EP1121427A1

EP1121427A1 - (mbp1) polypeptides capable of interacting with oncogenic mutants of the p53 protein

Info

Publication number: EP1121427A1
Application number: EP99947556A
Authority: EP
Inventors: Emmanuel Conseiller; Laurent Debussche; William Gallagher
Original assignee: Aventis Pharma SA
Current assignee: Aventis Pharma SA
Priority date: 1998-10-12
Filing date: 1999-10-12
Publication date: 2001-08-08
Also published as: US20030049699A1; AU6095899A; WO2000022120A1; JP2002527063A; CA2347121A1

Abstract

The invention concerns the field of biology and cell cycle regulation. More particularly, the invention concerns novel polypeptides capable of interacting specifically with the oncogenic forms of the p53 protein.

Description

POLYPEPTIDE (MBPl) CAPABLE OF INTERACTING WITH ONCOGENIC MUTANTS OF PROTEIN P53

The present invention relates to the field of biology and regulation of the cell cycle. More particularly, the present invention relates to novel polypeptides capable of interacting specifically with oncogenic forms of the p53 protein.

The wild-type p53 protein is involved in regulating the cell cycle and in maintaining the integrity of the cell genome. This protein, the main function of which is to activate the transcription of certain genes, is capable of blocking the cell in the G1 phase of the cell cycle when mutations appear during the replication of the genome, and d 'trigger a number of DNA repair processes. This blocking in Gl phase is mainly due to the activation of the p2I / WAFl gene. In addition, in the event of these repair processes malfunctioning or in the event of mutational events too numerous to be corrected, this protein is capable of inducing the phenomenon of programmed cell death, called apoptosis.

In this way, the p53 protein acts as a tumor suppressor, eliminating cells that are abnormally differentiated or whose genome has been damaged.

0 The p53 protein contains 393 amino acids, which define 5 functional domains (see Figure 1):

- the transcription activator domain, consisting of amino acids 1 to 73, capable of binding certain factors of the general transcription machinery such as the TBP protein. This area is also the site of a number of post-translational modifications. It is also the site of numerous interactions of the p53 protein with many other proteins and in particular with the cellular protein MDM2 or the EBNA5 protein of Epstein-Barr virus (EBV), capable of block the function of wild protein. In addition, this domain has amino acid sequences called PESTs of susceptibility to proteolytic degradation.

- the DNA binding domain, located between amino acids 73 and 315. The conformation of this central domain of p53 regulates the recognition of DNA sequences specific for the p53 protein. This area is the site of two types of alterations affecting the function of wild protein:

(i) interaction with proteins blocking the function of the p53 protein such as the 'big T' antigen of the SV40 virus or the viral proteins E6 of the HPV16 and HPV18 viruses capable of causing its degradation by the ubiquitin system. This latter interaction can only take place in the presence of the cellular protein E6ap (enzyme E3 of the ubiquitinilation cascade).

(ii) point mutations which affect the function of the p53 protein and of which almost all observed in human cancers are located in this region.

- the nuclear localization signal, consisting of amino acids 315 to 325, essential for the correct addressing of the protein in the compartment where it will exercise its main function.

- the oligomerization domain, consisting of amino acids 325 to 355. This region 325 to 355 forms a structure of type: β-sheet (326-334)-elbow (335-336) - α helix (337-355). The alterations of functions localized in this region are essentially due to the interaction of the wild protein with the different mutant forms which can lead to variable effects on the function of the wild protein.

- the regulatory domain, consisting of amino acids 365 to 393, which is the site of a certain number of post-translational modifications (glycosylations, phosphorylations, RNA binding, ...) which modulate the function of the p53 protein in a positive or negative way. This domain plays an extremely important role in modulating the activity of wild protein.

The functioning of the p53 protein can be disrupted in different ways:

- by blocking its function by a certain number of factors such as, for example, the 'big T' antigen of the SV40 virus, the EBNA5 protein of the Epstein-Barr virus, or the cellular protein MDM2.

- by the destabilization of the protein by increasing its susceptibility to proteolysis, in particular by interaction with the protein E6 of the human papillomavirus HPV16 and HPV18, which promotes the entry of p53 into the ubiquitinilation cycle. In this case, the interaction between these two proteins can only be done by the prior fixation of a cellular protein, the E6ap protein whose binding site is poorly known.

- by point mutations in the gene for the protein p53.

- by deletion of one or both alleles of p53

The last two types of changes are found in about 50% of the different types of cancer. In this regard, the mutations in the p53 proein gene listed in cancer cells affect a very large part of the gene coding for this protein, and result in variable modifications of the functioning of this protein. It can however be noted that these mutations are for the most part localized in the central part of the p53 protein which is known to be the region of contact with the specific genomic sequences of the p53 protein. This explains why most of the mutants of the p53 protein have the main characteristic of no longer being able to bind to the DNA sequences recognized by the wild-type protein and thus of no longer being able to exercise their role as transcription factor. We currently group all of these modifications into two categories:

- so-called weak mutants, the product of which is a non-functional protein, which, in the case of a mutation in only one of the two alleles, does not affect the functioning of the wild protein encoded by the other allele. The main representative of this category is the H273 mutant specific for familial Li-Fraumeni syndrome of hypersensitivity to cancerous conditions.

- dominant-oncogenic mutants, the product of which is a protein which has lost the capacity to bind to DNA and which actively participates in neoplastic transformation. Mutants in this category have lost their transactivating capacity and are more stable than wild-type protein. They are incapable of inhibiting the transformation of rat embryonic fibroblasts and they function as oncogenes by cooperating with the activated form of RAS in the transformation of rat embryonic fibroblasts (Eliyahu et al, Nature 312 (1984) 646 / Parada et al, Nature 312 (1984) 649). This behavior can be explained by two different mechanisms which are not mutually exclusive;

(i) these mutants generate a non-functional protein, which, in the case of a mutation in only one of the two alleles and by interaction with the wild-type protein, is capable of blocking the functioning thereof by the formation of mixed oligomers which are not -actives which can no longer bind to the DNA sequences specific for the wild-type protein. Such a mechanism is invoked in the case where the malignant transformation of the cells is observed after transfection of the mutants in the presence of endogenous p53.

(ii) these mutants can also exhibit a "gain in function" phenotype. Their expression in non-tumorigenic cells not expressing endogenous p53 leads to the appearance of tumors in athymic mice (Dittmer et al,

Nature Genetics 4 (1993) 42). These mutants are capable of activating the trancription of genes like MDR or PCNA having no consensus sequences recognized by p53; activation which is probably done by recruitment of transcription factors specific for mutants and which can participate in the appearance of the tumor phenotype (Chin et al, Science 255 (1992) 459; Deb et al, J. Virol. 66 (1992) 6164 ). Finally, it has recently been reported that these mutants can disturb the attachment of certain regions of DNA (MAR / SAR) to the nuclear matrix network (Mϋller et al, Oncogene 12 (1996) 1941).

Many cellular partners have been described for the p53 protein. Some interact as well with the wild and mutated conformations of the protein and others are specific for one or the other of the conformations (Iwabuchi et al, Proc. Natl. Acad. Sci. USA 91 (1994) 6098). It is conceivable that some of these 'gain of function' properties can be mediated by specific protein partners of p53 mutants, however such partners have never been identified. The identification of such partners would allow new approaches in anti-cancer therapies based on the modification or control of these interactions and on the obtaining of compounds capable of interfering in the interaction of these protein partners with the different forms of p53. The present invention satisfies this need and further provides other advantages.

In order to study this "gain in function" phenotype likely to involve protein-protein interactions specific for this type of mutant, the double-hybrid system was used to search for specific partners for the H 175 mutant, the main representative of this category of mutants. A mouse embryo cDNA library, fused to the GAL4 transactivation domain (TA) sequence, was screened in the yeast strain YCM17 using as bait protein the domain 73-393 of the H 175 mutant fused to the domain DNA binding of Gal4 (DB). This screening made it possible to isolate two cDNAs coding for two different proteins: the protein MBPl and Fibulin-2.

The interactions between these two proteins and the mutant H 175 of the protein p53 could be confirmed in mammalian cells and functional effects could be demonstrated, both on properties of the mutated form of p53 and on properties of the wild form.

The present invention therefore results from the discovery by the applicant of new polypeptides capable of interacting specifically with different forms of the p53 protein. More precisely, the present invention results from the identification, isolation and characterization of a new protein and of the corresponding gene, said protein being characterized in that it is capable of interacting specifically with the oncogenic forms of p53 and with mutants H175 and G281 in particular. This protein is called MBPl for p53 Mutant Binding Protein. The present invention also results from the demonstration that another protein, fibulin2, is capable of interacting specifically with the oncogenic forms of p53 and with the mutants H 175 and G281 in particular.

The present invention also results from the discovery of the particular properties of these new protein partners of p53 which, unexpectedly, also prove to be capable of blocking the anti-proliferative effects of the wild form of p53.

These new protein partners of p53 also exhibit a very significant synergy of action with the oncogenic mutants of p53, this synergy is exerted both for oncogenic cooperation with the activated form of the Ras protein and on the proliferative effect of the forms. mutated from p53.

In addition and independently of any interaction with p53, these polypeptides have a positive effect on cell growth. In addition, one of these partners, the MBPl protein, has the characteristics of an immortalizing oncogene by cooperating with the activated form of the Ras protein for cell transformation.

Due to the specificity and the synergistic effects of these new p53 partners with respect to certain mutated forms of p53, these polypeptides constitute a therapeutic target of choice for the treatment of cancers linked to mutations in the p53 protein.

In addition, these polypeptides, which have intrinsic oncogenic properties, constitute potential new targets for the treatment of cancer in general.

A first object of the invention therefore relates to polypeptides capable of interacting specifically with the oncogenic forms of p53. These polypeptides are further capable of stimulating cell growth and blocking the antiproliferative effects of the wild form of p53.

According to a first embodiment, these polypeptides comprise all or part of a sequence chosen from the polypeptide sequences SEQ ID No. 9 (C-terminal fragment of murine MBP1) or SEQ ID No. 16 (murine MBP1) or a derivative of these.

According to another embodiment, these polypeptides comprise all or part of a sequence chosen from the polypeptide sequences SEQ ID No. 31 (human C-terminal fragment MBPl) or SEQ ID No. 22 (human MBPl) or a derivative of those -this.

Finally according to yet another embodiment, these polypeptides comprise all or part of the polypeptide sequence SEQ ID No. 33 (C-terminal fibulin-2 murine fragment) or a derivative thereof.

Preferably, the polypeptides of the invention are represented by the polypeptide sequence SEQ ID No. 22 or its derivatives

Within the meaning of the present invention, the term derived polypeptide sequence designates any polypeptide sequence differing from the sequence considered, obtained by one or more modifications of genetic and / or chemical nature, and possessing the capacity to interact with the mutated oncogenic forms of p53 . By modification of genetic and / or chemical nature, one can hear any mutation, substitution, deletion, addition and / or modification of one or more residues. Such derivatives can be generated for different purposes, such as in particular that of modifying their properties of binding to mutated oncogenic forms of p53, or of increasing their therapeutic efficacy or of reducing their side effects, or that of conferring on them new properties. pharmacokinetics and / or biological.

In this regard, another subject of the invention relates to the polypeptide sequences which exhibit biological functions comparable to those of the polypeptides according to the invention and in particular the capacity to interact with the mutated oncogenic forms of p53 and which exhibit a degree of identity at least 80% and preferably at least 90% with the polypeptide sequence SEQ ID No 16 or the polypeptide sequence SEQ ID No 22 or the polypeptide sequence SEQ ID No 33.

Preferably, the polypeptide sequences according to the invention have at least 95% and more preferably at least 97% of identity with the polypeptide sequence SEQ ID No 16 or the polypeptide sequence SEQ ID No 22 or the polypeptide sequence SEQ ID N ° 33.

More particularly preferably, the polypeptide sequences according to the invention have at least 98% identity and more preferably at least 99% identity with the polypeptide sequence SEQ ID No. 16 or the polypeptide sequence SEQ ID No. 22 or the polypeptide sequence SEQ ID No. 33.

The term derived polypeptide sequence also includes fragments of the polypeptide sequences indicated above. Such fragments can be generated in different ways. In particular, they can be synthesized chemically, on the basis of the sequences given in the present application, using the peptide synthesizers known to those skilled in the art. They can also be synthesized genetically, by expression in a cellular host of a nucleotide sequence coding for the peptide sought. In this case, the sequence nucleotide can be prepared chemically using an oligonucleotide synthesizer, based on the peptide sequence given in the present application and the genetic code. The nucleotide sequence can also be prepared from the sequences given in the present application, by enzymatic cleavages, ligation, cloning, etc., according to techniques known to those skilled in the art, or by screening DNA libraries with elaborate probes from these sequences.

Another subject of the present invention relates to the nucleotide sequences SEQ ID No 15, SEQ ID No 21 and SEQ ID No 32 coding respectively for the polypeptide sequences presented in the sequences SEQ ID No 16, or SEQ ID No 22 or SEQ ID N ° 33.

According to a particular embodiment of the invention, the nucleotide sequences comprise all or part of the sequence SEQ ID No. 15 or SEQ ID No. 21 or their derivatives.

According to another embodiment of the invention, the nucleotide sequences comprise all or part of the nucleotide sequence SEQ ID No. 32 (cDNA corresponding to the C-term fragment of murine fibulin-2) or of its derivatives.

According to yet another mode, the nucleotide sequences comprise the sequence SEQ ID No. 23 (murine cDNA MBP1, partial sequence), or the sequence SEQ ID No. 30 (cDNA corresponding to the C-term fragment of human MBPl).

According to a preferred mode, the nucleotide sequence is represented by the sequence SEQ ID No. 21 or its derivatives.

Within the meaning of the present invention, the term derived nucleotide sequence designates any sequence different from the sequence considered due to the degeneracy of the genetic code, obtained by one or more modifications of genetic and / or chemical nature, as well as any sequence hybridizing with these sequences or fragments thereof and coding for a polypeptide according to the invention. By modification of genetic and / or chemical nature, one can hear any mutation, substitution, deletion, addition and / or modification of one or more residues.

The term derived nucleotide sequence also includes sequences homologous to the sequence considered, originating from other cellular sources and in particular from cells of human origin, or from other organisms.

In this regard, the present invention relates to any nucleotide sequence which has at least 70% identity and preferably at least 85% identity with the nucleotide sequence SEQ ID No. 21 or the nucleotide sequence SED ID No. 15 or the sequence nucleotide SEQ ID No. 32.

Preferably, the nucleotide sequence according to the invention has at least 90% and more preferably at least 93% identity with the nucleotide sequence SEQ ID No 21 or the nucleotide sequence SED ID No 15 or the nucleotide sequence SEQ ID N ° 32.

More particularly preferably, the sequences according to the invention have at least 95% and more preferably 97%, even 98% or even 99% identity with the nucleotide sequence SEQ ID N ° 21 or the nucleotide sequence SED ID N ° 15 or the nucleotide sequence SEQ ID N ° 32.

Such homologous sequences can be obtained by hybridization experiments. The hybridizations can be carried out from nucleic acid libraries, using as probe, the native sequence or a fragment thereof, under variable hybridization conditions. Another subject of the invention relates to nucleotide sequences capable of hybridizing under conditions of high stringency with the nucleotide sequences defined above.

In this regard, the term high stringency condition means that hybridization occurs if the nucleotide sequences have at least 95% and preferably at least 97% identity.

As indicated above, such sequences can in particular be used as detection probes with RNA or cDNA or genomic DNA to isolate nucleotide sequences coding for polypeptides according to the invention. Such probes generally have at least 15 bases. Preferably, these probes are at least 30 bases and can have more than 50 bases. Preferably, these probes have between 30 and 50 bases.

The nucleotide sequences according to the invention can be of artificial origin or not. They can be genomic sequences, cDNA, RNA, hybrid sequences or synthetic or semi-synthetic sequences. These sequences can be obtained for example by screening DNA libraries (cDNA library, genomic DNA library) by means of probes produced on the basis of sequences presented above. Such libraries can be prepared from cells of different origins by standard molecular biology techniques known to those skilled in the art. The nucleotide sequences of the invention can also be prepared by chemical synthesis or also by mixed methods including chemical or enzymatic modification of sequences obtained by screening of libraries. In general, the nucleic acids of the invention can be prepared according to any technique known to those skilled in the art.

Within the meaning of the present invention, the name oncogenic forms or mutated oncogenic forms of p53 denotes the dominant-oncogenic mutants, whose product is a protein that has lost the ability to bind DNA and is actively involved in neoplastic transformation. Mutants in this category have lost their transactivating capacity and are more stable than wild-type protein. Representatives of this category of p53 mutants include the mutant forms H175, G281, W248, and A143.

Another object of the present invention relates to a process for the preparation of the polypeptides according to the invention according to which a cell containing a nucleotide sequence according to the invention is cultivated, under conditions of expression of said sequence and the polypeptide produced is recovered. In this case, the part coding for said polypeptide is generally placed under the control of signals allowing its expression in a cellular host. The choice of these signals (promoters, terminators, secretory leader sequence, etc.) can vary depending on the cell host used. Furthermore, the nucleotide sequences of the invention can be part of a vector which can be autonomously replicating or integrative. More particularly, autonomously replicating vectors can be prepared using autonomously replicating sequences in the chosen host. As integrative vectors, these can be prepared, for example, by using sequences homologous to certain regions of the host genome, allowing, by homologous recombination, the integration of the vector.

The present invention also relates to host cells transformed with a nucleic acid comprising a nucleotide sequence according to the invention. The cellular hosts which can be used for the production of the peptides of the invention by the recombinant route are both eukaryotic and prokaryotic hosts. Among suitable eukaryotic hosts, there may be mentioned animal cells, yeasts, or fungi. In particular, as regards yeasts, mention may be made of yeasts of the genus Saccharomyces, Kluyveromyces, Pichia, Schwanniomyces, or Hansenula. As regards animal cells, mention may be made of insect cells (SF9 or SF21), COS, CHO, C127 cells, of neuroblastomas humans etc. Among the mushrooms, there may be mentioned more particularly Aspergillus ssp. or Trichoderma ssp. As prokaryotic hosts, it is preferred to use the following bacteria E.coli, Bacillus, or Streptomyces.

According to a preferred mode, the host cells are advantageously represented by recombinant yeast strains for the expression of the nucleic acids of the invention as well as the production of proteins derived from these.

Preferably, the host cells comprise at least one sequence or a sequence fragment chosen from the nucleotide sequences SEQ ID No 15, No 21, No 32, No 23 and No 30 for the production of the polypeptides according to the invention .

Another application of the nucleic acid sequences according to the invention is the production of antisense oligonucleotides or genetic antisenses usable as pharmaceutical agents. The antisense sequences are small oligonucleotides, complementary to the coding strand of a given gene, and therefore capable of specifically hybridizing with the transcribed mRNA, inhibiting translation into protein. The subject of the invention is therefore the antisense sequences capable of inhibiting, at least partially, the expression of polypeptides capable of interacting with p53 such as the protein MBP1 or fibulin2. Such sequences can consist of all or part of the nucleotide sequences defined above and can be obtained by fragmentation, etc. or by chemical synthesis.

The nucleotide sequences according to the invention can be used for the transfer and production in vitro, in vivo or ex vivo of antisense sequences or for the expression of proteins or polypeptides capable of interacting with the p53 protein. In this regard, the nucleotide sequences according to the invention can be incorporated into viral or non-viral vectors, allowing their administration in vitro, in vivo or ex vivo.

Another subject of the invention also relates to any vector comprising a nucleotide sequence defined above. The vector of the invention can be for example a plasmid, a cosmid or any DNA not encapsulated by a virus, a phage, an artificial chromosome, a recombinant virus etc. It is preferably a plasmid or a recombinant virus.

By way of viral vectors in accordance with the invention, mention may very particularly be made of vectors of the adenovirus, retrovirus, adeno-associated virus, herpes virus or vaccinia virus type. The present application also relates to defective recombinant viruses comprising a heterologous nucleic sequence coding for a polypeptide according to the invention.

The invention also allows the production of nucleotide probes, synthetic or not, capable of hybridizing with the nucleotide sequences defined above or of the corresponding mRNAs. Such probes can be used in vitro as a diagnostic tool, for the detection of the polypeptides according to the invention and in particular of the human MBPl protein or of fibulin 2. These probes can also be used for the detection of genetic anomalies (poor splicing, polymorphism, point mutations, etc.). These probes can also be used for the detection and isolation of homologous nucleic acid sequences coding for the polypeptides as defined above, from other cellular sources and preferably from cells of human origin. The probes of the invention generally comprise at least 10 nucleotides, preferably at least 15 nucleotides, and more preferably at least 20 nucleotides. Preferably, these probes are marked prior to their use. For this, different techniques known to those skilled in the art can be used (radioactive, enzymatic labeling, etc.).

The invention also relates to the use of nucleotide probes, synthetic or not, capable of hybridizing with the nucleotide sequences coding for the protein MBP1 for carrying out diagnostic tests for cancerous tissues, based on the detection of the level of expression. from MBPl. By way of example of nucleotide probes which can be used for this application, mention may in particular be made of the sequences SEQ ID No. 27 and SEQ ID No. 28. These nucleotide probes make it possible to detect the amplification of the expression of the protein MBPl. These probes can be RNA or DNA probes. The present invention demonstrates that an amplification of messenger RNA coding for the human MBPl protein can be detected in certain types of human tumors and in particular in the case of colon cancers. In this regard, the invention also relates to a method of diagnosing cancer comprising detecting the amplification of the expression of the gene coding for the human MBPl protein.

Another object of the invention resides in antibodies or fragments of polyclonal or monoclonal antibodies directed against a polypeptide as defined above. Such antibodies can be generated by methods known to those skilled in the art. In particular, these antibodies can be prepared by immunization of an animal against a polypeptide whose sequence is chosen from the sequences SEQ ID No. 9 (murine C-terminal MBPl fragment) or SEQ ID No. 31 (human C-terminal MBPl fragment) ) or the polypeptide sequences SEQ ID No. 22 (human MBPl) or SEQ ID No. 33 (C-term Fibulin-2 fragment) or any fragment or derivative thereof, then blood collection and isolation of antibodies. These antibodies can also be generated by preparing hybridomas according to techniques known to those skilled in the art.

A subject of the invention is also single chain ScFv antibodies derived from the monoclonal antibodies defined above. Such single chain antibodies can be obtained according to the techniques described in US Patents 4,946,778, US 5,132,405 and US 5,476,786.

The antibodies or antibody fragments according to the invention can in particular be used to inhibit and / or reveal the interaction between p53 and the polypeptides as defined above.

Another object of the present invention relates to a method of identifying compounds capable of binding to the polypeptides according to the invention. The detection and / or isolation of these compounds, can be carried out according to the following steps:

- A molecule or a mixture containing different molecules, possibly unidentified, is brought into contact with a polypeptide of the invention under conditions allowing interaction between said polypeptide and said molecule in the event that the latter has an affinity for said polypeptide, and,

- Molecules linked to said polypeptide of the invention are detected and / or isolated.

According to a particular embodiment, such a method makes it possible to identify molecules capable of opposing or blocking the activity of stimulating cell growth of the polypeptides according to the invention and in particular of the human MBPl protein or Fibulin 2 or fragments derived from these proteins. These molecules are also likely to have anti-cancer properties and to oppose the function of immortalizing oncogenes presented by MBP1 or the polypeptides derived from MBP1 which cooperate with the activated form of the Ras protein for cell transformation.

In this regard, another object of the invention relates to the use of a ligand identified and / or obtained according to the method described above as a medicament. Such Ligands are indeed capable of treating certain ailments involving a dysfunction of the cell cycle and in particular cancers.

Another object of the present invention relates to a method for identifying compounds capable of modulating or totally or partially inhibiting the interaction between the mutated oncogenic forms of p53 and the polypeptides according to the invention.

The demonstration and / or isolation of modulators or ligands capable of modulating or completely or partially inhibiting the interaction between the mutated oncogenic forms of p53 and the polypeptides according to the invention, can be carried out according to the steps following:

- Linking a mutated form of p53 or a fragment thereof to a polypeptide according to the invention is carried out; it may be mutated forms of p53 such as H175, G281, W248, or A143 or a fragment thereof, it is preferably the H 175 form or also the G281 form.

- adding a compound to be tested for its ability to inhibit the binding between the mutated form of p53 and the polypeptides according to the invention;

- It is determined whether the mutated form of p53 or the polypeptides according to the invention are displaced from the bond or prevented from binding;

- Detecting and / or isolating the compounds which prevent or which hamper the connection between the mutated form of p53 and the polypeptides according to the invention.

In a particular embodiment, this method of the invention is suitable for the detection and / or isolation of agonists and antagonists of the interaction between the mutated forms of p53 and the polypeptides of the invention. Still according to a particular mode, the invention provides a method of identifying molecules capable of block the interaction between mutated forms of p53 and human MBPl protein or human fibulin 2. Such a method makes it possible to identify molecules capable of opposing the effects of the action of the polypeptides according to the invention with the mutated forms of p53. In particular, such compounds are capable of preventing oncogenic cooperation between the MBP1 protein and the oncogenic mutant forms of p53 such as in particular H 175.

In this regard, another object of the invention relates to the use of a ligand or of a modulator identified and / or obtained according to the method described above as a medicament. Such ligands or modulators are indeed capable of treating certain ailments involving a dysfunction of the cell cycle and in particular of cancers.

The invention also provides non-peptide or non-exclusively peptide compounds which can be used pharmaceutically. It is indeed possible, from the active protein motifs described in the present application, to produce molecules inhibiting the interaction of MBP1 or fibulin2 with the oncogenic mutated forms of p53, these molecules being not exclusively peptide and compatible with pharmaceutical use. In this regard, the invention relates to the use of a polypeptide of the invention as described above for the preparation of non-peptide, or not exclusively peptide, pharmacologically active molecules, by determination of the structural elements of this polypeptide which are important for its activity and reproduction of these elements by non-peptide or not exclusively peptide structures. The invention also relates to pharmaceutical compositions comprising one or more molecules thus prepared.

The subject of the invention is also any pharmaceutical composition comprising as active principle at least one ligand obtained according to one and / or the other of the methods described above, and / or at least one antibody or antibody fragment, and / or an antisense oligonucleotide, and / or a non-exclusively peptide compound as described above.

The compositions according to the invention can be used to modulate the interaction of the mutated oncogenic forms of p53 with the MBP1 or Fibulin 2 polypeptides and therefore can be used to modulate the proliferation of certain cell types. More particularly, these pharmaceutical compositions are intended for the treatment of diseases involving a dysfunction of the cell cycle and in particular for the treatment of cancers. These are in particular cancers associated with the presence of oncogenic mutants of p53.

Other advantages of the present invention will appear on reading the examples which follow and which should be considered as illustrative and not limiting.

Legend of Figures

Figure 1: Functional domains of the wild-type p53 protein. TA: Field activating transcription; DNB: DNA binding domain; NLS: nuclear location signal; OL: domain of oligomerization; REG: regulatory domain.

Figure 2: Interaction between the protein C-mbpl and the proteins p53 and H 175 in mammalian cells.

Figure 3: Interaction between the protein C-fibulin2 and the proteins p53 and H 175 in mammalian cells.

Figure 4: Comparison of protein sequences encoded by mMBPl (murine) and hMBPl (human) cDNAs.

Figure 5: Comparative effects of the proteins C-mbpl and murine MBPl on growth cell of tumor cells.

Figure 6: Expression of mRNA coding for the protein MBPl in mice.

Figure 7: Expression of mRNA coding for the protein MBPl in different human tissues.

Figure 8: Expression of messenger RNA encoding the human MBPl protein in colon tumors.

Example 1 Construction of the Different Nucleotide Fragments Required for Screening

1-a - Construction of the cDNA encoding human wild-type p53

The human p53 gene was cloned by an amplification chain reaction

(PCR) on DNA from a human placenta bank (Clontech) using oligonucleotides 5'-1 and 3'-393.

Oligonucleotide 5'-l (SEQ ID No. 1): AGATCTGTATGGAGGAGCCGCAG

Oligonucleotide 3'-393 (SEQ ID N ° 2):

AGATCTCATCAGTCTGAGTCAGGCCCTTC

This product was then cloned directly after PCR into the vector pCRII (Invitrogen).

1-b - Construction of cDNAs coding for the various mutated forms of human p53 lb. (i) - Construction of the cDNA coding for the H 175 mutant of human p53

The cDNA carrying a point mutation on amino acid 175 of the human p53 protein (Arginine -> Histidine) was obtained by site-directed mutagenesis on the p53 DNA (described in example 1-a) using the Amersham kit. , using the oligonucleotide H 175 of sequence:

Oligonucleotide H 175 3 '(SEQ ID No. 3): GGGGCAGTGCCTCAC This fragment was designated H 175.

1-b. (ii) - Construction of the cDNA encoding the mutant W248 of human p53

The cDNA carrying a point mutation on amino acid 248 of the human p53 protein (Arginine -> Tryptophan) was obtained by site-directed mutagenesis on the p53 DNA (described in example 1-a) using the Amersham kit. , using the oligonucleotide W248 of sequence:

Oligonucleotide W248 3 '(SEQ ID No. 4): GGGCCTCCAGTTCAT This fragment was designated W248.

1-b (iii) - Construction of the cDNA encoding the H273 mutant of human p53

The cDNA carrying a point mutation on amino acid 273 of the human p53 protein (Aspartate -> Histidine) was obtained by site-directed mutagenesis on the p53 DNA (described in example 1-a) using the Amersham kit. , using the oligonucleotide H273 of sequence: Oligonucleotide H273 3 '(SEQ ID No. 5):

ACAAACATGCACCTC This fragment was designated H273.

1-b (iv) - Construction of the cDNA coding for the mutant G281 of human p53

The cDNA carrying a point mutation on amino acid 281 of the human p53 protein (Asparagine -> Glycine) was obtained by site-directed mutagenesis on the p53 DNA (described in example 1-a) using the Amersham kit. , using the oligonucleotide G281 of sequence:

Oligonucleotide G281 3 '(SEQ ID No. 6): GCGCCGGCCTCTCCC

This fragment was designated G281.

1-c - Construction of the cDNAs coding for the fragments 73-393 of wild human p53 and of the mutant H175

1-c (i) - Construction of the cDNA coding for the fragment 73-393 of wild human p53

This example describes the construction of a cDNA encoding amino acids 73 to 393 of the wild-type human p53 protein (73-393wt).

This cDNA was obtained by amplification chain reaction (PCR) on the p53 DNA (described in example 1-a) with the oligonucleotide 3 '-393 (SEQ ID No. 2) and the oligonucleotide 5'-73 next:

5'-73 (SEQ ID N ° 7): AGATCTGTGTGGCCCCTGCACCA 1-c (ii) - Construction of the cDNA coding for the fragment 73-393 of the mutant H175

This example describes the construction of a cDNA coding for amino acids 73 to 393 of the H 175 mutant of the human p53 protein (73-393H 175).

This cDNA was obtained by amplification chain reaction (PCR) on the DNA of the mutant (described in example 1-b) with the oligonucleotides 3 '-393 (SEQ ID No. 2) and 5'-73 (SEQ ID N ° 7).

EXAMPLE 2 Construction of the Expression Vectors in Yeast of the 73-393 t and 73-393H175 Fragments Fused to the DNA Binding Domain of the Gal4 Protein and of the Different Forms of the Whole Human (Wild and Mutated) P53 to the GaI4 protein transcription activation domain

This example describes the construction of vectors allowing the expression in yeast of the fragments 73-393wt and 73-393H175 in the form of a fusion with the DNA binding domain of the protein Gal4 (DB) of yeast S. cerevisiae for their use in the double-hybrid system and for the screening of cDNA libraries fused to the transcription activation domain (transactivator) of the same Gal4 protein (TA).

2-a - Construction of the yeast expression vectors of the fragments 73-393wt and 73-393H175 fused to the DNA binding domain of the Gal4 protein

Fragments 73-393wt and 73-393H175 were cloned into the vector pPC97 (Chevray et al, Proc. Natl. Acad. Sci. USA 89 (1992) 5789) using the recognition site by the restriction enzyme Bgl II .

The products of these constructions have the following names: 73-393wt in pPC97 -> (plasmid pMAl) -> DB-wt

73-393H175 in pPC97 -> (plasmid pEC16) -> DB-H175

2-b - Construction of yeast expression vectors of the various forms of whole human p53 (wild and mutated) fused to the activation domain of the transcription of the Gal4 protein

The different forms of whole human p53 (wild and mutated) were cloned into the vector pPC86 (Chevray et al, Proc. Natl. Acad. Sci. USA 89 (1992) 5789) using the enzyme recognition site Bgl II restriction.

The products of these constructions have the following names:

p53 in pPC86 -> (plasmid pEC10) -> TA-wt

H 175 in pPC86 -> (plasmid pEC20) -> TA-H175

H273 in pPC86 -> (plasmid pEC87) -> TA-H273

G281 in pPC86 -> (plasmid pEC88) -> TA-G281

Example 3 - Cloning by the double-hybrid system of the partners of the H175 protein, and characterization of this interaction in terms of specificity in yeast

This example describes the obtaining of the H 175 protein partners by the double-hybrid system using the mouse embryo cDNA library pPC67 (Chevray et al, Proc. Natl. Acad. Sci. USA 89 (1992) 5789 ), and the characterization, using the same double-hybrid system, of these partners in terms of specificity of interaction with the different forms of the human p53 protein (wild and mutated).

3-a - Isolation of the partners of the H175 protein

3-a (i) - Genotype of the YCM17 strain The YCM17 strain used for the isolation of partners and for the characterization of their interaction with the different forms of the human p53 protein by the double-hybrid system is a yeast strain of the genus Saccharomyces cerevisiae which has the following genotype:

MATa, Agal4, Δgal80, lys2, his3, trpi, leu2, ade2, ura3, cani, metl6 :: URA3 pGALl- 10 LacZ.

This yeast strain makes it possible to detect a positive response in a double-hybrid system by the appearance of the Ura + phenotype and / or the Ura + / LacZ + double phenotype.

3-a (ii) - Genotype of the TG 1 strain

The strain TG1 used for the purification of plasmid DNAs is a strain of bacteria of the genus E.coli which has the following genotype:

supE, hsdD5, thi, D (lac-proAB), F '[tra D36 proA ⁺ B ⁺ lad ^q lacZDM15]

3-a (iii) - Construction of the YMA1 strain

The YCM17 strain was transformed by the method of Gietz et al (Yeast 11 (1995) 355) with lμg of the plasmid pMAl thus allowing the obtaining of the YMA1 strain which expresses the protein DB-H175.

3-a (iv) - Isolation of the H 175 protein partners

The YMA1 strain was transformed by the same method as that used in Example Cl.3 using lOOμg of DNA from the pPC67 library, allowing 3.5.10 ⁷ transformants to be obtained, of which 404 have the Ura + phenotype and 14 the double Ura + / LacZ + phenotype.

The plasmid DNA contained in the 14 clones having the double Ura + / LacZ + phenotype was isolated by the method of Ward (Nucl. Acids Res. 18 (1990) 5319) before being used to transform the TG1 strain. The corresponding plasmids from the library were then purified and grouped into two different subgroups of plasmids, each containing a cDNA encoding two different proteins:

- a cDNA coding for the C-terminal part (SEQ ID No. 8) of a new gene.

a cDNA coding for the C-terminal part of murine fibulin 2 (amino acids 863 to 1195 (SEQ ID No. 32)) (Pan et al, J. Cell. Biol. 123 (1993) 1269).

The proteins encoded by these two cDNAs are respectively called C-mbp 1 (mbp = 'p53 Mutant Binding Protein') and C-fibulin2, the fusion proteins with the activation domain of the transcription of Gal4 are called TA-C- mbpl and TA-C- fibulin2 and the corresponding plasmids are named TA -C-MBP 1 and TA-C-FIB2

3 - b - Characterization of the interaction between the proteins C-mbpl and C-fibulin2 and the protein H175 in yeast

3 - b (i) - Characterization of the specificity of the interaction between the protein

DB-H175 and the proteins TA-C-mbpl and TA-C-fibulin2

In order to test the specificity of the interactions described in Example 3-a (iv), the plasmids pPC86, TA-C-MBP1 and TA-C-FIB2 were reintroduced into the strain YCM17 by co-transformation with different plasmids : the plasmid pPC97 coding for the protein DB, the plasmid pMAl coding for the protein DB-H175, the plasmid pECIO coding for the protein DB-wt and the plasmid pPC76 coding for a fusion protein between the DNA link domain of the Gal4 protein and a fragment of the human Fos protein (amino acids 132 to 211) (Chevray et al, Proc. Natl. Acad. Sci. USA, 89 (1992) 5789) (DB-Fos). After the co-transformation, the different clones obtained were tested for the phenotypes associated with the URA3 and LacZ genes The results of this experiment are presented in Table 1.

TA TA-C-mbpl TA-C-fibulin2

DB Ura - / LacZ- Ura - / LacZ- Ura - / LacZ-

DB-H175 Ura - / LacZ- Ura + / LacZ + Ura + / LacZ +

DB-wt Ura - / LacZ- Ura - / LacZ- Ura - / LacZ-

DB-Fos Ura - / LacZ- Ura - / LacZ- Ura - / LacZ-

Table 1: Specificity of the interaction between the DB-H175 protein and the TA-C-mbpl and TA-C-fibulin2 proteins

These results show that the interaction between the protein DB-H175 and the proteins TA-C-mbpl and TA-C-fibulin2 is specific and that such an interaction can be obtained neither with the protein DB alone, nor with the protein DB-wt ni with the DB-Fos control protein.

3-b (ii) - Construction of fusion proteins between the DNA binding domain of Gal4 and the proteins C-mbpl and C-fibulin2

The cDNAs encoding C-mbpl and C-fibulin2 were extracted from the plasmids TA-C-MBPl and TA-C-FIB2, then cloned into the vector pPC97 using the recognition sites by the restriction enzymes Sal I and Not I .

The fusion proteins with the DNA binding domain of Gal4 thus obtained are called respectively DB-C-mbpl and DB-C-fibulin2 and the corresponding plasmids DB-C-MBP1 and DB-C-FIB2. 3-b (iii) Characterization of the specificity of the interaction between DB-C-mbpl and DB-C-fibulin2 and the proteins TA-H175 and TA-G281

In order to verify that the potential interaction between the proteins C-mbpl and C-fibulin2 and the protein H 175 is not an artifact due to the fusion of one or the other of the partners with one or the other of the Gal4 domains, and to confirm the specificity of the interaction with the mutant form of the p53 protein, a new interaction experiment in yeast was carried out using fusions different from those of Example 3 -b (i).

In this experiment, the proteins DB-C-mbpl and DB-C-fibulin2 were tested against fusions of the activation domain of the transcription of Gal4 with the whole forms of the protein p53 (wild or mutant) described in the example 2-b, using a yeast strain different from the YCM17 strain, the PCY2 strain

(Chevray et al, Proc. Natl. Acad. Sci. USA 89 (1992) 5789).

The results of this experiment are presented in Table 2.

TA TA-wt TA-H175 TA-H273 TA-G281

DB LacZ - LacZ - LacZ - LacZ - LacZ -

DB-C-mbpl LacZ - LacZ - LacZ + LacZ - LacZ +

DB-C- LacZ - LacZ - LacZ -i- LacZ - LacZ + fibuline2

Table 2: Specificity of the interaction between the proteins DB-C-mbpl and DB-C- fibulin2 and the proteins TA-H175 and TA-G281

These results allow on the one hand to confirm the interaction observed during the screening. On the other hand, these results highlight the specificity of the interaction between the proteins C-mbpl and C-fibulin2 and certain mutated forms of the protein p53. Regarding this specificity, it is interesting to note, that these proteins do not interact with the H273 mutant. This mutant has a conformation equivalent to that of the wild-type p53 protein because it is recognized by the antibody PAb 1620 which is specific for the wild form and not by the antibody PAb 240 which is specific for the mutated form (Medcalf et al, Oncogene 7 (1992) 71). Thus, all of the data obtained in yeasts clearly show that the two proteins C-mbpl and C-fibulin2 are specific potential partners of the oncogenic mutants of the protein p53.

Example 4 Interaction between the proteins C-mbpl, C-fibulin2 and the different forms of the protein p53 in mammalian cells

This example describes the construction of plasmids for the expression of different proteins in mammalian cells and the characterization of the interaction between the proteins C-mbpl and C-fibulin2 and the different forms of the protein p53 in mammalian cells.

4-a Construction of the expression plasmids of the various proteins in mammalian cells

4-a (i) Construction of the expression vector pBFA 107

This example describes the construction of a vector allowing the expression in mammalian cells of proteins carrying a label derived from the protein c-myc (amino acids 410-419) and recognized by the antibody 9E10 (Oncogene Science). This construction was carried out using as base vector the mammalian expression vector pSV2, described in DNA Cloning, A practical approach Vol.2, D.M. Glover (Ed) IRL Press, Oxford, Washington DC, 1985.

The cDNA comprising the sequence coding for the c-myc tag as well as a cloning multisite (MCS) was constructed from the following 4 oligonucleotides: c-myc 5 '(SEQ ID N ° 10):

GATCCATGGAGCAGAAGCTGATCTCCGAGGAGGACCTGA c-myc 3 '(SEQ ID N ° l l):

GATCTCAGGTCCTCCTCGGAGATCAGCTTCTGCTCCATG MCS 5 '(SEQ ID N ° 12):

GATCTCGGTCGACCTGCATGCAATTCCCGGGTGCGGCCGCGAGCT MCS 3 '(SEQ ID N ° 13):

CGCGGCCGCACCCGGGAATTGCATGCAGGTCGACCGA

These four oligonucleotides have complementarities two by two (c-myc 5 '/ c-myc 3', MCS 5 '/ MCS 3') and overlapping complementarities (c-myc 3 '/ MCS 5') allowing obtaining the desired nucleotide sequence by simple hybridization and ligation. These oligonucleotides were phosphorylated using T4 kinase, then hybridized all together and inserted into the expression vector pSV2 previously digested with the restriction enzymes Bgl II and Sac I. The resulting vector is the vector pBFA 107.

4-a (ii) - Construction of the expression plasmids of the labeled proteins C-mbpl and C-fibulin2

The cDNAs coding for the proteins C-mbpl and C-fibulin2 were extracted from the plasmids TA-C-MBP1 and TA-C-FIB2 and cloned in the mammalian expression vector pBFA 107 using the recognition sites by the enzymes of restriction Sal I and Not I. The plasmids pBFA107-C-MBPl and pBFA107-C-FIB2 are thus obtained

4-a (iii) Construction of the expression plasmids of the different forms of the p53 protein The cDNA coding for the different forms of the protein p53 (wt, H 175, H273 and G281) were inserted into the expression vectors pSV2 and pcDNA3 (Invitrogen) using the recognition site by the restriction enzyme Bgl II .

4 b - Interaction between the proteins C-mbpl and C-fibulin2 and the different forms of the protein p53 in mammalian cells

This example describes the demonstration in mammalian cells of the interaction between the proteins C-mbpl and C-fibulin2 and the different forms of the protein p53. These experiments were carried out by transient transfection and co-immunoprecipitation in H1299 cells (tumor cells of the 'Non Small Cell Lung Cancer' type) deficient for the two alleles of the p53 protein (Mitsudomi et al, Oncogene 1 (1992) 171). .

The cells (10 ⁶ ) are seeded in 10 cm diameter petri dishes containing 8 ml of DMEM medium (Gibco BRL) added with 10% of heat-inactivated fetal calf serum, and cultured overnight in an incubator co. (5%) at 37 ° C. The different constructions are then transfected using lipofectAMINE (Gibco BRL) as transfection agent in the following manner: 6 μg of total plasmid (3 μg of each plasmid coding for each of the two partners) are incubated with 20 μl of lipofectAMINE (Gibco BRL) for 30 min with 3 ml of Opti-MEM medium (Gibco BRL) (transfection mixture). During this time, the cells are rinsed twice with PBS and then incubated for 4 h at 37 ° C. with the transfection mixture, after which the latter is aspirated and replaced with 8 ml of DMEM medium supplemented with 10% fetal calf serum. heat inactivated and cells returned to grow at 37 ° C.

Twenty four hours after transfection, the cells are washed once in

PBS then scraped, washed again twice in PBS and resuspended in 200 μl of lysis buffer (HNTG: Hepes 50 mM pH 7.5, 150 mM NaCl, 1% Triton X-100, 10% glycerol) added with protease inhibitors (Aprotinin 2 μg / ml, pepstatin 1 μg / ml, leupeptin 1 μg / ml, E64 2 μg / ml and Pefabloc 1 mM), incubated 30 min at 4 ° C and centrifuged 15 min at 15,000 φm and 4 ° C. The cell extract thus obtained is subjected to a “pre-clearing” step by incubation for 1 hour at 4 ° C. with 16 μl of a pre-immune rabbit serum, then 30 min at 4 ° C. with 200 μl of immunoprecipitin (Gibco BRL) prepared according to the supplier's recommendations. Subsequently, the cell extract thus cleaned is separated into 3 equal batches, each of which is incubated overnight at 4 ° C. with a different anticoφs; 3 μg of anticoφs 9E10 (anti myc), 1 μg of anticoφs DO1 (anti p53) (Oncogene Science) and 1 μg of anticoφs PAb416 (anti SV40 T-Ag used as anticoφs control) (Oncogene Science). This mixture [cell extract / anticoφs] is then added with 30 μl of immunoprecipitin and incubated for 30 min at 4 ° C. before being centrifuged for 30 sec at 15,000 φm. The pellet containing the immunoprecipitin is then washed twice with 1 ml of HNTG buffer supplemented with protease inhibitors, then resuspended in 30 μl of deposition buffer on acrylamide gel (Laemmli, Nature 227 (1970) 680) and incubated 5 min at 95 ° C. After 15 sec centrifugation at 15,000 φm, the supernatants are deposited on polyacrylamide gel in denaturing medium (Novex) and the proteins separated using the XCell II migration system (Novex) according to the supplier's recommendations, then transferred to the PVDF membrane ( NEN Life Science Products) using the same XCell I system

Anticoφs 9E10 and DO1 used for revealing the transferred proteins are coupled to biotin LCnHS (Pierce) according to the supplier's recommendations.

The transfer membranes are firstly incubated for 1 h at 4 ° C. in 10 ml of TTBSN buffer (20 mM Tris-HCl, pH 7.5, 150 mM NaCl, 0.02% NaN ₃ , Tween 20 0.1 %) supplemented with 3% serum bovine albumin (BSA) (TTBSN-BSA), then 2 h at room temperature with 10 ml of a TTBSN-BSA solution containing the biotinylated anticoφs 9E10 (1 μg / ml). After 6 washes with 10 ml of TTBSN buffer, the membranes are then incubated for 1 h at room temperature with 10 ml of a TTBSN-BSA solution containing ExtrAvidin-Peroxidase (Sigma Immuno Chemicals) at l / ^e 5000, again washed 6 times TTBSN and treated with ECL reagent (Amersham) for the revelation of proteins by chemiluminescence. The same membranes are then treated with the biotinylated DOl anticoφs after having been previously dehybridized (Ellis et al, Nature 343 (1990) 377) and following the same protocol as for the anticoφs 9E10.

4 - b (i) - Interaction between the protein C-mbpl and the different forms of the protein p53 in mammalian cells

In this example, the H 1299 cells were transfected with the following combinations of plasmids before immunoprecipitation and Western-blot:

pBFA107 / pBFA107-C-MBPl (3 μg) + pSV2 / pSV2-p53 (wild or mutant)

(3 μg)

In addition, the following combination serving as a control was carried out: pBFA107-Sam68 (3 μg) + pSV2-H175 (3 μg)

This control is used to examine whether or not H 175 can interact either with the myc tag or with a fusion between the myc tag and any protein, the protein Sam68 described by Lock et al (Cell 84 (1996) 23), n not supposed to interact with the different forms of the p53 protein.

The results of this experiment which are presented in Figure 2 show that: - the protein C-mbpl can interact with the protein H 175 in mammalian cells

- this interaction is very specific for the C-mbpl protein because the H 175 protein does not interact with the myc-Sam68 control 4-b (ii) - Interaction between the protein C-fibulin2 and the different forms of the protein p53 in mammalian cells

pBFA107 / pBFA107-C-FIB2 (3 μg) + pSV2 / pSN2-p53 (wild or mutant) (3 μg)

The results of this experiment which are presented in FIG. 3 show that the protein C-fibulin2 can interact specifically with the protein H 175 in mammalian cells.

The general conclusion of these experiments is that the proteins C-mbpl and C-fibulin2 are capable of interacting specifically in mammalian cells with the protein H175. These results as well as those obtained in yeast (example 3) are in agreement with:

1 / classification of mutants of the p53 protein:

- H 175 and G281: oncogenic dominants

- H273: weak mutant 2 / classification of the different forms of the p53 protein in terms of conformation and recognition by conformational anticoφs:

- H 175 and G281: mutant conformation, PAb 1620 - / PAb 240 +

- p53 and H273: wild conformation, PAb 1620 + / Pab 240 -

All of these data show that the proteins C-mbpl and C-fibulin2 interact with the forms of the p53 protein exhibiting a mutated conformation, and that they are capable of having an effect on specific functions of the mutated forms of the protein p53.

In addition, from the literature, it is known that a fraction of the p53 protein can exhibit a mutant conformation in mammalian cells, in particular: 1 / the p53 protein, capable of binding to DNA (Hupp et al, Nucl. Acids Res. 21 (1993) 3167), can adopt a mutant conformation when it binds to DNA (Halazonetis et al, EMBO J. 12 (1993) 1021)

2 / the p53 protein can adopt two different conformations during the cell cycle; the so-called 'suppressor' conformation (wild conformation, PAb 1620 + / PAb 240 -) and the so-called 'promoter' conformation (mutant conformation, PAb 1620 - / PAb 240 +) (Milner & Watson, Oncogene 2 (1990) 1683).

It can therefore be assumed that the proteins C-mbpl and C-fibulin 2 are also capable of having an effect on specific functions of the wild form of the protein p53.

Example 5 Effect of the C-mbpl Protein on Oncogenic Cooperation Between the H175 Protein and the Ras-Vall2 Protein

This example describes the effects of the protein C-mbpl on a property of the oncogenic mutant H 175, its capacity to cooperate with the mutated form of the proto-oncogene Ras (Ras-Val 12) in the oncogenic transformation of rat embryonic fibroblasts Fibroblasts rat embryos (REF) were prepared from rats

OFA (IFA-CREDO) according to the method described by C. Finlay (Methods in Enzymology 255 (1995) 389). After thawing, the cells (1.5 × 10 °) are seeded in 10 cm diameter petri dishes containing 8 ml of DMEM medium (Gibco BRL) supplemented with 10% fetal calf serum and grown overnight in an incubator at CO, (5%) at 37 ° C, then are transfected with the various mixtures of plasmids (21 μg of DNA) using the CellPhect reagent (Pharmacia) according to the supplier's recommendations. 24 hours after the end of the transfection, the cells contained in each of the dishes are scraped and then reseeded on three 10 cm petri dishes and cultured for 15 days before being stained with violet crystal according to the protocol described by C. Finlay ( Methods in Enzymology 255 (1995) 389). The transformation centers are then visualized and counted.

The plasmids used during this series of experiments are the following:

- buffer plasmid: pSG5 (Stratagene) - expression plasmid of the Ras-Vall2 protein: pEJ-Ras (Shih & Weinberg,

Cell 29 (1982) 161)

- expression plasmid of the whole c-myc protein: pSVc-mycl (Land et al, Nature 304 (1983) 596)

- expression plasmid for the H 175 protein: pSV2-H175 (example 4-a (iii)) - expression plasmid for the C-mbpl protein: pBFA107-C-MBPl (example 4-a

(ϋ))

Each transfection point contains a mixture of three plasmids at a rate of 7 μg of each plasmid. The results of two independent experiments are reported in Table 3.

Experience 1 Experience 2

control 0 0

Ras-Vall2 0 0 c-myc 0 NT

H175 0 NT

C-mbpl 0 NT

Ras-Val 12 + c-myc 1 1 1 16 *

Ras- Val 12 + c-myc + C-mbp 1 113 12 *

Ras-Vall2 + H175 0 16

Ras-Val 12 + C-mbpl 0 3

Ras- Val 12 + H 175 + C-mbp 1 13 30

Table 3. Effect of the C-mbpl protein on oncogenic cooperation between the H 175 protein and the Ras-Val 12 protein (NT: not tested, *: experiment carried out with

3 μg of plasmid pSVc-mycl)

The results of these experiments show that:

- C-mbpl can cooperate with the activated form of Ras for the transformation of REF

- there is a synergy between the H 175 proteins and C-mbpl in oncogenic cooperation with Ras which is specific to this association because C-mbpl has no effect on oncogenic cooperation Ras / c-myc.

Example 6 Effect of the C-mbpl and C-fibulin2 Proteins and Relationship with the Effects of the Different Forms of the P53 Protein on the Cell Growth of Tumor Cells This example describes the effects of the proteins C-mbpl and C-fibulin2 on the cell growth of tumor cells and their relationship with the effects of the different forms of the protein p53 on this same cell growth.

These effects of the proteins C-mbpl and C-fibulin2 on cell growth were tested on the cell line H 1299 in an experiment to form colonies resistant to neomycin following transfection with plasmids expressing these proteins.

These transfection experiments were carried out according to the protocol described in Example 4-b using 10 ⁵ cells per point and 1.5 μg of total DNA.

The plasmids used during this series of experiments are the following:

- p53 and H175 protein expression plasmids: pSV2-p53 and pSV2-H175.

- C-mbpl protein expression plasmid: pBFA107-C-MBPl (example 4-a (ii))

- C-fibulin2 protein expression plasmid: pBFA107-C-FIB2 (example 4-a

(ϋ)) - plasmid conferring resistance to neomycin: pSV2-Neo for a total amount of 0.4 μg

Protocol for forming colonies resistant to neomycin: 48 hours after transfection, the cells are scraped and transferred to 2 Petri dishes of 10 cm in diameter and re-cultured with 10 ml of DMEM medium supplemented with 10% inactivated fetal calf serum with heat and containing 400 μg / ml of geneticin (G418). After a selection of 15 days in the presence of G418, the number of Neo- - colonies is determined by counting after staining with fuchsin.

The results of these experiments are reported in Tables 4 and 5. Number of colonies resistant to Neomycin

Protein expressed Experience 1 Experience 2 Experience 3 average

Vector 36 (1.00) 52 (1.00) 73 (1.00) 1.00

C-mbpl lOOng 45 (1.25) 49 (1.06) 69 (0.95) 1.09

C-mbpl 500ng 51 (1.42) 71 (1.37) 1 10 (1.51) 1.43

C-mbpl lOOOng 70 (1.94) 83 (1.60) 160 (2.19) 1.90

wild p53 lOOng 7 (0.19) 12 (0.23) 10 (0.14) 0.19

C-mbpl lOOng 6 (0.17) 14 (0.27) 8 (0.11) 0.18

C-mbpl 500ng 19 (0.53) 28 (0.54) 23 (0.32) 0.46

C-mbpl lOOOng 32 (0.89) 50 (0.96) 51 (0.70) 0.85

p53 wild 200ng 2 (0.06) 5 (0.10) 8 (0.11) 0.08

C-mbpl lOOng 2 (0.06) 4 (0.08) 6 (0.08) 0.08

C-mbpl 500ng 5 (0.14) 8 (0.15) 16 (0.22) 0.17

C-mbpl lOOOng 9 (0.25) 20 (0.38) 28 (0.38) 0.35

H175 lOOng 41 (1.14) 47 (0.90) 61 (0.84) 0.96

C-mbpl lOOng 33 (0.92) 65 (1.25) 70 (0.96) 1.04

C-mbpl 500ng 67 (1.86) 101 (1.94) 123 (1.68) 1.83

C-mbpl lOOOng 162 (4.50) 128 (2.46) 316 (4.33) 3.76

H175 200ng 39 (1.08) 60 (1.15) 66 (1.10) 1.1 1

C-mbpl lOOng 43 (1.19) 54 (1.04) 75 (1.03) 1.10

C-mbpl 500ng 59 (1.64) 129 (2.48) 163 (2.23) 2.12

C-mbpl lOOOng 131 (3.64) 282 (5.42) 299 (4.10) 4.39

Table 4: Effect of the protein C-mbpl on the cell growth of tumor cells Number of colonies resistant to Neomycin

Protein expressed Experience 1 Experience 2 Experience 3 average

Vector 36 (1.00) 52 (1.00) 73 (1.00) 1.00

C-fibulin2 lOOng 35 (0.97) 56 (1.08) 80 (1.10) 1.05

C-fibulin2500ng 48 (1.33) 68 (1.31) 102 (1.40) 1.35

C-fibulin2 lOOOng 60 (1.67) 87 (1.67) 194 (2.66) 2.00

wild p53 lOOng 7 (0.19) 12 (0.23) 10 (0.14) 0.19

C-fibulin2 lOOng 10 (0.28) 11 (0.21) 13 (0.18) 0.22

C-fibulin2500ng 15 (0.42) 30 (0.58) 26 (0.36) 0.45

C-fibulin2 lOOOng 35 (0.97) 44 (0.85) 45 (0.62) 0.81

p53 wild 200ng 2 (0.06) 5 (0.10) 8 (0.11) 0.09

C-fibulin2 lOOng 3 (0.08) 6 (0.12) 6 (0.08) 0.09

C-fibulin2500ng 4 (0.11) 10 (0.19) 16 (0.22) 0.16

C-fibulin2 lOOOng 10 (0.28) 18 (0.35) 28 (0.38) 0.34

H175 lOOng 41 (1.14) 47 (0.90) 61 (0.84) 0.96

C-fibulin2 lOOng 47 (1.31) 54 (1.04) 84 (1.15) 1.17

C-fibulin2500ng 84 (2.33) 95 (1.83) 156 (2.14) 2.10

C-fibulin2 lOOOng 143 (3.97) 138 (2.65) 270 (3.70) 3.44

H175200ng 39 (1.08) 60 (1.15) 66 (1.10) 1.11

C-fibulin2 lOOng 51 (1.42) 63 (1.21) 80 (1.10) 1.24

C-fibulin2500ng 74 (2.06) 146 (2.81) 142 (1.95) 2.27

C-fibulin2 lOOOng 158 (4.39) 230 (4.42) 284 (3.89) 4.23

Table 5: Effect of the protein C-fibulin2 on the cell growth of tumor cells

The results of these experiments show that:

- the proteins C-mbpl and C-fibulin2 have a positive effect on cell growth

- the proteins C-mbpl and C-fibulin2 are capable of blocking the antiproliferative effect of the protein p53, and this independently of their proliferative effect - the proliferative effect of the proteins C-mbpl and C-fibulin2 is greatly increased in the presence of the protein H 175

Example 7 - Cloning of cDNAs encoding the whole form of the murine and human MBP1 proteins.

This example describes the cloning of cDNAs encoding the whole murine MBP1 protein and the use of these data for the cloning of a human MBP1 homolog.

7 a - Cloning of the cDNA coding for the entire form of the murine mbpl protein

The cDNA coding for the C-terminal part of the murine mbpl protein was cloned by amplification chain reaction (PCR) on the DNA of the murine embryo SuperScript library (8.5 days) (Gibco BRL) using the oligonucleotide 3'-mMBP1 and the oligonucleotide SP6 (Gibco BRL).

Oligonucleotide 3'-mMBPl (SEQ ID N ° 14): CGGTACTGGCAGAGGTAACTGG

This amplification made it possible to obtain a single product having a size of approximately 800 base pairs which was then cloned directly after PCR into the vector pCRII (Invitrogene) and sequence. The sequence thus obtained (SEQ ID No. 23) shows an overlap of 368 base pairs with C-MBP 1 (SEQ ID No. 8) with a strict sequence identity on this common part. In addition, in 5 ′ of this common part, there is an additional sequence of 445 base pairs having an open reading phase and a translation initiation codon.

The two fragments represented by these sequences were then combined by a three-partner ligation using the recognition sites by the restriction enzymes EcoR I, Pst I and Not I and the plasmid pBC-SK + (STRATAGENE) thus allowing the reconstitution of the whole murine MBPl cDNA (mMBPl) (SEQ ID N ° 15).

7-b Cloning of the cDNA coding for the whole form of the human mbpl protein

The murine MBPl gene sequence was used for a homology search in Genbank. This research made it possible to show a strong homology with the sequence of a human EST (gl 548384). From this sequence, two cDNA fragments were cloned by amplification chain reaction (PCR) on the DNA of the SuperScript library of human testis (Gibco BRL) using the oligonucleotides 3'-hMBPl and SP6 ( Gibco BRL) on the one hand, and the oligonucleotides 5'-hMBPl and T7 (Gibco BRL) on the other hand.

Oligonucleotide 3'-hMBPl (SEQ ID No. 17): CTCCGCTCCGAGGTGATGGTC

Oligonucleotide 5'-hMBP 1 (SEQ ID No. 18):

TGTAGCTACTCCAGCTACCTC

These amplifications made it possible to obtain two products having sizes of approximately 1100 and 700 base pairs which were then cloned directly after PCR in the vector pCRII (Invitrogene) and sequences. The sequences thus obtained (SEQ ID No. 19 and SEQ ID No. 20) show an overlap of 325 pairs with a strict sequence identity on this common part.

The two fragments represented by these sequences were then combined by a three-partner ligation using the recognition sites with the restriction enzymes EcoR I, Nco I and Not I and the plasmid pBC-SK + (STRATAGENE) thus allowing the reconstitution of whole human MBP1 cDNA (hMBP1) (SEQ ID No. 21) having an open reading phase and a translation initiation codon. The comparison of the protein sequences corresponding to the cDNAs previously obtained (Examples 7-a and 7-b) (Figure 4) shows a strict identity of 95% in the assumed open reading phase (after the translation start site (ATG) Assumed). On the other hand, an absence of identity and a very poor homology are observed between the regions located upstream from this putative translation start site (ATG). These data therefore make it possible to confirm this position as the start of translation and thereby that these two cDNAs code well for the whole forms of the human (SEQ ID No. 22) and murine (SEQ ID No. 16) MBPl proteins.

7 - c Construction of expression plasmids in mammalian cells of the murine and human forms of the mbpl protein

The cDNAs coding for the murine and human forms of the protein MBPl contained in the vector pBC SK +, were inserted into the expression vectors pSV2 and pcDNA3 (Invitrogen) using the recognition sites by the restriction enzymes Hind III and Not I.

Example 8 Comparative Effects of the C-mbpl and Murine Mbpl Proteins on the Cell Growth of Tumor Cells

This example describes the compared effects of the proteins C-mbpl and murine mbpl on the cell growth of tumor cells and their relationship with the effects of the protein H 175 on this same cell growth.

These effects of the murine mbpl protein on cell growth were tested on the H 1299 cell line in an experiment to form colonies resistant to neomycin following transfection with plasmids carrying the cDNAs coding for these proteins.

These transfection experiments were carried out according to the protocol described in Example D2 using 10 ⁵ cells per point and 1.5 μg of total DNA. The plasmids used during this series of experiments are the following:

- H175 protein expression plasmid: pSV2-H175.

- C-mbpl protein expression plasmid: pBFA107-C-MBPl (example 4-a (ii))

- Murine mbpl protein expression plasmid: pSV2-mMBPl (example 7-c)

- plasmid conferring resistance to neomycin: pSV2-Neo for a total amount of 0.4 μg

The neomycin resistant colony formation protocol used is that described in Example 6. The results of this experiment are presented in Table 6 and Figure 5.

Number of colonies resistant to Neomycin

Protein expressed Experiment 1 Experiment 2

Vector 61 (1.00) 71 (1.00)

C-mbpl lOOng 67 (1.10) C-mbpl 500ng 96 (1.57) C-mbpl lOOOng 278 (4.56) 239 (3.37)

mbpl lOOng 94 (1.54) mbpl 500ng 128 (2.10) mbpl lOOOng 419 (6.87) 562 (7.92)

H175 200ng 65 (1.07) 69 (0.97)

C-mbpl lOOng 72 (1.18) C-mbpl 500ng 134 (2.20) C-mbpl lOOOng 397 (6.51) 341 (4.80)

mbpl lOOng 81 (1.33) mbpl 500ng 206 (3.38) mbpl lOOOng 729 (1 1.95) 1215 (17.11) Table 6: Comparative effects of the proteins C-mbpl and murine mbpl on the cell growth of tumor cells

The results of this experiment show that the murine mbpl protein has the same characteristics as the C-mbpl protein, namely a positive effect on cell growth which is greatly increased in the presence of the H175 protein.

In addition, this effect of the protein mbp 1 is very strongly increased compared to the truncated protein C-mbpl.

Example 8a Oncogenic Cooperation of the C-mbpl and Murine Mbpl and Human mbpl Proteins with the Ras-Vall2 Protein

This example describes the compared effects of the proteins C-mbpl, murine mbpl and human mbpl in an experiment of oncogenic cooperation with the Ras-Vall2 protein.

This oncogenic cooperation was tested on rat embryonic fibroblasts following transfection with plasmids carrying the cDNAs coding for these proteins and according to the protocol described in Example 5.

The results of this experiment are presented in Table 7.

Experience Experience 2

control

Ras-Vall2 0 0 c-myc 0 0

H175 0 0

C-mbpl 0 0 mbpl 0 0

Ras-Vall2 + c-myc 31 42

Ras-Vall2 + H175 10 15 Ras-Vall2 + C-mbpl 4 4 Ras-Vall2 + murine mbpl 5 7 Ras-Vall2 + human mbpl 6 6

Table 7: Oncogenic cooperation of the C-mbpl, murine mbpl and human mbpl proteins with the Ras-Vall2 protein

The results of this experiment show that the murine and

Human MBPl have the same characteristics as the C-mbpl protein, namely the ability to cooperate with the Ras-Vall2 protein for the transformation of rat embryonic fibroblasts.

Interestingly, it is also noted that the fibroblasts thus transformed have a very particular moφhological aspect which differs from that obtained with the oncogene c-myc.

Example 9 Expression of the MBPl Protein in Mice and in Human Tissues This example describes the study of the expression of the messenger RNA of MBP1 in mice and in various human tissues.

9-a Preparation of the probes

The mMBPl and hMBPl probes consist of the corresponding cDNAs.

The GAPDH probe (control) was generated by amplification chain reaction (PCR) on the DNA of the SuperScript library of human testis (Gibco BRL) (GAPDH) using the following oligonucleotides:

Sense oligonucleotide-GAPDH (SEQ ID No. 24):

CGGAGTCAACGGATTTGGTCGTAT

Antisense-GAPDH oligonucleotide (SEQ ID No. 25): AGCCTTCTCCATGGTGGTGAAGAC

The probes were radiolabeled with ³² P-dCTP using the Rediprime kit

(Amersham) and the supplier's recommendations, and the non-incoφorated nucleotides were eliminated by chromatography on MicroSpin G-25 columns (Pharmacia Biotech). The Northern blots used in this experiment were obtained from Clontech. The membranes were prehybridized with the ExpressHyb solution (Clontech) 45 minutes at 65 ° C, then incubated for 2 hours with the radiolabelled probes at 65 ° C, washed three times with 2xSSC buffer twice with 2xSSC buffer supplemented with 0.1 % of SDS and finally washed with 0.2xSSC buffer supplemented with 0.1% SDS until disappearance of the background noise. The membranes were then subjected to autoradiography and a signal quantification was carried out using an instantimager (Packard instruments).

9-b Expression of the MBPl protein in mice This example describes the study of the expression of the messenger RNA of MBP1 in mice.

The probes used in this experiment are the mMBPl and GAPDH probes. The membranes used in this experiment contain one of the mouse embryo mRNAs obtained at different stages of development, and the other of the mRNAs representative of different tissues of adult mice.

The results of this experiment (Figure 6) clearly indicate that: 1 - a unique transcript of 1.8 kb is detected both in mouse embryo mRNA and in adult mouse tissue.

2 - this messenger presents variations in expression levels during development, with a high abundance in the early stages (7 days) then a significant decrease (11 days) to reach an apparently constant level. 3 - this messenger is moderately expressed in all of the adult tissues tested, with the exception of an important expression in the lungs and the testes.

Such a high level of transcript expression in a phase of embryonic development as well as in tissues exhibiting a high growth rate, confirms the implication of the MBPl gene product in the cell growth processes demonstrated in Examples 5, 6 and 7.

9-c Expression of the MBPl protein in human tissues

This example describes the study of the expression of the messenger RNA of MBP1 in different human tissues.

The probes used in this experiment are the hMBPl and GAPDH probes. The membranes used contain mRNAs representative of different human tissues. The results of this experiment (Figure 7) clearly indicate that:

1 - two 1.5 and 1.8 kb transcripts are detected in human tissue.

2 - these messengers are moderately expressed in all of the tissues tested and their expression profile is comparable to that of the murine messenger (strong expression in the lungs and testes).

These results show that:

- there may exist two different forms of the human mbpl protein with the possibility of alternative splicing of the messenger.

- the mRNAs coding for the human protein (s) mbp 1 as well as their murine counterpart exhibit a high level of expression in tissues with a high growth rate, and that the product (s) of the human MBPl gene could therefore also be involved in cell growth processes.

The results presented in the various examples show that the proteins C-mbpl, MBPl and C-fibulin2 interact specifically with the mutant forms of the protein p53 and that these interactions lead to synergy between these proteins and the oncogenic mutants of the protein p53 that either for oncogenic cooperation with the activated form of the Ras protein or for the proliferative effect.

In addition, the proteins C-mbpl, MBP1 and C-fibulin2 exhibit an intrinsic proliferative activity, and the protein C-mbpl acts as an immortalizing oncogene by cooperating with the activated form of the protein Ras for cell transformation.

The results presented in the various examples show that the proteins or polypeptides C-mbpl, MBPl and C-fibulin2 interact specifically with the mutant forms of the p53 protein and that these interactions lead to synergy between these proteins and the oncogenic mutants of the protein. p53 whether for the oncogenic cooperation with the activated form of the Ras protein or for the proliferative effect.

In addition, the proteins C-mbpl, MBPl and C-fibulin2 exhibit an intrinsic proliferative activity, and the proteins C-mbpl and MBPl act as immortalizing oncogenes by cooperating with the activated form of the protein Ras for cell transformation.

These properties give MBPl a potential role as an oncogene. In at least one of the tests (Example 8a), the MBP1 protein has increased oncogenic properties compared to the c-MBP 1 polypeptide.

Finally, the strong homology presented by the human and murine MBPl proteins (95% strict identity), and the similarity in tissue expression of their respective messengers, allow us to conclude that the human MBPl protein, which could be present in the form of two different variants (2 distinct messengers), has (s) properties similar to those of its murine counterpart.

In conclusion, these results describe the characterization of a new murine protein, MBPl, and of its human homolog (s), which has oncogenic properties and which interacts specifically with the mutated forms of the p53 protein. This interaction, which results in an increase in the oncogenic properties of MBP1, could constitute a fundamental element of the oncogenic capacity of these mutants of the p53 protein.

Such properties also seem to be shared by another protein exhibiting homologies with MBP1, fibulin 2. This protein being part of a larger family, it is conceivable that these properties could be extended to all members of the family of fibulins. These interactions showing a strong synergy between the oncogenic powers of the proteins MBPl, fibulin2 and mutants p53, they constitute a potential point of action in the treatment of cancers linked to mutations of the protein p53. Of moreover, the proteins MBPl and fibulin2 which have intrinsic oncogenic properties constitute potential targets for the treatment of cancer in general.

Example 10 Chromosomal Location of the Human MBPl Gene

The chromosomal localization of the MBPl gene was carried out according to a four-step protocol (Lichter et al, Science 247 (1990) 64) (Heng et al, Chromosoma 102 (1993) 325) (Kischkel et al, Cytogenet. Cell Genêt. 82 (1998) 95): - labeling of the cDNA with biotin by nick-translation

- hybridization on normal human metaphases (high resolution technology)

- revelation by fluorescein

- visualization and inteφretation on epifluorescence microscope

This hybridization study of the MBPl probe on human metaphases was carried out by analysis of 30 mitoses and showed the presence of a double spot on the long arms (q arm) of the two chromosomes 1 1 in 1 lql3. Interestingly, this region of chromosome 11 has been associated with a large number of pathologies:

- Mac Ardle's disease (Lebo et al, Science 225 (1984) 57)

- Usher syndrome type 1B (Weil et al, Nature 374 (1995) 60)

- type I endocrine neoplasia (Teh et al, J. Intern. Med. 238 (1995) 249)

- Best dystrophy (Graff et al, Genomics 24 (1994) 425) - insulin-dependent diabetes (Davies et al, Nature 371 (1994) 130)

- spinocerebellar ataxia 5 (Ranum et al, Nature Genêt. 8 (1994) 280)

- Bardet-Biedl syndrome (Leppert et al, Nature Genêt. 7 (1994) 108)

- osteoporosis (Gong et al, Am. J. Hum. Genêt. 59 (1996) 146)

In addition, this region of chromosome 11 is also the site of amplification events associated with different solid tumors (esophagus, head and neck, bladder, breast and lung) (Lammie & Peters, Cancer Cells 3 (1991) 413).

The MBPl gene could therefore not only be associated with a certain number of cancers but also with a large number of pathologies presenting disorders of renal, neurodegenerative, bone and other types. Among these pathologies, we can cite in particular: acute renal deficiencies such as those associated with Mac Ardle's disease, retinis pigmentosa and certain forms of blindness and deafness such as those associated with Usher syndrome type 1B, hyperthyroidism such as form associated with endocrine neoplasia type I, pathologies linked to a defect in retinal pigmentation such as those encountered in Best's dystrophy, insulin-dependent diabetes, neurodegenerative pathologies such as those associated with cerebrospinal ataxia 5, retinal dystrophies, kidney disorders such as the forms encountered in Bardet-Biedl syndrome, and osteoporosis.

Example 11 Expression of the Messenger RNA Encoding the Human MBPl Protein in Colon Tumors

This example describes a semi-quantitative analysis of the expression of the messenger RNA coding for the human protein MBPl, carried out in parallel on 9 colon tumors and 9 samples of healthy tissue (colon) from the same patients.

The samples were frozen at -70 ° C immediately after resection and the total RNA was prepared by homogenization of 100 mg of tissue using the RNA NOW solution (Ozyme) and the protocol recommended by the supplier. Subsequently, a cDNA synthesis was carried out using the First-Strand cDNA Synthesis kit (Amersham Pharmacia Biotech) using 1.5 μg of total RNA and according to the supplier's recommendations. Then the MBPl and β-actin (control) genes were amplified by PCR using an amount of cDNA for which the level of PCR product is directly correlable with the concentration of substrate and the following cycle program: 1 cycle 2min at 95 ° C

30 cycles 30sec at 94 lmin at 45 ° C lmin at 72 ° C

1 cycle 3min at 72 ° C

The oligonucleotides used for these amplifications are the following

Sense oligonucleotide-MBPl (SEQ ID No. 27) GCCCTGATGGTTACCGCAAGA

Antisense-MBPl oligonucleotide (SEQ ID No. 28) AGCCCCCATGGAAGTTGACAC

Sense-β-actin oligonucleotide (SEQ ID No. 29) GTGGGGCGCCCCAGGCACCA

Antisense-β-actin oligonucleotide (SEQ ID No. 26)

CGGTTGGCCTTGGGGTTCAGGGGGGG

The PCR products thus generated were then analyzed by electrophoresis on 1% agarose gel.

The results presented in FIG. 8 clearly show that the messenger RNA coding for the human MBPl protein is amplified in five of the tumors studied in comparison with the healthy tissue originating from the same patient, regardless of the grade of the tumor and independently of their status regarding the Ras and p53 genes.

The results of this example therefore show that an amplification of the messenger RNA coding for the human MBPl protein can be detected in certain types of human tumors and therefore underline a potential role of the protein MBPl in the appearance and / or the development of these tumors.

Claims

1. A polypeptide capable of interacting specifically with oncogenic forms of p53, of stimulating cell growth and of blocking the antiproliferative effects of the wild form of p53.

2. Polypeptide according to claim 1, characterized in that it comprises all or part of a sequence chosen from the polypeptide sequences SEQ ID No. 9 or SEQ ID No. 16 or a derivative thereof.

3. Polypeptide according to claim 1, characterized in that it comprises all or part of a sequence chosen from the polypeptide sequences SEQ ID No. 31 or SEQ ID No. 22 or a derivative thereof.

4. Polypeptide according to claim 1, characterized in that it comprises all or part of the polypeptide sequence SEQ ID No. 33 or a derivative thereof.

5. Polypeptide according to claim 3, characterized in that it is represented by the polypeptide sequence SEQ ID No. 22.

6. Nucleotide sequence coding for a polypeptide as defined according to one of claims 1 to 5.

7. Nucleotide sequence according to claim 6 characterized in that it comprises all or part of the sequence SEQ ID No. 15 or of SEQ ID No. 21 or their derivatives.

8. Nucleotide sequence according to claim 6 characterized in that it comprises all or part of the nucleotide sequence SEQ ID No. 32 or its derivatives.

9. Nucleotide sequence according to claim 6 or 7 characterized in that it comprises the sequence SEQ ID No. 15 or the sequence SEQ ID No. 30.

10. Nucleotide sequence according to claim 6, 7 or 9 characterized in that it is represented in SEQ ID No. 21.

11. Host cell for the production of polypeptide according to one of claims 1 to 5, characterized in that it has been transformed with a nucleic acid comprising a nucleotide sequence according to one of claims 6 to 10.

12. Method for preparing a polypeptide according to one of claims 1 to 5 characterized in that a cell containing a nucleotide sequence according to one of claims 6 to 10 is cultured under conditions of expression of said sequence and recovering the polypeptide produced.

13. Expression cassette comprising a nucleotide sequence coding for a polypeptide according to one of claims 6 to 10.

14. Vector comprising a nucleotide sequence according to one of claims 6 to 10.

15. Vector according to claim 14 characterized in that it is a plasmid vector, a cosmid or any DNA not packaged by a virus.

16. Vector according to claim 14 characterized in that it is a recombinant virus, and preferably a recombinant virus defective for replication.

17. Antisense oligonucleotide of a sequence according to claim 7 to 10 capable of at least partially inhibiting the production of polypeptides according to one of claims 1 to 5.

18. Nucleotide probe capable of hybridizing with a nucleotide sequence according to one of claims 7 to 10 or the corresponding mRNA.

19. Anticoφs or fragment of anticoφs directed against a polypeptide according to one of claims 1 to 5.

20. Anticoφs or fragment of anticoφs according to claim 19 characterized in that it is directed against a sequence chosen from the peptide sequences presented in SEQ ID No 9 or SEQ ID No 33 or SEQ ID No 31 or SEQ ID N ° 22.

21. Anticoφs or fragment of anticoφs according to claim 19 or 20 characterized in that it has the ability to prevent the interaction between the oncogenic forms of p53 and a polypeptide according to one of claims 1 to 5.

22. Method for highlighting or identifying compounds capable of binding with a polypeptide as defined according to one of claims 1 to 5, characterized in that the following steps are carried out: a - contact a molecule or a mixture containing different molecules, possibly unidentified, with a polypeptide as defined according to one of claims 1 to 5 under conditions allowing the interaction between said polypeptide and said molecule in the case where the latter would have an affinity for said polypeptide, and, b - detecting and / or isolating the molecules linked to said polypeptide.

23. Method for highlighting or identifying compounds capable of modulating or inhibiting the interaction between the oncogenic forms of p53 and a polypeptide according to one of claims 1 to 5, characterized in that one the following steps are carried out: a - the oncogenic form of p53 or a fragment thereof is bonded with said polypeptide; a compound to be tested is added for its capacity to inhibit the bond between the oncogenic form of p53 and said polypeptide,

- determining the displacement or inhibition of the bond between the oncogenic form of p53; - Detecting and / or isolating the compounds which prevent or which hamper the bond between the oncogenic form of p53 and said polypeptide;

24. Ligand of a polypeptide as defined in claims 1 to 5, capable of being obtained according to the method of claim 22.

25. A ligand capable of modulating or inhibiting the interaction between the oncogenic forms of p53 and a polypeptide as defined according to claims 1 to 5, capable of being obtained according to the method of claim 23.

26. Use of a ligand according to claim 24 or 25 for the preparation of a medicament intended for the treatment of diseases involving a dysfunction of the cell cycle.

27. Use of a polypeptide capable of interacting with the mutated oncogenic forms of p53 and comprising all or part of a peptide sequence chosen from the sequences SEQ ID No 9, No 33, No 31, or No 22 or a derivative thereof, according to one of claims 1 to 5 for the production of a non-peptide or non-exclusively peptide compound capable of interacting with the oncogenic mutated forms of p53, by determination of the structural elements of this polypeptide which are important for its activity and reproduction of these elements by non-peptide or non-exclusively peptide structures.

28. Pharmaceutical composition comprising as active principle at least one anticoφs or fragment of anticoφs according to one of claims 19 to 21, and / or a Antisense oligonucleotide according to claim 17 and / or a ligand according to one of claims 24 or 25 and / or a compound according to claim 27.

29. A composition according to claim 28 intended for the treatment of diseases involving a dysfunction of the cell cycle.

30. Composition according to claim 29 intended for the treatment of cancers.