SEQ ID NO:6, SEQ ID NO:8. SEQ ID NO:9, SEQ ID NO:10 or fragments thereof. (Kashani-Cabet and Scanlon, Cancer Gene Therapy, 2:213-223
(1995). hereby incorporated by reference in its entirety.) To obtain cellular expression, the ribozyme gene is cloned into an available vector and transfected into the cells of choice. Different vectors may be chosen based on the target cell to be infected. For example, respiratory cells may be targeted by an adeno or adeno associated virus
(AAV) vector. Appropriate promoters may be inserted into these vectors to ensure regulatable expression. (Kashani-Cabet at p. 216).
Antisense molecules can be developed based on the TIAM2 sequence shown in SEQ ID NO:l, SEQ ID NO:6, SEQ ID NO:8. SEQ ID NO:9, or SEQ ID NO:10. For example, see U. S. Patent Nos. 5,491 ,133 and 5,271.941 which are hereby incorporated by reference in their entireties.
Antisense RNA sequences have been described as naturally occurring biological inhibitors of gene expression in both prokaryotes (Mizuno, T., Chou, M-Y, and Inouye, M. (1984), Proc. Natl. Acad. Sci. USA 81, (1966-1970)) and eukaryotes (Heywood, S. M. Nucleic Acids Res., If. 6771 -6772 (1986) and these sequences function by hybridizing to complementary mRNA sequences, resulting in hybridization arrest of translation (Paterson. B. M., Roberts. B. E.. and Kuff. E. L.. (1977) Proc Natl Acad. Sci. USA, 74. 4370-4374.
Antisense oligodeoxynucleotides are short synthetic nucleotide sequences formulated to be complementary to a specific gene or RNA message. Through the binding of these oligomers to a target DNA or mRNA sequence, transcription or translation of the gene can be selectively blocked and the disease process generated by that gene can be halted. The cytoplasmic location of mRNA provides a target considered to be readily accessible to antisense oligodeoxynucleotides entering the cell; hence much of the work in the field has focused on RNA as a target.
Antisense therapy is the administration of oligonucleotides which bind to a target polynucleotide located within the cells. These oligonucleotides are usually exogenous, but they can be endogenously expressed. The term "antisense" refers to the fact that such oligonucleotides are complementary to their intracellular targets, e g , TIAM2. See for example. Jack Cohen, Oligodeoxynucleotides, Antisense Inhibitors of Gene Expression. CRC Press, 1989: and Synthesis 7:1-5 (1988).
The TIAM2 antisense oligonucleotides of the present invention include derivatives such as S-oligonucleotides (phosphorothioate derivatives or S-oligos, see, Jack Cohen, supra) which exhibit enhanced cancer cell growth inhibitory action. The TIAM2 antisense oligonucleotides of the present invention may be RNA or DNA which are complementary to and stably hybridize with the TIAM2 genome or the corresponding mRNA. Use of an oligonucleotide complementary to this region allows for the selective hybridization to TIAM2 mRNA and not to other mRNAs.
Preferably, the TIAM2 antisense oligonucleotides of the present invention are 15 to 40-mer fragments of the antisense DNA molecules which hybridize to TIAM2 mRNA. Alternatively, the preferred TIAM2 antisense oligonucleotide is a 20- to 30-mer oligonucleotide which is complementary to a region in TIAM2. Included in the present invention are pharmaceutical compositions comprising an effective amount of at least one of the TIAM2 antisense oligonucleotides of the invention in combination with a pharmaceutically acceptable carrier. In one embodiment, a single TIAM2 antisense oligonucleotide is utilized. In another embodiment, two TIAM2 antisense oligonucleotides are utilized which are complementary to adjacent regions of the TIAM2 genome.
Administration of two TIAM2 antisense oligonucleotides which are complementary to adjacent regions of the TIAM2 genome or corresponding mRNA may allow for more efficient inhibition of TIAM2 genomic transcription or mRNA translation, resulting in more effective inhibition of cancer cell growth. Preferably, the TIAM2 antisense oligonucleotide is coadministered with an agent which enhances the uptake of the antisense molecule by the cells. For example, the TIAM2 antisense oligonucleotide may be combined with a lipophilic cationic compound which may be in the form of liposomes.
The use of liposomes to introduce nucleotides into cells is taught, for example, in U.S. Pat. Nos. 4.897,355 and 4,394.448, the disclosures of which are incorporated by reference in their entireties. See also U.S. Pat. N'os. 4.235.871. 4.231.877, 4.224,179, 4,753,788, 4,673,567, 4,247.41 1 , 4.814.270 for general methods of preparing liposomes comprising biological materials.
Alternatively, the TIAM2 antisense oligonucleotide may be combined with a lipophilic carrier such as any one of a number of sterols including cholesterol, cholate and deoxycholic acid. A preferred sterol is cholesterol. In addition, the TIAM2 antisense oligonucleotide may be conjugated to a peptide that is ingested by cells. Examples of useful peptides include peptide hormones, antigens or antibodies, and peptide toxins. By choosing a peptide that is selectively taken up by the neoplastic cells, specific delivery of the antisense agent may be effected.
The TIAM2 antisense oligonucleotide may be covalently bound via the 5' H group by formation of an activated aminoalkyl derivative. The peptide of choice may then be covalently attached to the activated TIAM2 antisense oligonucleotide via an amino and sulfhydryl reactive hetero bifunctional reagent. The latter is bound to a cysteine residue present in the peptide. Upon exposure of cells to the TIAM2 antisense oligonucleotide bound to the peptide, the peptidyl antisense agent is endocytosed and the TIAM2 antisense oligonucleotide binds to the target TIAM2 mRNA to inhibit translation. See PCT Application Publication No. PCT/US89/02363.1.
The TIAM2 antisense oligonucleotides and the pharmaceutical compositions of the present invention may be administered by any means that achieve their intended purpose. For example, administration of the antisense compounds or other compounds of the present invention may be by parenteral, subcutaneous, intravenous, intramuscular, intra-peritoneal. or transdermal routes.
The dosage administered will be dependent upon the age. health, and weight of the recipient, kind of concurrent treatment, if any. frequency of treatment, and the nature of the effect desired. Compositions within the scope of this invention include all compositions wherein the TIAM2 antisense oligonucleotide is contained in an amount which is effective to achieve inhibition of proliferation and/or stimulate differentiation of the subject cancer cells.
While individual needs vary, determination of optimal ranges of effective amounts of each component is within the skill of the art. Typically, the TIAM2 antisense oligonucleotide may be administered to mammals, e.g , humans, at a dose of 0.005 to 1 mg/kg/day, or an equivalent amount of the pharmaceutically acceptable salt thereof, per day of the body weight of the mammal being treated.
In addition to administering the TIAM2 antisense oligonucleotides as a raw chemical in solution, the TIAM2 antisense oligonucleotides may be administered as part of a pharmaceutical preparation containing suitable pharmaceutically acceptable carriers comprising excipients and auxiliaries which facilitate processing of the TIAM2 antisense oligonucleotide into preparations which can be used pharmaceutically. The term pharmaceutically acceptable refers to compounds and compositions which may be administered to mammals without undue toxicity. Exemplary pharmaceutically acceptable salts include mineral acid salts such as hydrochlorides, hydrobromides, phosphates, sulfates, and the like; and the salts of organic acids such as acetates, propionates, malonates, benzoates. and the like.
Suitable formulations for parenteral administration include aqueous solutions of the TIAM2 antisense oligonucleotides in water-soluble form, for example. water-soluble salts. In addition, suspensions of the active compounds as appropriate oily injection suspensions may be administered. Suitable lipophilic solvents or vehicles include fatty oils, for example, sesame oil, or synthetic fatty acid esters, for example, ethyl oleate or triglycerides. Aqueous injection suspensions may contain substances which increase the viscosity of the suspension include, for example, sodium carboxymethyl cellulose, sorbitol, and/or dextran. Optionally, the suspension may also contain stabilizers.
The antisense oligonucleotides of the present invention may be prepared according to any of the methods that are well known to those of ordinary skill in the art. Preferably, the antisense oligonucleotides are prepared by solid phase synthesis. See. Goodchild, J., Bioconjugate Chemistry, 7:165-167 (1990), for a review of the chemical synthesis of oligonucleotides. Alternatively, the antisense oligonucleotides can be obtained from a number of companies which specialize in the custom synthesis of oligonucleotides. TIAM2 polypeptides, polynucleotides, or antibodies can be administered orally, topically, or by parenteral means, including subcutaneous and intramuscular injection, implantation of sustained release depots, intravenous injection, intranasal administration, and the like. When used to treat tumors, it may be advantageous to apply the TIAM2 polynucleotides or antibodies, for example, directly to the site, e.g., during surgery to remove the bulk of the tumor. Accordingly, TIAM2 polypeptides, polynucleotides, or antibodies may be administered as a pharmaceutical composition comprising a pharmaceutically acceptable excipient. Such compositions may be aqueous solutions, emulsions, creams, ointments, suspensions, gels, liposomal suspensions, and the like. Suitable excipients include water, saline. Ringer's solution, dextrose solution, and solutions of ethanol, glucose, sucrose, dextran. mannose. mannitol. sorbitol. polyethylene glycol (PEG), phosphate, acetate, gelatin, collagen. Carbopol®, vegetable oils, and the like. One may additionally include suitable preservatives, stabilizers, antioxidants, antimicrobials, and buffering agents, for example. BHA, BHT, citric acid, ascorbic acid, tetracycline, and the like. Cream or ointment bases useful in formulation include lanolin, Silvadene® (Marion). Aquaphor® (Duke Laboratories), and the like. Other topical formulations include aerosols, bandages, and other wound dressings.
Alternatively, one may incorporate or encapsulate the TIAM2 polypeptides, polynucleotides, or antibodies in a suitable polymer matrix or membrane, thus providing a sustained-release delivery device suitable for implantation near the site to be treated locally. Other devices include indwelling catheters and devices such as the Alzet® minipump. Ophthalmic preparations may be formulated using commercially available vehicles such as Sorbi-care® (Allergan), Neodecadron® (Merck, Sharp & Dohme), Lacrilube®, and the like, or may employ topical preparations such as that described in US 5,124.155. incorporated herein by reference. Further, one may provide a TIAM2 polypeptide, polynucleotide, or antibody in solid form, especially as a lyophilized powder. Lyophilized formulations typically contain stabilizing and bulking agents, for example human serum albumin, sucrose, mannitol. and the like. A thorough discussion of pharmaceutically acceptable excipients is available in Remington's Pharmaceutical Sciences (Mack Pub. Co.).
The amount of TIAM2 polypeptide, polynucleotide, or antibody required to treat any particular disorder will of course vary depending upon the nature and severity of the disorder, the age and condition of the subject, and other factors readily determined by one of ordinary skill in the art. The appropriate dosage may be determined by one of ordinary skill in the art.
It may be useful to administer the nucleic acid molecules described above, i.e., the ribozyme or antisense molecules, in a gene therapy method. Accordingly, the vectors and techniques described below will be useful. The following expression systems describe vectors, promoters and regulatory elements that are useful for gene therapy applications for the delivery of the above polynucleotides.
Vectors and expression systems useful for the present invention include viral and non-viral systems. Examples of viral delivery systems include retroviruses, adenoviruses, adeno-associated viruses (AAV), sindbis and herpes viruses. In one aspect of the present invention, the viral vector is capable of integrating the above nucleic acid sequence into the host cell genome for long term expression. One preferred retrovirus is a murine leukemia virus. However, it may be preferred to avoid integration into the host cell genome. Non-viral vectors include naked DNA and DNA formulated with cationic lipids or liposomes. A non-viral system that can be used is the T7/T7 system. Additionally, it will be useful to produce TIAM2 protein from the presently disclosed nucleic acid sequence to be used in an assay to test for inhibitors or for the preparation of monoclonal antibodies, for example. TIAM2 can be expressed by a baculovirus that has been transformed with a native or modified TIAM2 nucleic acid sequence. The TIAM2 nucleic acid sequence useful in the present invention encodes a protein having an amino acid sequence that is substantially identical to the amino acid sequence of native TIAM2.
Preferably, the TIAM2 nucleic acid or protein sequence will be homologous to the partial sequences listed below. Preferably, the above sequence will be greater than 80% homologous to SEQ ID NO:6, SEQ ID NO:8. SEQ ID NO:9. SEQ ID NO: 10 or fragments thereof, more preferably it will be greater than 85% homologous, more preferably greater than 90% homologous, even more preferably greater than 91 %, 92%, 93% . 94% or 95% homologous. Most preferably, it will be greater than 96%>, 97%, 98%o or 99% homologous. Substantial identity means the sequences are identical or differ by one or more alterations (deletion, additions, substitutions) that do not adversely affect the activity of the protein. It is preferable that the protein sequences are homologous in the same percentages noted above. Percent identity or homology can be calculated using methods and algorithms known in the art. A suitable but non-limiting method is the Smith- Waterman homology search algorithm as implemented in MPSRCH program (Oxford Biomolecular) using an affine gap search with the following search parameters: gap open penalty of 12, and gap extension penalty of 1.
The precise chemical structure of the TIAM2 sequence can depend on a number of factors. As ionizable amino and carboxyl groups are present in the molecule, a particular protein may be obtained as a acidic or basic salt, or in neutral form. All such preparations which retain their activity when placed in suitable environmental conditions are included in the definition of proteins herein. Further, the primary amino acid sequence of the protein may be augmented by derivitization using sugar moieties (glycosylation) or by other supplementary molecules such as lipids, phosphate, acetyl groups and the like. Certain aspects of such augmentation are accomplished through post-translational processing systems of the producing host; other such modifications may be introduced in vitro. In any event, such modifications are included in the definition of protein herein so long as the activity of the protein is not destroyed. It is expected that such modifications may quantitatively or qualitatively affect the activity, either by enhancing or diminishing the activity of the protein, in the various assays. Further, individual amino acid residues in the chain may be modified by oxidation, reduction, or derivatization, and the protein may be cleaved to obtain fragments which retain activity. Such alterations which do not destroy activity do not remove the protein sequence from the definition of TIAM2 herein.
Modifications to the primary structure itself, by deletion, addition, oi¬ alteration of the amino acids incorporated into the sequence during translation, can be made without destroying the activity of the protein. For example, site specific mutagenesis can enable specific changes in the DNA structure to effect a change in the polypeptide structure. See Mark et al. U. S. Pat. No. 4.959,314, and Sambrook. et al . supra. Volume 2. chapter 15 which is hereby incorporated by reference in its entirety. The TIAM2 proteins include mutants, fragments, fusions, and the protein encoded by the sequence listed in SEQ ID NO: 1 , SEQ ID NO:6, SEQ ID NO:8. SEQ ID NO:9, SEQ ID NO: 10 or fragments thereof. The native TIAM2 proteins are those that occur in nature. The amino acid sequence of native polypeptides will comprise a sequence that varies slightly; typically, less than by 10-20 amino acids encoded by SEQ ID NO: l. SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:9. or SEQ ID NO: 10.
The term "polynucleotide'" or "nucleic acid sequence"' as used herein refers to a polymer of nucleotides of any length, preferably deoxyribonucleotides. and is used interchangeably herein with the terms "oligonucleotide" and "oligomer." The term refers only to the primary structure of the molecule. Thus, this term includes double- and single-stranded DNA, as well as antisense polynucleotides. It also includes known types of modifications, for example, the presence of labels which are known in the art. methylation. end "caps," substitution of one or more of the naturally occurring nucleotides with an analog, internucleotide modifications such as. for example, replacement with certain types of uncharged linkages (e.g. , methyl phosphonates, phosphotriesters, phosphoamidates, carbamates, etc.) or charged linkages (e.g , phosphorothioates, phosphorodithioates, etc.), introduction of pendant moieties, such as, for example, proteins (including nucleases, toxins, antibodies, signal peptides, poly-L-lysine, etc.). intercalators (e.g.. acridine, psoralen, etc.). chelators (e.g. , metals, radioactive species, boron, oxidative moieties, etc.), alkylators (e g , alpha anomeric nucleic acids, etc.).
A polynucleotide sequence encoding a native TIAM2 protein can be easily modified to encode other classes of TIAM2 proteins. It will be recognized in the art that some amino acid sequence of the TIAM2 polypeptide can be varied without significant effect on the structure or function of the protein. If such differences in sequence are contemplated, it should be remembered that there are critical areas on the protein which determine activity. In general, it is possible to replace residues that form the tertiary structure, provided that residues performing a similar function are used. In other instances, the type of residue may be completely unimportant if the alteration occurs at a non-critical region of the protein. The replacement of amino acids can also change the selectivity of binding to cell surface receptors. Ostade et al., Nature 567:266-268 (1993) describes certain mutations resulting in selective binding of TNF- alpha to only one of the two known types of TNF receptors. Thus, the polypeptides of the present invention may include one or more amino acid substitutions, deletions or additions, either from natural mutations or human manipulation. Thus, the invention further includes variations of the TIAM2 polypeptide which show substantial TIAM2 polypeptide activity or which include regions of TIAM2 protein such as the protein portions discussed below. Such mutants include deletions, insertions, inversions, repeats, and type substitutions. As indicated above, guidance concerning which amino acid changes are likely to be phenotypically silent can be found in Bowie. J.U., et al. "Deciphering the Message in Protein Sequences: Tolerance to Amino Acid Substitutions." Science 2- 7: 1306-1310 (1990).
Of particular interest are substitutions of charged amino acids with another charged amino acid and with neutral or negatively charged amino acids. The latter results in proteins with reduced positive charge to improve the characteristics of the TIAM2 proteins. The prevention of aggregation is highly desirable. Aggregation of proteins not only results in a loss of activity but can also be problematic when preparing pharmaceutical formulations, because they can be immunogenic. (Pinckard et al., Clin. Exp. Immunol 2:331-340 (1967): Robbins et al., Diabetes 56:838-845 (1987); Cleland et al. Crit. Rev Therapeutic Drug Carrier Systems 70:307-377 (1993)). Amino acids in the polypeptides of the present invention that are essential for function can be identified by methods known in the art, such as site- directed mutagenesis or alanine-scanning mutagenesis (Cunningham and Wells, Science 244: 1081-1085 (1989)). The latter procedure introduces single alanine mutations at every residue in the molecule. The resulting mutant molecules are then tested for biological activity such as receptor binding or in vitro, or in vitro proliterative activity. Sites that are critical for ligand-receptor binding can also be determined by structural analysis such as crystallization, nuclear magnetic resonance or photoaffinity labeling (Smith et al., J. Mol Biol. 22-7:899-904 (1992) and de Vos et al. Science 255:306-312 (1992)). For example, mutants can be constructed by making conservative amino acid substitutions. The following are examples of conservative substitutions: Gly Λ/ Ala; Val He V Leu; Asp Glu; Lys Arg; Asn Λ/ Gin; and Phe Trp Tyr. A subset of mutants, called muteins, is a group of polypeptides with the non-disulfide bond participating cysteines substituted with a neutral amino acid, generally, with serines. These mutants may be stable over a broader temperature range than native TIAM2 proteins. As indicated, changes are preferably of a minor nature, such as conservative amino acid substitutions that do not significantly affect the folding or activity of the protein. Of course, the number of amino acid substitutions a skilled artisan would make depends on many factors, including those described above. Generally speaking, the number of substitutions for any given TIAM2 polypeptide will not be more than 50. 40. 30. 25. 20, 15. 10, 5 or 3. The coding sequence of mutants can be constructed by in vitro mutagenesis of the native TIAM2 polypeptide coding sequences.
As used herein, the term "protein"" or "polypeptide"' refers to a polymer of amino acids and does not refer to a specific length of the product: thus, peptides, oligopeptides. polypeptides, proteins, and polyproteins. as well as fragments of these, are included within this definition. This term also does not refer to. or exclude, post expression modifications of the protein, for example, glycosylations, acetylations, phosphorylations and the like. Included within the definition are, for example, proteins containing one or more analogs of an amino acid (including, for example, unnatural amino acids, etc.), proteins with substituted linkages, as well as other modifications known in the art, both naturally occurring and non-naturally occurring.
A polypeptide or protein or amino acid sequence "derived from" or "coded by" or ''encoded by"" a designated nucleic acid sequence refers to a polypeptide having an amino acid sequence identical to that of a polypeptide encoded in the sequence, or a portion thereof wherein the portion consists of at least 3-5 consecutive amino acids, and more preferably at least 8-10 amino acids, and even more preferably at least 1 1-15 amino acids, or which is immunologically identifiable with a polypeptide encoded in the sequence. This terminology also includes a polypeptide expressed from a designated nucleic acid sequence. "'Purified" and "isolated" mean, when referring to a polypeptide or nucleotide sequence, that the indicated molecule is present in the substantial absence of other biological macromolecules of the same type. The term "purified" as used herein preferably means at least 75% by weight, more preferably at least 85%> by weight, more preferably still at least 95% by weight, and most preferably at least 98%> by weight, of biological macromolecules of the same type present (but water, buffers, and other small molecules, especially molecules having a molecular weight of less than 1000, can be present).
Also included within the scope of the invention are fragments of polynucleotides that encode the TIAM2 polypeptides disclosed herein. Such fragments may encode antigenic regions of the proteins or biologically functional regions of the proteins as described herein. Such fragments also encode polypeptide components of the fusion proteins disclosed herein. Fragments are also suitable for use as probes for identifying polynucleotides capable of hybridizing with SEQ ID NO:8, 9. and/or 10. Fragments can range in length from about 10 basepairs to the full length polynucleotide, which is 3344 basepairs for SEQ ID NO:8, 4590 basepairs for SEQ ID NO:9, and 4514 basepairs for SEQ ID NO: 10. Preferred fragments are 15. 20. 25, 30. 35. 40, 45, 50. 55, 60, 65, 70, 75, 80, 85. 90, 95. 100, 125. 150, 200, 250. 300. 350, 400, 500, 600, 700. 800, 900, 1000. 1 100. 1200, 1300, 1400, 1500, 1600. 1700, 1800, 1900. 2000, 2100, 2200, 2300, 2400. 2500. 2600. 2700, 2800. 2900. 3000. 3100, 3200. or 3300 basepairs for SEQ ID NO: 8. 9, or 10: 3400. 3500. 3600, 3700. 3800. 4000, 4100, 4200. 4300. 4400. 4500, or 4510 basepairs for SEQ ID NO:9 or 10; and 4520, 4550. 4575. or 4580 basepairs for SEQ ID NO: 10. A particularly preferred fragment comprises nucleotides 1 -104 of SEQ ID NO:8.
Polypeptide fragments are amino and/or carboxyl terminal amino acid deletions of mutant or native TIAM2 proteins. The number of amino acids that are truncated is not critical as long as the polypeptide fragment exhibits the desired sequence homology, immunological or biological activity. Preferred fragments are 10. 15. 20. 25, 30, 35. 40. 45, 50, 55. 60. 65, 70. 75. 80. 85, 90. 95. 100, 125. 150, 175, 200, 250. 300, 350, 400, 450, 500, 550, 600 or 625 amino acids of SEQ ID NO:7. 1 1. 12 or 13; 650, 675. 700, 750. 800, 825. 900, 950, 1000, 1025, or 1050 amino acids of SEQ ID NO: 12 or 13; and 1060, 1065, 1070 or 1075 amino acids of SEQ ID NO: 13. Polypeptide fragments of immunological significance comprise, for example, at least one epitope shared by a native TIAM2 protein. Such TIAM2 proteins may be only 5-15 amino acids in length. Examples of amino acid sequence of fragments comprise amino acid number 1-8 (aal to aa8) of SEQ ID NO:7, 1 1. 12. or 13; aa2 to aa9 of SEQ ID NO:7, 1 1 , 12, or 13; aa3 to aalO of SEQ ID NO:7. 1 1 , 12. or 13; aa4 to aal l of SEQ ID NO:7, 1 1 , 12, or 13; aa5 to aal2 of SEQ ID NO:7, 1 1. 12. or 13; aa6 to aal 3 of SEQ ID NO:7. 11, 12, or 13; aa7 to aal4 of SEQ ID NO:7, 11, 12. or 13; aa8 to aal 5 of SEQ ID NO:7, 11, 12, or 13; aa9 to aal6 of SEQ ID NO:7. 1 1. 12, or 13; aal O to aal 7 of SEQ ID NO:7, 1 1 , 12. or 13; aal 1 to aal 8 of SEQ ID NO:7. 1 1. 12. or 13; aal 2 to aal 9 of SEQIDNO:7.11.12. or 13; aal3 to aa20 of SEQ ID NO:7, 11.12. or 13: aal4 to aa21 of SEQIDNO:7.11, 12, or 13; aal5 to aa22 of SEQ ID NO:7, 11, 12, or 13; aal 6 to aa23ofSEQIDNO:7.11, 12. or 13: aal7 to aa24 of SEQ ID NO:7, 11, 12. or 13; aal8 to aa25 of SEQ ID NO:7, 11.12. or 13; aal 9 to aa26 of SEQ ID NO:7, 11.12, or 13; aa20toaa27ofSEQIDNO:7, 11, 12, or 13; aa21 to aa28 of SEQ ID NO:7, 11, 12, or 13;aa22toaa29ofSEQIDNO:7, 11, 12. or 13; aa23 to aa30 of SEQ ID NO:7, 11.12, or 13;aa24to a31 ofSEQIDNO:7.11.12, or 13; aa25 to aa32 of SEQ ID NO:7.11. 12, or 13;aa26toaa33 ofSEQIDNO:7, 11, 12, or 13: aa27 to aa34 of SEQ ID NO:7,
11, 12. or 13; aa28 to aa35 of SEQ ID NO:7.11.12. or 13; aa29 to aa36 of SEQ ID NO:7, 11.12, or 13; aa30 to aa37 of SEQ ID NO:7, 11, 12. or 13; aa31 to aa38 of SEQ ID NO:7.11, 12, or 13; aa32 to aa39 of SEQ ID NO:7, 11.12, or 13; aa33 to aa40 of SEQIDNO:7.11, 12, or 13: aa34 to aa41 ofSEQIDNO:7, 11, 12. or 13: aa35 to aa42 of SEQ ID NO:7, 11, 12, or 13: aa36 to aa43 of SEQ ID NO:7, 11, 12. or 13; aa37 to aa44ofSEQID O:7.11, 12. or 13, aa38 to aa45 of SEQ ID NO.7.11.12. or 13; aa39 to aa46 of SEQ ID NO:7.11, 12, or 13; aa40 to aa47 of SEQ ID NO:7.1 ϊ.12, or 13; aa41 toaa48 of SEQ ID NO:7, 11.12. or 13; aa42 to aa49 of SEQ ID NO:7, 11.12. or 13;aa43toaa50ofSEQIDNO:7, 11, 12, or 13; aa44 to aa51 ofSEQIDNO:7, 11, 12, or 13;aa45 to aa52 of SEQ ID NO:7.11.12. or 13; aa46 to aa53 of SEQ ID NO:7, 11.
12. or 13; aa47 to aa54 of SEQ ID NO:7, 11, 12. or 13; aa48 to aa55 of SEQ ID NO:7,
11, 12, or 13; aa49 to aa56 of SEQ ID NO:7, 11, 12. or 13; aa50 to aa57 of SEQ ID NO:7, 11, 12, or 13; aa51 to aa58 of SEQ ID NO:7, 11, 12, or 13; aa52 to aa59 of SEQ ID NO:7, 11, 12, or 13; aa53 to aa60 of SEQ ID NO:7, 11, 12, or 13; aa54 to aaόl of SEQIDNO:7, 11, 12, or 13; aa55 to aa62 of SEQ ID NO:7, 11.12, or 13; aa56 to aa63 of SEQIDNO:7, 11, 12. or 13; aa57 to aa64 of SEQ ID NO:7, 11.12. or 13; aa58 to aa65ofSEQIDNO:7, 11, 12, or 13: aa59 to aa66 of SEQ ID NO:7, 11, 12. or 13; aa60 to aa67 of SEQ ID NO:7, 11, 12. or 13; aaόl to aa68 of SEQ ID NO:7, 11, 12. or 13; aa62toaa69ofSEQIDNO:7, 11, 12, or 13; aa63 to aa70 of SEQ ID NO:7.11, 12. or 13;aa64toaa71 ofSEQIDNO:7.11.12, or 13; aa65 to aa72 of SEQ ID NO:7, 11, 12. or 13;aa66toaa73 ofSEQIDNO:7.11.12, or 13; aa67 to aa74 of SEQ ID NO:7.11,
12. or 13;aa68toaa75ofSEQIDNO:7, 11, 12, or 13; aa69 to aa76 of SEQ ID NO:7. 11, 12, or 13; aa70 to aa77 of SEQ ID NO:7, 11, 12, or 13: aa71 to aa78 of SEQ ID NO:7, 11, 12, or 13; aa72 to aa79 of SEQ ID NO:7.11, 12, or 13: aa73 to aa80 of SEQ IDNO:7.11.12, or 13; aa74 to aa81 of SEQ ID NO:7.11.12, or 13; aa75 to aa82 of SEQIDNO:7, 11, 12, or 13; aa76 to aa83 of SEQ ID NO:7.11.12, or 13; aa77 to aa84 of SEQ IDNO:7, 11, 12, or 13; aa78 to aa84 of SEQ ID NO:7.11.12, or 13; aa79 to aa86ofSEQIDNO:7, 11.12, or 13; aa80 to aa87 of SEQ ID NO:7, 11.12, or 13; aa81 toaa88 of SEQ ID NO:7, 11, 12. or 13; aa82 to aa89 of SEQ ID NO:7, 11.12, or 13; aa83 to aa90 of SEQ ID NO:7.11.12, or 13; aa84 to aa91 of SEQ ID NO:7, 11, 12, or 13;aa85 to aa92 of SEQ ID NO:7.11.12, or 13; aa86 to aa93 ofSEQIDNO:7, 11.12. or 13;aa87toaa94of SEQ ID NO:7, 11.12, or 13; aa88 to aa95 of SEQ ID NO:7, 11,
12, or 13;aa89toaa96ofSEQIDNO:7.11, 12, or 13; aa90 to aa97 of SEQ ID NO:7, 11, 12, or 13; aa91 to aa98 of SEQ ID NO:7, 11.12, or 13: aa92 to aa99 of SEQ ID NO:7, 11.12. or 13: aa93 to aalOO of SEQ ID NO:7, 11, 12. or 13. aa94 to aalOl of SEQ ID NO:7.11, 12. or 13; aa95 to aal02 of SEQ ID NO:7, 11, 12. or 13; aa96 to aal03 of SEQ ID NO:7.11, 12, or 13: aa97 to aal04 of SEQ ID NO:7, 11, 12, or 13; aa98toaal05 of SEQ ID NO:7.11.12. or 13; aa99 to aalOό of SEQ ID NO:7, 11, 12, or 13;aal00toaal07ofSEQIDNO:7.11, 12, or 13 aalOl to aal08 of SEQ ID NO:7.
11, 12, or 13 aal02 to aal09 of SEQ ID NO:7, 11, 12, or 13; aal03 to aal 10 of SEQ ID NO:7.11, 12, or 13; aal04 to aall 1 ofSEQIDNO:7, 11, 12. or 13; aal05 to aal 12 of SEQIDNO:7, 11, 12, or 13; aal06 to aal 13 of SEQ ID NO:7, 11.12. or 13; aal 07 to aal 14 of SEQ ID NO:7, 11.12, or 13; aal08 to aal 15 ofSEQIDNO:7, 11, 12, or 13; aal09toaall6of SEQ ID NO: 7, 11, 12, or 13; aal 10 to aal 17 of SEQ ID NO:7, 11.
12, or 13; aal 11 to aal 18 of SEQ ID NO:7.11, 12, or 13; aal 12 to aal 19 of SEQ ID NO:7, 11, 12, or 13; aal 13 to aal20 of SEQ ID NO:7, 11, 12. or 13; aal 14 to aal21 of SEQIDNO:7, 11, 12. or 13; aal 15 to aal22 of SEQ ID NO:7.11.12. or 13; aal 16 to aal23 of SEQ ID NO:7, 11, 12, or 13; aal 17 to aal24 of SEQ ID NO:7, 11, 12, or 13; aal 18 to aal 25 of SEQ ID NO:7.11, 12. or 13; aal 19 to aal26 of SEQ ID NO:7, 11, 12, or 13; aal20 to aal27 of SEQ ID NO:7, 11, 12, or 13; aal21 to aal28 of SEQ ID NO:7, 11.12. or 13; aal22 to aal29 of SEQ ID NO:7, 11.12. or 13; aal23 to aal30 of SEQIDNO:7, 11, 12, or 13; aal24 to aal31 of SEQ ID NO:7, 11.12, or 13; aal25 to aal32of SEQ ID NO:7.11, 12, or 13; aal26toaal33 ofSEQIDNO:7.11, 12, or 13; aal27toaal34of SEQ ID NO:7.11, 12. or 13; aal28 to aal 35 of SEQ ID NO:7, 11. 12, or 13; aal29 to aal36 of SEQ ID NO:7, 11.12. or 13; aal30 to aal37 of SEQ ID NO:7, 11, 12. or 13; aal31 to aal38 of SEQ ID NO:7.11, 12, or 13; aal 32 to aal 39 of SEQ IDNO:7, 11, 12. or 13; aal33 to aal40 of SEQ ID NO:7, 11, 12. or 13; aal34to aal41 of SEQ ID NO:7.11, 12, or 13; aal35 to aal42 of SEQ ID NO:7.11.12, or 13; aal36toaal43 of SEQ ID NO:7, 11, 12, or 13; aal 37 to aal 44 of SEQ ID NO:7.11. 12, or 13; aal38 to aal45 of SEQ ID NO:7, 11, 12. or 13; aal39 to aal46 of SEQ ID NO:7, 11.12, or 13; aal40 to aal47 of SEQ ID NO:7.11.12. or 13; aal41 to aal 48 of SEQIDNO:7, 11, 12, or 13; aal 42 to aal 49 of SEQ ID NO:7, 11, 12, or 13; aal43 to aal50of SEQ ID NO:7.11, 12. or 13; aal44 to aal 51 of SEQ ID NO:7, 11, 12, or 13; aal45 to aal 52 of SEQ ID NO:7.11.12, or 13; aal 46 to aal53 of SEQ ID NO:7, 11, 12. or 13; aal47 to aal54 of SEQ ID NO:7, 11, 12. or 13; aal 48 to aal 55 of SEQ ID NO:7, 11, 12. or 13; aal49 to aal56 of SEQ ID NO:7, 11.12, or 13: aal50 to aal57 of SEQIDNO:7.11, 12, or 13; aal51 to aal 58 of SEQ ID NO:7.11.12, or 13; aal52 to aa!59of SEQ ID NO:7.11, 12. or 13; aal53 to aal 60 of SEQ ID NO:7.11.12, or 13: aal54toaal61 of SEQ ID NO:7, 11, 12, or 13; aal55 to aal62 of SEQ ID NO:7, 11. 12. or 13; aal 56 to aal63 of SEQ ID NO:7.11, 12. or 13; aal 57 to aal64 of SEQ ID NO:7, 11, 12, or 13; aal 58 to aal 65 ofSEQIDNO:7.11, 12. or 13; aal 59 to aal 66 of SEQIDNO:7, 11, 12, or 13; aal60 to aal67 of SEQ ID NO:7, 11, 12, or 13; aalόl to aal68of SEQ ID NO:7, 11, 12, or 13; aal 62 to aal 69 of SEQ ID NO:7, 11, 12, or 13: aal63 to aal 70 of SEQ ID NO:7, 11, 12, or 13; aal 64 to aal 71 of SEQ ID NO:7.11, 12, or 13; aal65 to aal 72 of SEQ ID NO:7, 11, 12. or 13; aal66 to aal73 of SEQ ID NO:7, 11, 12, or 13; aal67 to aal74 of SEQ ID NO:7, 11, 12. or 13; aal 68 to aal 75 of SEQIDNO:7, 11, 12, or 13; aal 69 to aal 76 of SEQ ID NO:7, 11, 12, or 13; aal70 to aal77of SEQ ID NO:7.11, 12, or 13; aal71 to aal 78 of SEQ ID NO:7.11.12. or 13; aal 72 to aal 79 of SEQ ID NO: 7.11.12, or 13; aal 73 to aal 80 of SEQ ID NO:7.11, 12. or 13; aal 74 to aal 81 of SEQ ID NO:7.11, 12, or 13; aal75 to aal82 of SEQ ID NO:7, 11, 12, or 13; aal 76 to aal 83 of SEQ ID NO:7, 11, 12. or 13; aal 77 to aal 84 of SEQIDNO:7, 11, 12. or 13; aal 78 to aal 85 ofSEQIDNO:7, 11, 12, or 13; aal 79 to aal 86 of SEQ ID NO:7.11, 12, or 13; aal 80 to aal 87 of SEQ ID NO:7.11.12. or 13; aal81 to aal88 of SEQ ID NO:7.11.12. or 13; aal82 to aal89 of SEQ ID NO:7.11, 12, or 13; aal83 to aal90 of SEQ ID NO:7, 11, 12. or 13; aal84 to aal91 of SEQ ID NO:7.11.12, or 13: aal85 to aal92 of SEQ ID NO:7, 11, 12, or 13; aal86 to aal93 of SEQIDNO:7.11.12, or 13; aal 87 to aal 94 of SEQ ID NO:7, 11, 12. or 13; aal 88 to aal95 ofSEQIDNO:7, 11, 12. or 13; aal89 to aal96 of SEQ ID NO:7, 11, 12, or 13; aal90toaal97 of SEQ ID NO:7, 11.12. or 13; aal91 to aal 98 of SEQ ID NO:7.11. 12, or 13; aal92 to aal99 of SEQ ID NO:7, 11.12, or 13; aal93 to aa200 of SEQ ID NO:7.11.12, or 13; aal94 to aa201 ofSEQIDNO:7, 11, 12. or 13; aal95 to aa202 of SEQIDNO:7.11, 12, or 13; aal96 to aa203 of SEQ ID NO:7, 11, 12. or 13; aal97 to aa204 of SEQ ID NO:7, 11.12, or 13; aal98 to aa205 of SEQ ID NO:7, 11.12. or 13; aal 99 to aa206 of SEQ ID NO:7, 11, 12, or 13; aa200 to aa207 of SEQ ID NO:7, 11, 12, or 13; aa201 to aa208 of SEQ ID NO:7, 11, 12, or 13: aa202 to aa209 of SEQ ID NO:7.11.12, or 13: aa203 to aa210 of SEQ ID NO:7.11.12. or 13; aa204 toaa211 of SEQ ID NO:7.11.12, or 13; aa205 to aa212 of SEQ ID NO:7, 11, 12, or 13; aa206 to aa213 of SEQ ID NO:7, 11.12. or 13; aa207 to aa214 of SEQ ID NO:7.11.12. or 13: aa208 to aa215 of SEQ ID NO:7, 11, 12, or 13; aa209 to aa216 of SEQ ID NO:7.11. 12. or 13; aa210 to aa217 of SEQ ID NO:7, 11.12, or 13; aa211 to aa218 of SEQ ID NO:7, 11, 12, or 13; aa212 to aa219 of SEQ ID NO:7, 11, 12, or 13; aa213 to aa220 of SEQIDNO:7, 11, 12, or 13; aa214 to aa221 of SEQ ID NO:7, 11, 12. or 13; aa215 to aa222ofSEQIDNO:7, 11, 12, or 13; aa216 to aa223 ofSEQIDNO:7, 11.12. or 13; aa217 to aa224 of SEQ ID NO:7, 11, 12, or 13; aa218 to aa225 of SEQ ID NO:7.11, 12, or 13; aa219 to aa226 of SEQ ID NO:7, 11, 12, or 13; aa220 to aa227 of SEQ ID NO:7, 11.12, or 13; aa221 to aa228 of SEQ ID NO:7, 11, 12, or 13; aa222 to aa229 of SEQ ID NO:7, 11, 12, or 13; aa223 to aa230 of SEQ ID NO:7, 11, 12, or 13; aa224 to aa231 ofSEQIDNO:7, 11, 12. or 13; aa225 to aa232 of SEQ ID NO:7, 11, 12, or 13; and aa226 to aa233; of SEQ ID NO:7.11, 12, or 13 aa227 to aa234 of SEQ ID NO:7. 11.12, or 13; aa228 to aa235 of SEQ ID NO:7, 11,12. or 13; aa229 to aa236 of SEQ ID NO:7, 11.12, or 13; aa230 to aa237 of SEQ ID NO:7, 11, 12, or 13; aa231 to aa238 of SEQIDNO:7, 11, 12, or 13; aa222 to aa239 of SEQ ID NO:7.11, 12, or 13; aa233 to aa235 to aa242 of SEQ ID NO:7.11.12, or 13; aa236 to aa243 of SEQ ID NO:7, 11. 12, or 13; aa237 to aa244 of SEQ ID NO:7, 11.12. or 13; aa238 to aa245 of SEQ ID NO:7, 11, 12, or 13; aa239 to aa246 of SEQ ID NO:7, 11, 12. or 13; aa240 to aa247 of SEQIDNO:7.11.12, or 13; aa241 to aa248 of SEQ ID NO:7, 11, 12, or 13; aa242 to aa249of SEQ ID NO:7, 11, 12. or 13; aa243 to aa250 of SEQ ID NO:7.11.12. or 13; aa244 to aa251 of SEQ ID NO:7, 11.12, or 13; aa245 to aa252 of SEQ ID NO:7, 11. 12. or 13; aa246 to aa253 of SEQ ID NO:7, 11.12, or 13; aa247 to aa254 of SEQ ID NO:7, 11.12. or 13; aa248 to aa255 ofSEQIDNO:7, 11, 12. or 13; aa249 to aa256 of SEQIDNO:7, 11.12, or 13; aa250 to aa257 of SEQ ID NO:7.11, 12, or 13: aa251 to aa258 of SEQ ID NO:7.11.12. or 13; aa252 to aa259 of SEQ ID NO:7, 11, 12. or 13; aa253 to aa260 of SEQ ID NO:7, 11, 12, or 13; aa254 to aa261 of SEQ ID NO:7, 11, 12, or 13. aa255 to aa262 of SEQ ID NO:7.11, 12, or 13: aa256 to aa263 of SEQ ID NO:7.11.12. or 13: aa257 to aa264 ot SEQ ID NO:7, 11, 12, or 13: aa258 to aa265 of SEQIDNO:7.11.12. or 13: aa25c> to aa266 of SEQ ID NO:7, 11.12. or 13; aa260 to aa267of SEQ ID NO:7.11.12, or 13; aa261 to aa268 of SEQ ID NO:7.11, 12. or 13; aa262 to aa269 of SEQ ID NO:7, 11, 12, or 13; aa263 to aa270 of SEQ ID NO:7, 11, 12, or 13; aa264 to aa271 of SEQ ID NO:7, 11, 12, or 13; aa265 to aa272 of SEQ ID NO:7, 11, 12. or 13; aa266 to aa273 of SEQ ID NO:7, 11, 12. or 13; aa267 to aa274 of SEQIDNO:7, 11.12, or 13; aa268 to aa275 of SEQ ID NO:7, 11, 12, or 13; aa269 to aa276ofSEQIDNO:7, 11.12, or 13; aa270 to aa277 of SEQ ID NO:7.11, 12, or 13; aa271 to aa278 of SEQ ID NO:7, 11, 12, or 13; aa272 to aa279 of SEQ ID NO:7, 11. 12, or 13; aa273 to aa280 of SEQ ID NO:7, 11, 12, or 13; aa274 to aa281 of SEQ ID NO:7, 11, 12, or 13; aa275 to aa282 of SEQ ID NO:7, 11, 12. or 13; aa276 to aa283 of SEQIDNO:7, 11, 12. or 13; aa277 to aa284 of SEQ ID NO:7.11.12, or 13; aa278 to aa284ofSEQIDNO:7, 11, 12, or 13; aa279 to aa286 of SEQ ID NO:7.11, 12, or 13; aa280toaa287 of SEQ ID NO:7, 11.12, or 13; aa281 to aa288 of SEQ ID NO:7, 11, 12, or 13; aa282 to aa289 of SEQ ID NO:7, 11, 12, or 13; aa283 to aa290 of SEQ ID NO:7, 11, 12, or 13; aa284 to aa291 of SEQ ID NO:7, 11.12. or 13; aa285 to aa292 of SEQIDNO:7, 11.12, or 13; aa286 to aa293 of SEQ ID NO:7.11, 12. or 13; aa287 to aa294of SEQ ID NO:7, 11, 12. or 13; aa288 to aa295 of SEQ ID NO:7, 11, 12, or 13; aa289 to aa296 of SEQ ID NO:7, 11, 12. or 13; aa290 to aa297 of SEQ ID NO:7.11. 12. or 13; aa291 to aa298 of SEQ ID NO:7, 11, 12. or 13; aa292 to aa299 of SEQ ID NO:7, 11, 12, or 13; aa293 to aa300 of SEQ ID NO:7, 11, 12. or 13; aa294 to aalOl of SEQIDNO:7, 11, 12. or 13; aa295 to aal02 of SEQ ID NO:7, 11, 12. or 13; aa296 to aal03 of SEQ ID NO:7, 11, 12. or 13; aa297 to aal04 of SEQ ID NO:7, 11, 12, or 13; aa298 to aal 05 of SEQ ID NO:7.11.12. or 13; aa299 to aalOό of SEQ ID NO:7.11, 12. or 13; aa300 to aa307 of SEQ ID NO:7.11, 12. or 13 aa301 to aa308 of SEQ ID NO:7, 11, 12. or 13 aa302 to aa309 of SEQ ID NO:7.11.12. or 13; aa303 to aa310 of SEQIDNO:7.11, 12, or 13; aa304 to aa311 of SEQ ID N; O:7; aa305 to aa312 of SEQ IDNO:7.11, 12, or 13; aa306 to aa313 of SEQ ID NO:7, 11.12. or 13; aa307 to aa314 of SEQIDNO:7, 11, 12, or 13; aa308 to aa315 of SEQ ID NO:7, 11, 12. or 13; aa309 toaa316of SEQ ID NO:7.11, 12, or 13: aa310 to aa317 of SEQ ID NO:7.11, 12. or 13aa311 to aa318 of SEQ ID NO:7.11, 12, or 13: aa312 to aa319 of SEQ ID NO:7, 11, 12. or 13; aa313 to aa320 of SEQ ID NO:7.11, 12. or 13: aa314 to aa32l of SEQ ID NO:7, 11.12, or 13: aa315 to aa322 of SEQ ID NO:7, 11, 12. or 13; aa316toaa323 of SEQIDNO:7, 11, 12, or 13; aa317 to aa324 of SEQ ID NO:7.11.12, or 13; aa318 to aa325 of SEQ ID NO:7, 11, 12. or 13; aa319 to aa326 of SEQ ID NO:7.11, 12, or 13; aa320 to aa327 of SEQ ID NO:7, 11, 12. or 13; aa321 to aa328 of SEQ ID NO:7, 11, 12, or 13; aa322 to aa329 of SEQ ID NO:7, 11, 12, or 13: aa323 to aa330 of SEQ ID NO:7, 11, 12, or 13; aa324 to aa331 ofSEQIDNO:7, 11, 12. or 13; aa325 to aa332 of SEQ ID NO:7, 11.12, or 13; aa326 to aa333 of SEQ ID NO:7, 11, 12, or 13; aa327 to aa334 of SEQ ID NO:7, 11, 12, or 13; aa328 to aa335 of SEQ ID NO:7, 11, 12, or 13; aa329toaa336 of SEQ ID NO:7, 11, 12, or 13; aa330 to aa337 of SEQ ID NO:7, 11, 12, or 13; aa331 to aa338 of SEQ ID NO:7, 11, 12. or 13; aa332 to aa339 of SEQ ID NO:7, 11, 12, or 13; aa333 to aa340 of SEQ ID NO:7, 11, 12. or 13; aa334 to aa341 of SEQIDNO:7.11, 12, or 13; aa335 to aa342 of SEQ ID NO:7.11, 12. or 13; aa336 to aa343 of SEQ ID NO:7, 11.12, or 13; aa337 to aa344 of SEQ ID NO:7, 11.12, or 13; aa338 to aa345 of SEQ ID NO:7.11, 12. or 13; aa339 to aa346 of SEQ ID NO:7, 11, 12, or 13; aa340 to aa347 of SEQ ID NO:7.11, 12. or 13; aa341 to aa348 of SEQ ID NO:7, 11, 12. or 13; aa342 to aa349 of SEQ ID NO:7.11.12, or 13; aa343 to aa350 of SEQIDNO:7.11.12. or 13; aa344toaa351 of SEQ ID NO:7, 11.12, or 13: aa345 to aa352of SEQ ID NO:7.11, 12. or 13; aa346 to aa353 of SEQ ID NO:7.11, 12. or 13; aa347 to aa354 of SEQ ID NO:7, 11, 12, or 13; aa348 to aa355 of SEQ ID NO:7, 11. 12, or 13; aa349 to aa356 of SEQ ID NO:7, 11, 12. or 13; aa350 to aa357 of SEQ ID NO:7.11, 12, or 13; aa351 to aa358 of SEQ ID NO:7, 11, 12, or 13; aa352 to aa359 of SEQIDNO:7, 11, 12. or 13; aa353 to aa360 of SEQ ID NO:7, 11, 12, or 13: aa354 to aa361 of SEQ ID NO:7.11, 12. or 13; aa355 to aa362 of SEQ ID NO:7, 11.12, or 13; aa356 to aa363 of SEQ ID NO:7, 11, 12, or 13: aa357 to aa364 of SEQ ID NO:7, 11. 12, or 13; aa358 to aa365 of SEQ ID NO:7, 11.12. or 13; aa359 to aa366 of SEQ ID NO:7, 11, 12. or 13; aa360 to aa367 of SEQ ID NO:7.11, 12, or 13; aa361 to aa368 of SEQ ID NO:7, 11, 12, or 13; aa362 to aa369 of SEQ ID NO:7, 11, 12, or 13; aa363 to aa370of SEQ ID NO:7, 11.12. or 13: aa364 to aa371 of SEQ ID NO:7.11, 12. or 13; aa365 to aa372 of SEQ ID NO:7, 11, 12, or 13; aa366 to aa373 of SEQ ID NO:7, 11, 12, or 13; aa367 to aa374 of SEQ ID NO :7, 11.12. or 13; aa368 to aa375 of SEQ ID NO:7, 11, 12. or 13, aa369 to aa376 of SEQ ID N07, 11, 12, or 13; aa370 to aa377 of SEQIDNO:7.11.12. or 13; aa371 to aa378 of SEQ ID NO:7, 11, 12, or 13; aa372 to aa379of SEQ ID NO:7, 11, 12, or 13; aa373 to aa380 of SEQ ID NO:7, 11, 12, or 13; aa374 to aa381 of SEQ ID NO:7, 11, 12, or 13; aa375 to aa382 of SEQ ID NO:7, 11, 12, or 13; aa376 to aa383 of SEQ ID NO:7.11.12, or 13; aa377 to aa384 of SEQ ID NO:7, 11, 12, or 13; aa378 to aa385 of SEQ ID NO:7, 11, 12, or 13; aa379 to aa386 of SEQIDNO:7, 11, 12, or 13; aa380 to aa387 of SEQ ID NO:7, 11, 12, or 13; aa381 to aa388ofSEQIDNO:7, 11, 12, or 13; aa382 to aa389 of SEQ ID NO:7, 11, 12, or 13; aa383 to aa390 of SEQ ID NO:7, 11, 12, or 13: aa384 to aa391 of SEQ ID NO:7, 11, 12, or 13; aa385 to aa392 of SEQ ID NO:7, 11.12, or 13; aa386 to aa393 of SEQ ID NO:7, 11, 12. or 13; aa387 to aa394 of SEQ ID NO:7, 11, 12, or 13; aa388 to aa395 of SEQIDNO:7, 11, 12. or 13; aa389 to aa396 of SEQ ID NO:7, 11, 12, or 13; aa390 to aa397 of SEQ ID NO:7.11, 12. or 13; aa391 to aa398 of SEQ ID NO:7, 11, 12, or 13; aa392 to aa399 of SEQ ID NO:7, 11, 12, or 13; aa393 to aa400 of SEQ ID NO:7, 11. 12, or 13; aa394 to aa401 of SEQ ID NO:7, 11.12, or 13; aa395 to aa402 of SEQ ID NO:7, 11, 12, or 13; aa396 to aa403 of SEQ ID NO:7, 11, 12, or 13; aa397 to aa404 of SEQ IDNO:7.11.12. or 13: aa398 to aa405 of SEQ ID NO:7, 11.12, or 13; aa399 to aa406of SEQ ID NO:7.11, 12. or 13; aa400 to aa407 of SEQ ID NO:7, 11, 12, or 13; aa401 to aa408 of SEQ ID NO:7, 11.12. or 13; aa402 to aa409 of SEQ ID NO:7, 11. 12, or 13; aa403 to aa410 of SEQ ID NO:7, 11, 12, or 13; aa404 to aa411 of SEQ ID NO:7, 11.12. or 13; aa405 to aa412 of SEQ ID NO:7, 11.12. or 13; aa406 to aa413 of SEQIDNO:7.11, 12. or 13; aa407 to aa414 of SEQ ID NO:7, 11, 12, or 13; aa408 to aa415 ofSEQIDNO:7.11, 12. or 13; aa409 to aa416 of SEQ ID NO:7.11, 12, or 13; aa410to aa417 of SEQ ID NO:7, 11, 12, or 13. aa411 to aa418 of SEQ ID NO:7.11, 12, or 13; aa412 to aa419 of SEQ ID NO:7.11, 12, or 13; aa413 to aa420 of SEQ ID NO:7, 11, 12, or 13; aa414 to aa421 of SEQ ID NO:7, 11, 12, or 13; aa415 to aa422 of SEQIDNO:7.11, 12. or 13; aa416 to aa423 of SEQ ID NO:7, 11, 12, or l3;aa417to aa424 of SEQ ID NO:7.11, 12. or 13; aa418 to aa425 of SEQ ID NO:7.11, 12, ι»r 13; aa419 to aa42o of SEQ ID NO:7, 11.12. or 13: aa^20 to aa427 of SEQ ID NO:7, 11. 12. or 13; aa421 to aa428 of SEQ ID NO:7.11.12. or 13: aa422 to aa429 of SEQ ID NO:7, 11.12. or 13. aa423 to aa430 of SEQ ID NO:7.11.12. or 13: aa424 to aa431 of SEQIDNO:7.11, 12, or 13; aa425 to aa432 of SEQ ID NO:7, 11, 12. or 13; aa426 to aa433 of SEQ ID NO:7, 11, 12, or 13; aa427 to aa434 of SEQ ID NO:7.11, 12, or 13; aa428 to aa435 of SEQ ID NO:7, 11, 12, or 13; aa429 to aa436 of SEQ ID NO:7, 11. 12, or 13; aa430 to aa437 of SEQ ID NO:7, 11, 12, or 13; aa431 to aa438 of SEQ ID NO:7, 11, 12, or 13; aa432 to aa439 of SEQ ID NO:7.11.12, or 13; aa433 to aa440 of SEQIDNO:7, 11, 12, or 13; aa434 to aa441 ofSEQIDNO:7.11, 12, or 13; aa435 to aa442 of SEQ ID NO:7, 11, 12, or 13; aa436 to aa443 of SEQ ID NO:7.11, 12, or 13: aa437 to aa444 of SEQ ID NO:7, 11.12. or 13; aa438 to aa445 of SEQ ID NO:7.11. 12. or 13; aa439 to aa446 of SEQ ID NO:7, 11, 12, or 13; aa440 to aa447 of SEQ ID NO:7, 11, 12, or 13; aa441 to aa448 of SEQ ID NO:7.11.12, or 13; aa442 to aa449 of SEQIDNO:7, 11, 12, or 13; aa443 to aa450 of SEQ ID NO:7.11, 12, or 13: aa444 to aa451 ofSEQIDNO:7, 11, 12, or 13; aa445 to aa452 of SEQ ID NO:7.11.12, or 13; aa446 to aa453 of SEQ ID NO:7, 11.12, or 13; aa447 to aa454 of SEQ ID NO:7, 11, 12. or 13; aa448 to aa455 of SEQ ID NO:7, 11, 12, or 13; aa449 to aa456 of SEQ ID NO:7.11, 12. or 13: aa450 to aa457 of SEQ ID NO:7, 11, 12, or 13; aa451 to aa458 of SEQIDNO:7, 11.12. or 13; aa452 to aa459 of SEQ ID NO:7, 11, 12, or 13; aa453 to aa460of SEQ ID NO:7, 11.12, or 13; aa454 to aa461 ofSEQIDNO:7, 11.12, or 13; aa455 to aa462 of SEQ ID NO:7, 11, 12, or 13; aa456 to aa463 of SEQ ID NO:7.11. 12, or 13; aa457 to aa464 of SEQ ID NO:7.11, 12. or 13; aa458 to aa465 of SEQ ID NO:7, 11, 12, or 13; aa459 to aa466 of SEQ ID NO:7.11, 12, or 13: aa460 to aa467 of SEQIDNO:7, 11, 12. or 13: aa461 to aa468 of SEQ ID NO:7, 11, 12, or 13; aa462 to aa469of SEQ ID NO:7, 11, 12, or 13; aa463 to aa470 of SEQ ID NO:7, 11.12. or 13; aa464 to aa471 of SEQ ID NO:7, 11, 12, or 13; aa465 to aa472 of SEQ ID NO:7, 11, 12, or 13; aa466 to aa473 of SEQ ID NO:7, 11, 12, or 13; aa467 to aa474 of SEQ ID NO:7, 11.12, or 13. aa468 to aa475 ofSEQIDNO:7.11, 12, or 13; aa469 to aa476 of SEQIDNO:7, 11.12, or 13; aa470 to aa477 of SEQ ID NO:7, 11, 12. or 13; aa471 to aa478ofSEQIDNO:7.11, 12, or 13; aa472 to aa479 of SEQ ID NO:7.11.12, or 13: aa473 to aa480 of SEQ ID NO:7, 11, 12. or 13; aa474 to aa481 of SEQ ID NO:7.11, 12, or 13; aa475 to aa482 of SEQ ID NO:7, 11.12. or 1 ; aa476 to aa483 of SEQ ID NO:7.11, 12, or 13: aa477 to aa484 of SEQ ID NO:7.11.12, or 13; aa478 to aa484 of SEQIDNO:7.11, 12, or 13: aa479 to aa486 of SEQ ID NO:7, 11, 12. or 13; aa480 to aa487 of SEQ ID NO:7, 11.12, or 13; aa481 to aa488 of SEQ ID NO:7, 11.12. or 13; aa482 to aa489 of SEQ ID NO:7, 11, 12, or 13; aa483 to aa490 of SEQ ID NO:7, 11, 12. or 13; aa484 to aa491 of SEQ ID NO:7, 11, 12. or 13; aa485 to aa492 of SEQ ID NO:7, 11, 12, or 13: aa486 to aa493 of SEQ ID NO:7, 11, 12, or 13; aa487 to aa494 of SEQIDNO:7, 11, 12, or 13; aa488 to aa495 of SEQ ID NO:7, 11, 12, or 13; aa489 to aa496ofSEQIDNO:7, 11, 12, or 13; aa490 to aa497 of SEQ ID NO:7, 11, 12. or 13; aa491 to aa498 of SEQ ID NO:7, 11, 12, or 13; aa492 to aa499 of SEQ ID NO:7.11, 12, or 13; aa493 to aa500 of SEQ ID NO:7, 11, 12, or 13; aa494 to aa501 of SEQ ID NO:7, 11, 12, or 13; aa495 to aa502 of SEQ ID NO:7.11, 12, or 13; aa496 to aa503 of SEQIDNO:7, 11.12, or 13; aa497 to aa504 of SEQ ID NO:7, 11.12, or 13; aa498 to aa505 ofSEQIDNO:7, 11, 12, or 13; aa499 to aa506 of SEQ ID NO:7, 11.12. or 13; aa500toaa507ofSEQIDNO:7.11.12, or 13 aa501 to aa508 of SEQ ID NO:7, 11, 12, or 13aa502toaa509ofSEQIDNO:7, 11, 12, or 13: aa503 to aa510 of SEQ ID NO:7. 11, 12, or 13;aa504toaa511 ofSEQIDNO:7.11, 12. or 13; aa505 to aa512 of SEQ ID NO:7.11, 12, or 13; aa506 to aa513 of SEQ ID NO:7.11, 12. or 13; aa507 to aa514 of SEQIDNO:7.11.12, or 13; aa508 to aa515 ofSEQIDNO:7.11, 12. or 13; aa509 to aa516of SEQ ID NO:7, 11, 12, or 13; aa510 to aa517 of SEQ ID NO:7, 11, 12, or 13; aa511 to aa518 of SEQ ID NO:7.11.12, or 13; aa512 to aa519 of SEQ ID NO:7, 11,
12, or 13; aa513 to aa520 of SEQ ID NO:7, 11, 12. or 13; aa514 to aa521 of SEQ ID NO:7.11.12, or 13: aa515 to aa522 of SEQ ID NO:7, 11, 12. or 13; aa516 to aa523 of SEQIDNO:7.11, 12, or 13; aa517 to aa524 of SEQ ID NO:7.11, 12. or 13; aa518 to aa525 of SEQ ID NO:7, 11, 12, or 13; aa519 to aa526 of SEQ ID NO:7, 11.12, or 13; aa520 to aa527 of SEQ ID NO:7, 11, 12, or 13; aa521 to aa528 of SEQ ID NO:7, 11. 12, or 13: aa522 to aa529 of SEQ ID NO:7, 11, 12, or 13; aa523 to aa530 of SEQ ID NO:7.11.12, or 13; aa524 to aa531 of SEQ ID NO:7.11.12, or 13; aa525 to aa532 of SEQIDNO:7.11.12, or 13: aa526 to aa533 of SEQ ID NO:7.11.12. or 13: aa527 to aa534of SEQ ID NO:7, 11.12. or 13: aa528 to aa535 of SEQ ID NO:7.11, 12, or 13; aa529 to aa536 of SEQ ID NO:7.11, 12. or 13: aa530 to aa537 of SEQ ID NO:7, 11. 12, or 13: aa531 to aa538 of SEQ ID NO:7, 11.12. or 13; aa532 to aa539 of SEQ ID NO:7, 11.12. or 13; aa533 to aa540 of SEQ ID NO:7, 11, 12, or 13; aa534 to aa541 of SEQIDNO:7, 11, 12, or 13; aa535 to aa542 of SEQ ID NO:7.11, 12, or 13;aa536to aa543 of SEQ ID NO:7, 11, 12, or 13; aa537 to aa544 of SEQ ID NO:7, 11, 12, or 13; aa538 to aa545 of SEQ ID NO:7.11, 12, or 13; aa539 to aa546 of SEQ ID NO:7, 11, 12, or 13; aa540 to aa547 of SEQ ID NO:7, 11.12, or 13; aa541 to aa548 of SEQ ID NO:7, 11, 12, or 13; aa542 to aa549 of SEQ ID NO:7, 11, 12. or 13; aa543 to aa550 of SEQIDNO:7, 11, 12, or 13; aa544 to aa551 ofSEQIDNO:7.11, 12, or 13; aa545 to aa552of SEQ ID NO:7, 11, 12, or 13; aa546 to aa553 ofSEQIDNO:7, 11, 12, or 13; aa547 to aa554 of SEQ ID NO:7.11, 12. or 13; aa548 to aa555 of SEQ ID NO:7, 11, 12, or 13; aa549 to aa556 of SEQ ID NO:7.11.12, or 13; aa550 to aa557 of SEQ ID NO:7, 11, 12. or 13; aa551 to aa558 of SEQ ID NO:7, 11, 12. or 13; aa552 to aa559 of SEQIDNO:7, 11, 12, or 13; aa553 to aa560 of SEQ ID NO:7.11.12, or 13;aa554to aa561 of SEQ ID NO:7, 11, 12, or 13; aa555 to aa562 of SEQ ID NO:7, 11, 12, or 13; aa556 to aa563 of SEQ ID NO:7, 11, 12, or 13; aa557 to aa564 of SEQ ID NO:7, 11, 12. or 13; aa558 to aa565 of SEQ ID NO:7.11.12, or 13: aa559 to aa566 of SEQ ID NO:7.11, 12, or 13; aa560 to aa567 of SEQ ID NO:7.11, 12, or 13; aa561 to aa568 of SEQIDNO:7, 11, 12. or 13; aa562 to aa569 of SEQ ID NO:7, 11, 12. or 13; aa563 to aa570of SEQ ID NO:7, 11, 12. or 13; aa564 to aa571 ofSEQIDNO:7, 11, 12, or 13; aa565 to aa572 of SEQ ID NO:7, 11, 12, or 13; aa566 to aa573 of SEQ ID NO:7, 11, 12, or 13; aa567 to aa574 of SEQ ID NO:7, 11, 12. or 13; aa568 to aa575 of SEQ ID NO:7.11, 12, or 13; aa569 to aa576 of SEQ ID NO:7, 11, 12, or 13; aa570 to aa577 of SEQIDNO:7, 11, 12, or 13; aa571 to aa578 of SEQ ID NO:7, 11, 12, or 13; aa572 to aa579ofSEQIDNO:7, 11, 12. or 13; aa573 to aa580 of SEQ ID NO:7.11, 12, or 13; aa574toaa581 of SEQ ID NO:7.11, 12, or 13; aa575 to aa582 of SEQ ID NO:7, 11, 12, or 13; aa576 to aa583 of SEQ ID NO:7, 11, 12. or 13; aa577 to aa584 of SEQ ID NO:7, 11, 12, or 13; aa578 to aa585 of SEQ ID NO:7, 11, 12. or 13; aa579 to aa586 of SEQ ID NO:7.11, 12, or 13; aa580 to aa587 of SEQ ID NO:7.11, 12. or 13; aa581 to aa588of SEQ ID NO:7.11.12. or 13; aa582 to aa589 of SEQ ID NO:7, 11, 12. or 1 i: aa583 to aa590 of SEQ ID NO:7.11, 12. or 13: aa584 to aa591 of SEQ ID NO:7, 11, 12, or 13; aa585 to aa592 of SEQ ID NO:7.11, 12. or 13; aa586 to aa593 of SEQ ID NO:7.11, 12, or 13; aa587 to aa594 of SEQ ID NO:7, 11, 12, or 13; aa588 to aa595 of SEQIDNO:7.11.12, or 13; aa589 to aa596 of SEQ ID NO:7, 11, 12, or 13; aa590 to aa597ofSEQIDNO:7, 11, 12. or 13; aa591 to aa598 of SEQ ID NO:7, 11, 12, or 13: aa592 to aa599 of SEQ ID NO:7, 11, 12, or 13: aa593 to aaόOO of SEQ ID NO:7, 11. 12, or 13; aa594 to aa601 of SEQ ID NO:7, 11.12, or 13; aa595 to aa602 of SEQ ID NO:7, 11, 12, or 13; aa596 to aa603 of SEQ ID NO:7.11, 12, or 13; aa597 to aa604 of SEQ ID NO:7, 11, 12, or 13; aa598 to aa605 of SEQ ID NO:7, 11, 12, or 13; aa599 to aa606ofSEQIDNO:7, 11, 12, or 13; aaόOO to aa607 of SEQ ID NO:7, 11, 12, or 13; aa601 to aa608 of SEQ ID NO:7, 11, 12, or 13; aa602 to aa609 of SEQ ID NO:7, 11. 12, or 13; aa603 to aaόlO of SEQ ID NO:7, 11.12. or 13; aa604 to aaόll of SEQ ID NO:7, 11, 12, or 13; aa605 to aa612 of SEQ ID NO:7.11, 12, or 13; aa606 to aa613 of SEQIDNO:7, 11, 12, or 13; aa607 to aa614 of SEQ ID NO:7, 11, 12, or 13; aa608 to aa615 of SEQ ID NO:7, 11, 12, or 13; aa609 to aa616 of SEQ ID NO:7, 11, 12, or 13; aa610 to aa617 of SEQ ID NO:7, 11, 12, or 13; aaόll to aaόl 8 of SEQ ID NO:7, 11. 12, or 13; aa612 to aa619 of SEQ ID NO:7, 1 1 , 12, or 13; aa613 to aa620 of SEQ ID NO:7, 1 1, 12. or 13; aa614 to aa621 of SEQ ID NO:7, 1 1 , 12, or 13; aa615 to aa622 of SEQ ID NO:7, 1 1. 12, or 13; aaόlό to aa623 of SEQ ID NO:7, 11. 12. or 13; aa617 to aa624 of SEQ ID NO:7, 1 1 , 12, or 13; aa618 to aa625 of SEQ ID NO:7. 1 1, 12, or 13; aa619 to aa626 of SEQ ID NO:7. 1 1. 12, or 13; aa620 to aa627 of SEQ ID NO: 12 or 13; aa621 to aa628 of SEQ ID NO: 12 or 13; aa622 to aa629 of SEQ ID NO:12 or 13; aa623 to aa630 of SEQ ID NO: 12 or 13; aa624 to aa631 of SEQ ID NO:12 or 13: aa625 to aa632 of SEQ ID NO: 12 or 13; aa626 to aa633 of SEQ ID NO: 12 or 13; aa627 to aa634 of SEQ ID NO: 12 or 13; aa628 to aa635 of SEQ ID NO: 12 or 13: aa629 to aa636 of SEQ ID NO: 12 or 13; aa630 to aa637 of SEQ ID NO: 12 or 13; aa631 to aa638 of SEQ ID NO: 12 or 13: aa632 to aa639 of SEQ ID NO: 12 or 13; aa633 to aa640 of SEQ ID NO: 12 or 13; aa634 to aa641 of SEQ ID NO:12 or 13; aa635 to aa642 of SEQ ID
NO: 12 or 3; aa636 to aa643 of SEQ ID NO: 12 or 3; aa637 to aa644 of SEQ ID NO: 12 or aa638 to aa645 of SEQ ID NO: 12 oi 3; aa6 9 to aa646 of SEQ ID NO:12 or aa640 to aa647 of SEQ ID NO: 12 or 3: aa641 to aa648 of SEQ ID NO:12 or aa642 to aa649 of SEQ ID NO: 12 or 3: aa643 to aa650 of SEQ ID NO: 12 or aa644 to aa651 of SEQ ID NO: 12 or 3: aa645 to aa652 of SEQ ID NO:12 or aa646 to aa653 of SEQ ID NO: 12 or 3; aa647 to aa654 of SEQ ID NO:12 or aa648 to aa655 of SEQ ID NO: 12 or 3; aa649 to aa656 of SEQ ID NO:12 or aa650 to aa657 of SEQ ID NO: 12 or 3; aa651 to aa658 of SEQ ID NO:12 or aa652 to aa659 of SEQ ID NO: 12 or 3; aa653 to aa660 of SEQ ID NO: 12 or aa654 to aaόόl of SEQ ID NO: 12 or 3; aa655 to aa662 of SEQ ID NO:12 or aa656 to aa663 of SEQ ID NO: 12 or 3; aa657 to aa664 of SEQ ID NO:12 or aa658 to aa665 of SEQ ID NO: 12 or 3; aa659 to aa666 of SEQ ID NO: 12 or aa660 to aa667 of SEQ ID NO: 12 or 3; aaόόl to aa668 of SEQ ID NO: 12 or aa662 to aa669 of SEQ ID NO: 12 or 3; aa663 to aa670 of SEQ ID NO:12 or aa664 to aa671 of SEQ ID NO: 12 or 3; aa665 to aa672 of SEQ ID NO:12 or aa666 to aa673 of SEQ ID NO: 12 or 3; aa667 to aa674 of SEQ ID NO: 12 or aa668 to aa675 of SEQ ID NO: 12 or 3; aa669 to aa676 of SEQ ID NO:12 or aa670 to aa677 of SEQ ID NO: 12 or 3; aa671 to aa678 of SEQ ID NO: 2 or aa672 to aa679 of SEQ ID NO: 12 or 13: aa673 to aa680 of SEQ ID
NO: 2 or aa674 to aa681 of SEQ ID NO: 12 or 13: aa675 to aa682 of SEQ ID NO: 2 or aa676 to aa683 of SEQ ID NO: 12 or 13; aa677 to aa684 of SEQ ID NO: 2 or aa678 to aa684 of SEQ ID NO: 12 or 13: aa679 to aa686 of SEQ ID NO: 2 or aa680 to aa687 of SEQ ID NO: 12 or 13; aa681 to aa688 of SEQ ID NO: 2 or aa682 to aa689 of SEQ ID NO: 12 or 13; aa683 to aa690 of SEQ ID NO: 2 or aa684 to aa691 of SEQ ID NO: 12 or 13; aa685 to aa692 of SEQ ID NO: 2 or aa686 to aa693 of SEQ ID NO: 12 or 13; aa687 to aa694 of SEQ ID NO: 2 or aa688 to aa695 of SEQ ID NO: 12 or 13; aa689 to aa696 of SEQ ID NO: 2 or aa690 to aa697 of SEQ ID NO: 12 or 13; aa691 to aa698 of SEQ ID NO: 2 or aa692 to aa699 of SEQ ID NO: 12 or 13; aa693 to aa700 of SEQ ID NO: 2 or aa694 to aa701 of SEQ ID NO: 12 or 13; aa695 to aa702 of SEQ ID NO: 2 or aa696 to aa703 of SEQ ID NO: 12 or 13; aa697 to aa704 of SEQ ID NO: aa698 to aa705 of SEQ ID NO: 12 or 13; aa699 to aa706 of SEQ ID NO: 2 or aa700 to aa707 of SEQ ID NO: 12 or 13; aa701 to aa708 of SEQ ID NO: 2 or aa702 to aa709 of SEQ ID NO: 12 or 13: aa703 to aa710 of SEQ ID NO: 2 or aa704 to aa71 1 of SEQ ID NO: 12 or 13, aa705 to aa712 of SEQ ID NO: 2 or 13; aa76 to aa713 of SEQ ID NO:12 or 13; aa707 to aa714 of SEQ ID NO:12 or 13; aa708 to aa715 of SEQ ID NO:12 or 13; aa709 to aa716 of SEQ ID NO:12 or 13; aa710 to aa717 of SEQ ID NO:12 or 13; aa711 to aa718 of SEQ ID NO: 12 or 13; aa712 to aa719 of SEQ ID NO:12 or 13; aa713 to aa720 of SEQ ID NO:12 or 13; aa714 to aa721 of SEQ ID NO:12 or 13; aa715 to aa722 of SEQ ID NO:12 or 13; aa716 to aa723 of SEQ ID NO:12 or 13; aa717 to aa724 of SEQ ID NO:12 or 13; aa718 to aa725 of SEQ ID NO:12 or 13; aa719 to aa726 of SEQ ID NO:12 or 13; aa720 to aa727 of SEQ ID NO:12 or 13; aa721 to aa728 of SEQ ID NO:12 or 13; aa722 to aa729 of SEQ ID NO:12 or 13; aa723 to aa730 of SEQ ID NO: 12 or 13; aa724 to aa731 of SEQ ID NO:12 or 13; aa725 to aa732 of SEQ ID NO:12 or 13; aa726 to aa733 of SEQ ID NO:12 or 13; aa727 to aa734 of SEQ ID NO:12 or 13; aa728 to aa735 of SEQ ID NO:12 or 13; aa729 to aa736 of SEQ ID NO:12 or 13; aa730 to aa737 of SEQ ID NO:12 or 13; aa731 to aa738 of SEQ ID NO:12 or 13; aa732 to aa739 of SEQ ID NO: 2 or 1 aa733 to aa740 of SEQ ID NO: 2 or 13; aa734 to aa741 of SEQ ID
NO: 2 or 1 aa735 to aa742 of SEQ ID NO: 2 or 13; aa736 to aa743 of SEQ ID
NO: 2 or 1 aa737 to aa744 of SEQ ID NO: 2 or 13; aa738 to aa745 of SEQ ID
NO: 2 or 1 aa739 to aa746 of SEQ ID NO: 2 or 13; aa740 to aa747 of SEQ ID
NO: 2 or 1 aa741 to aa748 of SEQ ID NO: 2 or 13; aa742 to aa749 of SEQ ID
NO: 2 or 1 aa743 to aa750 of SEQ ID NO: 2 or 13; aa744 to aa751 of SEQ ID
NO: 12 or 1 aa745 to aa752 of SEQ ID NO: 2 or 13; aa746 to aa753 of SEQ ID
NO: 2 or 1 aa747 to aa754 of SEQ ID NO: 2 or 13: aa748 to aa755 of SEQ ID
NO: 2 or 1 aa749 to aa756 of SEQ ID NO: 2 or 13; aa750 to aa757 of SEQ ID
NO: 2 or 1 aa751 to aa758 of SEQ ID NO: 2 or 13; aa752 to aa759 of SEQ ID
NO: 2 or 1 aa753 to aa760 of SEQ ID NO: 2 or 13; aa754 to aa761 of SEQ ID
NO: 2 or 1 aa755 to aa762 of SEQ ID NO: 2 or 13: aa756 to aa763 of SEQ ID
NO: 2 or 1 aa757 to aa764 of SEQ ID NO: 2 or 13. aa758 to aa765 of SEQ ID
NO;i 2 or 1 aa759 to aa766 of SEQ ID NO: 2 or 13: aa760 to aa767 of SEQ ID
NO: 2 or 1 aa761 to aa768 of SEQ ID NO: 2 or 13: aa762 to aa769 of SEQ ID
NO:l 2 or 1 aa763 to aa770 of SEQ ID NO: 2 or 13; aa764 to aa771 of SEQ ID
NO:l 2 or 1 aa765 to aa772 of SEQ ID NO: 2 or 13; aa766 to aa773 of SEQ ID
NO:1 2 or 1 aa767 to aa774 of SEQ ID NO: 2 or 13; aa768 to aa775 of SEQ ID
NO:l 2 or 1 aa769 to aa776 of SEQ ID NO: .2 or 13; aa770 to aa777 of SEQ ID
NO:l 2 or 1 aa771 to aa778 of SEQ ID NO: 2 or 13; aa772 to aa779 of SEQ ID
NO:] 2 or 1 aa773 to aa780 of SEQ ID NO: 2 or 13; aa774 to aa781 of SEQ ID
NO:l 2 or 1 aa775 to aa782 of SEQ ID NO: 2 or 13; aa776 to aa783 of SEQ ID
NO:] 2 or 1 aa777 to aa784 of SEQ ID NO: 2 or 13; aa778 to aa784 of SEQ ID
NO:] 2 or 1 aa779 to aa786 of SEQ ID NO: 2 or 13; aa780 to aa787 of SEQ ID
NO:] 2 or 1 aa781 to aa788 of SEQ ID NO: 2 or 13; aa782 to aa789 of SEQ ID
NO:] 2 or 1 aa783 to aa790 of SEQ ID NO: 2 or 13; aa784 to aa791 of SEQ ID
NO:] 2 or 1 aa785 to aa792 of SEQ ID NO: 2 or 13; aa786 to aa793 of SEQ ID
NO: 2 or 1 aa787 to aa794 of SEQ ID NO: 2 or 13; aa788 to aa795 of SEQ ID
NO: 2 or 1 aa789 to aa796 of SEQ ID NO: 2 or 13; aa790 to aa797 of SEQ ID
NO: 2 or 1 aa791 to aa798 of SEQ ID NO: 2 or 13; aa792 to aa799 of SEQ ID 3; aa793 to aa800 of SEQ ID NO: 12 or IJ, aa794 to aa801 of SEQ ID
-3, aa795 to aa802 of SEQ ID NO: 12 or IJ, aa796 to aa803 of SEQ ID aa797 to aa804 of SEQ ID NO: .2 or 13; aa798 to aa805 of SEQ ID
-3, aa799 to aa806 of SEQ ID NO: 2 or 13; aa800 to aa807 of SEQ ID
3-, aa801 to aa808 of SEQ ID NO: 2 or 13; aa802 to aa809 of SEQ ID aa803 to aa810 of SEQ ID NO: 12 or 13; aa804 to aaδll of SEQ ID aa805 to aa812 of SEQ ID NO: 2 or IJ, aa806 to aa813 of SEQ ID aa807 to aa814 of SEQ ID NO: 2 or IJ, aa808 to aa815 of SEQ ID aa809 to aa816 of SEQ ID NO: 2 or aa810 to aa817 of SEQ ID
3, aaδll to aa818 of SEQ ID NO: 2 or IJ, aa812 to aa819 of SEQ ID aa813 to aa820 of SEQ ID NO: 2 or aa814 to aa821 of SEQ ID aa815 to aa822 of SEQ ID NO: 2 or 1 . aa816 to aa823 of SEQ ID
J. aa817 to aa824 of SEQ ID NO:] 2 or L J. aa818 to aa825 of SEQ ID
3; aa819 to aa826 of SEQ ID NO- 2 or aa820 to aa827 of SEQ ID 3, aa82l to aa828 of SEQ ID NO: 2 or aa822 to aa829 of SEQ ID
-3, aa823 to aa830 of SEQ ID NO: 2 or aa824 to aa831 of SEQ ID aa825 to aa832 of SEQ ID NO:] 2 or aa826 to aa833 of SEQ ID aa827 to aa834 of SEQ ID NO:l 2 or -3, aa828 to aa835 of SEQ ID aa829 to aa836 of SEQ ID NO:] 2 or aa830 to aa837 of SEQ ID 3, aa831 to aa838 of SEQ ID NO:l 2 or aa832 to aa839 of SEQ ID aa833 to aa840 of SEQ ID NO:l 2 or aa834 to aa841 of SEQ ID aa835 to aa842 of SEQ ID NO:l 2 or ' aa836 to aa843 of SEQ ID aa837 to aa844 of SEQ ID NO:l 2 or 1 aa838 to aa845 of SEQ ID aa839 to aa846 of SEQ ID NO:l 2 or aa840 to aa847 of SEQ ID aa841 to aa848 of SEQ ID NO:l 2 or •3, aa842 to aa849 of SEQ ID aa843 to aa850 of SEQ ID NO:l 2 or aa844 to aa851 of SEQ ID 3, aa845 to aa852 of SEQ ID NO:l 2 or '. 3; aa846 to aa853 of SEQ ID aa847 to aa854 of SEQ ID NO:l 2 or -3, aa848 to aa855 of SEQ ID aa849 to aa856 of SEQ ID NO:l 2 or '. - , aa850 to aa857 of SEQ ID . aa851 to aa858 of SEQ ID NO:l 2 or '. aa852 to aa859 of SEQ ID NJ z z z z z z z z z z z z z z z z z z z z z z z z z z z z o o o o o o o o o o o o o o o z z o c o o o o o o o o o o o o o t to to to to to to to to to t to to I to to to to t to to IO to to to to to to to
P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P MD MD MD MD oo 00 OO oo 00 oo 00 00 00 oo 00 oo 00 00 00 00 oo 00 00 00 oo 00 00 o o o o o MD MD MD MD MD o 00 00 00 oo -J -. O O ON Cl Cl Ci
MD Cl t->J Ci OJ Ci G.J MD Ci Cl > MD UJ o o o o o o o o O o o o o O o o O o o o o o o o o o o o o o
P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P
MD MD MD MD MD MD 00 00 oo 00 00 OO 00 00 00 00 00 00 00 oo oo 00 00 oo 00 oo o o o o MD MD MD MD MD OO 00 oo oo 00 -J -~J -o. G ON O O ON oo ON 4^ to O 00 ON -t- to o OO O to o oc ON 4^ to o oo ON 4^ t o 00 4^ t o o O o o O o O o o o o O o o o O o O o o o o o o o o o o o o
"→5 •→5 >→5 >-4 !→1 >→1
o >-ι o •"t o oι-t o o >-! o o o "I o >-! o o o o o 0
-t o -i o o >-! o o >-t o c o o 1 o o o o o -1
U
P P
P P
MJ MD to o o o o O O o O O O O o O o o o o o o o o o o o o o o o o O o
P P P P P P P P P P P P P P P P P P P P P P P P P P P P
P P P P P P P P P P P P P P P P P P P P P P P P P P P
MD o MD MD MD MD MD MD MD MD oo OO 00 00 00 c 00 00 00 00 00 00 00 00 00 00 oo 00 00 00
O O O O MD MD MD MD MD oo 00 00 00 00 - . -o -J -o o> O O-N
OJ o> ON
MD -J ^ MD -J C< L.J ^-* MD -J Cl J —^ MD --J 4^ > —' MD -J Cl υj *—' MD ~-j Cl G.J —'
O o o o O O o o o O O o O o O O c o o o O o o o o O o o 5 ^- "- -+> -+ι ^h >- >-b -+ι -* - o o
-4 "-4 ^+> !-+) l>-b >-b '-b <- >- !-+> I→J -!-> α u α D D σ σ σ α u α σ D σ σ u o D ϋ σ u σ u D σ u σ α σ u
NJ NJ o z z z z z z z z z z z z z z z z z z z z z z z z z o o o o o z z z z z o o o o o o o o o c o o o o o o o o o o o o o o
NJ IO to to to to t to to to to to to to t to to to t to to to to to NJ NJ to to to NJ o o o o o o o o o o o o o o o o o o o o o o o o o o o o o o
•-! >-t -i >-i !-! !-i >-! >-! >-ι
UJ UJ
P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P CO P P P P P P P P P P w P P P
P P P P MD MD MD MD MD MD MD MD MD MD MD MD MD MD MD MJ MJ •o MD MD MD MD MD MD MD MJ MD MD MD ON O O σ-i ON Ci Ci Cl Ci Ci J -> -ϋ. 4^ 4i> J UJ UJ UJ UJ NJ to to NJ to MD CI MD Cl UJ MD Ci UJ MD -o Cl UJ MD -o Cl UJ i— MD
P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P MD MD MD MD MD MD MD MD MD SO MD MD MD MD MD MD MD MD MD MD MD MD MD MD MD MD MD MD MD MD -J ^J -, O O O o> σ-N Cl Ci Ci Cl Cl 4^ 4^ 4^ 4^ 4^. UJ UJ UJ UJ UJ t to to NJ to oo 0\ J NJ o 00 ON 4^ to o 00 ON to o 00 ON 4- to 00 ON -P- to o 00 O ^ to o o o O>→> O o O O o o o o O o O O o O O o o o o o ι-b -*> o
GO GO GO GO GO GO GO GO GO GO GO GO CO GO GO GO GO GO m GO GO GO GO GO GO GO GO GO GO GO GO tn tn tn m tn tn tn tn tn tn tn tn tn tn tn tn tn m tn tn tn tn tn tn tn tn m tn tn 0 0 0 0 /O / O d O D /D /D σ α σ σ σ σ ϋ O α O α o ϋ o o O D σ σ o σ o σ o o σ σ ϋ u o UJ z z z z z z Z z z O o o z z o o z z Z Z o o O O o o z z z z z o o o o o o Z o o o z Z o O o z z o o z z z o o o Z z o o
IO NJ t to to to to to NJ to NJ t to NJ to IO to NJ NJ to NJ to to NJ to NJ NJ NJ NJ to
P P P P
P P P P
MD MD MD MD
-o -O ON ON
NJ o 00 ON
O o O O O o O o o O o O o o O O O o o o o o O O o o o o o O
P P P P P P P P P P P P P P P P P P P P P P P P P P P P P
P P P P P P P P P P P P P P P P P P P P P P P P P P P P P
MD MD MD MD MD MD MD MD MD MD MD MD MD MD MD MD MD MD MD MD MD MD MD MD D MD MD MD MD
-J -0 -o. -J -O ON ON ON ON ON Ci Cl Cl Ci Cl φ- -P- -- 4i- 4^ UJ UJ UJ J UJ to NJ NJ NJ to
MD -J Cl UJ MD -O Cl UJ MD -o Cl UJ 1—' MD -o Cl J '—* MD -. Cl UJ ^ MD -J Cl UJ —^
O o o o o O o o o O O O o o O O o o O O O o o o o O O O o
'-'I ι- ι→> >-b !- ) >- >-+) *-+ι >-+) >-b -+v !-+) <— ^+> *-4 !-4 «-> >-+> '-+> >-h -b →i >→5 -4
α σ α ϋ D D σ α α α o α σ α σ σ o α u D D D D α u σ D U D α
NO:l12 or 13; aa973 to aa980 of SEQ ID NO: 12 or 13; aa974 to aa981 of SEQ ID
NO:l12 or 13; aa975 to aa982 of SEQ ID NO: 12 or 13; aa976 to aa983 of SEQ ID
NO:l12 or 13; aa977 to aa984 of SEQ ID NO: 12 or 13; aa978 to aa984 of SEQ ID
NOT 12 or 13; aa979 to aa986 of SEQ ID NO: 12 or 13; aa980 to aa987 of SEQ ID
NO:l12 or 13; aa981 to aa988 of SEQ ID NO: 12 or 13; aa982 to aa989 of SEQ ID
NOT 12 or 13; aa983 to aa990 of SEQ ID NO: 12 or 13; aa984 to aa991 of SEQ ID
NO:l12 or 13; aa985 to aa992 of SEQ ID NO: 12 or 13; aa986 to aa993 of SEQ ID
NOT 12 or 13; aa987 to aa994 of SEQ ID NO: 12 or 13; aa988 to aa995 of SEQ ID
NOT 12 or 13; aa989 to aa996 of SEQ ID NO: 12 or 13; aa990 to aa997 of SEQ ID
NOT 12 or 13; aa991 to aa998 of SEQ ID NO: 12 or 13; aa992 to aa999 of SEQ ID
NOT 12 or 13; aa993 to aalOOO of SEQ ID NO: 12 or 13; aa994 to aalOOl of SEQ ID
NOT 12 or 13; aa995 to aal 002 of SEQ ID NO: 12 or 13; aa996 to aal 003 of SEQ ID
NOT 12 or 13; aa997 to aal 004 of SEQ ID NO: 12 or 13; aa998 to aal 005 of SEQ ID
NO: I12 or 13: aa999 to aal 006 of SEQ ID NOT 12 or 13; aal OOO to aal 007 of SEQ ID
NOT 12 or 13; aalOOl to aal008 of SEQ ID NO: 12 or 13; aal 002 to aal 009 of SEQ ID
NOT 12 or 13; aal003 to aal OlO of SEQ ID NO: 12 or 13; aal 004 to aal 01 1 of SEQ ID
NOT 12 or 13; aal005 to aal 012 of SEQ ID NO: 12 or 13; aal 006 to aal013 of SEQ ID
NOT 12 or 13; aal 007 to aal 014 of SEQ ID NO: 12 or 13; aal 008 to aal015 of SEQ ID
NOT 12 or 13; aal009 to aalOlό of SEQ ID NO: 12 or 13; aalOlO to aal017 of SEQ ID
NOT 12 or 13; aalOl l to aal 018 of SEQ ID NO: 12 or 13; aal012 to aal019 of SEQ ID
NOT 12 or 13; aal013 to aal 020 of SEQ ID NO: 12 or 13; aal014 to aal021 of SEQ ID
NOT 12 or 13; aal015 to aal 022 of SEQ ID NO: 12 or 13; aalOlό to aal023 of SEQ ID
NOT 12 or 13; aal017 to aal024 of SEQ ID NO: 12 or 13; aal018 to aal025 of SEQ ID
NOT 12 or 13; aal019 to aal026 of SEQ ID NO: 12 or 13; aal 020 to aal 027 of SEQ ID
NOT 12 or 13; aal 021 to aal 028 of SEQ ID NO: 12 or 13; aal022 to aal029 of SEQ ID
NOT 12 or 13; aal 023 to aal 030 of SEQ ID NO: 12 or 13; aal024 to aal031 of SEQ ID
NOT 12 or 13; aal 025 to aal 032 of SEQ ID NO: 12 or 13; aal026 to aal033 of SEQ ID
NOT 12 or 13; aal 027 to aal 034 of SEQ ID NO: 12 or 13; aal028 to aal035 of SEQ ID
NOT 12 or 13; aal029 to aal036 of SEQ ID NO: 12 or 13; aal030 to aal037 of SEQ ID
NOT 12 or 13; aal031 to aal 038 of SEQ ID NO: 12 or 13; aal032 to aal039 of SEQ ID NO: 12 or 13; aal 033 to aal 040 of SEQ ID NO: 12 or 13; aal 034 to aal 041 of SEQ ID NO:12 or 13; aal035 to aal 042 of SEQ ID NO: 12 or 13; aal 036 to aal 043 of SEQ ID NO:12 or 13; aal 037 to aal 044 of SEQ ID NO: 12 or 13; aal 038 to aal045 of SEQ ID NO: 12 or 13; aal 039 to aal 046 of SEQ ID NO: 12 or 13; aal 040 to aal 047 of SEQ ID NO:12 or 13; aal041 to aal 048 of SEQ ID NO: 12 or 13; aal 042 to aal049 of SEQ ID NO: 12 or 13; aal 043 to aal050 of SEQ ID NO: 12 or 13; aal 044 to aal 051 of SEQ ID NO:12 or 13; aal 045 to aal 052 of SEQ ID NO: 12 or 13; aal 046 to aal 053 of SEQ ID NOT2 or 13; aal 047 to aal 054 of SEQ ID NO: 12 or 13; aal 048 to aal055 of SEQ ID NO: 13; aal049 to aal056 of SEQ ID NO: 13; aal050 to aal057 of SEQ ID NOT 3; aal051 to aal 058 of SEQ ID NO: 13; aal 052 to aal059 of SEQ ID NOT3; aal053 to aal060 of SEQ ID NOT3; aal054 to aal061 of SEQ ID NOT3: aal055 to aal062 of SEQ ID NO: 13: aal 056 to aal 063 of SEQ ID NO: 13; aal 057 to aal 064 of SEQ ID NOT3; aal058 to aal065 of SEQ ID NOT3: aal059 to aal066 of SEQ ID NOT 3; aal 060 to aal 067 of SEQ ID NOT 3; aal061 to aal068 of SEQ ID NOT 3: aal 062 to aal069 of SEQ ID NOT3; aal063 to aal070 of SEQ ID NOT3: aal064 to aal07 l of SEQ ID NO: 13: aal065 to aal072 of SEQ ID NO: 13; aal 066 to aal 073 of SEQ ID NOT3; aal067 to aal074 of SEQ ID NOT3; aal068 to aal075 of SEQ ID NOT3; aal 069 to aal076 of SEQ ID NOT3; aal070 to aal077 of SEQ ID NOT3; and aal071 to aal 078 of SEQ ID NO: 13. The coding sequence of fragments can be constructed by cleaving the unwanted nucleotides from the mutant or native TIAM2 protein coding sequences.
Fusions are fragment, mutant, or native TIAM2 proteins with additional amino acids at either or both of the termini. The additional amino acid sequence generally is not homologous to sequence found in native TIAM2 polypeptides. The additional amino acid residues can facilitate expression, detection, or activity of the polypeptide, for example. The additional amino acid sequence can also be used as linker to construct multimers of TIAM2 proteins. All fusion polypeptides exhibit the desired sequence homology. immunological or biological activity. Recombinant TIAM2 fusion proteins can be produced using the preferred cell system, baculovirus. After inserting the TIAM2 DNA sequence into the transfer vector, the vector and the wild type viral genome are transfected into an insect host cell where the vector and viral genome are allowed to recombine. The packaged recombinant virus is expressed and recombinant plaques are identified and purified. Materials and methods for baculovirus/insect cell expression systems are commercially available in kit form from, inter alia. Invitrogen, San Diego CA ("MaxBac" kit). These techniques are generally known to those skilled in the art and fully described in Summers and Smith, Texas Agricultural Experiment Station Bulletin No. 1555 (1987).
Prior to inserting the DNA sequence encoding the protein into the baculovirus genome, the above-described components, comprising a promoter, leader (if desired), coding sequence of interest, and transcription termination sequence, are usually assembled into an intermediate construct (transfer vector).
Currently, the most commonly used transfer vector for introducing foreign genes into AcNPV is pAc373. Many other vectors, known to those of skill in the art. have also been designed. These include, for example, pVL985 (which alters the polyhedrin start codon from ATG to ATT. and which introduces a BamHI cloning site 32 base pairs downstream from the ATT; see Luckow and Summers, Virology 77:31 (1989).
The plasmid usually also contains the polyhedron polyadenylation signal (Miller et al Ann. Rev. Microbiol, 42:177 (1988)) and a prokaryotic ampicillin- resistance (amp) gene and origin of replication for selection and propagation in E. coli.
Baculovirus transfer vectors usually contain a baculovirus promoter. A promoter will have a transcription initiation region which is usually placed proximal to the 5' end of the coding sequence. This transcription initiation region usually includes an RNA polymerase binding site and a transcription initiation site. A baculovirus transfer vector may also have a second domain called an enhancer, which, if present, is usually distal to the structural gene. Expression may be either regulated or constitutive.
Structural genes, abundantly transcribed at late times in a viral infection cycle, provide particularly useful promoter sequences. Examples include sequences derived from the gene encoding the viral polyhedron protein, Friesen et al, (1986) "The Regulation of Baculovirus Gene Expression," in: The Molecular Biology of Baculoviruses (ed. Walter Doerfler); EPO Publ. Nos. 127 839 and 155 476; and the gene encoding the plO protein. Vlak et al , J. Gen. Virol 69:765 (1988).
DNA encoding suitable signal sequences can be derived from genes for secreted insect or baculovirus proteins, such as the baculovirus polyhedrin gene
(Carbonell et al. Gene, 73:409 (1988)). Alternatively, since the signals for mammalian cell posttranslational modifications (such as signal peptide cleavage, proteolytic cleavage, and phosphorylation) appear to be recognized by insect cells, and the signals required for secretion and nuclear accumulation also appear to be conserved between the invertebrate cells and vertebrate cells, leaders of non-insect origin, such as those derived from genes encoding human α-interferon, Maeda et al, Nature 315:592 (1985); human gastrin-releasing peptide, Lebacq-Verheyden et al , Molec. Cell Biol 5:3129
(1988); human IL-2. Smith et al, Proc. Nat'l Acad. Sci. USA, 52:8404 (1985); mouse
IL-3, (Miyajima et al. Gene 58:272 ( 1987); and human glucocerebrosidase, Martin et al. DNA 7:99 (1988), can also be used to provide for secretion in insects.
After insertion of the DNA sequence and/or the gene encoding the expression product precursor of the protein, an insect cell host is co-transformed with the heterologous DNA of the transfer vector and the genomic DNA of wild type baculovirus, usually by co-transfection. Methods for introducing heterologous DNA into the desired site in the baculovirus virus are known in the art. (See Summers and Smith; Ju et al. (1987); Smith et al, Mol. Cell. Biol 5:2156 (1983); and Luckow and Summers (1989)). For example, the insertion can be into a gene such as the polyhedrin gene, by homologous double crossover recombination; insertion can also be into a restriction enzyme site engineered into the desired baculovirus gene. Miller et al. Bioessays 4:9\ (1989).
The newly formed baculovirus expression vector is subsequently packaged into an infectious recombinant baculovirus. Methods to identify recombinant viruses are described in "Current Protocols in Microbiology" Vol. 2 (Ausubel et al eds) at 16.8 (Supp. 10, 1990); Summers and Smith; Miller et al. (1989). Recombinant baculovirus expression vectors have been developed for infection into several insect cells. For example, recombinant baculoviruses have been developed for, inter alia: Aedes aegypti , Autographa californica, Bombyx mori. Drosophila melanogaster, Spodoptera frugiperda. and Trichoplusia ni (PCT Pub. No. WO 89/046699: Carbonell et al , J. Virol. 56:\ 52 (1985); Wright Nature 327:718 (1986); Smith et al, Mol. Cell. Biol. 3:2156 (1983); and see generally. Fraser, et al. In Vitro Cell Dev. Biol 25:225 (1989)).
The TIAM2 protein can be used in an assay for inhibitors and for preparing antibodies directed to TIAM2. TIAM2 protein may also be useful as a factor that promotes the growth of cancer cells in culture. The TIAM2 protein may be combined with the pharmaceutically acceptable carrier noted above for use with the
TIAM2 antisense molecule.
The present invention will now be illustrated by reference to the following examples which set forth particularly advantageous embodiments. However. it should be noted that these embodiments are illustrative and are not to be construed as restricting the invention in any way.
EXAMPLES
EXAMPLE 1 : IDENTIFICATION OF THE TIAM2 GENE
In a degenerative PCR-based screen for new genes, a single 377- nucleotide clone (DP-75) was identified, with high homology to the mouse and human TIAMl genes. Due to its similarity to TIAMl, this new gene and its predicted protein product were designated T-cell lymphoma invasion and metastasis 2 (TIAM2). Northern analysis with the DP-75 probe revealed a ~-3.3-kb transcript in cerebral cortex, occipital pole, frontal lobe, and temporal lobe, and a ~4.4-kb transcript in testis and cerebellum (Figures 1A and IB). Through cDNA library screens and RACE cloning, overlapping clones were isolated and compiled into full-length sequences representing the ~4.4- and ~3.3-kb messages. To perform Northern analyses. Human Multiple Tissue Northern Blots (Clontech) were hybridized with DP-75 probe in SpeedHyb solution (BIOS lab) at 65° C. Blots were washed two times with 0.5 x SSC, 0.5%) SDS at room temperature for 10 min. and one time with 0.1 x SSC, 0.5% SDS at 65° C for I hr.
The compiled cDNA for the ~4.4-kb message is 4586 nucleotides long, without polyadenylation, and is predicted to encode the 1077-amino-acid-long form of the TIAM2 protein (TIAM2L). The first ATG is at nucleotide 51 and is in good context for translation. An alignment of the predicted protein to TIAMl (Figure 3) shows significant identity beginning with the first methionine of TIAM2 and a methionine at position 576 of TIAMl, a region that corresponds to the last 14 amino acids of the coiled coil domain of TIAMl (aa 548-590). The identity continues into the EX domain, which extends from amino acid 599 to amino acid 691 of human TIAMl . A comparison of the TIAMl /TIAM21 EX domains shows 62%> overall identity, but with 85% identity in a 60-aa subdomain. Following the EX domain, alternative splicing of a 72-nucleotide miniexon leads to the presence or absence of a 24-amino acid sequence with no significant identity to TIAMl or SIF sequences. Following the alternatively spliced region is a sequence with weak identity to TIAMl (18%)). but which contains the conserved residues of PDZ or DHR domains (Michiels et al.. Nature 375:338-340, 1995). The remaining sequence contains identity to the DH catalytic region (70%) and the carboxyl-terminal PH domain (54%).
The compiled sequence for the ~3.3-kb message is 3344 nucleotides long and is predicted to encode a short form (626 aa) of TIAM2 (TIAM2S). The ~3.3-kb message differs from the ~4.4-kb message in that the first 104 nucleotides are unique, suggesting that the ~3.3-kb message results from initiation at a promoter distinct from that of the ~4.4-kb message. The initiator methionine at position 162 coincides with a methionine at amino acid 428 of the 4.4-kb TIAM2 predicted protein and for the remainder of the protein shows complete identity with TIAM2L. Similar to what is seen with the TIAMl gene (Habets et al.. Cell 77:537-549, 1994), there are two upstream ATGs in the ~3.3-kb message that precede the long open reading frame (nucleotide 162), but only the start codon at nucleotide 162 is in good context for translation. A comparison with TIAMl shows that TIAM2S. begins immediately upstream (24 aa) of the DH domain.
Northern analysis with a probe isolated from the 5' end of the ~4.4-kb message identifies only the larger TIAM2 transcript (Figure IC), while a probe isolated from the 3" end of TIAM2 identifies both transcripts (Figure ID).
A Radiation Hybrid Mapping experiment was performed as follows. TIAM2-specifιc oligos AGTCCTACCTCATCAAGCCG (SEQ ID NO: 14) and TTAGTGCTTCCGTCAGGTGG (SEQ ID NO: 15) were synthesized and used with the G3 panel (Research Genetics) as per the manufacturer's instructions. The resulting PCR products were analyzed by gel electrophoresis, and the resulting data were analyzed according to methods of Stewart and Cox. In "Genome Mapping: A Practical Approach" (P. Dear et al. Ed.) pp. 73-93. Oxford Lniv. Press, Oxford. 1997. A two- point maximum-likelihood analysis showed that the markers were linked to D6S1556 (6q25 ) with a lod score of 1000.
EXAMPLE 2 IN SITU HYBRIDIZATION
Oligos designed from nucleotides 566-586 (AGTACAGAAGGTT- CTGGAGCG) and from nucleotides 1348-1367 (TACCAGGCGATCCTTACACG) of the human 3.3 kb TIAM2 cDNA were used to perform PCR on mouse brain cDNA (Clontech). Thirty cycles of PCR performed with an annealing temperature of 40° C led to the production of a product (MDP75) of the expected size (802 nt). Cloning and sequencing confirmed that MDP75 was 90% identical to human TIAM2 throughout the length of the clone. Mouse embryos (CD-I) were processed for whole-mount RNA in situ hybridization following the protocol of Nieto et al, In "Methods in Avian Embryology" (M. Bronner-Fraser, Ed.). Academic Press, San Diego (1995). Adult brain sections were processed using the protocol for frozen sections as described (Schaeren-Wiemers and Gerfin-Moser, Histochemistry 700:431 -440 (1993)). The expression of TIAM2 mRNA in the embryonic day 13.5 (E13.5) and adult mouse brain was examined by in situ hybridization with a digoxigenin-labeled ribo-probe. Discrete and reproducible labeling was observed at both ages with an antisense probe; no labeling was detected with a sense probe. In both El 3.5 and adult brain, the cellular localization of TIAM-2 transcripts is consistent with TIAM2 expression in neurons rather than glial cells. At E13.5, TIAM2 transcripts are present throughout the telencephalon (Figure 2A). Parasagittal sections through the telencephalon demonstrate that expression is localized to the pial surface where early born postmitotic neurons are located (Figure 2B). TIAM2 is not expressed in the proliferating neural precursor cells that line the ventricles.
In the adult mouse brain. TIAM2 continues to be expressed primarily in regions derived from the telencephalon (Figures 2C-2G. Table 1). Areas of strong expression include the olfactory bulb, cerebral cortex, caudate putamen, and hippocampus. The hippocampus expression is highly specific in that cells of the dentate gyrus and regions derived from it. induseum griseum and fasciola cinerea; and pyramidal cells of one subregion of the CA fields (CA2) are labeled very strongly while CA1 and CA3 show very little expression. TIAM2 is also strongly expressed in the ependymal cells of the lateral surface of the lateral ventricles (Figure 2D). This region is a germinal zone where neurons are generated throughout adult life. The majority of neurons born in this region are believed to migrate to the olfactory bulb.
TABLE 1 EXPRESSION OF TIAM2 MRNA IN THE ADULT MOUSE BRAIN
Olfactory bulb
Mitral cell layer +++
Glomerular layer ++
Granular cell layer +++
Olfactory nuclei ++
Cerebral cortex +++
Hippocampus
CA1 +
CA2 +-+++
CA3 +
Dentate gyrus +-H--,-
Insidium gresium +++ f
Fasciola cinerea ++++
Amygdala +
Septum ++
Caudate putamen +++
Ependymal and subependymal layers +++
Thalamus
Reticular nucleus +++
Ventral posterolateral nucleus +++
Pons ++
I he highest levels and lowest levels of expression are indicated ++++ and +. respective!} EXAMPLE 3
GDP-GTP EXCHANGE ACTIVITY
An amino-terminal HIS tagged version of the 3.3-kb TIAMS protein (His-TIAM2) was expressed in a baculovirus system. A protein of the predicted molecular mass (75.661 Da) was partially purified on a nickel column, and its identity was confirmed by amino-terminal sequencing and mass spectrometry. To generate the His-tagged TIAM2 s expression construct, a linker-adapter was produced such that it added an EcoRI site to the 5' end of the first 29 bp of the TIAM2S sequence (GAATTCATGGAAGGACCGCGGGA-GAATCAGGATCC). This kinased linker/adapter, terminating in a BamHI site (bases 23-29 of the TIAM2S sequence), was ligated to a cDNA clone DP-75#1 , which had been linearized by a BamHI fragment that encompassed the entire coding region of TIAM2S. A subsequent Sail digest liberated an -2000-bp EcυRl-Sall fragment that encompassed the entire coding region of TIAM2S. The fragment was isolated, purified, and ligated into ΕcoRI-S<7/I-digested pBlueBacHis2B vector (Invitrogen). The resulting clone (pHIS- T1AM2S) was confirmed by sequence analysis. pHIS-TIAM2s was introduced into SF9 cells, and clones expressing high levels of pHIS- TIAM2S were identified by Western blot. Following clonal expansion, pHIS- TIAM2 -expressing cells were concentrated, lysed, and applied to a nickel column (Invitrogen). pHIS-TIAM2s protein was purified from the column as per the manufacturer's recommendations except that following the 50 mM imidazole wash, the protein was directly eluted in 500 mM imidazole. The fractions containing pHIS- TIAM2S were concentrated on a Centricon (Amicon) 30 column spun at 5000g for 30 min. His-TIAM2S was tested for its ability to stimulate the GDP-GTP exchange activity with Rac or Ras proteins and was compared to the activity of SOS, a known Ras GΕF (Jefferson et al., Oncogene 16:2303-2310. 1998). In these experiments (Figure 4). immunoprecipitated Rac or Ras protein was preloaded with GDP and incubated in [12P]GTP-containing buffer alone or in buffer containing either His- TIAM2S or purified SOS. In multiple experiments, His-TIAM: showed approximately fivefold stimulation of Rac exchange activity at 30 min relative to buffer alone, while SOS showed a modest stimulation (1.6χ) at best (Figure 4 A). Conversely, when His- TIAM2S and SOS were incubated with RAS. SOS demonstrated a four- to fivefold stimulation of exchange activity while His-TIAM2S had little or no effect (Figure 4B).
EXAMPLE 4: UTILIZING POLYNUCLEOTIDES TO DIAGNOSE CANCER
In a dot blot assay. TIAM2 was hybridized to RNA from both cancerous and normal tissue. The source of cancerous tissue include renal, thyroid, breast, colon, ureter, lung, nose, stomach, esophagus, liver, lymphoma. uterus, bladder, rectum, and brain.
The blots were from BioChain Institute, Inc.. San Leandro, California.
USA. ExpressHyb™ hybridization buffer (Clontech, Palo Alto. California. USA) was used for the blotting at 68°C with TJAM2 (SEQ ID NOT) at lxlO6 cpm/ml for 2 hours.
As shown in Figure 5, in four of four thyroid samples, SEQ ID NOT mRNA levels were higher in the cancer than the normal samples. In two of the four colon samples, SEQ ID NOT mRNA levels were higher in the cancer than the normal samples. In one of two ureter samples, the SEQ ID NOT (TIAM2) mRNA level were higher in the cancer than the normal sample. In one of four breast samples, the SEQ ID
NOT mRNA level were higher in the cancer than the normal sample. In one of four renal sample, the SEQ ID NOT mRNA level were higher in the cancer than the normal sample. In all other tissue types tested, the SEQ ID NOT mRNA levels were the same or higher in the normal samples than the cancer samples. SEQ ID NOT
AAGGCCTTTGTTGGGTGCCCGGAACCCCACCAAGCAGCATTCCTCACGCTG GAGTCCTACCTCATCAAGCCGGTTCAGAGAGCGCTCAGGTACCCGCTGCTG CTCAAGGAGCTGGTGTCCCTGACGGACCAGGAGAGCGAGGAGCACTACCAC CTGACGGAAGCACTAAAGGCAATGGAGAAAGTAGCGAGCCACATCAATGA GATGCAGAAGATCTATGAGGATTATGGGACCGTGTTTGACCAGCTAGTAGC TGAGCAGAGCGGAACAGAGAAGGAGGTAACAGAACTTTCGATGGGAGAGC TTCTGATGCACTCTACGGTTTCCTGGTTGAACCCAATGTTGATCCCCGGGG
EXAMPLE S: ISOLATION OF SEQ ID NO:6
SEQ ID NO:6 was isolated from a frontal cortex library utilizing a phage vector Stratagene. La Jolla. California, USA). The library was probed with SEQ ID NOT. which was generated by a random primed label with a final radioactive count of approximately 1x106 cpm/ml. The probe was labeled according to manufacturer's instruction with a RediPrime™ DNA labeling kit (Amersham, Arlington Heights. Illinois, USA).
The phage library was propagated and plated onto twenty plates according to the manufacturer's instructions with a 3.0-5.0 x 10" plaques/plate. The plaques were transferred to a nitrocellulose membranes. Each membrane was incubated with the SEQ ID NOT probe for 2 hours at 65°C in ExpressHyb™ hybridization solution purchased from Clontech, Palo Alto. California, USA. The filters were washed according to the Clontech instruction. Film was exposed to the membranes to identify putative positive plaques containing the desired TIAM2 polynucleotide.
A second round of plating and hybridization was performed to identify a single positive plaque. The positive plaques from the first round were propagated and plated onto agar medium according to the instructions provided by Stratagene. The plaques were transferred to filters. These filters were incubated with the SEQ ID NOT probe. The probe and hybridization conditions were the same as described above. Positive plaques were identified and propagated. According to manufacturer's instructions, a BlueScript plasmid was rescued from the phage vector. The EcoRI insert from the plasmid was sequenced. The polynucleotide sequence is shown in SEQ ID NO:6.
The present invention has been described with reference to specific embodiments. However, this application is intended to cover those changes and substitutions which may be made by those skilled in the art without departing from the spirit and the scope of the appended claims.
Deposit Information:
The following materials were deposited with the American Type Culture
Collection:
Name Deposit Date Accession No.
Escherichia coli INVαF' DP 75 25 April 1996 98030
The above materials have been deposited with the American Type Culture Collection. Manassas, Virginia, under the accession numbers indicated. This deposit will be maintained under the terms of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for purposes of Patent Procedure. The deposits will be maintained for a period of 30 years following issuance of this patent, or for the enforceable life of the patent, whichever is greater. Upon issuance of the patent, the deposits will be available to the public from the ATCC without restriction.
These deposits are provided merely as convenience to those of skill in the art, and are not an admission that a deposit is required under 35 U.S.C. §1 12. The sequence of the polynucleotides contained within the deposited materials, as well as the amino acid sequence of the polypeptides encoded thereby, are incorporated herein by reference and are controlling in the event of any conflict with the written description of sequences herein. A license may be required to make, use, or sell the deposited materials, and no such license is granted hereby.

Claims

CLAIMS WHAT IS CLAIMED:
1. An isolated nucleic acid molecule comprising a polynucleotide selected from the group consisting of:
(a) a polynucleotide encoding amino acids from about 1 to about 626 ofSEQIDNO l;
(b) a polynucleotide encoding amino acids from about 2 to about 626 ofSEQIDNOTl:
(c) a polynucleotide encoding amino acids from about 1 to about 626 ofSEQIDNOT2;
(d) a polynucleotide encoding amino acids from about 2 to about 626 ofSEQIDNOT2;
(e) a polynucleotide encoding amino acids from about 1 to about 626 ofSEQID OT3;
(f) a polynucleotide encoding amino acids from about 2 to about 626 ofSEQIDNO:13;
(g) a polynucleotide at least 80 % identical to the polynucleotide of (a), (b), (c), (d), (e) or (f): and
(h) the polynucleotide complement of the polynucleotide of (a), (b). (c), (d), (e), (f), (g).
2. An isolated nucleic acid molecule comprising 10 contiguous nucleotides from the coding region of SEQ ID NO:8. SEQ ID NO:9 or SEQ ID NO: 10.
3. The isolated nucleic acid molecule of claim 2, which comprises 20 contiguous nucleotides from the coding region of SEQ ID NO:8. SEQ ID NO:9 or SEQIDNOT0.
4. The isolated nucleic acid molecule of claim 3. which comprises 50 contiguous nucleotides from the coding region of SEQ ID NO:8. SEQ ID NO:9 or SEQ ID NOT0.
5. An isolated nucleic acid molecule comprising a polynucleotide encoding a polypeptide wherein, except for at least one conservative amino acid substitution, said polypeptide has an amino acid sequence selected from the group consisting of:
(a) a polynucleotide encoding amino acids from about 1 to about 626 of SEQ ID NO l ;
(b) a polynucleotide encoding amino acids from about 2 to about 626 of SEQ ID NO l ;
(c) a polynucleotide encoding amino acids from about 1 to about 626 of SEQ ID NO: 12:
(d) a polynucleotide encoding amino acids from about 2 to about 626 of SEQ ID NO: 12;
(e) a polynucleotide encoding amino acids from about 1 to about 626 of SEQ ID NOT 3: and
(1) a polynucleotide encoding amino acids from about 2 to about 626 of SEQ ID NO: 13.
6. A method of making a recombinant vector comprising inserting a nucleic acid molecule of claim 1 into a vector in operable linkage to a promoter.
7. A recombinant vector produced by the method of claim 6.
8. A method of making a recombinant host cell comprising introducing the recombinant vector of claim 7 into a host cell.
9. A recombinant host cell produced by the method of claim 8.
10. A recombinant method of producing a polypeptide. comprising culturing the recombinant host cell of claim 9 under conditions such that said polypeptide is expressed and recovering said polypeptide.
1 1. An isolated polypeptide comprising amino acids at least 90% identical to amino acids selected from the group consisting of:
(a) amino acids from about 1 to about 626 of SEQ ID NO: 1 1 ;
(b) amino acids from about 2 to about 626 of SEQ ID NO: 1 1 ;
(c) amino acids from about 1 to about 626 of SEQ ID NO: 12;
(d) amino acids from about 2 to about 626 of SEQ ID NO: 12:
(e) amino acids from about 1 to about 626 of SEQ ID NO: 13: and
(f) amino acids from about 2 to about 626 of SEQ ID NO: 13.
12. An isolated polypeptide wnerein, except for at least one conservative amino acid substitution, said pol peptide has an amino acid sequence selected from the group consisting of:
(a) amino acids from about 1 to about 626 of SEQ ID NO: 1 1 ;
(b) amino acids from about 2 to about 626 of SEQ ID NOT 1 :
(c) amino acids from about 1 to about 626 of SEQ ID NO: 12;
(d) amino acids from about 2 to about 626 of SEQ ID NO: 12:
(e) amino acids from about 1 to about 626 of SEQ ID NO: 13; and
(f) amino acids from about 2 to about 626 of SEQ ID NO: 13.
13. An isolated polypeptide comprising amino acids selected from the group consisting of:
(a) amino acids from about 1 to about 626 of SEQ ID NO: 1 1 :
(b) amino acids from about 2 to about 626 of SEQ ID NO 1 :
(c) amino acids from about 1 to about 626 of SEQ ID NO: 12;
(d) amino acids from about 2 to about 626 of SEQ ID NO: 12;
(e) amino acids from about 1 to about 626 of SEQ ID NO: 13; and (f) amino acids from about 2 to about 626 of SEQ ID NO: 13.
14. An epitope-bearing portion of the polypeptide of SEQ ID NO: 1 1 , SEQ ID NOT2. or SEQ ID NOT3.
15. The epitope-bearing portion of claim 14, which comprises 10 contiguous amino acids of SEQ ID NO: 1 1, SEQ ID NO: 12, or SEQ ID NO: 13.
16. The epitope-bearing portion of claim 15, which comprises 20 contiguous amino acids of SEQ ID NO: 1 1. SEQ ID NO: 12. or SEQ ID NO: 13.
17. An isolated antibody that binds specifically to the polypeptide of claim 1 1.
An isolated antibody that binds specifically to a polypeptide of claim 12.
19. An isolated antibody that binds specifically to the polypeptide of claim J .
20. An antisense vector comprising (i) an antisense polynucleotide that comprises a sequence capable of hybridizing to at least one of SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NOT0 or fragments thereof under stringent conditions wherein said polynucleotide is capable of hybridizing to the mRNA of native human TIAM2; and (ii) and polynucleotide comprising a sequence capable of initiating transcription of said antisense polynucleotide.
21. The antisense vector of claim 20, wherein said sequences to initiate transcription are derived from a retrovirus, an adenovirus. or an adeno- associated virus.
22. The antisense vector of claim 21, further comprising an origin of replication.
23. A method of inhibiting expression of TIAM2. comprising:
(a) providing an antisense polynucleotide comprising a nucleic acid sequence capable of hybridizing to at least one of SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO: 9, SEQ ID NO: 10 or fragments thereof under stringent conditions and is capable of hybridizing to native human TIAM2 mRNA; and
(b) contacting said antisense polynucleotide with said TIAM2.
24. A method for detecting hyperproliferative cells in a sample comprising
(a) providing a probe polynucleotide comprising a sequence capable of hybridizing to at least one of SEQ ID NO:6. SEQ ID NO:8. SEQ ID NO:9, SEQ ID NO: 10 or fragments thereof under stringent conditions;
(b) contacting the probe with the polynucleotides of the sample cell under conditions permitting formation of polynucleotide hybrids; and
(c) detecting the hybrids.
25. A method to detect TIAM2 polypeptides in a sample comprising:
(a) providing an antibody that specifically binds to a TIAM2 polypeptide. wherein said TIAM2 polypeptide comprises an amino acid sequence that is encoded by a polynucleotide comprising a sequence capable of hybridizing to at least one of SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NOT0 or fragments thereof;
(b) contacting said antibody to the sample under conditions permitting the formation of antibody /antigen complexes; and
(c) detecting the complexes.
26. A method of inhibiting the replication of a cell comprising
(a) providing an antibody that specifically binds to a TIAM2 polypeptide. wherein said TIAM2 polypeptide comprises an amino acid sequence that is encoded by a polynucleotide comprising a sequence capable of hybridizing to at least one of SEQ ID NO:6. SEQ ID NO:8. SEQ ID NO:9. SEQ ID NO: 10 or fragments thereof; and
(b) contacting said antibody to the sample under conditions permitting the formation of antibody/antigen complexes.
EP00902369A 1999-01-06 2000-01-06 Tiam2 (t-cell lymphoma invasion and metastasis 2) nucleotide exchange factor Withdrawn EP1144448A3 (en)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US22727899A 1999-01-06 1999-01-06
US227278 1999-01-06
PCT/US2000/000459 WO2000040607A2 (en) 1999-01-06 2000-01-06 Tiam2 (t-cell lymphoma invasion and metastasis 2) nucleotide exchange factor

Publications (2)

Publication Number Publication Date
EP1144448A2 true EP1144448A2 (en) 2001-10-17
EP1144448A3 EP1144448A3 (en) 2002-03-06

Family

ID=22852486

Family Applications (1)

Application Number Title Priority Date Filing Date
EP00902369A Withdrawn EP1144448A3 (en) 1999-01-06 2000-01-06 Tiam2 (t-cell lymphoma invasion and metastasis 2) nucleotide exchange factor

Country Status (4)

Country Link
EP (1) EP1144448A3 (en)
JP (3) JP4707235B2 (en)
AU (1) AU2409700A (en)
WO (1) WO2000040607A2 (en)

Families Citing this family (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20020165145A1 (en) * 2000-09-25 2002-11-07 Meyers Rachel E. 33521, a novel human guanine nucleotide exchange family member and uses thereof
EP1752040A1 (en) * 2005-08-12 2007-02-14 Max-Planck-Gesellschaft zur Förderung der Wissenschaften e.V. Isolation of the t-complex distorters and applications thereof
US8679760B2 (en) * 2011-05-03 2014-03-25 National Cheng Kung University Biomarker and method for evaluating risk of proliferation, invasion, or metastasis of cancer
JP6675287B2 (en) 2016-08-23 2020-04-01 日機装株式会社 Fluid sterilizer

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1997046680A1 (en) * 1996-06-05 1997-12-11 Chiron Corporation Dna encoding dp. 75 and a process for its use

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO0040607A3 *

Also Published As

Publication number Publication date
JP2010233574A (en) 2010-10-21
JP2011083295A (en) 2011-04-28
WO2000040607A2 (en) 2000-07-13
JP4707235B2 (en) 2011-06-22
JP2002538774A (en) 2002-11-19
EP1144448A3 (en) 2002-03-06
WO2000040607A3 (en) 2001-11-01
AU2409700A (en) 2000-07-24

Similar Documents

Publication Publication Date Title
JP2007289186A (en) Dna encoding dp75 and process for using the same
WO1996026215A1 (en) Ingap protein involved in pancreatic islet neogenesis
US20130102542A1 (en) Cancer related isoforms of components of transcription factor complexes as biomarkers and drug targets
US7329741B2 (en) Polynucleotides that hybridize to DP-75 and their use
USRE39062E1 (en) INGAP protein involved in pancreatic islet neogenesis
CN1747744B (en) Regeneration and neogenesis of retinal photoreceptor cell using otx2 gene
US5905146A (en) DNA binding protein S1-3
JP2011083295A (en) Tiam2 (t-cell lymphoma invasion and metastasis 2) nucleotide exchange factor
JPH10201482A (en) Calcitonin gene-related peptide receptor component factor (HOUDC44)
JP2002300891A (en) New compound
KR19990007806A (en) Conversion Growth Factor α HII
US7041497B2 (en) Nuclear factor κB inducing factor
JP2004041175A (en) Human lig-1 homolog (hlig-1)
JP4280878B2 (en) MASL1 gene
US20030113869A1 (en) Human FGF gene and gene expression products
US7309783B2 (en) Mammalian early developmental regulator gene
AU708499C (en) Ingap protein involved in pancreatic islet neogenesis
WO2003091390A2 (en) Regulation of gene expression by neuromodulators and discovery of a novel ngf-induced protein termed pincher
US20030049699A1 (en) Polypeptide (MBP1) capable of interacting with oncogenic mutants of the P53 protein
WO2001029179A2 (en) Regulation of gene expression by neuromodulators
JP2001145493A (en) Protein interacting with heat shock protein HSP47
JPH11103866A (en) New compound
JPH11507813A (en) Human amine receptor
JP2003038174A (en) Human amine receptor

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20010713

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE

AX Request for extension of the european patent

Free format text: AL;LT;LV;MK;RO;SI

XX Miscellaneous

Free format text: DERZEIT SIND DIE WIPO-PUBLIKATIONSDATEN A3 NICHT VERFUEGBAR.

PUAK Availability of information related to the publication of the international search report

Free format text: ORIGINAL CODE: 0009015

AK Designated contracting states

Kind code of ref document: A3

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE

AX Request for extension of the european patent

Free format text: AL;LT;LV;MK;RO;SI

RIC1 Information provided on ipc code assigned before grant

Ipc: 7C 12N 15/63 B

Ipc: 7C 07K 14/47 A

Ipc: 7G 01N 33/53 B

Ipc: 7C 07K 16/18 B

Ipc: 7C 12N 15/11 B

RAP1 Party data changed (applicant data changed or rights of an application transferred)

Owner name: NOVARTIS VACCINES AND DIAGNOSTICS, INC.

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20130416