KR20010104373A - Promotion or Inhibition of Angiogenesis and Cardiovascularization - Google Patents

Abstract

Compositions and methods for stimulating or inhibiting angiogenesis and / or cardiovascular formation in mammals, including humans, are disclosed. Diseases that can be diagnosed, prevented or treated with the composition of the present invention include trauma such as wound, various cancers, and vascular diseases including atherosclerosis and cardiac hypertrophy. The invention also relates to novel polypeptides and nucleic acid molecules encoding the polypeptides. The present invention further provides vectors and host cells comprising the nucleic acid sequences, chimeric polypeptide molecules comprising the polypeptides of the invention linked to a heterologous polypeptide sequence, antibodies that bind to the polypeptides of the invention, and methods of producing the polypeptides of the invention .

Description

[0002] Promotion or Inhibition of Angiogenesis and Cardiovascularization [

A. Heart Disease and Factors

About 5 million Americans are suffering from heart failure, and about 400,000 new cases of heart failure occur annually. Heart failure is the single most common cause of hospitalization in the United States over the age of 65. Recently, the progressive management of acute heart disease, including acute myocardial infarction, has led to the expansion of the patient population that will eventually develop into chronic heart failure. From 1979 to 1995, hospitalization for congestive heart failure (CHF) increased from 377,000 to 872,000 (130% increase), and CHF deaths increased by 116%.

CHF is a syndrome characterized by decreased left ventricular function, reduced exercise tolerance, impaired quality of life, and very shortened life span. A prerequisite for heart failure is that the heart can not pump blood at a rate sufficient to meet the metabolic demands of the body tissue (in other words, insufficient cardiac output).

In elevating cardiac output in patients with heart failure, at least four major complementary mechanisms are activated, including peripheral vasoconstriction, increased heart rate, increased cardiac shrinkage, and increased plasma volume. These effects are mediated primarily by the sympathetic and the renin-angiotensin system (Eichlorn, American Journal of Medicine, 104: 163-169 (1998)). Increased release from the sympathetic nervous system increases vascular tone, heart rate and contractility. Angiotensin II stimulates vascular smooth muscle contraction, stimulates aldosterine and antidiuretic hormone secretion, promotes expansion of plasma volume, stimulates sympathetic-mediated vasomotor tone, and 4) Blood pressure is elevated by catalyzing the breakdown of Bradykinin, which exhibits sodium diuretic activity (see Review by Brown and Vaughan, Circulation. 97: 1411-1420 (1998)). As noted below, angiotensin II has a direct adverse effect on the heart by promoting myocardial necrosis (impaired contractility) and intracardiac fibrosis (impaired relaxation and, in some cases, impaired contractility) (Weber, Circulation, 96: 4065-4082 (1998)).

A consistent feature of congestive heart failure (CHF) is heart relaxation, which is activated by cardiac hypertrophy, mechanical and hormonal stimuli, allowing the heart to adapt to increased cardiac output requirements (Morgan and Baker. Circulation, 83 : 13-25 (1991)). This hyperactivity is often associated with a variety of pathological conditions, all of which lead to chronic hemodynamic overload, such as hypertension, aortic stenosis, myocardial infarction, cardiomyopathy, plaque reflux and intracardiac shorts.

Hypertrophy is defined as an increase in the size of a period or structure, unlike natural proliferation, which generally does not involve tumor formation. Hypertrophy of the heart is due to an increase in the mass of individual cells (myocytes), or an increase in the number of cells constituting the tissue (hyperplasia), or both. Embryo cardiac relaxation primarily depends on an increase in the number of myocytes (which lasts until birth), whereas myocardial cells lose proliferative capacity. Additional proliferation occurs through hyperplasia of individual cells.

Hypertrophy of mature muscle cells is initially beneficial as a short-term response to impaired cardiac function as it reduces the load on individual muscle fibers. However, long-term severe overloading causes the non-enlarged cells to begin to degenerate and eventually die (Katz, "Heart Failure", in AM ed., Physiology of the Heart (New York: Raven Press, 668). Hypertrophic cardiomyopathy is a significant risk factor affecting mortality and morbidity in the clinical course of heart failure (Katz, Trends Cardiovasc. Med., 5: 37-44 (1995)). For more information on the cause and pathology of cardiac hypertrophy, see, for example, Heart Disease A Textbook of Cardiovascular Medicine, Braunwald, E. ed. (WB Saunders Co., 1998), Chapter 14, Pathophysiology of Heart Failure ").

At the cellular level, the heart is composed of muscle cells and peripheral supporting cells, commonly called non-myocytes. Non-myocytes are mainly fibroblast / mesenchymal cells, but also endothelial cells and smooth muscle cells. In fact, even though myocytes constitute most mature myocardial masses, they account for only about 30% of the total number of cells in the heart. Mature ventricular myocytes can adapt to increased overload through activation of hypertrophic processes in response to hormone stimulation, physiological stimulation, hemodynamic stimulation, and pathological stimulation. This response is characterized by simultaneous cell division, increased muscle cell size and increased contractile protein content of individual myocardial cells without the activation of embryonic genes, including genes for atrial sodium renal peptide (ANP) (Chien et al. FASEB J., 5: 3037-3046 (1991); Chien et al., Annu. Rev. Physiol., 55: 77-95 (1993)). The increase in myocardial mass as a result of an increase in muscle cell size associated with the accumulation of epileptic collagen in the extracellular matrix and around the coronary arteries in the myocardium has been reported in human left ventricular hypertrophy due to pressure overload (Caspari et al., Cardiovasc Hess et al., Circulation 63: 360-371 (1981); < RTI ID = 0.0 > Pearlman et al., Lab Invest., 46: 158-164 (1982)).

In addition, it has been suggested that the secretory factors produced by cells supporting non-myocytes may also be involved in the development of ectopic hypertrophy, and the hypertrophic factors produced from various non-myocytes (for example, leukocyte inhibitory factor Endothelin was also identified (Metcalf, Growth Factors, 7: 169-173 (1992); Kurzrock et al., Endocrine Reviews, 12: 208-217 (1991); Inoue et al., Proc. Natl. USA, 86: 2863-2867 (1989); Yanagisawa and Masaki, Trends Pharm. Sci., 10: 374-378 (1989); U.S. Patent No. 5,573,762 (published Nov. 12, 1996)). Exemplary additional factors identified as potential mediators of cardiac hypertrophy include cardiotropin-1 (CT-1) (Pennica et al., Proc. Nat. Acad. Sci. USA, 92: 1142-1146 (1995) , Catecholamines, adrenocorticosteroids, angiotensin, and prostaglandins.

Currently, treatment of cicatricial hypertrophy varies according to the cause of the heart disease. Catecholamines, adrenocorticosteroids, angiotensin, prostaglandins, LIF, endothelin (including endothelin-1, -2 and -3 and bigendothelin), and CT-1 are factors identified as potential mediators of hyperplasia. For example, a beta-adrenergic receptor blocking drug (beta-blocker such as propranolol, timolol, tertarolol, carthorol, nadolol, betasol, penbutolol, acetobutanol, Noreol, metoprolol and carvedilol) and verapamil have been widely used in the treatment of hypertrophic cardiomyopathy. The beneficial effects of beta-blockers on symptoms (eg, chest pain) and exercise tolerance are mainly due to a decrease in heart rate and consequently an extension of the diastole and increased passive ventricular filling (Thompson et al., Br. Heart J., 44: 488-98 (1980); Harrison et al., Circulation., 29: 84-98 (1964)). Verapamil has been reported to improve ventricular filling and reduce myocardial ischemia (Bonow et al., Circulation, 72: 853-64 (1985)).

Nifedipine and diltiazem have also been used frequently in the treatment of hypertrophic cardiomyopathy (Lorell et al., Circulation, 65: 499-507 (1982); Betocchi et al., Am. J. Cardiol., 78: 451- 457 (1996)). However, nifedipine can be harmful to patients suffering from emesis, especially due to its potent vasodilatability. Diisopiramide has been used to alleviate symptoms due to its reduced contractility (Pollick, N. Engl. J. Med., 307: 997-999 (1982)). However, in many patients, the initial effect decreases over time (Wigle et al., Circulation., 92: 1680-1692 (1995)). Antihypertensive drug therapy has been reported to have beneficial effects on hypertrophy associated with elevated blood pressure. Examples of drugs that are used alone or in combination in antihypertensive therapy include calcium antagonists, such as nitrendipine; Adrenergic receptor blockers, such as those described above; Angiotensin converting enzyme (ACE) inhibitors such as quinapril, captopril, enalapril, ramipril, benazepril, posinopril, and ricinopril; Diuretics such as chlorothiazide, hydrochlorothiazide, hydrofluorometazide, methylcothiazide, benzthiazide, dichlorophenamide, acethazolamide and indapamide; And calcium channel blockers such as diltiazem, nifedipine, verapamil and nicardipine.

For example, treatment of hypertension with diltiazem and capto pril reduced left ventricular mass and did not normalize the Doppler index of relaxation function (Szlachcic et al., Am. J. Cardiol., 63: 198 -201 (1989); Shahi et al., Lancet, 336: 458-461 (1990)). This finding has been interpreted to indicate that excessive epileptic collagen may remain after degeneration of left ventricular hypertrophy (Rossi et al., Am. Heart J., 124: 700-709 (1992)). Rossi et al. Investigated the effect of capto prill on the prevention and degeneration of myocardial hypertrophy and epileptic fibrosis in hypertensive hypertrophic rats.

Materials that directly increase cardiac shrinkage (shiatsu festival) are believed to be effective initially in patients with heart failure because they improve cardiac output in the short term. However, all muscle contraction enhancers except for digoxigenin have been shown to increase long-term mortality even if they improve cardiac function in the short term (Massie, Curr. Op. In Cardiology, 12: 209-217 (1997) ; Reddy et al., Curr. Opin. Cardiol., 12: 233-241 (1997)). Recently, beta-adrenergic receptor blockers have been recommended for use in heart failure. The reported improvement in patient survival has not yet been proven, but studies of clinical trials have shown that cardiac function can be improved without increasing mortality. Further, the use of cardiotropin-1 or its antagonist, or proliferating hormone and / or insulin-like growth factor-I in the treatment of CHF is disclosed in U.S. Patent Nos. 5,935,924, 5,624,806, 5,661,122, 5,610,134 and WO 95/28173. Another treatment method is heart transplantation, but this is limited by the availability of the donor heart.

Endothelin is a vasoconstrictor peptide comprising 21 amino acids, which has been structurally identified and isolated from the endothelial cell culture supernatant of porcine artery (Yanagisawa et al., Nature, 332: 411-415 (1988)). Endothelin was later shown to exhibit various actions, and endothelin antibodies as endothelin antagonists have proven effective in the treatment of myocardial infarction, renal failure and other diseases. Because endothelin is present in vivo and exhibits vasoconstriction, it is expected to be an endogenous factor involved in the regulation of the circulatory system and may be associated with kidney diseases such as hypertension, cardiovascular diseases such as myocardial infarction, and acute renal failure have. Endothelin antagonists are described, for example, in U.S. Patent Nos. 5,773,414; Japanese Patent Application Laid-Open No. 3130299/1991; European Patent No. 457,195; European Patent No. 460,679; And European Patent 552,489. New endothelin B receptors for identifying endothelin receptor antagonists are described in U.S. Patent No. 5,773,223.

Current therapies for heart failure include the use of angiotensin-converting enzyme (ACE) inhibitors and diuretics, principally captoprir. These drugs improve the hemodynamic profile and exercise tolerance and reduce the morbidity and mortality of patients with CHF (Kramer et al., Circulation, 67 (4): 807-816 (1983); Captopril Multicenter Research Group, JACC, 2 (4): 755-763 (1983): The CONSENSUS Trial Study Group, N. Engl. J. Med., 316 (23): 1429-1435 (1987); The SOLVD Investigators, N. Engl. J Med., 325 (5): 293-302 (1991)). In addition, the drugs are useful for treating hypertension, LV dysfunction, atherosclerotic vascular disease, and diabetic nephropathy (Brown and Vaughan, supra). However, despite the proven efficacy, the response to ACE inhibitors is limited. For example, ACE inhibitors seem to slow the progression toward terminal heart failure while prolonging survival in the treatment of heart failure, but a significant number of patients treated with ACE inhibitors suffer from functional class III heart failure.

In addition, improvements in functional and exercise time are minor and mortality rates are still high, albeit reduced (CONSENSUS Trial Study Group, N. Engl. J. Med., 316 (23): 1429-1453 (1987); The SOLVD Investigators, N. Engl. J. Med., 325 (5): 293-302 (1991); Cohn et al., N. Engl. J. Med., 325 (5): 303-310 (1991) Digoxin Multicenter Research Group, JAMA, 259 (4): 539-544 (1988)). Therefore, ACE inhibitors seem to be unable to relieve symptoms consistently in patients with heart failure> 60% and seem to reduce heart failure mortality by only about 15-20%. Other side effects are discussed in the above references (Brown and Vaughan).

Alternatives to ACE inhibitors are indicated by specific AT1 receptor antagonists. Clinical studies are planned to compare the efficacy of these two methods in the treatment of cardiovascular and renal diseases. However, animal model data suggest that the ACE / Ang II pathway is clearly not involved in hypercardia, but is not the only or major pathway that is active in hypercardia. A mouse genetic " knockout " model was created to test the individual components of the pathway. In the above model, in which AT < RTI ID = 0.0 > sub-1A < / RTI > is genetically deleted, the major cardiac receptor for Ang II, these mice did not develop asymptomatic when given Ang II (Experimental, Model). However, when the aorta is contracted in these animals (a hypertensive heart stress model), the heart is still hypertrophied. This suggests that a separate signaling pathway independent of the receptor (ATs sub-1A) is activated in hypertension. ACE inhibitors may not be able to inhibit these pathways (see Harada et al., Circulation, 97: 1952-1959 (1998)). Also, see Homcy, Circulation, 97: 1890-1892 (1998) for a riddle associated with the process and mechanism of hypercardia.

Approximately 750,000 patients have acute myocardial infarction (AMI) annually, and approximately one-quarter of all deaths in Americans is AMI. Recently, thrombolytic agents, such as streptokinase, urokinase and, in particular, plasminogen activator (t-PA) have significantly increased the survival rate of patients with myocardial infarction. When t-PA is administered with continuous intravenous infusion over 1.5 hours to 4 hours, t-PA exhibits coronary openness at 90 minutes to 69% to 90% of treated patients (Topol et al., Am. J. Cardiol., 61, 723-728 (1988); Neuhaus et al., J. Am. Coll. Cardiol., 12: 581-587 (1988); , 14: 1566-1569 (1989)). The highest open rates have been reported in high dose or accelerated dosing regimens (Topol et al., J. Am. Coll. Cardiol., 15: 922-924 (1990)). In addition, t-PA can be administered tj as a single bolus, but is more suitable for vascular therapy because of its relatively short half-life (Tebbe et al., Am. J. Cardiol., 64: 448-453 (1989) . (T103N, N117Q, KHRR (296-299) AAAA t-PA variant, Keyt et al., which is a t-PA mutant, specifically t-PA mutant designed to exhibit a longer half-life and higher fibrin specificity , Proc Natl Acad Sci USA, 91: 3670-3674 (1994)) is particularly suitable for bolus administration. However, despite all these advances, the long-term prognosis of patient survival largely depends on the post-infarction observation and treatment of patients, including the observation and treatment of hypercardia.

B. Growth factor

It has been reported that a variety of naturally occurring polypeptides induce the proliferation of endothelial cells. These polypeptides include basic and acidic fibroblast growth factor (FGF) (Burgess and Maciag, Annual Rev. Biochem., 58: 575 (1989)), platelet-derived endothelial cell growth factor (PD-ECGF) (Ishikawa et al. Nature, 338: 557 (1989)) and vascular endothelial cell proliferation factors (Leung et al., Science, 246: 1306 (1989); Ferrara and Henzel, Biochem. Biophys. Res. Commun., 161: EP 471,754B (patented on July 31, 1996), which is incorporated herein by reference in its entirety), Biochem. Biophys. Res. Commun., 165: 1198 (1989).

Medium containing cells transfected with human VEGF (hVEGF) cDNA promoted capillary endothelial cell proliferation, whereas control cells did not. (Leung et al., Science, 246: 1306 (1989)). Several additional cDNAs have been identified in cDNA libraries encoding 121-, 189-, and 206-amino acid homologues of hVEGF, collectively referred to as hVEGF-related proteins. The 121-amino acid protein differs from hVEGF in that 44 amino acids have been deleted between residues 116 and 159 of hVEGF. The 189-amino acid protein differs from hVEGF by the insertion of 24 amino acids at residue 116 of hVEGF and is clearly the same as the human vascular permeability factor (hVPF). 206-amino acid protein differs from hVEGF by insertion of 41 amino acids at residue 116 of hVEGF (Houck et al., Mol. Endocrin., 5: 1806 (1991); Ferrara et al., J. Cell Biochem., 47 264: 20017 (1991); Ferrara et al., Endocrine Reviews, 13: 18 (1989); EP 370,989 (published May 30, 1990)).

It is well established that angiogenesis associated with the formation of new blood vessels from existing endothelium is now involved in the pathogenesis of various diseases. These include solid tumors and metastases; Atherosclerosis; Posterior lens fibrosis; Hemangioma; Chronic inflammation; Proliferative retinopathy, such as diabetic retinopathy, neovascularization syndrome; Age related macular degeneration (AMD); Neovascular glaucoma; Immune rejection of transplanted corneal tissue and other tissues; Rheumatoid arthritis; And psoriasis (Folkman et al., J. Biol. Chem., 267: 10931-10934 (1992); Klagsbrun et al., Annu. Rev. Physiol., 53: 217-239 A., " Vascular Diseases ", In: Pathobiology of Ocular Disease, A Dynamic Approach, Garner A., Klintworth GK, eds., Second Edition (Marcel Dekker, NY, 1994), pp 1625-1710).

In the case of tumor growth, angiogenesis appears to play a crucial role in the transfer from abnormal proliferation to tumors and to solid tumors that multiply nutrients (Folkman et al., Nature, 339: 58 (1998)). Angiogenesis allows tumor cells to gain proliferation benefits and proliferative autonomy compared to normal cells. Thus, associations have been observed between microvessel density of tumor sections and patient survival rates in breast cancer as well as in various other cancers (Weidner et al., N. Engl. J. Med., 324: 1-6 (1991); Horak et al., Lancet, 340: 1120-1124 (1992); Macchiarini et al., Lancet, 340: 145-146 (1992)).

A number of candidates including aFGF, bFGF, TGF-α, TGF-β, HGF, TNF-α, angiogenin and IL-8 have been identified as a result of screening for positive regulators of angiogenesis (Folkman et al. JBC, and Klagsbrun et al., Supra). Probe Natl. Acad. Sci. USA., 87: 6624-6628 (1990)), the N-terminal fragment of prolactin (16-kilodalton) (O'Reily et al., Cell, 79: 315-328 (1994)) and endostatin (O'Reily et al., Cell, 88: 277-285 (1996)).

Recent studies have established a key role for VEGF in inducing vascular permeability and angiogenesis as well as stimulating vascular endothelial cell proliferation (Ferrara et al., Endocr. Rev., 18: 4-25 (1997)). The finding that even loss of a single VEGF allele is fatal to the embryo suggests an irreplaceable role for this factor in the development and differentiation of the vascular system. In addition, VEGF appears to be a key mediator of angiogenesis associated with tumor and guide disease (Ferrara et al., Endocr. Rev., supra). VEGF mRNA is overexpressed by the majority of human tumors examined (Berkman et al., J. Clin. Invest., 91: 153-159 (1993); Brown et al., Human Pathol., 26: 86-91 1995); Brown et al., Cancer Res., 53: 4727-4735 (1993); Mattern et al., Brit. J. Cancer, 73: 931-934 (1996); Dvorak et al., Am. Pathol., 146: 1029-1039 (1995)).

In addition, levels of VEGF in the eye fluid are closely related to the active proliferation of blood vessels in patients with diabetic retinopathy and other ischemia-related retinopathy (Aiello et al., N. Engl. J. Med., 331: 1480-1487 (1994)). In addition, recent studies have demonstrated localization of VEGF in the neovascular membrane of patients with AMD (Lopez et al., Invest. Ophthalmol. Vis. Sci., 37: 855-868 (1996)).

Anti-VEGF neutralization lutein inhibits the proliferation of various human tumor cell lines in nude mice (Kim et al., Nature, 362: 841-844 (1993); Warren et al., J. Clin. Invest., 95: 1789 Melnyk et al., Cancer Res., 56: 921-924 (1996)), a guide in the model of ischemic retinal disease (Borgstrom et al., Cancer Res., 56: 4032-4039 But also inhibits angiogenesis (Adamis et al., Arch. Ophthalmol., 114: 66-71 (1996)). Therefore, anti-VEGF monoclonal antibodies or other inhibitors of VEGF activity are likely to be agents for the treatment of solid tumors and various angiogenic angiogenesis diseases. Such antibodies are described, for example, in European Patent No. 817,648, published Jan. 14, 1998, and PCT / US98 / 06724, filed Apr. 3,

There are a number of other growth factors and mitogens, including transgenic oncogenes, that can rapidly induce a set of genes expressed by some cells (Lau and Nathans, Molecular Aspects of Cellular Regulation, 6: 152- 202 (1991)). These genes, called immediate-early genes or early-response genes, are transcriptionally activated within minutes after contact with proliferating factors and mitogens, independent of new protein synthesis. These immediate-early gene families encode extracellular secretory proteins necessary for the regulation of various biological processes such as differentiation and proliferation, regeneration, and wound healing (Ryseck et al., Cell Growth Differ., 2: 233-235 )).

Highly related proteins belonging to this family include cef 10 (Simmons et al., Proc. Natl. Acad. Sci. USA, 86: 1178-1182 (1989)); Cyr 61 (O'Brien et al., Mol. Cell Biol., 10: 3569-3577 (1990)) which is rapidly activated by serum or platelet-derived growth factor (PDGF); (TGF-beta), secreted at a high concentration by human vascular endothelial cells, exhibit PDGF -like biological and immunological activity, and have a specific cell surface receptor ( fisp- 12 (Ryseck et al. (Bradham et al., J. Cell. Biol., 114: 1285-1294 (1991)), which compete with PDGF against human fibroblast growth factor (FGFR), Cell Growth Differ., 2: 235-233 Human vascular IBP-like growth factor (VIGF) (WO 96/17931), and nov , normally found in mature kidney cells, which have been found to be overexpressed in myeloproliferative-associated-virus- (Joloit et al., Mol. Cell Biol., 12: 10-21 (1992)).

Expression of these immediate-early genes acts as a " third messenger " in a stepwise chain reaction caused by the proliferative factor. The gene also integrates complex biological processes such as differentiation and wound healing, It is thought necessary to adjust.

As an additional mitogen, insulin-like growth factor binding protein (IGFBP) has been shown to stimulate increased binding of fibroblasts and smooth muscle cell surface receptors to IGF as a combination with insulin-like growth factor (IGF) (Clemmons et al. J. Clin. Invest., 77: 1548 (1986)). Inhibitory effects of IGFBP on various IGF actions in vitro include stimulation of glucose transport by adipocytes, sulphate incorporation by chondrocytes, and thymidine incorporation in fibroblasts (Zapf et al., ≪ RTI ID = 0.0 > Clin. Invest., 63: 1077 (1979)). In addition, an inhibitory effect of IGFBP on proliferative factor-mediated mitogen activity was demonstrated in normal cells.

C. Necessity for additional treatment

In view of the role of vascular endothelial cell proliferation and angiogenesis in many diseases and disorders, it is desirable to have a method of reducing or inhibiting one or more biological effects that cause these processes. In addition, there is a preferred method for detecting the presence of pathogenic polypeptides in normal and diseased states, and particularly in cancer. In addition, in a particular aspect, since there is no generally applicable treatment for the treatment of myocardial hypertrophy, identification of factors capable of preventing or reducing myocardial cell hypertrophy has been identified in the development of novel therapies that inhibit pathophysiological cardiac proliferation Secondly, it is important. There are many treatments for various cardiovascular and tumor diseases, but additional treatments are still needed.

SUMMARY OF THE INVENTION [

A. Embodiment

Accordingly, the present invention relates to compositions and methods for promoting or inhibiting angiogenesis and / or cardiovascular formation in a mammal. The present invention is based on the identification of proteins positively tested in a variety of cardiovascular assays to test the promotion and inhibition of some biological activities. Thus, the present protein may be used to stimulate or inhibit angiogenesis, inhibit or stimulate vascular endothelial cell proliferation, stimulate proliferation or proliferation of vascular endothelial cells, inhibit tumor growth, inhibit angiogenesis-dependent tissue proliferation, (Including prevention) of diseases that require effects such as stimulation of proliferation, inhibition of cardiac hypertrophy, and stimulation of cardiac hypertrophy, and are useful drugs for diagnosis, for example, in the treatment of congestive heart failure.

In one embodiment, the invention provides a composition comprising a PRO polypeptide as a mixture with a pharmaceutically acceptable carrier. In one aspect, the composition comprises a therapeutically effective amount of the polypeptide. In another aspect, the composition comprises a further active ingredient, a cardiovascular agent, an endothelial system agent or an angiogenesis or angiogenesis inhibitor, preferably an angiogenesis or angiogenesis inhibitor. Preferably, the composition is sterile. The PRO polypeptide may be administered in the form of a liquid pharmaceutical formulation that can be preserved to enhance storage stability. Preserved liquid pharmaceutical formulations may contain multiple doses of the PRO polypeptide and may therefore be suitable for repeated use.

In a further embodiment, the invention provides a method of preparing such a composition useful for the treatment of cardiovascular diseases, endothelial cell disorders or angiogenic diseases, comprising admixing a therapeutically effective amount of a PRO polypeptide with a pharmaceutically acceptable carrier .

In another embodiment, the invention provides a composition comprising an agonist or antagonist of a PRO polypeptide as a mixture with a pharmaceutically acceptable carrier. In one aspect, the composition comprises a therapeutically effective amount of an agonist or antagonist. In another aspect, the composition comprises an additional active ingredient, a cardiovascular agent, an endothelial system agent or an angiogenesis agent, or an angiogenesis inhibitor, preferably an angiogenesis or angiogenesis inhibitor. Preferably, the composition is sterile. The PRO polypeptide agonist or antagonist can be administered in the form of a liquid pharmaceutical formulation that can be stored to enhance storage stability. Preserved liquid pharmaceutical formulations may contain multiple doses of PRO polypeptide agonists or antagonists and may therefore be suitable for repeated use.

In a further embodiment, the invention provides a method for the manufacture of a composition useful for the treatment of a cardiovascular disease, endothelial cell disease or angiogenic disease, comprising admixing a therapeutically effective amount of a PRO polypeptide agonist or antagonist with a pharmaceutically acceptable carrier ≪ / RTI >

In another embodiment, the invention relates to a composition comprising an anti-PRO antibody in admixture with a pharmaceutically acceptable carrier. In one aspect, the composition comprises a therapeutically effective amount of the antibody. In another aspect, the composition comprises an additional active ingredient, a cardiovascular agent, an endothelial system agent or an angiogenesis agent, or an angiogenesis inhibitor, preferably an angiogenesis or angiogenesis inhibitor. Preferably, the composition is sterile. The composition may be administered in the form of a liquid pharmaceutical formulation that can be preserved to enhance storage stability. Preserved liquid pharmaceutical formulations may contain multiple doses of the anti-PRO antibody and may therefore be suitable for repeated use. In a preferred embodiment, the antibody is a monoclonal antibody, an antibody fragment, a humanized antibody or a single chain antibody.

In a further embodiment, the present invention provides a method of making such a composition useful for the treatment of cardiovascular diseases, endothelial cell disorders or angiogenic diseases, comprising admixing a therapeutically effective amount of an anti-PRO antibody with a pharmaceutically acceptable carrier to provide.

In a further aspect,

(a) a composition of matter comprising a PRO polypeptide, an agonist or antagonist thereof;

(b) a container containing the composition; And

(c) a label attached to said container, which refers to the use of said PRO polypeptide, or an agonist or antagonist thereof, which may be an antibody that binds to said PRO polypeptide, in the treatment of cardiovascular disease, endothelial cell disease or angiogenesis disease The package insert

And the like. The composition may comprise a therapeutically effective amount of the PRO polypeptide, agonist or antagonist thereof.

In another embodiment,

(a) contacting a cell with a test compound to be screened under conditions suitable for inducing a cellular response normally induced by the PRO polypeptide; And

(b) confirming induction of the cellular response to determine if the test compound is an effective agonist, wherein induction of the cellular response is an indication that the test compound is an effective agonist.

≪ RTI ID = 0.0 > a < / RTI > PRO polypeptide.

In another embodiment,

(a) contacting the cell with a test compound to be screened under conditions suitable for stimulation of cell proliferation by the PRO polypeptide; And

(b) measuring proliferation of said cells to determine if said test compound is an effective antagonist, wherein stimulation of cell proliferation is an indication that said test compound is an effective antagonist,

, ≪ / RTI > or a pharmaceutically acceptable salt thereof.

In another embodiment, the present invention provides a method of treating a subject suffering from a condition selected from the group consisting of PRO, comprising contacting a test compound with a PRO polypeptide for a sufficient period of time under conditions in which the polypeptide interacts with the test compound, and confirming that the activity of the PRO polypeptide is not inhibited A method for identifying a compound that inhibits the activity of a polypeptide is provided. In certain preferred aspects, the test compound or PRO polypeptide is attached to a solid support. In another preferred aspect, the unattached component is accompanied by a detectable label. In a preferred aspect,

(a) contacting the cells and a test compound to be screened with a PRO polypeptide in the presence of a PRO polypeptide under conditions suitable for inducing a normally induced cellular response; And

(b) confirming induction of the cellular response to determine if the test compound is an effective agonist

.

In another preferred aspect, the method comprises

a) contacting the cells with a test compound to be screened in the presence of a PRO polypeptide under conditions suitable for stimulation of cell proliferation by the PRO polypeptide; And

(b) measuring proliferation of said cells to determine if said test compound is an effective antagonist

.

In another embodiment, the present invention provides a method of identifying a compound that normally inhibits the expression of a PRO polypeptide in a cell expressing said polypeptide, wherein said method comprises contacting said cell with a test compound, Lt; / RTI > expression is inhibited. In a preferred aspect,

(a) contacting the cell with a test compound to be screened under conditions suitable to permit expression of the PRO polypeptide; And

(b) confirming the inhibition of the expression of the polypeptide

.

In a further embodiment, the invention provides a compound that inhibits the expression of a PRO polypeptide, such as a compound identified by the method.

Another aspect of the invention relates to agonists or antagonists of PRO polypeptides that may optionally be identified by the methods described above.

One type of antagonist of PRO polypeptides that inhibits one or more functions or activities of the PRO polypeptide is an antibody. Thus, in another aspect, the invention provides isolated antibodies that bind to PRO polypeptides. In a preferred aspect, the antibody is preferably a monoclonal antibody comprising a non-human complementarity-determining-region (CDR) residue and a human framework-region (FR) residue. The antibody can be labeled and attached onto a solid support. In a further aspect, the antibody is an antibody fragment, a single chain antibody, or a humanized antibody. Preferably, the antibody specifically binds to the polypeptide.

In a further aspect, the present invention provides a method of diagnosing a disease or a susceptibility to a mutation in a PRO polypeptide-encoding nucleic acid sequence, comprising identifying the presence or absence of a mutation in the PRO polypeptide nucleic acid sequence , Wherein the presence or absence of said mutation is an indication of the presence or absence of said disease or susceptibility to said disease.

In a further aspect, the present invention provides a method for determining the expression level of a PRO polypeptide in a sample comprising (a) a test sample of tissue cells obtained from a mammal and (b) analyzing the expression level of a gene encoding a PRO polypeptide in a control sample of known normal tissue cells of the same cell type A method of diagnosing cardiovascular disease, endothelial cell disease or angiogenesis disease in a mammal, wherein a higher or lower expression level of a test sample as compared to a control sample is indicative of a cardiovascular disease, endothelial cell Disease or angiogenic disease. Optionally, the expression of the gene encoding the PRO polypeptide can be confirmed by measuring the mRNA or the concentration of the polypeptide in the test sample as compared to the control sample.

In a further aspect, the present invention provides a method of diagnosing a cardiovascular disease, endothelial cell disease or angiogenesis disease in a mammal comprising detecting the presence or absence of a PRO polypeptide in a test sample of tissue cells obtained from a mammal Wherein the presence or absence of said PRO polypeptide in said test sample indicates the presence of said cardiovascular disease, endothelial cell disease or angiogenic disease in said mammal.

In a further embodiment, the invention provides a method of detecting an antibody, comprising: (a) contacting an anti-PRO antibody with a test sample of tissue cells obtained from a mammal; and (b) detecting the formation of a conjugate between said antibody and said PRO polypeptide Wherein the formation of said conjugate is indicative of the presence of a cardiovascular disease, endothelial cell disease or angiogenesis disease in a mammal, said method comprising the steps of: . The detection may be qualitative or quantitative and is performed by comparing and observing the formation of a conjugate of a control sample of a known normal tissue cell of the same cell type. The greater or lesser amount of conjugate formed in the test sample indicates the presence of a cardiovascular disease, endothelial cell disease or angiogenic disease in the mammal from which the test tissue cells are obtained. Preferably, the antibody is accompanied by a detectable label. Conjugate formation can be observed by, for example, optical microscopy, flow cytometry, fluorimetry or other techniques known in the art. The test sample is usually obtained from a subject suspected of having cardiovascular, endothelial or angiogenic diseases.

In another embodiment, the present invention provides a method for detecting the presence of a PRO polypeptide in a sample, comprising exposing a sample suspected of containing a PRO polypeptide to an anti-PRO antibody and confirming that the antibody binds to a component of the sample. Quot; < / RTI > In certain aspects, the sample comprises cells suspected of containing a PRO polypeptide, and the antibody binds to the cell. Preferably, the antibody is detectably labeled and / or attached to a solid support.

In a further aspect, the present invention provides a diagnostic kit for cardiovascular disease, endothelial cell disease or angiogenesis disease, comprising an anti-PRO antibody and carrier in a suitable package. Preferably, the kit further comprises an indicator for using the antibody to detect the presence of the PRO polypeptide. Preferably, the carrier is, for example, a buffer. Preferably, the cardiovascular disease, endothelial cell disease or angiogenic disease is cancer.

In another embodiment, the invention provides a method of treating cardiovascular, endothelial, or angiogenic diseases in a mammal comprising administering to the mammal an effective amount of a PRO polypeptide. Preferably, the disease is septicemia, trauma such as wound or burn, or cancer type. In a further aspect, the mammal is selected from the group consisting of angioplasty, an ACE inhibitor or a chemotherapeutic agent (such as a cardiovascular disease, endothelial cell disease or angiogenesis disease in the case of cancer type), cardiovascular disease, endothelial cell disease or angiogenic disease Exposure to drugs. Preferably, the mammal is a human, preferably a human at risk of developing cardiac hypertrophy, more preferably a human with myocardial infarction.

In another preferred aspect, the hypercardia is characterized by the presence of high concentration of PGF _{2 ?} . Alternatively, hypercardia may be induced by myocardial infarction, wherein preferably the administration of the PRO polypeptide is initiated within 48 hours, more preferably within 24 hours after myocardial infarction.

In another preferred embodiment, the cardiovascular disease, endothelial cell disease or angiogenesis disease is hypercardia, and the PRO polypeptide is administered with a cardiovascular agent, an endothelial system agent or an angiogenesis agent. Preferred cardiovascular, endothelial or angiogenic agents for this purpose are selected from the group consisting of antihypertensive drugs, ACE inhibitors, entothelin receptor antagonists and thrombolytic agents. In the case of administration of the thrombolytic agent, it is preferable to administer the PRO polypeptide after the administration of the agent. More preferably, the thrombolytic agent is a recombinant human tissue plasminogen activator.

In another preferred aspect, the cardiovascular disease, endothelial cell disease or angiogenic disease is cardiac hypertrophy and administers a PRO polypeptide after primary angioplasty for the treatment of acute myocardial infarction, wherein preferably said mammal is angioplasty, Or to cardiovascular, endothelial or angiogenic agents.

In another preferred embodiment, the cardiovascular disease, endothelial cell disease or angiogenesis disease is cancer, and the PRO polypeptide is administered in combination with a chemotherapeutic agent, proliferation inhibitor or cytotoxic agent.

In a further embodiment, the invention relates to a method of treating cardiovascular, endothelial or angiogenic diseases in a mammal comprising administering to the mammal an effective amount of a PRO polypeptide agonist. Preferably, the cardiovascular disease, endothelial cell disease or angiogenesis disease is hypercardia, trauma, cancer or age-related macular degeneration. It is also preferred that the mammal be administered with a human, and an effective amount of an angiogenesis or angiogenesis inhibitor, with an agonist.

In a further embodiment, the invention relates to a method of treating cardiovascular, endothelial or angiogenic diseases in a mammal comprising administering to the mammal an effective amount of a PRO polypeptide antagonist. Preferably, the cardiovascular disease, endothelial cell disease or angiogenesis disease is hypercardia, trauma, cancer or age-related macular degeneration. Also, it is preferred that the mammal be administered a human and an effective amount of an angiogenesis or angiogenesis inhibitor with an antagonist.

In a further embodiment, the invention relates to a method of treating cardiovascular, endothelial or angiogenic diseases in a mammal comprising administering to the mammal an effective amount of an anti-PRO antibody. Preferably, the cardiovascular disease, endothelial cell disease or angiogenesis disease is hypercardia, trauma, cancer or age-related macular degeneration. It is also preferred that the mammal be administered a human and an effective amount of an angiogenesis or angiogenesis inhibitor with the antibody.

In a further embodiment, the invention provides a method of treating a cardiovascular disease, endothelial cell, or endothelial cell, comprising administering to the mammal a nucleic acid molecule that encodes (a) a PRO polypeptide, (b) an agonist of a PRO polypeptide, A method of treating a mammal suffering from a disease or angiogenesis disease, wherein the agonist or antagonist is an anti-PRO antibody. In a preferred embodiment, the mammal is a human. In another preferred embodiment, the gene is administered via in vitro gene therapy. In a further preferred embodiment, the gene is contained in a vector, more preferably an adenovirus vector, an adeno-associated viral vector, a lentivirus vector or a retroviral vector.

In yet another aspect, the present invention is directed to a polypeptide that is essentially a promoter, (a) a PRO polypeptide, (b) an agonist polypeptide of a PRO polypeptide, or (c) a nucleic acid encoding an antagonist of a PRO polypeptide, , Wherein the retroviral vector is associated with a retroviral structural protein. Preferably, the signal sequence is from a mammal such as the signal sequence of a native PRO polypeptide.

In a further embodiment, the invention relates to a method of expressing a retroviral structural protein and essentially comprising a promoter, (a) a PRO polypeptide, (b) an agonist polypeptide of a PRO polypeptide, or (c) a nucleic acid encoding an antagonist of a PRO polypeptide, The present invention provides an in vitro produced cell comprising a nucleic acid construct which also comprises a retroviral vector consisting of a cell division cost signal sequence of a polypeptide, wherein said production cell is a retroviral vector which is associated with said structural protein to produce recombinant retroviral particles, The virus vector is packaged.

In another embodiment, the invention provides a method of inhibiting endothelial cell proliferation in a mammal comprising administering to the mammal an antagonist of (a) a PRO polypeptide, (b) an agonist of a PRO polypeptide, or (c) Wherein endothelial cell proliferation of said mammal is inhibited, and said agonist or antagonist may be an anti-PRO antibody. Preferably, the mammal is a human and the endothelial cell proliferation is associated with a tumor or retinal disease.

In another embodiment, the invention provides a method of stimulating endothelial cell proliferation in a mammal comprising administering to the mammal an antagonist of (a) a PRO polypeptide, (b) an agonist of a PRO polypeptide, or (c) Wherein endothelial cell proliferation of said mammal is stimulated and said agonist or antagonist may be an anti-PRO antibody. Preferably, the mammal is a human.

In another embodiment, the invention provides a method of inhibiting hyperhidrosis in a mammal comprising administering to the mammal an antagonist of (a) a PRO polypeptide, (b) an agonist of a PRO polypeptide, or (c) a PRO polypeptide Wherein the hypercholesterolemia of the mammal is inhibited and the agonist or antagonist may be an anti-PRO antibody. Preferably, the mammal is a human and the hypercardiasis is induced by myocardial infarction.

In another embodiment, the invention provides a method of stimulating hyperthyroidism in a mammal comprising administering to a mammal an antagonist of (a) a PRO polypeptide, (b) an agonist of a PRO polypeptide, or (c) a PRO polypeptide Wherein the hypercholesterolemia of the mammal is stimulated and the agonist or antagonist may be an anti-PRO antibody. Preferably, the mammal is a human suffering from congestive heart failure.

In another embodiment, the invention provides a method of inhibiting angiogenesis induced by a PRO polypeptide in a mammal comprising administering to the mammal a therapeutically effective amount of an anti-PRO antibody. Preferably, the mammal is a human, more preferably the mammal is suffering from a tumor or retinal disease.

In another embodiment, the invention provides a method of stimulating angiogenesis induced by a PRO polypeptide in a mammal comprising administering to the mammal a therapeutically effective amount of a PRO polypeptide. Preferably, the mammal is a human, and more preferably angiogenesis will promote tissue regeneration or wound healing.

In another embodiment, the invention provides a method for inhibiting endothelial cell proliferation in a mammal, comprising administering to the mammal a PRO333, PRO364, PRO877, PRO879, PRO882 or PRO885 polypeptide or agonist thereof , Wherein endothelial cell proliferation of said mammal is inhibited.

In another embodiment, the invention provides a method for stimulating endothelial cell proliferation in a mammal, comprising administering to the mammal a PRO179, PRO321, PRO840, PRO844, PRO846 PRO878 or PRO879 polypeptide or agonist thereof Wherein endothelial cell proliferation of said mammal is stimulated.

In another embodiment, the present invention provides a method for inhibiting endothelial cell proliferation in a mammal comprising administering to the mammal an antagonist of PRO179, PRO321, PRO840, PRO844, PRO846 PRO878 or PRO879 polypeptide, Wherein endothelial cell proliferation of said mammal is inhibited.

In another embodiment, the invention provides a method for stimulating endothelial cell proliferation in a mammal, comprising administering to the mammal an antagonist of a PRO333, PRO364, PRO877, PRO879, PRO882 or PRO885 polypeptide, wherein Endothelial cell proliferation of the mammal is stimulated.

In another embodiment, the present invention provides a method for inducing hypercardia of a mammal, comprising administering to the mammal a PRO205, PRO882 or PRO887 polypeptide or an agonist thereof, wherein the stem of said mammal Hypertrophy is induced.

In another embodiment, the present invention provides a method for reducing cardiac hypertrophy in a mammal, comprising administering to the mammal a PRO238, PRO878 or PRO1760 polypeptide or agonist thereof, wherein the heart of the mammal Hypertrophy is reduced.

In another embodiment, the invention provides a method for inducing hypercalcemia in a mammal comprising administering to the mammal an antagonist of a PRO238, PRO878 or PRO1760 polypeptide, wherein the hypercalcemia of the mammal is selected from the group consisting of .

In another embodiment, the present invention provides a method for reducing cardiac hypertrophy in a mammal comprising administering to the mammal an antagonist of a PRO205, PRO882 or PRO887 polypeptide, wherein the hypertrophy of the mammal is selected from the group consisting of .

In another embodiment, the invention provides a method of treating a mammal comprising administering to a mammal a therapeutically effective amount of an anti-PRO179, anti-PRO321, anti-PRO840, anti-PRO844, anti- PRO846, anti- PRO878 or anti- PRO179, PRO321, PRO840, PRO844, PRO846, PRO878 or PRO879 polypeptides wherein the angiogenesis is inhibited.

In another embodiment, the invention provides a method for stimulating angiogenesis induced by a polypeptide, comprising administering to the mammal a therapeutically effective amount of a PRO179, PRO321, PRO840, PRO844, PRO846, PRO878 or PRO879 polypeptide Wherein said angiogenesis is stimulated.

B. Additional embodiments

In another embodiment of the invention, the present invention provides an isolated nucleic acid molecule comprising a nucleotide sequence encoding a PRO polypeptide.

In one aspect, the isolated nucleic acid molecule is selected from the group consisting of: (a) a full length amino acid sequence as disclosed herein, an amino acid sequence of the invention without a signal peptide, an extracellular domain of the membrane transporter protein with or without a signal peptide, (A) a DNA molecule encoding a PRO polypeptide comprising any other specifically defined fragment of the sequence, or (b) a sequence having at least about 80% sequence identity, preferably at least about 81% sequence identity Identity, more preferably at least about 82% sequence identity, more preferably at least about 83% sequence identity, more preferably at least about 84% sequence identity, more preferably at least about 85% sequence identity, At least about 86% sequence identity, more preferably at least about 87% sequence identity, more preferably at least about 88% sequence identity, More preferably at least about 89% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 91% sequence identity, more preferably at least about 92% sequence identity, more preferably at least about 93 More preferably at least about 94% sequence identity, more preferably at least about 95% sequence identity, more preferably at least about 96% sequence identity, more preferably at least about 97% sequence identity, more preferably at least about 95% sequence identity Preferably at least about 98% sequence identity, more preferably at least about 99% sequence identity.

In another aspect, the isolated nucleic acid molecule is selected from the group consisting of: (a) the coding sequence of the full-length PRO polypeptide cDNA disclosed herein, the coding sequence of the PRO polypeptide of the present invention without the signal peptide, the extracellular region of the transmembrane PRO polypeptide with or without the signal peptide Domain, or (b) a DNA molecule comprising a coding sequence of any other specifically defined fragment of the full length amino acid sequence disclosed herein, or (b) a DNA molecule comprising at least about 80% sequence identity , Preferably at least about 81% sequence identity, more preferably at least about 82% sequence identity, more preferably at least about 83% sequence identity, more preferably at least about 84% sequence identity, more preferably at least about 85 More preferably at least about 86% sequence identity, more preferably at least about 87% sequence identity, more preferably at least about < RTI ID = 0.0 > More preferably at least about 89% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 91% sequence identity, more preferably at least about 92% sequence identity, more preferably at least about 88% sequence identity, more preferably at least about 89% sequence identity, Sequence identity, more preferably at least about 93% sequence identity, more preferably at least about 94% sequence identity, more preferably at least about 95% sequence identity, more preferably at least about 96% sequence identity, Comprises a nucleotide sequence that exhibits at least about 97% sequence identity, more preferably at least about 98% sequence identity, and more preferably at least about 99% sequence identity.

(A) a DNA molecule encoding the same mature polypeptide as that encoded by any human protein cDNA deposited in the ATCC as disclosed herein, or (b) a DNA molecule encoding a complement of said (a) DNA molecule Sequence identity, preferably at least about 81% sequence identity, more preferably at least about 82% sequence identity, more preferably at least about 83% sequence identity, more preferably at least about 84% sequence identity , More preferably at least about 85% sequence identity, more preferably at least about 86% sequence identity, more preferably at least about 87% sequence identity, more preferably at least about 88% sequence identity, More preferably at least about 89% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 91% sequence identity, More preferably at least about 93% sequence identity, more preferably at least about 94% sequence identity, more preferably at least about 95% sequence identity, more preferably at least about 96% sequence identity, More preferably at least about 97% sequence identity, more preferably at least about 98% sequence identity, more preferably at least about 99% sequence identity.

In another aspect, the present invention provides an isolated nucleic acid molecule comprising, or complementary to, a nucleotide sequence that encodes a PRO polypeptide in which the transmembrane domain has been deleted or the transmembrane domain has been inactivated, The transmembrane domain (s) of the polypeptide are disclosed herein. Therefore, soluble extracellular domains of the PRO polypeptides described herein are also contemplated.

Yet another embodiment is a PRO polypeptide coding sequence which can be used as a hybridization probe or an antisense oligonucleotide probe for a PRO polypeptide coding fragment that encodes a fragment of a PRO polypeptide encoding a polypeptide comprising a binding site for an anti- It is about his complement. The length of such nucleic acid fragments is generally at least about 20 nucleotides, preferably at least about 30 nucleotides, more preferably at least about 40 nucleotides, more preferably at least about 50 nucleotides, and more preferably about 60 nucleotides More preferably at least about 70 nucleotides, more preferably at least about 80 nucleotides, more preferably at least about 90 nucleotides, more preferably at least about 100 nucleotides, more preferably at least about 110 nucleotides, more preferably at least about 90 nucleotides, more preferably at least about 100 nucleotides, More preferably at least about 120 nucleotides, more preferably at least about 130 nucleotides, more preferably at least about 140 nucleotides, more preferably at least about 150 nucleotides, more preferably at least about 160 nucleotides, more preferably at least about 140 nucleotides, more preferably at least about 150 nucleotides, Above More preferably at least about 170 nucleotides, more preferably at least about 180 nucleotides, more preferably at least about 190 nucleotides, more preferably at least about 200 nucleotides, more preferably at least about 250 nucleotides, more preferably at least about 190 nucleotides, more preferably at least about 200 nucleotides, More preferably at least about 300 nucleotides, more preferably at least about 350 nucleotides, more preferably at least about 400 nucleotides, more preferably at least about 450 nucleotides, more preferably at least about 500 nucleotides, more preferably at least about 500 nucleotides, More preferably at least about 600 nucleotides, more preferably at least about 700 nucleotides, more preferably at least about 800 nucleotides, more preferably at least about 900 nucleotides, more preferably at least about 1000 nucleotides, more preferably at least about 800 nucleotides, More than Nucleotides, and the term "about" in this information, refers to the nucleotide sequence length plus or minus 10% of the above-mentioned length. Coding sequence nucleotide sequence with another known nucleotide sequence using any of a number of well-known sequence alignment programs and to determine which PRO polypeptide-coding nucleotide sequence fragment (s) are novel A new fragment of the polypeptide-coding nucleotide sequence can be identified. All such PRO polypeptide-coding nucleotide sequences are contemplated herein. Also contemplated are PRO polypeptide fragments encoded by these nucleotide molecule fragments, preferably PRO polypeptide fragments comprising a binding site for an anti-PRO antibody.

In another embodiment, the invention provides isolated PRO polypeptides that are encoded by any of the isolated nucleic acid sequences identified above.

In some aspects, the invention provides a method for the detection of a full-length amino acid sequence as disclosed herein, an amino acid sequence of the invention without the signal peptide, an extracellular domain of the membrane transporter protein with or without a signal peptide, Sequence identity, preferably at least about 81% sequence identity, more preferably at least about 82% sequence identity, more preferably at least about 83% sequence identity with a PRO polypeptide comprising any fragment of SEQ ID NO: Sequence identity, preferably at least about 84% sequence identity, more preferably at least about 85% sequence identity, more preferably at least about 86% sequence identity, more preferably at least about 87% sequence identity, more preferably at least about 88% , More preferably at least about 89% sequence identity, more preferably at least about 90% sequence identity Sequence identity, more preferably at least about 91% sequence identity, more preferably at least about 92% sequence identity, more preferably at least about 93% sequence identity, more preferably at least about 94% sequence identity, More preferably at least about 96% sequence identity, more preferably at least about 97% sequence identity, more preferably at least about 98% sequence identity, more preferably at least about 99% sequence identity, more preferably at least about 95% sequence identity, more preferably at least about 96% sequence identity, Lt; RTI ID = 0.0 > PRO < / RTI > polypeptide comprising an amino acid sequence that exhibits sequence identity.

In a further aspect, the invention provides an isolated nucleic acid molecule comprising at least about 80% sequence identity, preferably at least about 81% sequence identity with an amino acid sequence encoded by any human protein cDNA deposited with the ATCC as disclosed herein, More preferably at least about 82% sequence identity, more preferably at least about 83% sequence identity, more preferably at least about 84% sequence identity, more preferably at least about 85% sequence identity, more preferably at least about 86% sequence identity, More preferably at least about 87% sequence identity, more preferably at least about 88% sequence identity, more preferably at least about 89% sequence identity, more preferably at least about 90% sequence identity, more preferably at least about 91 More preferably at least about 92% sequence identity, more preferably at least about 93% sequence identity, More preferably at least about 94% sequence identity, more preferably at least about 95% sequence identity, more preferably at least about 96% sequence identity, more preferably at least about 97% sequence identity, more preferably at least about 98 , More preferably at least about 99% sequence identity, and more preferably at least about 99% sequence identity.

In a further aspect, the present invention provides a method for identifying a specifically defined amino acid sequence comprising the full-length amino acid sequence disclosed herein, the amino acid sequence of the invention without the signal peptide, the extracellular domain of the transmembrane protein of the present invention with or without a signal peptide, More preferably at least about 81%, more preferably at least about 82%, more preferably at least about 83%, more preferably at least about 80%, more preferably at least about 80%, more preferably at least about 83% Preferably at least about 84% positive, more preferably at least about 85% positive, more preferably at least about 86% positive, more preferably at least about 87% positive, more preferably at least about 88% positive Preferably at least about 89% positive, more preferably at least about 90% positive, more preferably at least about 91% positive, More preferably at least about 92% positive, more preferably at least about 93% positive, more preferably at least about 94% positive, more preferably at least about 95% positive, more preferably at least about 96% positive, More preferably at least about 97% positive, more preferably at least about 98% positive, more preferably at least about 99% positive amino acid sequence.

In particular aspects, the invention provides isolated PRO polypeptides that are free of N-terminal signal sequence and / or initiation methionine and that are encoded by a nucleotide sequence encoding such an amino acid sequence. Methods for producing the same are also described herein, wherein the method comprises culturing a host cell comprising a vector comprising a suitable nucleic acid molecule encoding under suitable conditions for expression of the PRO polypeptide, and culturing the PRO polypeptide . ≪ / RTI >

In another aspect, the invention provides isolated PRO polypeptides in which the transmembrane domain is deleted or inactivated. Methods of producing the same are also described herein, wherein the method comprises culturing a host cell containing a vector comprising a suitable nucleic acid molecule under conditions suitable for expression of the PRO polypeptide, and culturing the PRO polypeptide Recovery.

In another embodiment, the invention is directed to an agonist or antagonist of a native PRO polypeptide as defined herein. In a specific embodiment, the agonist or antagonist is an anti-PRO antibody or small molecule.

In a further embodiment, the invention relates to a method of identifying an agonist or antagonist for a PRO polypeptide, comprising contacting a PRO polypeptide with a candidate molecule, and observing the biological activity mediated by said PRO polypeptide . Preferably, the PRO polypeptide is a native PRO polypeptide.

In a further embodiment, the invention relates to a composition of matter comprising the PRO polypeptide described herein, an agonist or antagonist of a PRO polypeptide, or an anti-PRO antibody as described herein in combination with a carrier. Optionally, the carrier is a pharmaceutically acceptable carrier.

Another embodiment of the present invention is a pharmaceutical composition comprising said PRO polypeptide, an agonist or antagonist thereof, or a pharmaceutically acceptable salt thereof, for the manufacture of a medicament useful for the treatment of a PRO polypeptide, agonist or antagonist thereof, RTI ID = 0.0 > anti-PRO < / RTI >

In a further embodiment of the invention, the invention provides a vector comprising DNA encoding any of the polypeptides described herein. Host cells containing such arbitrary vectors are also provided. For example, the host cell may be a CHO cell, an E. coli, a yeast or a baculovirus-infected insect cell. The invention further provides a method of producing any of the polypeptides described herein, the method comprising culturing the host cell under conditions suitable for expression of the desired polypeptide, and recovering the desired polypeptide from the cell culture.

In another embodiment, the invention provides chimeric molecules in which any of the polypeptides described herein are bound to a heterologous polypeptide or amino acid sequence. An example of such a chimeric molecule is that any of the polypeptides described herein are bound to an epitope tag sequence or Fc region of an immunoglobulin.

In another embodiment, the invention provides an antibody that specifically binds to a polypeptide as described above or below. Optionally, the antibody is a monoclonal antibody, humanized antibody, antibody fragment or single chain antibody.

In another embodiment, the invention provides oligonucleotide probes useful for isolating genomic and cDNA nucleotide sequences as antisense probes, wherein said probes can be derived from any of the nucleotide sequences described above or below.

The present invention relates to compositions and methods useful for promoting or inhibiting angiogenesis and / or cardiovascular formation in mammals requiring an effect of promoting or inhibiting angiogenesis and / or cardiovascular formation. This includes diagnosis and treatment of cardiovascular disease as well as tumor disease.

Figure 1 shows the nucleotide sequence (SEQ ID NO: 1) of the native sequence PRO179 cDNA, wherein SEQ ID NO: 1 is a clone referred to herein as " DNA16451-1388 ".

Fig. 2 shows the amino acid sequence (SEQ ID NO: 2) derived from the coding sequence of SEQ ID NO: 1 shown in Fig.

Figure 3 shows the nucleotide sequence (SEQ ID NO: 3) of the native sequence PRO238 cDNA, wherein SEQ ID NO: 3 is a clone referred to herein as " DNA35600-1162 ".

Figure 4 shows the amino acid sequence (SEQ ID NO: 4) derived from the coding sequence of SEQ ID NO: 3 shown in Figure 3.

Figure 5 shows the nucleotide sequence (SEQ ID NO: 5) of the native sequence PRO364 cDNA, wherein SEQ ID NO: 5 is a clone referred to herein as " DNA47365-1206 ".

Figure 6 shows the amino acid sequence (SEQ ID NO: 6) derived from the coding sequence of SEQ ID NO: 5 shown in Figure 5.

Figure 7 shows the nucleotide sequence (SEQ ID NO: 7) of the native sequence PRO844 cDNA, wherein SEQ ID NO: 7 is a clone referred to herein as " DNA59838-1462 ".

Fig. 8 shows the amino acid sequence (SEQ ID NO: 8) derived from the coding sequence of SEQ ID NO: 7 shown in Fig.

Figure 9 shows the nucleotide sequence (SEQ ID NO: 9) of the native sequence PRO846 cDNA, wherein SEQ ID NO: 9 is a clone referred to herein as " DNA44196-1353 ".

Fig. 10 shows the amino acid sequence (SEQ ID NO: 10) derived from the coding sequence of SEQ ID NO: 9 shown in Fig.

Figure 11 shows the nucleotide sequence (SEQ ID NO: 11) of the native sequence PRO1760 cDNA, wherein SEQ ID NO: 11 is a clone referred to herein as " DNA76532-1702 ".

Fig. 12 shows the amino acid sequence (SEQ ID NO: 12) derived from the coding sequence of SEQ ID NO: 11 shown in Fig.

Figure 13 shows the nucleotide sequence (SEQ ID NO: 13) of the native sequence PRO205 cDNA, wherein SEQ ID NO: 13 is a clone referred to herein as " DNA30868 ".

Fig. 14 shows the amino acid sequence (SEQ ID NO: 14) derived from the coding sequence of SEQ ID NO: 13 shown in Fig.

Figure 15 shows the nucleotide sequence (SEQ ID NO: 15) of the native sequence PRO321 cDNA, wherein SEQ ID NO: 15 is a clone referred to herein as " DNA34433 ".

Fig. 16 shows the amino acid sequence (SEQ ID NO: 16) derived from the coding sequence of SEQ ID NO: 15 shown in Fig.

Figure 17 shows the nucleotide sequence (SEQ ID NO: 17) of the native sequence PRO333 cDNA, wherein SEQ ID NO: 17 is a clone referred to herein as " DNA41374 ".

Fig. 18 shows the amino acid sequence (SEQ ID NO: 18) derived from the coding sequence of SEQ ID NO: 17 shown in Fig.

Figure 19 shows the nucleotide sequence (SEQ ID NO: 19) of the native sequence PRO840 cDNA, wherein SEQ ID NO: 19 is a clone referred to herein as " DNA53987 ".

Fig. 20 shows the amino acid sequence (SEQ ID NO: 20) derived from the coding sequence of SEQ ID NO: 19 shown in Fig.

Figure 21 shows the nucleotide sequence (SEQ ID NO: 21) of the native sequence PRO877 cDNA, wherein SEQ ID NO: 21 is a clone referred to herein as " DNA58120 ".

22 shows the amino acid sequence (SEQ ID NO: 22) derived from the coding sequence of SEQ ID NO: 21 shown in FIG.

Figure 23 shows the nucleotide sequence (SEQ ID NO: 23) of the native sequence PRO878 cDNA, wherein SEQ ID NO: 23 is a clone referred to herein as " DNA58121 ".

24 shows the amino acid sequence (SEQ ID NO: 24) derived from the coding sequence of SEQ ID NO: 23 shown in Fig.

Figure 25 shows the nucleotide sequence (SEQ ID NO: 25) of the native sequence PRO879 cDNA, wherein SEQ ID NO: 25 is a clone referred to herein as " DNA58122 ".

26 shows the amino acid sequence (SEQ ID NO: 26) derived from the coding sequence of SEQ ID NO: 25 shown in FIG.

Figure 27 shows the nucleotide sequence (SEQ ID NO: 27) of the native sequence PRO882 cDNA, wherein SEQ ID NO: 27 is a clone referred to herein as " DNA58125 ".

28 shows the amino acid sequence (SEQ ID NO: 28) derived from the coding sequence of SEQ ID NO: 27 shown in FIG.

Figure 29 shows the nucleotide sequence (SEQ ID NO: 29) of the native sequence PRO885 cDNA, wherein SEQ ID NO: 29 is a clone referred to herein as " DNA58128 ".

30 shows the amino acid sequence (SEQ ID NO: 30) derived from the coding sequence of SEQ ID NO: 29 shown in FIG.

Figure 31 shows the nucleotide sequence (SEQ ID NO: 31) of the native sequence PRO887 cDNA, wherein SEQ ID NO: 31 is a clone referred to herein as " DNA58130 ".

32 shows the amino acid sequence (SEQ ID NO: 32) derived from the coding sequence of SEQ ID NO: 31 shown in FIG.

1. Definitions

The term " cardiovascular disease, endothelial cell disease and angiogenesis disorder ", " cardiovascular disorder, endothelial cell disorder and angiogenesis disorder ", " cardiovascular disease, endothelial cell disease or angiogenesis disorder & Disorder " is used interchangeably and refers to a systemic disease affecting the blood vessels, such as diabetes, as well as diseases of the blood vessels themselves, such as arteries, capillaries, veins and / or lymphatic vessels. This includes symptoms that stimulate angiogenesis and / or cardiovascular formation, and symptoms that inhibit angiogenesis and / or cardiovascular formation. Such diseases include, for example, atherosclerosis, hypertension, inflammatory vasculitis, Raynaud's disease and Raynaud's syndrome, arterial diseases such as aneurysms and arterial restenosis; Venous and lymphatic diseases such as thrombotic phlebitis, lymphatic ductitis and lymphatic edema; Such as peripheral vascular disease, vascular tumors such as hemangiomas (capillaries and sponges), dysplasia, capillary vasculopathy, bacterial angiomatosis, vascular endothelial, angiosarcoma, vasculocele, Kaposi sarcoma, lymphangioma and lymphangiosarcoma) Kidney diseases such as cancer, tumor angiogenesis, wounding, burns and other damaged tissues, implant fixation, scar formation, ischemic reperfusion injury, rheumatoid arthritis, cerebrovascular disease, acute renal failure, and other vascular diseases such as osteoporosis . Such diseases include angina pectoris, myocardial infarction such as acute myocardial infarction, cardiac hypertrophy, and heart failure such as CHF.

As used herein, " hyperplasia " is defined as an increase in the mass of an organ or structure independent of natural proliferation not involving tumor formation. Hypertrophy of an organ or tissue is due to either an increase in the mass of an individual cell (true hyperplasia) or an increase in the number of cells constituting the tissue (hyperplasia), or both. Some organs, such as the heart, lose their ability to divide immediately after birth. Thus, " hypercardia " is defined as an increase in adult cardiac mass that is not associated with cell division and is characterized by an increase in muscle cell size and contraction protein content. The characteristics of the stresses leading to hypertrophy (such as increased pre-load, post-load, muscle cell loss, or contractile primary depression of myocardial cells, such as in myocardial infarction) appear to play a decisive role in determining responsiveness . The earliest stages of ectopic hyperplasia are generally morphologically characterized by enlargement of myofibers and mitochondria as well as expansion of mitochondria and nuclei. At this stage, muscle cells are larger than normal cells, but most of the cell organization is preserved. In the course of the progression of cardiac hypertrophy, the size or number of specific organelles such as mitochondria is greatly increased, and new contraction factors are added to the localized areas of the cells in an irregular manner. Long-lived non-enlarged cells exhibit more pronounced collapse in cellular organization, including significantly expanded nuclei with high lobular membranes that replace adjacent muscle fibers and cause degradation of normal Z-band labeling. The term "hypercardia" is used to cover all stages of development of the disease characterized by various structural damage of the myocardium, regardless of the underlying heart disease. Therefore, the term also includes physiological symptoms associated with the development of hypercardia, such as hypertension, aortic stenosis, or myocardial infarction.

"Heart failure" refers to the abnormality of cardiac function when the heart does not pump blood at the rate required for tissue metabolism. Heart failure can be caused by a number of factors including ischemic, congestive, rheumatic, or idiopathic forms.

&Quot; Congestive heart failure " (CHF) is a progressive condition in which the heart is unable to progressively deliver a heart rate output (blood volume pumped by the heart over a period of time) sufficient to deliver blood including oxygen to peripheral tissues . As CHF progresses, structural and hemodynamic damage occurs. These impairments manifest various symptoms, but one characteristic symptom is ventricular hypertrophy. CHF is a common result of many different heart diseases.

&Quot; Myocardial infarction " is commonly caused by atherosclerosis of coronary arteries, often with redundant coronary thrombosis. Myocardial infarction can be classified into two main types: myocardial infarction with myocardial necrosis accompanied by an entire layer of the ventricular wall, and intracardiac infarction with necrosis not extending to the epicardium through the wall of the ventricle and into the subendothelial, Non-conductive layer) infarction. Myocardial infarction is known to cause both changes in hemodynamic effects and structural changes in damaged and healthy cardiac regions. Thus, for example, myocardial infarction reduces the heart's maximum cardiac output and stroke volume. In addition, stimulation of DNA synthesis, which occurs in the gap as well as increased collagen formation in unaffected cardiac regions, is associated with myocardial infarction.

For example, hypertension resulting from increased stress or fatigue on the heart in persistent hypertension due to increased total peripheral resistance has long been associated with " hypertension ". The characteristic of ventricular enlargement as a consequence of chronic pressure overload is impaired relaxation performance (Fouad et al., J. Am. Coll. Cardiol., 4: 1500-1506 (1984); Smith et al., J. Am Cardiol., 5: 869-874 (1985)). Persistent left ventricular relaxation has been observed in early intrinsic hypertension despite normal or maximal contraction function (Hartford et al., Hypertension, 6: 329-338 (1984)). However, there is no close correspondence between blood pressure level and hypercardia. Although improvement in left ventricular function in response to antihypertensive therapy has been reported in humans, patients who have been variously treated with diuretics (hydrochlorothiazide), beta-blockers (propranolol) or calcium channel blockers (diltiazem) (Inouye et al., Am. J. Cardiol., 53: 1583-7 (1984)) without improvement of left ventricular hypertrophy.

Another complicated cardiac disease associated with hypercardia is "asymptomatic cardiomyopathy". The disease is characterized by a high diversity of morphological, functional and clinical characteristics (Maron et al., N. Engl. J. Med., 316: 780-789 (1987); Spirito et al., N. Engl. 36: 275-308 (1994); Wigle et al., Circulation, 92: 1680-1692 (1995)), and all (Spirito et al., N. Engl. J. Med., 336: 775-785 (1997)), which is emphasized by the fact that patients of the ages suffer from the disease. The etiologic factors of asymptomatic cardiomyopathy are various and little known. Generally, a mutation in a gene encoding an endocrine protein is associated with asymptomatic cardiomyopathy. Recent data suggest that the β-myosin heavy chain mutation may be responsible for approximately 30-40% of cases of familial acromegaly cardiomyopathy (Warkins et al., N. Engl. J. Med., 326: 1108-1114 Thierfelder et al., Cell, 77: 701-712 (1994); Marian and Roberts, Circulation, 92: 1336-1347 (1995); Schwartz et al., Circulation, 91: 532-540 Watkins et al., Nat. Gen., 11: 434-437 (1995)). Gene mutations at other positions besides the β-myosin heavy chain include cardiac troponin T.alpha.potomyosin, cardiac myosin binding protein C, essential myosin light chains and regulated myosin light chains (Malik and Watkins. Curr. Opin. Cardiol., 12: 295-302 (1997)).

The upper "aortic stenosis" is a hereditary vascular disease characterized by stenosis of the ascending aorta, but other arteries, including the pulmonary artery, may also be affected. Untreated aortic stenosis elevates intracardiac blood pressure, which leads to myocardial hypertrophy leading to heart failure and death. The pathogenesis of this disease is not fully understood, but hypertrophy and (probably) hyperplasia of the medial smooth muscle is a hallmark feature of this disease. Molecular variants of the elastin gene have been reported to be involved in the development and onset mechanism of aortic stenosis (U.S. Patent No. 5,650,282, issued July 22, 1997).

"Plateau reflux" occurs as a result of heart disease resulting in heart valve disease. Various diseases, such as rheumatic fever, can result in shrinkage or pulling irrespective of valvular organs, but other diseases can lead to endocarditis, inflammation of the endocardial or atrioventricular lining and cardiac surgery. Defects such as stenosis of the valve stenosis or valve defect closure lead to blood accumulation in the deep river, or backflow of blood through the valve. Persistent valvular stenosis or persistent valvular insufficiency can result in cardiac hypertrophy and myocardial damage if left untreated, which eventually requires a valve replacement.

The present invention encompasses all of these diseases, which may or may not be accompanied by cardiac hypertrophy, and other cardiovascular, endothelial, and angiogenic diseases.

The terms " cancer ", " cancer ", and " malignant " refer to or describe the physiological condition of a mammal, which is a typical characteristic of uncontrolled cell proliferation. Examples of cancer include but are not limited to cancer, including adenocarcinoma, lymphoma, blastoma, melanoma, sarcoma, and leukemia. More specific examples of such cancers include squamous cell carcinoma, small cell lung cancer, non-small cell lung cancer, gastric cancer, Hodgkin's lymphoma and non-Hodgkin's lymphoma, pancreatic cancer, glioblastoma, uterine cancer, ovarian cancer, liver cancer (for example, liver cancer and hepatocellular carcinoma) (Eg, renal cell carcinoma and Wilms' tumor), basal cell carcinoma, melanoma, prostate cancer, vulvar cancer, thyroid cancer, testicular cancer, esophageal cancer, and a variety of other cancers including breast cancer, breast cancer, breast cancer, colon cancer, colorectal cancer, endometrial cancer, There are types of head and neck cancer. The preferred cancer for treatment herein is breast cancer, colon cancer, lung cancer, melanoma, ovarian cancer, and other cancers accompanied by angiomas described above.

The term " cytotoxic agent " as used herein refers to a substance that inhibits or interferes with cell function and destroys the cell. This term includes toxins such as radioactive isotopes (e.g., ¹³¹ I, ¹²⁵ I, ⁹⁰ Y, and ¹⁸⁶ Re), chemotherapeutic agents, and enzymatically active toxins from bacteria, fungi, plants or animals, or fragments thereof .

&Quot; Chemotherapeutic agents " are compounds useful in the treatment of cancer. Examples of chemotherapeutic agents include, but are not limited to, alkylating agents, folic acid antagonists, anti-metabolites of nucleic acid metabolism, antibiotics, pyrimidine analogs, 5-fluorouracil, cisplatin, purine nucleosides, amines, triazole nucleosides or corticosteroids . Specific examples include adriamycin, doxorubicin, 5-fluorouracil, cytosine arabinoside ("Ara-C"), cyclophosphamide, thiotepa, But are not limited to, phycoerythrin, phorbol, vinblastine, bleomycin, etoposide, ifosfamide, mitomycin C, mitoxantrone, vincraestin, binorelin, carboplatin, teniposide, daunomycin, Terrine, dactinomycin, mitomycin, esperamicin (see U.S. Patent No. 4,675,187), melphalan and other related nitrogen mustards. This definition also includes hormones that regulate or inhibit hormone action on tumors, such as tamoxifen and onapristone.

As used herein, " proliferation inhibitor " refers to a compound or composition that inhibits the proliferation of cells, such as Wnt-overexpressing cancer cells, in vitro or in vivo. Thus, proliferation inhibitors significantly reduce the proportion of tumor cells in the S phase. Examples of the proliferation inhibitor include substances that block cell cycle progression (for example, in a state other than the S group), for example, a G1-group conformation and a substance inducing an M-group conformation. Typical M-phase blockers include VINCAS (vincristine and vinblastine), taxol and topo II inhibitors (e.g., doxorubicin, daunorubicin, etoposide and bleomycin). DNA alkylating agents such as tamoxifen, prednisone, dacarbazine, mechlorethamine, cisplatin, methotrexate, 5-fluorouracil and ara-C also induce S-group identity. For more information, refer to WB Saunders (Philadelphia, 1995), especially p. 1, "Molecular Basis of Cancer, Mendelsohn and Israel, eds., Chapter 1, entitled" Cell cycle regulation, oncogenes, and antineoplastic drugs "by Murakami et al. 13). Additional examples include tumor necrosis factor (TNF); An antibody capable of inhibiting or neutralizing the angiogenic activity of an acidic or basic FGF or hepatocellular carcinoma proliferative factor (FGF); An antibody capable of inhibiting or neutralizing the coagulation activity of a tissue factor, protein C or protein S (WO 91/01753, published Feb. 21, 1991); And antibodies capable of binding to the HER2 receptor (WO 89/06692), such as the 4D5 antibody (and functional equivalents thereof) (e.g., WO 92/22653).

&Quot; Treatment " is intended to prevent the development of cardiovascular, endothelial, and angiogenic diseases or to alter the pathology of the disease. The concept of treatment is used in the broadest sense and specifically includes preventing (preventing), alleviating, alleviating and curing cardiovascular, endothelial and angiogenic diseases at any stage. Thus, " treatment " refers to both therapeutic treatment and prophylactic or preventative treatment, wherein the purpose is to prevent or slow angiogenic diseases such as cardiovascular disease, endothelial cell disease and hyperplasia. The object requiring treatment is not only a subject susceptible to the disease or an object to prevent the disease, but also an object already suffering from the disease. The disease may arise from any cause, including idiopathic, cardiac affinity or muscle affinity causes, or from ischemic or ischemic seizures, such as myocardial infarction.

&Quot; Chronic " administration refers to the administration of the agent (s) in a continuous fashion as opposed to an acute method to maintain an initial effect, such as an anti-hyperplastic effect, for an extended period of time.

"Mammal" for therapeutic purposes refers to any animal classified as a mammal, including humans, livestock and breeding animals, zoo animals, sports animals and pets such as dogs, horses, cats, cattle, sheep, pigs and the like . Preferably, the mammal is a human.

Administration " together " with one or more additional therapeutic agents includes simultaneous administration and sequential administration in any order.

The phrase " cardiovascular drug, endothelial cell drug or angiogenesis related drug " generally refers to any drug that acts to treat cardiovascular, endothelial, and angiogenic diseases. Examples of cardiovascular drugs include drugs that promote blood vessel homeostasis by regulating blood pressure, heart rate, cardiac contractility, and the biology of the endothelial and smooth muscle, which are factors affecting vascular disease. Specific examples thereof include angiotensin-II, a receptor antagonist; Endothelin receptor antagonists such as BOSENTAN TM and MOXONODIN TM; Interferon-gamma (INF-y); Des-aspartate-angiotensin I; T-PA, TNK t-PA (T103N, N117Q, KHRR (296-299) AAAA (296-299)) specifically designed to show thrombolytic agents such as streptokinase, urokinase, t-PA and longer half-life and very high fibrin specificity t-PA mutant, Keyt et al., Proc. Natl. Acad. Sci., USA 91, 3670-3674 (1994)); Such as propranolol, timolol, tertarolol, carthorol, nadolol, betasol, penbutolol, acetobutolol, atenolol, Metoprolol and carvedilol; Angiotensin converting enzyme (ACE) inhibitors such as quinapril, captopril, enantapril, ramipril, benzazepril, posinopril and lisinopril; Diuretics such as chlorothiazide, hydrochlorothiazide, hydrofluorometazide, methylchlorothiazide, benzthiazide, dichlorphenamide, acethazolamide and indapamide; And calcium channel blockers such as diltiazem, nifedipine, verapamil, nicardipine. One preferred category of this type is hyperhidrosis; Or a physiological condition that develops hypercardia such as hypertension, aortic stenosis or myocardial infarction.

&Quot; Angiogenesis " and " endothelial cell medicament " are active agents that promote angiogenesis and / or endothelial cell proliferation or, if applicable, angiogenesis. This accelerates wound healing, such as proliferating hormone, insulin-like growth factor-I (IGF-I), VEGF, VIGF, PDGF, epidermal growth factor (EGF), CTGF and its members, FGF, TGF-a and TGF- Lt; / RTI >

An " angiogenesis inhibitor " is an activator that inhibits angiogenesis or angiogenesis or inhibits or prevents the proliferation of cancer cells. An example is an antibody or other antagonist for an angiogenic agent as defined above, such as an antibody to VEGF. In addition, they can be used to treat cell therapy agents such as cytotoxic agents, chemotherapeutic agents, proliferation inhibitors, apoptosis agents, and other agents (e.g., anti-HER-2, anti-CD20, other bioactive agents and organic chemicals) .

In the pharmaceutical context, a " therapeutically effective amount " of a PRO polypeptide, an agonist or antagonist thereof, or an anti-PRO antibody, in the context of the present invention is an active agent useful for the treatment of cardiovascular, endothelial, The amount can be determined experimentally.

An " effective amount " of an active agent, such as a PRO polypeptide, agonist or antagonist thereof, or an anti-PRO antibody used herein refers to an amount effective to accomplish the above purpose wherein the amount can be determined empirically to achieve the desired effect .

The terms " PRO polypeptide " and " PRO ", as used herein, refer to various polypeptides when immediately followed by a number, wherein the full designation (i.e., PRO / number) refers to the particular polypeptide sequence described herein. As used herein, the terms " PRO / numeric polypeptide " and " PRO / number " (where numbers are expressed in substantial numbers) are terms that include natural sequence polypeptides and polypeptide variants (defined further herein). The PRO polypeptides described herein can be isolated from a variety of sources, such as human tissue or other sources, or can be recombinantly or synthetically produced.

A " native sequence PRO polypeptide " comprises a polypeptide having the same amino acid sequence as the corresponding PRO polypeptide derived from nature. Such native sequence PRO polypeptides can be isolated from nature or can be prepared by recombinant or synthetic methods. The term " native sequence PRO polypeptide " specifically refers to a naturally-occurring truncated or secreted form of a particular PRO polypeptide (e. G., An extracellular domain sequence), a naturally occurring variant form of such a polypeptide , Alternate spritzed forms) and naturally occurring allelic variants. In various embodiments of the invention, the native sequence PRO polypeptides described herein are mature or full length native sequence polypeptides comprising the full length amino acid sequence shown in the accompanying figures. Start and stop codons are shown in bold and underlined in the figure. However, while the PRO polypeptide disclosed in the figures accompanying the present document is shown to begin with a methionine residue referred to as amino acid position 1 in the figure, other methionine residues located in the upper or lower portion from amino acid position 1 in the figure represent the starting amino acid of the PRO polypeptide Lt; / RTI >

PRO polypeptide " extracellular domain " or " ECD " refers to a form of a PRO polypeptide that is essentially free of transmembrane or cytoplasmic domains. PRO polypeptide ECDs typically comprise less than 1% of the transmembrane and / or cytoplasmic domains, preferably less than 0.5% of such domains. It is to be understood that all transmembrane domains identified in the PRO polypeptides of the present invention have been identified in accordance with criteria routinely used in the art to identify hydrophobic domain types. The exact borderline of the transmembrane domain may be different, but most are within about 5 amino acids at the end of the domain originally identified herein. Thus, the extracellular domain of the PRO polypeptide may optionally contain no more than about 5 amino acids at each interface of the transmembrane / extracellular domains identified in the Examples and the detailed description, and such polypeptides with or without a bound signal peptide , And nucleic acids encoding them are included in the present invention.

The approximate positions of the " signal peptides " of the various PRO polypeptides disclosed herein are set forth in the present specification and / or accompanying drawings. However, although the C-terminal boundary of the signal peptide may vary, it should be noted that there can be no more than about 5 amino acids at each interface of the C-terminal of the signal peptide, which is initially identified herein, wherein the C- End-bounds can be identified according to criteria commonly used in the art to identify the types of amino acid sequence elements (see, for example, Nielsen et al., Prot. Eng. 10: 1-6 Heinje et al., Nucl. Acids. Res. 14: 4683-4690 (1986)). In addition, it should be appreciated that in some cases, the cleavage of the signal sequence of the secreted polypeptide is totally incompatible, resulting in one or more secreted polypeptides. When the signal peptide is cleaved within about 5 amino acids at each interface of the C-terminal of the signal peptide identified herein, these mature polypeptides, and polynucleotides encoding them, are also encompassed by the invention.

&Quot; PRO polypeptide variant " refers to a full-length native sequence PRO polypeptide sequence as disclosed herein, a PRO polypeptide sequence without a signal peptide as disclosed herein, an extracellular domain of a PRO polypeptide with or without signal peptides as disclosed herein, Means an active PRO polypeptide as defined hereinbefore or hereinafter, having at least about 80% amino acid sequence identity with any other fragment of the full-length PRO polypeptide sequence. Such PRO polypeptide variants include, for example, PRO polypeptides wherein one or more amino acid residues are added or deleted at the N-terminus or C-terminus of the full-length native amino acid sequence. Typically, a PRO polypeptide variant is a full-length native sequence PRO polypeptide sequence as disclosed herein, a PRO polypeptide sequence without a signal peptide as disclosed herein, an extracellular domain of a PRO polypeptide with or without a signal peptide as disclosed herein, More preferably at least about 80%, more preferably at least about 82%, even more preferably at least about 83% amino acid sequence identity with any other fragment of the full-length PRO polypeptide sequence, more preferably at least about 80% , More preferably at least about 84%, more preferably at least about 85%, more preferably at least about 86%, even more preferably at least about 87%, even more preferably at least about 88%, even more preferably at least about 89% More preferably at least about 90%, more preferably at least about 91%, even more preferably at least 92%, even more preferably at least about 93%, even more preferably at least about 94% , More preferably at least about 95%, more preferably at least about 96%, more preferably at least about 97%, even more preferably at least about 98%, most preferably at least about 99%. Typically, a PRO variant polypeptide is one whose length is at least about 10 amino acids, often at least about 20 amino acids, more often at least about 30 amino acids, more often at least about 40 amino acids, more often at least about 50 amino acids, More usually at least about 70 amino acids, more often at least about 80 amino acids, more often at least about 90 amino acids, more often at least about 100 amino acids, more often at least about 150 amino acids, More usually more than about 200 amino acids, more often more than about 300 amino acids or more.

As shown below, Table 1 provides complete source code for the ALIGN-2 sequence comparison computer program. This source code can typically be edited for use on UNIX operating systems that provide ALIGN-2 sequence comparison computer programs.

In addition, Tables 2A-2D show the hypotheses using the methods described below for determining% amino acid sequence identity (Table 2A-2B) and% nucleic acid sequence identity (Table 2C-2D) using the ALIGN- Quot; PRO " refers to the amino acid sequence of the polypeptide to be compared with the " PRO " polypeptide of interest, and " PRO-DNA "Quot; refers to the nucleotide sequence of the nucleic acid molecule to be compared with the " PRO-DNA " nucleic acid molecule of interest, and " X ", " Y & &Quot; N ", " L " and " V " denote the nucleotides of different assumptions, respectively.

<Table 1>

<Table 2A>

<Table 2B>

<Table 2C>

<Table 2D>

&Quot; Amino acid sequence identity (%) " for the PRO polypeptide sequence disclosed herein refers to the sequence identity of the PRO polypeptide sequence to the amino acid sequence identity of the particular PRO polypeptide sequence, and, if necessary, introduces a gap to obtain a maximum of the percent sequence identity, Is defined as the percentage of amino acid residues of the candidate sequence that are identical to the amino acid residues of a particular PRO polypeptide sequence without being considered as part of the PRO polypeptide sequence. Alignment to determine amino acid sequence identity (%) can be accomplished using a variety of methods known in the art, such as readily available computer software such as BLAST, BLAST-2, ALIGN or Megalign (DNASTAR) software . Skilled artisans may define parameters suitable for measuring alignment, including any algorithms necessary to maximally align over the entire length of the compared sequences. However, for purposes of this disclosure, the amino acid sequence identity (%) may be obtained using the sequence comparison computer program ALIGN-2, wherein the complete source code for the ALIGN-2 program is described in Figures 248A-Q. The ALIGN-2 sequence comparison computer program was developed by Genentech, Inc. The source code shown in Figures 248A-Q is stored as a user document in the US Copyright Office (located at 20559 Washington, DC) Under the subparagraph. The ALIGN-2 program is easily available through Genentech, Inc. (South San Francisco, Calif.), Or can be edited from the source code described in Table 1. The ALIGN-2 program can be edited and used in the UNIX operating system, preferably Digital UNIX V4.0D. All sequence comparison parameters are set by the ALIGN-2 program and are not varied.

For purposes of the present application, a given amino acid sequence B has the amino acid sequence identity (%) of a given amino acid sequence A to B and / or B (given amino acid sequence B to a given amino acid sequence identity to B or B, May be represented differently by a given amino acid sequence A, which may or may not be included).

X / Y x 100

Where X is the number of amino acid residues recorded as being equally matched by the sequence alignment program ALIGN-2 in the program alignment of A and B, and Y is the total number of amino acid residues in B. It will be appreciated that if the length of amino acid sequence A is not equal to the length of amino acid sequence B, then the amino acid sequence identity (%) of A to B is not equal to the amino acid sequence identity (%) of B to A. As an example of the amino acid sequence identity calculation using this method, Table 2A-2B shows a method for calculating the amino acid sequence identity (%) of the amino acid sequence referred to as " comparison protein "

Unless specifically stated otherwise, all amino acid sequence identity values used herein are obtained using the ALIGN-2 computer program as described above. However, the amino acid sequence identity (%) can also be obtained using the sequence comparison program NCBI-BLAST2 (Altschul et al., Nucleic Acids Res., 25: 3389-3402 (1997) NCBI-BLAST2 uses a number of search parameters, all of which are, for example, unmasked = yes, Value = 0.01, multipath constant = 25, dropoff for final gap alignment = 25, and score matrix = BLOSUM62 As shown in FIG.

When NCBI-BLAST2 is used for amino acid sequence comparison, the amino acid sequence identity (%) of a given amino acid sequence A to a given amino acid sequence B, with respect to B, or B (given amino acid sequence B, Which may or may not be expressed as a given amino acid sequence A that has or comprises a constant amino acid sequence identity (%)) is calculated as follows.

X / Y x 100

Where X is the number of amino acid residues recorded as being equally matched by the sequence alignment program NCBI-BLAST2 in the NCBI-BLAST2 program alignment, and Y is the total number of amino acid residues in B. It will be appreciated that if the length of amino acid sequence A is not equal to the length of amino acid sequence B, then the amino acid sequence identity (%) of A to B is not equal to the amino acid sequence identity (%) of B to A.

Amino acid sequence identity values (%) can also be determined using the WU-BLAST-2 computer program (Altschul et al., Methods in Enzymology 266: 460-80 (1996)). Most of the WU-BLAST-2 search parameters are set to default values. Those that are not set to default values, that is, adjustable parameters, are set to the following values: Overlap span = 1, overlap fraction = 0.125, word limit (T) = 11, and score matrix = BLOSUM62. In order to achieve the objects herein, the amino acid sequence identity value (%) is determined by comparing the amino acid sequence of the desired PRO polypeptide having the sequence derived from the native PRO polypeptide with the amino acid sequence of the desired PRO polypeptide Polypeptide), determined by WU-BLAST-2, and dividing by the total number of amino acid residues of the desired PRO polypeptide. For example, a polypeptide comprising the amino acid sequence A having an amino acid sequence identity of 80% or more with the amino acid sequence B ", the amino acid sequence A is the desired amino acid sequence to be compared and the amino acid sequence B is the amino acid sequence of the desired PRO polypeptide.

A " PRO variant polynucleotide " or " PRO variant nucleic acid sequence " is a nucleic acid molecule that encodes an active PRO polypeptide as defined below and includes a full length native sequence PRO polypeptide sequence as disclosed herein, a full length native A nucleic acid sequence identity of at least about 80% with a nucleic acid sequence encoding a sequence of a PRO polypeptide, an extracellular domain of a PRO polypeptide disclosed herein, or any other fragment of a full-length PRO polypeptide sequence disclosed herein to be. Usually a PRO variant polynucleotide is a full-length native sequence PRO polypeptide sequence as disclosed herein, a full-length native sequence PRO polypected sequence without a signal peptide as disclosed herein, an extracellular domain of a PRO polypeptide disclosed herein, or a full length PRO Preferably at least about 81%, more preferably at least about 82%, more preferably at least about 83% nucleic acid sequence identity to a nucleic acid sequence encoding any one of the other fragments of the polypeptide sequence. , More preferably at least about 84%, more preferably at least about 85%, even more preferably at least about 86%, even more preferably at least about 87%, even more preferably at least about 88% More preferably at least about 90%, more preferably at least about 91%, more preferably at least about 92%, even more preferably at least about 93%, more preferably at least about 89%, more preferably at least about 90% More preferably at least about 95%, more preferably at least about 96%, more preferably at least about 97%, even more preferably at least about 98%, most preferably at least about 99% %. Variants do not encompass the entire natural nucleotide sequence.

Generally, PRO variant polynucleotides are those whose length is at least about 30 nucleotides, more often at least about 60 nucleotides, more often at least about 90 nucleotides, more often at least about 120 nucleotides, more often at least about 150 nucleotides More often more than about 280 nucleotides, more often more than about 280 nucleotides, more often more than about 240 nucleotides, more often more than about 270 nucleotides, more often more than about 300 nucleotides, more often more than about 240 nucleotides, More than about 450 nucleotides, more often more than about 600 nucleotides, more often more than about 900 nucleotides or more.

With respect to the PRO coding nucleic acid sequence identified herein, the term " nucleic acid sequence identity (%) " refers to the sequence of a specific PRO nucleic acid sequence after the introduction of a gap to align the candidate sequence with a specific PRO nucleic acid sequence, Is defined as the ratio of the nucleotides of the same candidate sequence as the nucleotides. Alignment to determine nucleic acid sequence identity (%) can be accomplished using a variety of methods known in the art, such as readily available computer software such as BLAST, BLAST-2, ALIGN or Megalign (DNASTAR) software . Those skilled in the art can determine appropriate parameters for measuring alignment, including any algorithms necessary to achieve maximum alignment over the entire length of the sequence being compared. However, for purposes of this disclosure, nucleic acid sequence identity values (%) may be obtained using the sequence comparison computer program ALIGN-2, the complete source code for the ALIGN-2 program is set forth in Table 1 below. The ALIGN-2 sequence comparison computer program was developed by Genentech, Inc., and the source code shown in Table 1 is maintained in the user documentation of the United States Copyright Office (20559 Washington, DC), which is under US Copyright Registration No. TXU510087 It is registered. The ALIGN-2 program is easily available through Genentech, Inc. (South San Francisco, Calif.), Or can be edited from the source code described in Table 1. The ALIGN-2 program can be edited and used in the UNIX operating system, preferably Digital UNIX V4.0D. All sequence comparison parameters are set by the ALIGN-2 program and are not varied.

For purposes of the present application, nucleic acid sequence identity (%) (given nucleic acid sequence D, D, or constant nucleic acid sequence identity% to D) of a given nucleic acid sequence C to D, Or may be represented differently by a given nucleic acid sequence C containing or containing).

W / Z x 100

Where W is the number of nucleotides that are equally recorded by the sequence alignment program ALIGN-2 in the program alignment of C and D, and Z is the total number of nucleotides in D; It should be noted that if the length of the nucleic acid sequence C is not equal to the length of the nucleic acid sequence D, then the nucleic acid sequence identity of C to D is not equal to the nucleic acid sequence identity (%) of D to C. As an example of nucleic acid sequence identity calculation, Table 2C-2D shows a method for calculating the nucleic acid sequence identity (%) of a nucleic acid sequence referred to as " comparison DNA "

Unless specifically stated otherwise, nucleic acid sequence identity (%) can be obtained using the sequence comparison program ALIGN-2 described below. However, nucleic acid sequence identity (%) can also be calculated using the sequence comparison program NCBI-BLAST2 described below (Altschul et al., Nucleic Acids Res. 25: 3389-3402 (1997)). The NCBI-BLAST2 sequence comparison program can be downloaded from the website (http://www.ncbi.nlm.nih.gov.). NCBI-BLAST2 uses several search parameters, such as, for example, unmasked = yes, strand = all, expected occurrence = 10, minimum low complexity length = 15/5, multi- = 0.01, a constant for multi-pass = 25, a drop-off for final gap alignment = 25, and a scoring matrix = BLOSUM62.

When NCBI-BLAST2 is used for nucleic acid sequence comparison, the nucleic acid sequence identity (%) of a given nucleic acid sequence C to D and / or D (given nucleic acid sequence D, D and / or D) Which may be expressed in terms of a given nucleic acid sequence C that has or comprises a constant nucleic acid sequence identity (%)) is calculated as follows.

W / Z x 100

Where W is the number of nucleotides recorded equally matched by the sequence alignment program NCBI-BLAST2 in the program alignment, and Z is the total number of nucleotides in D. It should be noted that if the length of the nucleic acid sequence C is not equal to the length of the nucleic acid sequence D, then the nucleic acid sequence identity of C to D is not equal to the nucleic acid sequence identity (%) of D to C.

In addition, the% identity of the nucleic acid sequence may be determined using the WU-BLAST-2 computer program (Altschul et al., Methods in Enzymology 266: 460-80 (1996)). Most of the WU-BLAST-2 search parameters are set to default values. Those that are not set to default values, that is, adjustable parameters, are set to the following values: Overlap span = 1, overlap fraction = 0.125, word limit (T) = 11, and score matrix = BLOSUM62. In order to achieve the objects herein, the nucleic acid sequence identity value (%) is determined by comparing the desired nucleic acid sequence with the nucleic acid sequence of the desired PRO polypeptide having the sequence derived from the native PRO polypeptide (i. E., The PRO variant The number of identical nucleotides matched with the polypeptide of interest may be determined by WU-BLAST-2 and is determined by dividing by the total number of nucleotides of the desired PRO polypeptide-encoding nucleic acid molecule. For example, a polypeptide comprising a nucleic acid sequence A having a nucleic acid sequence identity of 80% or more with the nucleic acid sequence B ", the nucleic acid sequence A is the desired nucleic acid sequence to be compared and the nucleic acid sequence B is the nucleic acid sequence of the desired PRO polypeptide.

In another embodiment, the PRO mutant polynucleotide is preferably selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, 12, 14, 16, 18, 20, 22, 24, 24, Encoding an active PRO polypeptide capable of hybridizing to the nucleotide sequence encoding the full length PRO polypeptide shown in Figure 26 (SEQ ID NO: 26), Figure 28 (SEQ ID NO: 28), Figure 30 Lt; / RTI &gt; The PRO mutant polypeptide may be one which is encoded by a PRO mutant polynucleotide.

The term " positive " in the context of sequence comparisons performed as described above refers to amino acid residues of comparable sequences that are not identical but of similar quality. Amino acid residues that record positive values for a desired amino acid residue are the same as the desired amino acid residue or the desired substitutions of the desired amino acid residue (as defined in Table 3 below).

For purposes of the present application, a given amino acid sequence B has a positive value (%) of a given amino acid sequence A for B and / or B (given amino acid sequence B has a positive positive value (%) for B and / Or may be represented differently by the given amino acid sequence A including the amino acid sequence A).

X / Y x 100

Where X is the number of amino acid residues that record the positive value defined above by the sequence alignment program ALIGN-2 in the program alignment of A and B and Y is the total number of amino acid residues in B. It will be appreciated that if the length of amino acid sequence A is not equal to the length of amino acid sequence B, then the positive value of A for B is not equal to the positive value of B for A.

&Quot; Isolated " as used to describe the various polypeptides disclosed herein means that the polypeptide has been identified and has been isolated and / or recovered from its natural environmental elements. Pollution factors of the polypeptide's natural environment can be substances that generally interfere with the diagnostic or therapeutic use of the polypeptide, including enzymes, hormones and other proteinaceous or non-proteinaceous solutes. In a preferred embodiment, the polypeptide is (1) purified to a sufficient degree to obtain at least 15 residues of the N-terminal or internal amino acid sequence using a spinning cup sequencer, or (2) coomassie blue or preferably silver Can be purified to yield only one band on SDS-PAGE under non-reducing or reducing conditions. PRO polypeptide The isolated polypeptide comprises a polypeptide present in the recombinant cell since there will be no more than one element of the natural environment. However, usually isolated polypeptides will be obtained by one or more purification steps.

An " isolated " nucleic acid molecule encoding a PRO polypeptide or an " isolated " nucleic acid molecule encoding an anti-PRO antibody refers to a natural source of PRO- coding nucleic acids or one or more contaminants normally associated with the natural source of anti- Means a nucleic acid molecule identified and isolated from a nucleic acid molecule. Preferably, the isolated nucleic acid is free from association with all naturally associated components. Isolated PRO-coding nucleic acid molecules or isolated anti-PRO-encoding nucleic acid molecules are in a different form from those found in nature. Thus, isolated nucleic acid molecules are distinguished from PRO-coding nucleic acid molecules or anti-PRO-encoding nucleic acid molecules present in natural cells. However, for example, when the nucleic acid molecule is at a chromosomal location different from the native cell, the isolated nucleic acid molecule encoding the PRO polypeptide or the isolated nucleic acid molecule encoding the anti-PRO antibody typically contains a PRO polypeptide or anti- PRO-nucleic acid molecules or anti-PRO nucleic acid molecules contained in cells expressing the PRO antibody.

The term " regulatory sequence " is a DNA sequence necessary for the expression of coding sequences operably linked in a particular host organism. Suitable regulatory sequences for prokaryotes include, for example, promoters, optionally operator sequences, and ribosome binding sites. Eukaryotic cells are known to utilize promoters, polyadenylation signals and enhancers.

A nucleic acid is " operably linked " when placed in a functional relationship with another nucleic acid sequence. For example, the DNA of a full-length or secretory leader is operably linked to the DNA of the polypeptide when expressed as a whole protein in its pre-secreted form, and the promoter or enhancer is capable of effecting transcription of the polypeptide sequence The ribosome binding site is operably linked to the coding sequence when it is placed to facilitate translation. Generally, " operably linked " means that the DNA sequences to be ligated are located adjacent to each other, and in the case of a secretory leader, not only located adjacent but also within the same reading frame. However, the enhancer does not need to be located contiguously. Linking is accomplished by ligation at convenient restriction sites. If such sites are not present, synthetic oligonucleotide adapters or linkers are used according to conventional practice.

The " stringency " of the hybridization reaction is readily determinable by those skilled in the art and is generally an empirical calculation that depends on probe length, wash temperature, and salt concentration. Generally, longer probes require higher temperatures for proper annealing, and shorter probes require lower temperatures. Hybridization generally depends on the ability of the denatured DNA to be re-annealed when the complementary strands are in an environment below their melting temperature. The higher the degree of desired homology between the probe and the hybridizable sequence, the higher the relative temperature that can be used. Thus, the higher the relative temperature, the more stringent the reaction conditions, while the lower the relative temperature, the less stringent the reaction conditions. See Ausubel et al., Current Protocols in Molecular Biology, Wiley Interscience Publishers (1995) for more information and descriptions regarding the severity of the hybridization reaction.

As used herein, "stringent conditions" or "stringent conditions" means (1) conditions of low ionic strength and high temperature conditions, such as 0.015 M sodium chloride / 0.0015 M sodium citrate / 0.1% sodium dodecyl sulfate (2) 50 mM sodium phosphate buffer (pH 6.5) / 0.1% bovine serum (pH 6.5) containing formamide, for example, 42 캜, 750 mM sodium chloride and 75 mM sodium citrate at the time of hybridization (3) 50% formamide, 5 x SSC (0.75 M NaCl, 0.075 &lt; RTI ID = 0.0 &gt; Sodium citrate), 50 mM sodium phosphate (pH 6.8), 0.1% sodium pyrophosphate, 5 x Denhardt's solution, sonicated salmon sperm DNA (50 ug / ml), 0.1% SDS, and 10% dextran sulfate 42 [deg.] C, 0.2 x SSC (sodium chloride / sodium citrate) at 42 [deg.] C, and 55 Washed in 50% formamide, to perform a high-stringency wash with 0.1 x SSC containing EDTA at a 55 ℃.

The term " moderate stringency conditions ", as described in Sambrook et al., Molecular Cloning: A Laboratory Manual, New York: Cold Spring Harbor Press 1989), hybridization conditions that are less stringent than those described above , Temperature, ionic strength and% SDS). Examples of moderately stringent conditions include 20% formamide, 5 x SSC (150 mM sodium chloride, 15 mM trisodium citrate), 50 mM sodium phosphate (pH 7.6), 5 x Denhardt's solution, 10% dextran sulfate and 20 mg / ml of truncated salmon semen-modified DNA, followed by washing the filter with 1 x SSC at about 37-50 &lt; 0 &gt; C. Skilled artisans will appreciate how to adjust the temperature, ionic strength, and the like necessary to meet such factors as probe length and the like.

As used herein, the term " epitope tagged " refers to a chimeric polypeptide comprising a PRO polypeptide linked to a " tag polypeptide ".Quot; tag polypeptide " is sufficiently short that it will have sufficient residues to provide an epitope sufficient to make it, but will not interfere with the activity of the PRO polypeptide bound. It is desirable that the tag polypeptide is so unique that the antibody to itself does not substantially cross-react with other epitopes. Suitable tag polypeptides generally have at least six amino acid residues and typically have about 8 to 50 amino acid residues (preferably about 10 to 20 residues).

&Quot; Active " or " active " in the context of a PRO variant refers to the form (s) of a PRO protein that retains the biological and / or immunological activity of a native or naturally occurring PRO polypeptide.

"Biological activity" in the context of molecules (eg, organic or inorganic small molecules, peptides, etc.) capable of antagonizing a PRO polypeptide that can be identified by the screening assays disclosed herein, binds or forms a conjugate with a PRO polypeptide identified herein Is used to refer to the ability of a molecule to either interfere with the interaction of a PRO polypeptide with other cellular proteins or otherwise inhibit the transcription or translation of the PRO polypeptide. In particular, the preferred biological activity includes sympathomimetic activity that affects vascular-affecting systemic diseases, such as diabetes, as well as diseases and cancers of the arteries, capillaries, veins and / or lymphatic vessels.

The term " antagonist " is used in its broadest sense and refers to the biological activity of a native PRO polypeptide disclosed herein, for example, partially or completely blocking, inhibiting or neutralizing the activity of at least one of mitogenic or angiogenic activity, All molecules are referred to collectively. An antagonist of a PRO polypeptide may act by disabling the binding of the PRO polypeptide to the cell receptor thereby disabling or killing the cell activated by the PRO polypeptide or by interfering with activation of the vascular endothelial cell after binding of the PRO polypeptide with the cell receptor . All such activities by PRO polypeptide antagonists will be considered as being the same for the purposes of the present invention. Said antagonist inhibits the pro-fragmentation promoting activity, angiogenic activity or other biological activity of the PRO polypeptide and is therefore useful for the treatment of tumors and especially solid malignant tumors, rheumatoid arthritis, psoriasis, atherosclerosis, diabetic retinopathy and other retinopathies, Diseases characterized by undesired excessive angiogenesis, including post-follicle hyperplasia, age-related macular degeneration, neovascular glaucoma, angiomas, hyperthyroidism (including Graves' disease), corneal and other tissue grafts, and chronic inflammation Or diseases. Antagonists can also be used in the treatment of diseases or disorders characterized by undesired excessive vascular permeability, such as edema associated with brain tumors, ascites associated with malignancy, Meigs' syndrome, pulmonary inflammation, nephrotic syndrome, pericardial effusion (e.g. associated with pericarditis) It is useful for the treatment of pleural effusion. Similarly, the term &quot; agonist &quot; is used in its broadest sense and collectively refers to any molecule that mimics the biological activity of a native PRO polypeptide disclosed herein. Suitable agonist or antagonist molecules specifically include antibodies or antibody fragments of agonists or antagonists, fragments or amino acid sequence variants of native PRO polypeptides, peptides, small organic molecules, and the like.

&Quot; Small molecule " is defined herein as having a molecular weight of less than about 500 daltons.

As used herein, the term " PRO polypeptide receptor " refers to a cell receptor for a PRO polypeptide, typically a cell-surface receptor found on vascular endothelial cells, as well as variants thereof that have the ability to bind to PRO polypeptides.

&Quot; Antibodies " (Ab) and " immunoglobulins " (Ig) are glycoproteins that have the same structural characteristics. Antibodies exhibit binding specificity for a particular antibody, but immunoglobulins include both antibodies and other antibody-like molecules without antigen specificity. For example, polypeptides that are antibody-like molecules without antigen specificity are produced at low concentrations in the lymphatic system and are produced at high concentrations in the myeloma. The term " antibody " is used in its broadest sense and specifically includes multispecific antibodies (e. G., Bispecific antibodies) formed from intact monoclonal antibodies, polyclonal antibodies, two or more intact antibodies, And exhibit biological activity), but are not limited thereto.

&Quot; Natural antibody " and " natural immunoglobulin " are heterotetrameric glycoproteins of about 150,000 daltons, usually consisting of two identical light chains (L) and two identical heavy chains (H). Although each light chain is bonded to the heavy chain by one covalent disulfide bond, the number of disulfide bonds varies between the heavy chains of the various immunoglobulin isomers. Each heavy chain and light chain also has a regular intra-chain disulfide bridging that is spaced apart. At one end of each heavy chain is the variable domain (V _H ) following many invariant domains. There is a variable domain (V _L ) at one end of each light chain and a constant domain at the other end, the constant domain of the light chain is aligned with the first constant domain of the heavy chain and the light chain variable domain is aligned with the variable domain of the heavy chain . It is believed that certain amino acid residues form junctions between the light chain variable domain and the heavy chain variable domain.

The term " variable " means that a portion of the variable domain is broadly dissimilar in sequence among antibodies and is used for the binding of a particular antigen to each specific antibody, and for the specificity of each particular antibody to a particular antigen. However, the variability is not evenly distributed throughout the variable domains of the antibody. Variables are concentrated in three fragments called complementarity-determining regions (CDRs) or hypervariable regions in both the light chain and heavy chain variable domains. The higher conserved portion of the variable domain is called the framework region (FR). The variable domains of the native heavy and light chains each comprise four FR regions that are predominantly in the beta -sheet structure, connected by three CDRs, wherein the three CDRs form loops connecting the beta -sheet structure, And forms a part of the? -Shake structure. The CDRs of each chain are very close together by the FR region and contribute to the formation of the antigen-binding site of the antibody along with the CDRs of the other chain (Kabat et al., NIH Publ. No. 91-3242, Vol. I, pages 647-669 (1991)). The constant domains are not directly involved in binding the antibody to the antigen, but exhibit various effector functions such as antibody participation in antibody-dependent cytotoxicity.

An " antibody fragment " includes a portion of a whole antibody, preferably an antigen binding region or variable region of an intact antibody. Examples of antibody fragments include Fab, Fab ', F (ab') ₂ and Fv fragments; Diabody; Linear antibodies (Zapata et al., Protein Eng., 8 (10): 1057-1062 (1995); single chain antibody molecules; and multispecific antibodies formed from antibody fragments.

Papain degradation of the antibody produces two identical antigen binding fragments, the respective " Fab " fragments with single antigen binding sites, and the remaining named " Fc " fragments reflecting their ability to crystallize readily. Treatment of pepsin produces an F (ab ') ₂ fragment that has two antigen binding sites and is still cross-linked to the antigen.

&Quot; Fv " is a minimal antibody fragment comprising a complete antigen recognition and antigen binding site. This region consists of a dimer consisting of one light chain variable domain and one light chain variable domain that are tightly noncovalently bound. In this structure, three CDRs of each variable domain interact to form an antigen-binding site on the surface of the V _H -V _L dimer. In conclusion, six CDRs confer antigen binding specificity to the antibody. However, even a single variable domain (or half of an Fv that contains only three CDRs specific for an antigen) has a lower affinity than the entire binding site, but has the ability to recognize and bind to an antigen.

In addition, the Fab fragment contains the constant domain of the light chain and the first constant domain (CHl) of the heavy chain. The Fab 'fragment differs from the Fab fragment in that several residues were added to the carboxy terminus of the heavy chain CH1 domain comprising one or more cysteines from the antibody hinge region. Fab'-SH herein refers to Fab 'in which the cysteine residue (s) of the constant domain retain a free thiol group. F (ab ') ₂ antibody fragments were originally generated as several pairs of Fab' fragments with hinge cysteines between Fab 'fragments. Other chemical couplings of antibody fragments are also known.

The "light chain" of an antibody (immunoglobulin) derived from any vertebrate species is classified as one of two distinctly different types called kappa (κ) and lambda (λ) based on the amino acid sequence of the constant domain of the antibody .

Immunoglobulin can be classified into various classes according to the amino acid sequence of the constant domain of its heavy chain. There are five major classes of immunoglobulins, IgA, IgD, IgE, IgG and IgM, some of which are subclasses (isotypes), such as IgGl, IgG2, IgG3, IgG4, IgA and IgA2 Can be classified. The heavy chain constant domains corresponding to the various immunoglobulins are called alpha, delta, epsilon, gamma and mu, respectively. The subunit structure and the three-dimensional structure of various immunoglobulins are well known.

The term " monoclonal antibody " as used herein refers to an antibody obtained from a population of substantially allogeneic antibodies, i.e. individual antibodies that make up a population are identical except for possible naturally occurring mutations that may be present in minor amounts. Monoclonal antibodies are highly specific for a single antigenic site. In addition, each monoclonal antibody is directed against a single determinant on the antigen, as opposed to the conventional (polyclonal) antibody population, which typically includes a variety of antibodies to a variety of determinants (epitopes). In addition to the specificity of monoclonal antibodies, they are advantageous in that they are synthesized by hybridoma cultures that are not contaminated with other immunoglobulins. The modifier " monoclonal " indicates the characteristics of the antibody obtained from a substantial population of homologous antibodies, but should not be construed as requiring production of the antibody by any specific method. For example, a monoclonal antibody used in accordance with the present invention can be made by the hybridoma method first described in Kohler et al., Nature, 256: 459 (1975), or by recombinant DNA methods , U.S. Patent No. 4,816,567). "Monoclonal antibodies" are described, for example, in Clackson et al., Nature, 352: 624-628 (1991) and Marks et al., J. Mol. Biol., 222: 581-597 May also be isolated from the phage antibody library using techniques described in &lt; RTI ID = 0.0 &gt;

The monoclonal antibody herein specifically includes a " chimeric " antibody (immunoglobulin), wherein in the chimeric antibody, the heavy chain and / or light chain are part of an antibody or a particular antibody class or subclass The remainder of the chain is identical to or homologous to the corresponding sequence of the antibody, but includes antibodies derived from another species or antibodies belonging to another antibody class or subclass, as well as fragments of such antibodies, if they exhibit the desired biological activity (US Pat. No. 4,816,567; Morrison et al., Proc. Natl. Acad. Sci. USA, 81: 6851-6855 (1984)).

A "humanized" form of a non-human (e.g., murine) antibody includes a chimeric immunoglobulin, an immunoglobulin chain, or a fragment thereof (e.g., an Fv, Fab, Fab ', F (ab') ₂ or other antigen-binding subsequences). In most cases, the humanized antibody is a human immunoglobulin (recipient antibody) in which the recipient's CDR has been replaced with a non-human species (donor antibody) having the desired specificity, affinity and capacity, such as the mouse, rat or rabbit CDR residues. In some cases, the Fv FR residue of a human immunoglobulin is replaced with a corresponding non-human residue. In addition, the humanized antibody may comprise a recipient antibody and a residue not found in both the imported CDR or the framework sequence. Additional formulas are used to improve and maximize antibody performance. In general, the humanized antibody will consist essentially of one or more, and typically two, variable domains, wherein all or substantially all of the CDR regions within the variable domains correspond to the CDR regions of non-human immunoglobulins And all or substantially all of the FR regions are FR residues of the human immunoglobulin sequence. In addition, the humanized antibody will preferably comprise at least a portion of the immunoglobulin constant region (Fc), typically a portion of a human immunoglobulin. For further details, see Jones et al., Nature, 321: 522-525 (1986); Reichmann et al., Nature, 322: 323-329 (1988); and Presta, Curr. Op. Struc. Biol. , 2: 593-596 (1992)). Humanized antibodies include PRIMATIZED (TM) antibodies derived from antibodies produced by immunizing macaque monkeys with the antigen-binding region of the antibody as the desired antigen.

A " single chain Fv " or " sFv " antibody fragment comprises the V _H and V _L domains of an antibody, wherein these domains are present in a single polypeptide chain. Preferably, the Fv polypeptide additionally comprises a polypeptide linker between the V _H and V _L domains, which allows the sFv to form the desired structure for antigen binding. 113, Rosenburg and Moore, eds. (Springer-Verlag: New York, 1994), pp. 269-315) for the investigation of sFv.

The term "dia body (diabody)" in the same polypeptide chain (V _H -V _L) light chain variable domain (V _L) with a small antibody, the two antigen binding site comprising a heavy chain variable domain (V _H) connected to the in It is a fragment. By using a linker that is too short to pair two domains on the same chain, the domain is forcedly paired with the complementary domain of the other chain to generate two antigen binding sites. Diabodies are described in more detail in, for example, EP 404,097, WO 93/11611 and Hollinger et al., Proc. Natl. Acad. Sci. USA, 90: 6444-6448 (1993).

An " isolated " antibody is an antibody that has been identified and / or recovered from a component of its natural environment. Contaminants in his natural environment are substances that interfere with the diagnostic or therapeutic uses of the antibody, and may include enzymes, hormones and other monovalent or non-hydrophobic solutes. In a preferred embodiment, the antibody is purified (1) to an extent of greater than 95% by weight, most preferably greater than 99% by weight, as determined by the Lowry method, or (2) or (3) SDS &lt; RTI ID = 0.0 &gt; (SDS) &lt; / RTI &gt; under reducing or nonreducing conditions using coomassie blue, or preferably silver stain, -PAGE will be refined to appear as a single band. The isolated antibody comprises an in situ antibody in the recombinant cell since there will be no more than one component in the natural environment of the antibody. However, the isolated antibody will generally be purified by one or more purification steps.

&Quot; Label " when used herein refers to a detectable compound or composition that is directly or indirectly conjugated to an antibody to produce a " labeled " antibody. The label can be detected by itself (radioactive isotope label or fluorescent label) or, if the label is an enzyme, it can catalyze the chemical change of the detectable substrate compound or composition. Radionuclides that can serve as detectable labels include, for example, I-131, I-123, I-125, Y-90, Re-188, At-211, Cu- . The label may be undetectable, such as toxins.

&Quot; Solid phase " means a non-aqueous matrix to which an antibody of the invention may be attached. Examples of the solid phase to be considered here include those formed partially or entirely of glass (for example, a controlled pore glass), polysaccharides (for example, agarose), polyacrylamides, polystyrene, polyvinyl alcohol, . In certain embodiments, depending on the context, the solid phase may be a well of the assay plate, and in other embodiments, the solid phase may be a purification column (e. G., Affinity chromatography column). The term also includes non-continuous solid phases of individual particles such as those described in U.S. Patent No. 4,275,149.

&Quot; Liposomes " are small vesicles composed of lipids, phospholipids and / or surfactants useful for delivering drugs (e. G., PRO polypeptides or antibodies thereto) to mammals. The components of the liposomes are typically arranged in bilayer form similar to the lipid alignment of biological membranes.

As used herein, the term " immunoadhesin " refers to an antibody-like molecule that combines the effector function of an immunoglobulin constant domain with the binding specificity of a heterologous protein (adhesin). Structurally, the immunoadhesin comprises a combination of an immunoglobulin constant domain sequence with an amino acid sequence that exhibits the desired binding specificity (i. E., &Quot; heterologous ") rather than the antigen recognition and binding site of the antibody. The adhered portion of the immunoadhesin molecule is typically a contiguous amino acid sequence comprising at least the binding site of the receptor or ligand. The immunoglobulin constant domain sequence in the immunoadhesin is selected from the group consisting of IgG-1, IgG-2, IgG-3, IgG-4 subtypes, IgA (including IgA-1 and IgA-2), IgE, IgD, &Lt; / RTI &gt;

II. Compositions and Methods of the Invention

A. PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 and PRO887 mutants

In addition to the full-length native sequences PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 and PRO887 polypeptides described herein, PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 and PRO887 variants are also contemplated. PRO189, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885, and PRO887 mutants can be obtained by substituting appropriate nucleotide changes with PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, , PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885, or PRO887 DNA and the desired PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, , PRO879, PRO882, PRO885 or PRO887 polypeptides. Those skilled in the art will appreciate that the amino acid changes can be altered by altering the number or position of the glycosylation sites or by altering the anchorage properties of the membranes, such as PRO179, PRO264, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882 , &Lt; / RTI &gt; PRO885 and PRO887.

The full-length native sequences PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887 described herein; Or variants in the various domains of PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887 described herein are described, Can be produced using any of the conservative and non-conservative mutagenesis techniques and guidelines disclosed in U.S. Pat. No. 5,364,934. The mutations may be selected from the group consisting of PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO864, PRO864, PRO764, PRO724, PRO279, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO833, Deletion or insertion of one or more codons that encode PRO878, PRO879, PRO882, PRO885 or PRO887. Optionally, one or more amino acids present in one or more of the PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887 domains may be replaced by any other amino acid Mutate. Amino acid residues that can be inserted, substituted or deleted without adversely affecting the desired activity are selected from the group consisting of PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, By comparing the sequence of PRO887 with the sequence of a known homologous protein molecule and minimizing the change of the amino acid sequence in the region of high homology. Amino acid substitutions may be the substitution of one amino acid with another amino acid having similar structure and / or chemical properties, e. G., The substitution of leucine with serine, i. E. Conservative substitution of amino acids. Insertion or deletion may optionally be insertion or deletion of about 1 to 5 amino acids. Acceptable mutations can be determined by systematically inserting, deleting, or substituting amino acids in the sequence, and testing mutants generated for activity exhibited by full-length or mature native sequences.

In a specific embodiment, conservative substitutions of interest are shown in Table 3 with the heading of preferred substitutions. When the biological activity is changed by such a substitution, more substantial changes, referred to as exemplary substitutions in Table 3 below or described in more detail below for amino acid classes, are introduced and the products screened.

<Table 3>

Substantial modifications in the function or immunological identity of the PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887 polypeptides, (B) retaining the charge or hydrophobicity of the molecule at the target site, or (c) significantly changing its effect of retaining the side-chain with a large volume, as the structure of the polypeptide backbone, e.g., as a sheet or helical structure, Lt; / RTI &gt; Naturally occurring residues can be divided into the following groups according to their common branching characteristics:

(1) hydrophobicity: norleucine, met, ala, val, leu, ile;

(2) Neutral hydrophilic: cys, ser, thr;

(3) Acid: asp, glu;

(4) Basicity: asn, gln, his, lys, arg;

(5) Residues that affect chain orientation: gly, pro; And

(6) aromatic; trp, tyr, phe.

Non-conservative substitutions will replace one member of the group with another. In addition, such substituted moieties may be introduced at conservative substitution sites, or more preferably at the rest (non-conserved) sites.

And can be mutated using methods known in the art, such as oligonucleotide-mediated (site-specific) mutagenesis, alanine scanning, and PCR mutagenesis. Site-directed mutagenesis [Carter et al., Nucl. Acids Res. , &Lt; / RTI &gt; 13 : 4331 (1986); Zoller et al., Nucl. Acids Res. , 10: 6487 (1987)], cassette mutagenesis [Wells et al, Gene, 34 :.. 315 (1985)], restriction selection mutagenesis [Wells et al, Philos. Trans. R. Soc. London SerA, 317: 415 (1986 )] or PRO179 of the present invention was applied to the DNA cloning technology other known, PRO238, PRO364, PRO844, PRO846 , PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879 , PRO882, PRO885 or PRO887 variant DNA.

In addition, scanning amino acid analysis can be performed to identify one or more amino acids along the contiguous sequence. Preferred scanning amino acids are relatively small neutral amino acids. Such amino acids include alanine, glycine, serine, and cysteine. Alanine is a typical preferred scanning amino acid among these, since it is less likely to eliminate beta-carbon side chains and alter the backbone structure of the mutant [Cunningham and Wells, Science , 244 : 1081-1085 (1989)]. In addition, alanine is particularly preferred because it is the most common amino acid. Also, alanine is frequently found in both buried and exposed sites (Creighton, The Proteins , (WH Freeman & Co., NY); Chothia, J. Mol. Biol. , &Lt; / RTI &gt; 150 : 1 (1976)]. An isoteric amino acid can be used if the alanine substitution does not produce a suitable amount of the variant.

B. PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885,

Covalent bond formulas of PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 and PRO887 are included in the scope of the present invention. One form of the covalently bonded formula is reacted with a selected side chain, N-terminal or C-terminal residue of PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, And the target amino acid residues of the PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887 polypeptides. Derivatization with a dual functional agent can be carried out using, for example, anti-PR179, anti-PRO238, anti-PRO364, anti-PRO844, anti-PRO846, anti-PRO1760, anti- PRO205, anti- PRO is cross-linked to an insoluble support matrix or surface for use in a method for purifying PRO840, anti-PRO877, anti-PRO878, anti-PRO879, anti-PRO882, anti-PRO885 and anti- It is useful to combine. Commonly used crosslinking agents are, for example, 1,1-bis (diazoacetyl) -2-phenylethane, glutaraldehyde, N-hydroxysuccinimide esters such as 4-azidic salicylic acid ester, Homobifunctional imidoesters including disuccinimidyl esters such as 3,3'-dithiobis (succinimidyl propionate), bifunctional maleimides such as bis-N-maleimido-1,8-octane and Methyl-3 - [(p-azidophenyl) dithio] propioimidate.

Other formulas include deamidating the glutaminyl and asparaginyl residues with the corresponding glutamyl and aspartyl residues, respectively; Hydroxylation of proline and lysine; Phosphorylation of the hydroxyl group in the seryl or threonyl residue; Methylation of alpha-amino groups in lysine, arginine and histidine side chains [TE Creighton, Proteins: Structure and Molecular Properties , WH Freeman & 79-86 (1983); Acetylation of the N-terminal amine; And amidation of C-terminal carboxyl groups.

Another type of covalent bond modification of the PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887 polypeptides, And changes in the glycosylation pattern. As used herein, the term " altered native glycosylation pattern " refers to any one or more of the carbohydrates found in the native sequences PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885, And / or the natural sequences PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205 (which are achieved by eliminating the potential glycosylation site or by eliminating the glycosylation by chemical and / , &Lt; / RTI &gt; PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887. The term also includes qualitative changes in the glycosylation of natural proteins, including changes in the nature and proportion of the various carbohydrate residues present.

Addition of glycosylation sites to PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887 polypeptides can be achieved by altering the amino acid sequence . The alteration may be accomplished, for example, by adding one or more serine or threonine residues to the native sequence PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885, This can be accomplished by replacing the native sequence polypeptide with the residue (in the case of O-linked glycosylation sites). The amino acid sequences of PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887 are particularly preferably selected from the group of preselected bases Can be arbitrarily altered through changes at the DNA level by mutating the DNA encoding the PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 and PRO887 polypeptides have.

Another means of increasing the number of carbohydrate moieties on the PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887 polypeptides is to add the glycoside to the polypeptide chemically Or by enzymes. Such methods are described, for example, in WO 87/05330, published September 11, 1987, and in Aplin and Wriston, CRC Crit. Rev. Biochem. , pp. 259-306 (1981).

The removal of the carbohydrate moieties present in the PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887 polypeptides can be achieved chemically, by enzymes, or by glycosylation Lt; RTI ID = 0.0 &gt; codon &lt; / RTI &gt; Chemical deglycosylation techniques are well known in the art and are described, for example, in Hakimuddin, et al., Arch. Biochem. Biophys. , 259 : 52 (1987) and Edge et al., Anal. Biochem. , 118 : 131 (1981). Enzymatic cleavage of carbohydrate residues on polypeptides can be achieved using a variety of endoglycosidases and exoglycosidases [Thotakura et al., Meth. Enzymol. , &Lt; / RTI &gt; 138 : 350 (1987)).

Other classes of covalent bond modifications of PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887 are disclosed in U.S. Patent Nos. 4,640,835, 4,496,689, PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882 in the manner described in US Pat. Nos. 4,301,144, 4,670,417, 4,791,192 or 4,179,337, , PRO885 and PRO887 polypeptides to one of a variety of non-proteinaceous polymers, for example, polyethylene glycol (PEG), polypropylene glycol or polyoxyalkylene.

Also, PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887 of the present invention can be used in combination with other heterologous polypeptides or amino acid sequences, May be modified in such a manner as to form a chimeric molecule comprising PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887.

In one embodiment of the invention, such chimeric molecules are selected from the group consisting of PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887. The epitope tag is generally located at the amino or carboxyl terminus of PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887. The presence of PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887 in this epitope-tag form is detected using an antibody against the tag polypeptide . In addition, introduction of an epitope tag results in the production of PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840 by affinity purification using an anti-tag antibody or other affinity matrix that binds to an epitope tag. , PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887 can be easily purified. A variety of tag polypeptides and their respective antibodies are known in the art. Examples include poly-histidine (poly-his) or poly-his-gly (poly-his-gly) tags; flu HA tag polypeptide and its antibody 12CA5 [Field et al., Mol. Cell. Biol. , 8 : 2159-2165 (1988); c-myc tag and its 8F9, 3C7, 6E10, G4, B7 and 9E10 antibodies [Evan et al., Molecular and Cellular Biology , 5 : 3610-3636 (1985)]; And the herpes simplex virus protein glycoprotein D (gD) tag and its antibody [Paborsky et al., Protein Engineering , 3 (6): 547-553 (1990)]. Other tag polypeptides include Flag-peptides [Hopp et al., BioTechnology , 6 : 1204-1210 (1988)], KT3 epitope peptides [Martin et al., Science , 255 : 192-194 (1992) Epitope peptides [Skinner et al., J. Biol. Chem. , 266 : 15163-15166 (1991)] and the T7 gene 10 protein peptide tag [Lutz-Freyermuth et al., Proc. Natl. Acad. Sci. USA , 87 : 6393-6397 (1990).

In another embodiment, the chimeric molecule is selected from the group consisting of PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887 and the immunoglobulin or immunoglobulin specific Region. &Lt; / RTI &gt; In the case of the bimodal form of the chimeric molecule (also referred to as &quot; immunoadhesin &quot;), such a conjugate may be the Fc region of an IgG molecule. The Ig conjugates are preferably selected from the group consisting of PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 and PRO887 polypeptides in place of one or more variable domains in the Ig molecule Soluble (deleted or inactivated transmembrane domain). In a particularly preferred embodiment, the immunoglobulin conjugate comprises the hinge, CH2 and CH3, or hinge, CH1, CH2 and CH3 regions of the IgG1 molecule. Methods for producing immunoglobulin conjugates are described in U.S. Patent No. 5,428,130, issued June 27, 1995.

C. Preparation of PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 and PRO887

The present invention provides a newly identified and isolated nucleotide sequence that encodes a polypeptide termed herein PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887 . In particular, cDNAs encoding PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887 polypeptides were identified, as described in more detail in the Examples below. Respectively. The PRO number of proteins produced in separate expression rounds may vary, but the UNQ number will be unique to any given DNA and coded protein and will not change. However, in the present application, the term " DNA16451-1388 ", DNA35600-1162, DNA47365-1206, DNA59838-1462, DNA44196-1353, DNA76532-1702, DNA30868, DNA34433, DNA41374, DNA53987, DNA58120, DNA58121, DNA58122, DNA58125, As well as other natural homologues and variants included in the above definition of PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 and PRO887, Quot ;, " PRO329 ", " PRO840 ", " PRO846 ", & , "PRO877", "PRO878", "PRO879", "PRO882", "PRO885" or "PRO887".

The following discussion will be directed to the transformation of a vector containing a nucleic acid encoding a predominantly PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887 polypeptides Or culturing the transfected cells to produce PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887. Of course, it is also contemplated to produce PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887 polypeptides using other methods known in the art . For example, the PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887 polypeptide sequences or fragments thereof are prepared by direct peptide synthesis using solid phase technology can be [literature (Stewart et al, Solid -Phase Peptide Synthesis, WH Freeman Co., San Francisco, CA (1969); Merrifield, J. Am Chem Soc, 85:.... 2149-2154 (1963)) . In vitro protein synthesis can be performed using manual or automated methods. Automated synthesis can be performed, for example, using an Applied Biosystems Peptide Synthesizer (Foster City, CA) according to the manufacturer's instructions. Various parts of PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887 are chemically synthesized separately and combined by chemical or enzymatic methods The full-length PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887 polypeptides can be produced.

i . Isolation of DNA encoding the PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887

The DNA encoding the PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887 polypeptides is PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, , PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887 to obtain a detectable level of the mRNA. Thus, the present invention encompasses the use of the human PRO179, human PRO238, human PRO364, human PRO844, human PRO846, human PRO860, human PRO205, human PRO201, human PRO333, human PRO840, human PRO877, human PRO878, human PRO879, human PRO882, The coding DNA can conveniently be obtained from cDNA libraries derived from human tissue, as described in the Examples. Also, genes encoding PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887 polypeptides can be obtained from a genomic library or obtained by oligonucleotide synthesis can do.

The library includes probes designed to identify a desired gene or a protein encoded by the gene (e.g., PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, An antibody against a PRO882, PRO885 or PRO887 polypeptide, or an oligonucleotide composed of from about 20 to 80 or more bases). Screening of the cDNA or genomic library using the selected probe can be carried out using standard methods, for example as described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, Can be performed. An alternative method of isolating the gene encoding the PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887 is to use PCR methods [Sambrook et al ., Supra ; Dieffenbach et al., PCR Primer: A Laboratory Manual (Cold Spring Haror Laboratory Press, 1995).

The following examples illustrate techniques for screening cDNA libraries. The oligonucleotide sequences selected as probes should be of sufficient and clear sequence to minimize undesired results. The oligonucleotide is preferably labeled so that it can be detected upon hybridization with the DNA of the library to be screened. Methods of labeling are well known in the art and include the use of radiolabeled, biotinylated or enzymatic labels such as ³² P-labeled ATP. Stringency and hybridization conditions including the high stringency of the medium is provided in the literature (Sambrook et al., Supra).

The sequence identified in the library screening method can be aligned with other known sequences available from public databases such as GenBank or from other proprietary sequence databases. Sequence identity (at the amino acid or nucleotide level) within a defined region of a molecule or across a full-length sequence is determined through sequence alignment using computer software programs that use various algorithms to measure homology, such as ALIGN, DNAstar, and INHERIT .

If the nucleic acid in the protein coding sequence is first necessary to use the estimated amino acid sequence disclosed herein, and the reference to detect the precursor using conventional methods of primer extension as described in (Sambrook et al., Supra), selected cDNA or Screening the genomic library, and processing an intermediate of the mRNA that is not reverse transcribed into cDNA.

ii. Screening and transformation of host cells

For the production of PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887, the host cells are transfected with the expression or cloning vectors described herein And cultured in a conventional nutrient medium modified for the purpose of promoting, inducing a transformant, screening a transformant or amplifying a gene encoding a target sequence. Those skilled in the art can select culture conditions such as medium, temperature, pH, etc., without performing unnecessary experiments. In general, the principles, protocols, and techniques for maximizing the productivity of cell cultures are described in Mammalian Cell Biotechnology: a Practical Approach , M. Butler, ed. (IRL Press, 1991) and Sambrook et al., May be found in the above document.

Transfection methods, such as CaPO ₄ treatment and electroporation, are known to those skilled in the art. Depending on the host cell used, transformation is carried out using standard techniques suitable for such cells. For other cells that contain substantial cell wall, or a prokaryotic cell, in general, the literature uses a calcium treatment using calcium chloride method as described in (Sambrook et al., Supra), or electroporation. Infection with Agrobacterium tumefaciens has been shown to inhibit the growth of certain plant cells as described in Shaw et al., Gene , 23 : 315 (1983), and WO 89/05859, published Jun. 29, Lt; / RTI &gt; For mammalian cells without such cell walls, the calcium phosphate precipitation method of Graham and van der Eb, Virology , 52 : 456-457 (1978) can be used. General characteristics of mammalian cell host system transfection are described in U.S. Patent No. 4,399,216. Transformation into yeast is generally described in Van Solingen et al., J. Bact. , 130 : 949 (1977) and Hsiao et al., Proc. Natl. Acad. Sci. (USA) , 76 : 3829 (1979). However, other methods of introducing DNA into cells, such as nuclear microinjection, electroporation, bacterial protoplast fusion with intact cells, or polycations, such as polybrene or polyornithine, may also be used . See Keown et al., Methods in Enzymology , 185: 527-537 (1990) and Mansour et al., Nature , 336: 348-352 (1988) for a variety of techniques for transforming mammalian cells do.

Suitable host cells for cloning or expressing the DNA in the vector herein include prokaryotic cells, yeast or higher eukaryotic cells. Suitable prokaryotic cells include true bacteria, e. G., Gram negative or gram positive organisms, e. But is not limited to, Enterobacteriaceae such as E. coli . A variety of this. Coli strains, e. E. coli K12 strain MM294 (ATCC 31,446); E. coli X1776 (ATCC 31, 537); Coli strains W3110 (ATCC 27,325) and K5 772 (ATCC 53,635) are readily available. Other suitable prokaryotic host cells include Escherichia , e. E. coli, Enterobacter (Enterobacter), El Winiah (Erwinia), keulrep when Ella (Klebsiella), Proteus (Proteus), Salmonella (Salmonella), e.g., Salmonella typhimurium (typhimurium), Serratia marcescens (Serratia), for example, . g., Serratia dry process intestinal bacteria (Enterobacteriaceae), such as a non-kanseu (marcescans) and Shigella (Shigella). Subtilis and non-subtilis. Bacillus such as licheniformis (e.g., B. licheniformis 41P as described in DD 266,710, dated April 12, 1989), p. Rugi the Oh and a Pseudomonas (Pseudomonas), and Streptomyces (Streptomyces), such as industrial (aeruginosa). These examples are merely illustrative and not restrictive. The strain W3110 is a particularly preferred host or parental host since it is a host strain common to recombinant DNA product fermentation. Preferably, the host cell secretes a minimal amount of proteolytic enzyme. For example, strain W3110 may be modified to result in a mutation of the gene encoding the endogenous protein of the host, and examples of such a host may be the. E. coli W3110 strain 1A2, with complete genotype tonA ptr3. E. coli W3110 strain 9E4, complete genotype tonA ptr3 phoA E15 (argF-lac) 169 degP ompT kan ^r . E. coli W3110 strain 27C7 (ATCC 55,244), complete genotype tonA ptr3 phoA E15 (argF-lac) 169 degP ompT rbs7 ilvG kan ^r . E. coli W3110 strain 37D6, strain 37D6 with a non-kanamycin resistant degP deletion mutant. E. coli W3110 strain 40B4, and the periplasmic protease mutant chain disclosed in U.S. Patent No. 4,946,783, issued August 7, 1990. Coli strains. Alternatively, in vitro cloning methods, such as PCR or other nucleic acid polymerase reactions, are suitable.

In addition to prokaryotic cells, eukaryotic microbes such as filamentous fungi or yeast are suitable for vectors encoding PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887. Cloning or expression host. Saccharomyces cerevisiae is a lower eukaryotic host microorganism commonly used. Other microorganisms include Schizosaccharomyces pombe (Beach and Nurse, Nature , 290: 140 [1981]; EP 139,383, published May 2, 1985); Kluyveromyces hosts (U.S. Patent No. 4,943,529; Fleer et al., Bio / Technology , 9: 968-975 (1991)); Lactis (lactis) (MW98-8C, CBS683, CBS4574;.. Louvencourt et al, J. Bacteriol, 737 [1983]), Kay. Plastic jilriseu (fragilis) (ATCC 12,424), K. Bulgaria kusu (bulgaricus) (ATCC 16,045), K. Wike lamina (wickeramii) (ATCC 24,178), K. Waltii (ATCC 56,500), Kay. Drosophilarum (ATCC 36,906; Van den Berg et al., Bio / Technology , 8: 135 (1990)), Kay. Thermotolerans and K. Marxianus ; Yarrowia (EP 402,226); Pichia pastoris (EP 183,070; Sreekrishna et al., J. Basic Microbiol. , 28: 265-278 [1988]); Candida (Candida); Trichoderma reesia (EP 244,234); Neurospora crassa (Case et al., Proc. Natl. Acad. Sci. USA , 76: 5259-5263 [1979]); Schwanniomyces , for example, Siebenia occidentalis (EP 394,538, published October 31, 1990); And filamentous fungi such as Neurospora, Penicillium , Tolypocladium (WO 91/00357 published Jan. 10, 1991) and Aspergillus host, For example, a. Nidul lance (nidulans) (Ballance et al ,, Biochem Res Commun Biophys, 112: 284-289 [1983]; Tilburn et al, Gene, 26:..... 205-221 [1983]; Yelton et al,. Proc. Natl. Acad. Sci. USA , 81: 1470-1474 [1984]) and AA. Needle germanium (niger): a (Kelly and Hynes, EMBO J., 4 475-479 [1985]). Herein it is suitable for a methyl auxotrophic yeast, and the yeast century Cronulla (Hansenula), Candida (Candida), the claw exciter Mosquera (Kloeckera), blood teeth, saccharose to my process, Sat. rulrop sheath (Torulopsis) and also torulra ( Rhodotorula ), but are not limited to, yeast capable of propagating on methanol. A list of specific species that are examples of these types of yeast can be found in [C. Anthony, The Biochemistry of Methylotrophs , 269 (1982).

Suitable host cells for expression of the nucleic acid encoding glycosylated PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887 are derived from multicellular organisms . Examples of invertebrate cells include insect cells and plant cells such as Drosophila S2 and Spodoptera Sf9. Examples of useful mammalian host cell lines include Chinese hamster ovary (CHO) cells and COS cells. More specific examples include monkey kidney CV1 cell line (COS-7, ATCC CRL 1651) transformed by SV40, human embryonic kidney cell line (293 cells subcloned for proliferation in suspension culture, Graham et al., J Gen. Virol. , 36: 599 (1997)), Chinese hamster ovary cells / -DHFR (CHO, Urlaub and Chasin, Proc. Natl. Acad. Sci. USA , 77: 4216 (1980)), mouse Sertoli cells TM4, Mather, Biol Reprod, 23 :.. 243-251 (1980)), human lung cells (W138, ATCC CCL 75), human liver cells (Hep G2, HB 8065) and mouse mammary gland tumor (MMT 060562, ATCC CCL51) . One skilled in the art can select suitable host cells.

iii. Selecting and Using Replicable Vectors

(Eg, cDNA or genomic DNA) encoding the PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, Amplification) or expression in a replicable vector. Various vectors can be easily obtained. For example, the vector may be in the form of a plasmid, a cosmid, a viral particle or a phage. Suitable nucleic acid sequences may be inserted into the vector by a variety of methods. Generally, DNA is inserted into the appropriate restriction endonuclease site (s) using techniques known in the art. When a sequence is secreted, the vector component generally includes, but is not limited to, one or more signal sequences, origin of replication, one or more marker genes, enhancer elements, promoters and transcription termination sequences. The production of suitable vectors containing one or more of the above components utilizes standard ligation techniques known to those skilled in the art.

Not only can they be produced by direct recombinant methods, but also the N-terminal of the mature protein or polypeptide can be produced by direct recombinant methods, as well as by the direct recombination method, such as PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, May be produced as a fusion polypeptide with a heterologous polypeptide, which may be another polypeptide or signal sequence with a specific cleavage site at the terminus. In general, the signal sequence may be a component of a vector, or it may be a vector that encodes the inserted PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885, Gt; DNA &lt; / RTI &gt; The signal sequence may be, for example, a prokaryotic signal sequence selected from the group of alkaline phosphatase, penicillinase, lpp or heat-stable intestinal endotoxin II leader. In the case of yeast secretion, the signal sequence may be, for example, a yeast invertase leader, an alpha factor leader (including Saccharomyces and Kluyveromyces alpha-factor leader (US Patent 5,010,182)), an acid phosphatase leader, Seed. A C. albicans glucoamylase leader (EP 362,179 published April 4, 1990), or a signal sequence described in WO 90/13646 published November 15, 1990. When expressed in mammalian cells, the protein may be secreted using a signal sequence and a viral secretory leader derived from a mammalian signal sequence, e. G., A secreted polypeptide of the same or related species.

Both expression and cloning vectors contain nucleic acid sequences that allow the vector to replicate in one or more selected host cells. Such sequences are known for a variety of bacteria, yeast and viruses. The origin of replication of the plasmid pBR322 is suitable for most Gram negative bacteria, the plasmid origin of 2μ is suitable for yeast, and the various viral origin (SV40, polyoma, adenovirus, VSV or BPV) It is useful.

Expression and cloning vectors will typically contain a selectable gene, also referred to as a selectable marker. Representative selectable genes include (a) proteins that confer resistance to antibiotics or other toxins, such as ampicillin, neomycin, methotrexate or tetracycline, (b) proteins that supplement nutritional deficiencies, or (c) For example, in the case of Bacillus , there is a gene encoding D-alanine racemase.

Examples of suitable selectable markers for mammalian cells are those capable of accepting nucleic acids encoding PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887 Lt; / RTI &gt; or &lt; RTI ID = 0.0 &gt; thymidine kinase. &Lt; / RTI &gt; When wild-type DHFR is used, suitable host cells are CHO cell lines without DHFR activity, see Urlaub et al, Proc. Natl. Acad. Sci. USA , 77: 4216 (1980). A suitable selection gene for use in yeast is the trp1 gene present in the yeast plasmid YRp7 [Stinchcomb et al., Nature , 282: 39 (1979); Kingsman et al., Gene , 7: 141 (1979); Tschemper et al., Gene , 10: 157 (1980)]. The trp1 gene provides selection markers for yeast mutants (e.g., ATCC 44076 or PEP4-1) that are unable to propagate in tryptophan-containing media [Jones, Genetics , 85: 12 (1977)].

Expression and cloning vectors can be operably linked to nucleic acid sequences encoding PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887, RTI ID = 0.0 &gt; promoter. &Lt; / RTI &gt; Promoters recognized by a variety of potential host cells are known. Promoters suitable for use in prokaryotic hosts include the? -Lactamase and lactose promoter systems [Chang et al., Nature , 275: 615 (1978); Goeddel et al., Nature , 281: 544 (1979)], alkaline phosphatase, tryptophan (trp) promoter system [Goeddel, Nucleic Acid Res. , &Lt; / RTI &gt; 8: 4057 (1980); EP 36,776], and hybrid promoters such as the tac promoter [deBoer et al., Proc. Natl. Acad. Sci. USA , 80: 21-25 (1983)]. In addition, the promoter used in the bacterial system may be a promoter operably linked to DNA encoding PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887 Shine-Dalgano (SD) sequence.

Examples of promoter sequences suitable for use in yeast hosts include 3-phosphoglycerate kinase [Hitzeman et al., J. Biol. Chem. , 255: 2073 (1980)] or other sugar degrading enzymes [Hess et al., J. Adv. Enzyme Reg. , &Lt; / RTI &gt; 7: 149 (1968); Holland, Biochemistry , 17: 4900 (1978)), for example, enolase, glyceraldehyde-3-phosphate dehydrogenase, hexokinase, pyruvate decarboxylase, phosphofructokinase, glucose- 6-phosphate isomerase, 3-phosphoglycerate mutase, pyruvate kinase, triosulfate isomerase, phosphoglucose isomerase, and a promoter for glucokinase.

Other yeast promoters that are inducible promoters with other advantages of transcription controlled by the propagation conditions include alcohol dehydrogenase 2, isocytocrome C, acid phosphatase, degrading enzymes associated with nitrogen metabolism, metallothionein, glyceraldehyde- 3-phosphate dehydrogenase, and an enzyme that acts on maltose and galactose utilization. Suitable vectors and promoters for use in yeast expression are further described in EP 73,657.

Nucleic acid transcripts from the vectors in mammalian host cells include, for example, poliomaviruses, puerile viruses, &lt; RTI ID = 0.0 &gt; papillomaviruses, &lt; / RTI &gt; (UK) 2,211,504, published July 5, 1989), adenovirus (e.g., adenovirus 2), cow papilloma virus, avian sarcoma virus, cytomegalovirus, retrovirus, hepatitis B virus and monkey virus 40 (SV40); &lt; / RTI &gt; A heterologous mammalian promoter, for example, an actin promoter or an immunoglobulin promoter; And heat-shock promoters, provided that the promoter is compatible with the host cell.

Transcription of DNA encoding PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887 by higher eukaryotic cells can be achieved by inserting an enhancer sequence into the vector Can be increased. Enhancers are generally cis-acting elements of about 10 to 300 bp DNA that act on the promoter to increase transcription. Many enhancer sequences are known to result from mammalian genes (globin, elastase, albumin, alpha-fetoprotein, and insulin). However, an enhancer will usually be used which is derived from eukaryotic viruses. Examples include the SV40 enhancer (bp 100-270) at the rear of the origin of replication, the cytomegalovirus early promoter enhancer, the polyoma enhancer at the rear of the replication origin, and the adenovirus enhancer. The enhancer may be spliced to the vector at the 5 'or 3' position of the sequence encoding PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887 , But it is preferably located at the 5 'site from the promoter.

In addition, expression vectors used in eukaryotic host cells (polynuclear cells derived from yeast, fungi, insects, plants, animals, humans or other multicellular organisms) will contain sequences necessary for transcription termination and mRNA stabilization. Such sequences are typically obtained from the 5 'and, often, 3' untranslated regions of eukaryotic cells or viral DNA or cDNA. These regions are transcribed as polyadenylation fragments in the untranslated portion of mRNA encoding PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887 Nucleotide fragment.

Vectors and hosts suitable for application in the synthesis of PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887 in recombinant vertebrate cell culture. Cells are described in Gething et al., Nature , 293: 620-625 (1981); Mantei et al., Nature , 281: 40-46 (1979); EP 117,060 and EP 117,058.

iv. Detection of gene amplification / expression

Gene amplification and / or expression can be performed, for example, using conventional Southern blotting, northern blotting to quantify transcription of mRNA [Thomas, Proc. Natl. Acad. Sci. USA , 77: 5201-5205 (1980)], direct blotting (DNA analysis), or in situ hybridization using appropriately labeled probes based on the sequences provided herein have. Alternatively, antibodies capable of recognizing a particular double-strand, including DNA duplexes, RNA duplexes, and DNA-RNA hybrid duplexes or DNA-protein duplexes, can be used. The antibody can be labeled and the assay can be performed if the double strand is bound to the surface and the presence of the antibody bound to the double strand can be detected when the double strand is formed on the surface.

Alternatively, gene expression can be measured by analysis of cell culture fluids or body fluids to directly quantitate the expression of the gene product and immunological methods such as immunohistochemical staining of cells or tissue sections. Antibodies useful for immunohistochemical staining and / or analysis of sample fluids may be monoclonal or polyclonal antibodies, and may be prepared in any mammal. Conveniently, synthetic peptides based on the DNA sequences provided herein, natural sequences PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887 polypeptides , Or for an exogenous sequence that is linked to DNA encoding a specific antibody epitope that is linked to DNA encoding PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887 Antibodies can be prepared.

v. Purification of polypeptides

Polypeptide form of PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887 can be recovered from the culture medium or host cell lysate. When the polypeptide binds to the membrane, it can be liberated from the membrane by using a suitable detergent solution (e.g., Triton-X TM 100) or by cutting with an enzyme. Cells used for the expression of nucleic acids encoding the PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887 polypeptides can be cryopreserved, , Mechanical pulverization, or cell lysing agents.

It may be desirable to purify PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887 polypeptides from the recombinant cell protein or polypeptide. Examples of suitable purification methods include fractionation on an ion exchange column; Ethanol precipitation; Reversed phase HPLC; Silica or cation exchange resins, for example chromatography on DEAE, chromatofocusing; SDS-PAGE; Ammonium sulfate precipitation; For example, gel filtration using Sephadex G-75; Protein A Sepharose column to remove contaminants such as IgG; And metal chelating columns for binding epitope tag forms of PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887 polypeptides. A variety of protein purification methods may be used, such methods are well known in the art and are described, for example, in Deutscher, Methods in Enzymology , 182 (1990); Scopes, Protein Purification: Principles and Practice , Springer-Verlag, New York (1982). The purification step (s) selected may be, for example, the production method used and the specific PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 It will depend on the properties of PRO887.

D. Use of PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887 Polypeptides

i. Test for cardiovascular-related activity, endothelial cell-related activity and angiogenic activity

Various assays may be used to test the polypeptides of the present invention for cardiovascular-related, endothelial-associated and angiogenic activities. Such assays include those described in the following examples.

Test assays for endothelin antagonist activity disclosed in U.S. Patent No. 5,773,414 include rat cardiac ventricular septal assay, which tests the ability of the polypeptide to inhibit iodinated endothelin-1 binding in receptor assays, rabbit kidney artery vascular smooth muscle cells Endocellin receptor binding assay method for measuring intact cell binding of radiolabeled endothelin-1, inositol phosphate accumulation assay for measuring functional activity in Rat-1 cells by measuring intracellular concentration of a second messenger, Arachidonic acid free assay, which measures the ability of additive compounds to reduce arachidonic acid stimulated with endothelin in smooth muscle, and in vitro (isolated blood vessel) studies using endothelial cells of male New Zealand rabbits, and Sprague-Dawley rats There are in vivo studies used.

Tissue regeneration activity assays include WO 95/16035 (bone cartilage, tendon); WO 95/05846 (neurons, nerve cells); And WO 91/07491 (skin, endothelial cells).

The wound-healing activity assay is described, for example, in Winter, Epidermal Wound Healing, Maibach, HI and Rovee, edited by Eaglstein and Mertz, J. Invest. Dermatol., 71: 382-384 (1978) , DT, eds (Year Book Medical Publishers, Inc., Chicago), pp. 71-112).

Endothelin B ₁ (ETB ₁₎ the step of binding to the receptor polypeptide and assays for screening test compounds related to the PRO polypeptide to regulate signal transduction activity provides a transformed host cell with DNA encoding endothelin B ₁ receptor polypeptide , the cells comprises the step of exposing to the test candidate, and for example, measuring an endothelin B ₁ receptor signal transduction activity, as described in U.S. Patent No. 5,773,223.

There are several different tests for cardiac hypertrophy. In vitro assays may induce the spread of myocardial cells in mature rats. In this assay, essentially as described in Piper et al., "Adult ventricular rat heart muscle cells" in Cell Culture Techniques in Heart and Vessel Research, HM Piper, ed. (Berlin: Springer-Verlag, 1990) (Male Sprague-Dawley) rats according to a modification of the method described in detail in US Pat. This method allows for the isolation of mature myocardial cells, and using this method, these cells are cultured for long periods in a rod-like phenotype. _{Phenylephrine} and prostaglandin F _2α (PGF _2α ) were found to induce spreading responses in these mature cells. Next, the inhibition of myocardial spread induced by PGF _2α or PGF _2α homologues (eg, fluprostanol) is tested as various potential inhibitors of cardiac hypertrophy.

One example of an in vivo assay is a test for the inhibition of hyperprostanil-induced hypercardia in vivo. This pharmacological model tests the ability of PRO polypeptides to inhibit rheumatic hypermesty in rats by subcutaneous injection of _fluprostanol (an agonist homolog of PGF2a). It is known that rats suffering from myocardial infarction-induced pathologic _ectropion have a high concentration of clinically extractable PGF ₂ alpha in their myocardium (Lai et al., Am. J. Physiol. (Heart Circ. Physiol. , 271: H2197-H2208 (1996)). Thus, factors capable of inhibiting the effect of fluprostenol on myocardial growth in vivo may be useful in the treatment of hypercardia. The effect of PRO polypeptide on hypercardia is determined by measuring the heart, ventricular, and left ventricular weights (normalized by body weight) for the fluoprostenol-treated rats not receiving the PRO polypeptide.

Another example of an in vivo assay is the pressure-overloaded-hypertrophic assay. For in vivo testing, the abdominal aorta of the test animal is typically contracted to induce pressure-hyperloading hypertrophy. In a typical protocol, rats (e. G., Male Wistar or Sprague-Dolly) are anesthetized and the abdominal aorta of each rat is narrowed beneath the diaphragm (Beznak M., Can. J. Biochem. Physiol. 985-94 (1995)). The aorta is incised and exposed, and the needle is placed next to the blood vessel. The suture is sutured around the needle to constrict the aorta, which is immediately removed and reduces the lumen of the aorta to the diameter of the needle. This method is described for example in Rossi et al., Am. Heart J., 124: 700-709 (1992) and O'Rourke and Reibel, PSEMB, 200: 95-100 (1992) .

In another in vivo assay, the effect of experimentally induced myocardial infarction (MI) on myocardial hypertrophy is measured. In rats, acute MI is induced by left coronary artery ligation and confirmed by electrocardiography. An apparently operated animal group is also prepared as a control animal. Initial data indicate the presence of hyperhidrosis in animal groups with MI that have been proven to increase the ratio of cardiac weight to body weight by 18% (Lai et al., Supra). Treatment of these animals with candidate polyneuropathic agents, such as PRO polypeptides, provides valuable information about the therapeutic potential of the candidate substance tested. This assay for inducing cardiac hypertrophy using Sprague-Dawley rats is described in more detail in U.S. Patent No. 5,773,415.

In the case of cancer, a variety of well-known animal models are used to better understand the role of genes identified herein in the development and pathology of cancer, and the efficacy of candidate therapeutics including other antagonists of natural PRO polypeptides such as antibodies and small molecule antagonists Can be tested. The in vivo properties of these models make it possible to predict responses in human patients. Animal models of tumors and cancers (e.g., breast, colon, prostate, lung, etc.) include non-recombinant and recombinant (transformed) animals. Non-recombinant animals include, for example, rodents (e.g., murine animals). Such models may be used to deliver tumor cells using standard techniques such as, for example, subcutaneous injection, tail vein injection, spleen transplantation, intraperitoneal transplantation, transplantation under a renal capsule, or orthotopic transplantation (e.g., colon cancer cells implanted in colon tissue) (See, for example, PCT Publication No. WO 97/33551, published September 18, 1997). The animal species most commonly used for oncology studies are probably immunodeficient mice, specifically nude mice. The nude mice are widely used for this purpose because of the fact that nude mice suffering from thymic hypoplasia or amenorrhoea could successfully function as hosts for human tumor xenografts. The homologous chromosomal recessive nu gene can be used in a variety of forms including, for example, ASW, A / He, AKR, BALB / c, B10.LP, C17, C3H, C57BL, C57, CBA, DBA, DDD, I / NZ / N, NZB, NZC, NZW, P, RIII and SJL. In addition, we have breed various other animals suffering from genetic immunodeficiency other than nude mice and have used it as a recipient of tumor xenotransplantation. For further details, see, for example, The Nude Mouse in Ocology Research, E. Boven and B. Winograd, eds. (CRC Press, Inc., 1991).

The cells introduced into such an animal may be, for example, a tumor cell line described above, for example, a B104-1-1 cell line (a stable NIH-3T3 cell line transfected with a neu oncogene; ras-transfected NIH-3T3 cells; Caco-2 (ATCC HTB-37); Or from well-differentiated (cancer) cell lines such as suitably well differentiated grade II human colon adenocarcinoma cell line HT-29 (ATCC HTB-38) or tumors and cancers. Tumor cells or cancer cell samples can be obtained from patients who underwent surgery using standard conditions involving freezing and storage in liquid nitrogen (Karmali et al., Br. J. Cancer, 48: 689-696 (1983) ).

Tumor cells can be introduced into animals such as nude mice in a variety of ways. The subcutaneous (s.c.) space of the mouse is well suited for tumor implantation. Tumors can be implanted subcutaneously as solid masses, by use of trophoblasts, or as cell suspensions. In the case of solid lumps or trocar transplantation, a tumor tissue fragment of an appropriate size is introduced into the subcutaneous space. The cell suspension is freshly prepared and subcutaneously injected from a primary tumor cell line or a stable tumor cell line. In addition, tumor cells can be injected as a subcutaneous implant. In this position, the inoculum lies between the lower part of the skin connective tissue and the subcutaneous tissue.

Animal models of breast cancer can be obtained, for example, from rat neuroblastoma cells (as described in Drebin et al., Proc. Nat. Acad. Sci., USA, 83: 9129-9133 neu oncogene) or neu -transformed NIH-3T3 cells into nude mice.

Similarly, an animal model of colon cancer can be made by subculturing colon cancer cells in an animal, such as a nude mouse, to cause the tumor to appear in these animal models. An isotope model of human colon cancer in nude mice is described in, for example, Wang et al., Cancer Research 54: 4726-4728 (1994) and Too et al., Cancer Research, 55: 681-684 (1995) . This model is based on the so-called " METAMOUSE " (trade name) marketed by AntiCancer, Inc., San Diego, Calif.

Tumors originating from animals can be harvested and cultured in vitro. The cells obtained from the in vitro cultures can then be subcultured in the animal. These tumors may serve as targets for other tests or drug screening. Alternatively, tumors generated from subculture can be isolated and RNA obtained from pre-transfected cells and isolated cells after one or more passaged cultures can be analyzed for differential expression of the desired gene. This transfer technique can be performed using any known tumor cell line or cancer cell line.

For example, Meth A, CMS4, CMS5, CMS21, and WEHI-164 were used in BALB / c male mice (DeLeo et al., J. Exp. Med., 146: 720 (1997)) (Palladino et al., J. Immunol., 138: 4023-4032 (1987)). Briefly, tumor cells can be grown in vitro by cell culture. Prior to injection into the animal, the cell line is washed and suspended in the buffer at a cell density of about 10 x 10 ⁶ to 10 x 10 ⁷ cells / ml. The animals are then subcutaneously infected with 10 to 100 [mu] l of cell suspension to allow the tumor to appear after 1 to 3 weeks.

In addition, one of the most thoroughly studied experimental tumors, Lewis lung (3LL) cancers of mice, can be used as a study tumor model. The efficacy in this tumor model is associated with a beneficial effect in the treatment of human patients diagnosed with small cell lung cancer (SCC). These tumors can be introduced into normal mice when injecting tumor cells obtained from diseased mice or cells in culture (Zupi et al., Br. J. Cancer. 41: suppl. 4, 30 (1998) ). It has been shown that tumors can even start from single cell injections and that a very high percentage of infected tumor cells survive. For additional information on this tumor model, see Zacharski, Haemostasis, 16: 300-320 (1986).

One method of determining the efficacy of a test compound in an animal model with transplanted tumors is to measure tumor size before and after treatment. Typically, the implanted tumor size is measured with a two- or three-dimensional slide caliper. Restricted measurements in two dimensions do not accurately reflect the size of the tumor and are usually converted to corresponding volumes using mathematical equations. However, the measurement of tumor size is very inaccurate. The therapeutic effect of drug candidates can be better expressed by treatment-induced proliferative delay and specific proliferative delay. Another important variable in the expression of tumor proliferation is the time it takes to double the tumor volume. A computer program for the calculation and expression of tumor growth, for example, by Rygaard and Spang-Thomsen, Proc. 6th Int. Workshop on Immune-Deficient Animals, Wu and Sheng eds. (Basel, 1989), p. Reported programs are also available. However, posttreatment cytotoxicity and immune responses actually increase tumor size at least initially. Therefore, these changes need to be carefully monitored in parallel with morphometric methods and flow cytometric analysis.

In addition, recombinant (transformed) animal models can be generated by introducing into the genome of the desired animal a portion of the coding sequence of the PRO gene identified herein using standard techniques for producing transgenic animals. Animal capable of acting as a transformational targeting include, but is not limited to, mice, rats, rabbits, guinea pigs, sheep, goats, pigs and other nonhuman primates such as baboons, chimpanzees and monkeys. Techniques known in the art for introducing transgene genes into these animals include precursor microinjection (U.S. Patent No. 4,873,191); Retrovirus-mediated gene transfer into germ cell lines (e.g., Van der Putten et al., Proc. Natl. Acad. Sci. USA, 82: 6148-615 (1985)); Gene targeting in embryonic stem cells (Thompson et al., Cell, 56: 313-321 (1989)); Electroporation of embryos (Lo, Mol. Cell. Biol., 3: 1803-1814 (1983)); And sperm-mediated gene transfer (Lavitrano et al., Cell, 57: 717-73 (1989)). For further details, see, for example, U.S. Patent No. 4,736,866.

For purposes of the present invention, transgenic animals include animals (" mosaic animals ") with transgenic genes in only some of the cells. The transgene can be inserted as a single transgene gene or a concatamer, e.g., head-to-head or head-to-tail tandem. It is also possible to selectively introduce a transgene into a particular cell type according to the technique of Lasko et al., Proc. Natl. Acad. Sci. USA, 89: 6232-636 (1992) . Expression of transgenic genes in transgenic animals can be observed with standard techniques. For example, Southern blot analysis or PCR amplification can be used to confirm the insertion of the transgene. MRNA expression can then be investigated using techniques such as in situ hybridization, Northern blot analysis, PCR or immunocytochemistry. In addition, the symptoms of tumor or cancer development are further investigated in the transgenic animal.

Alternatively, as a result of homologous recombination between the endogenous gene encoding the PRO polypeptide identified herein and the mutated genomic DNA encoding the same polypeptide as introduced into the animal embryo cell, a gene encoding a PRO polypeptide having a deletion or mutation gene "Knockout" animals can be created. For example, genomic DNA encoding the PRO polypeptide can be cloned using cDNA encoding a particular PRO polypeptide according to established techniques. Some of the genomic DNA encoding a particular PRO polypeptide may be deleted or replaced with another gene, such as a gene encoding a selectable marker that can be used to observe the insertion. Typically, the vector contains several hundred kilobases of flanking DNA that are not mutated (at both the 5 'and 3' ends). For a description of homologous recombination vectors, see, for example, Thomas and Capecchi, Cell, 51: 503 (1987). The vector is introduced into the embryonic stem cell line (e. G., Electroporation) and the introduced DNA is homologously recombined with endogenous DNA (e. G. Li et al., Cell. 69: 915 ) Reference). The selected cells are then injected into a bomb in an animal (e.g., a mouse or a rat) to form a precipitated chimera (see, for example, Bradley, in Teratocarcinomas and Embryonic Stem Cells: A Practical Approach, EJ Robertson, : Oxford, 1987), pp. 113-152). The chimeric embryo can then be transplanted into a suitable childbearing female parent, and this embryo results in the term "knockout" animal. Using standard techniques, homologous recombinant DNA can be identified in the reproductive cells, which can be used to breed animals in which all cells contain homologous recombinant DNA. For example, the characteristics of a knockout animal may be a defense against some pathological conditions, and the development of pathological conditions due to the absence of PRO polypeptides.

In the treatment of spontaneous animal tumors, the efficacy of antibodies and other drug candidates specifically binding to PRO polypeptides identified herein can also be tested. A suitable target for this study is cucumber squamous cell carcinoma (SCC). Cat oral SCC is a highly invasive malignant tumor, the most common celiac malignancy, accounting for more than 60% of oral cancer reported in this species. Even though this low developmental metastasis can only reflect the short life span of cats with this tumor, the tumor does not migrate to almost any other site. These tumors are not usually treated with surgery because of the anatomy of the cat's mouth. Currently, there is no effective treatment for this tumor. Before entering the study, each cat will undergo complete clinical examination and biopsy and scan with computed tomography (CT). Cats diagnosed with sublingual squamous cell carcinoma are excluded from the study. The tongue can be paralyzed as a result of these tumors, and even if treatment can remove the tumor, the animal can not eat it by itself. Repeat each cat for a longer period of time. Photographs of the tumor are taken daily during the treatment period, and then each is reviewed. After treatment, each cat is scanned for another CT scan. The CT scan and chest radiographs are then evaluated every 8 weeks. Data are evaluated for differences in survival, response and toxicity when compared to the control. Positive reactions may require tumor regression, preferably improved quality of life and / or evidence of increased lifespan.

In addition, fibrosarcoma; Adenocarcinoma; Lymphoma; Chondromatosis; Or other spontaneous animal tumors such as leiomyosarcoma of dogs, cats and baboons. Of these, mammary adenocarcinomas of dogs and cats are desirable models because their appearance and behavior are very similar to human mammary adenocarcinomas. However, the use of this model is limited because of the rare occurrence of this form of tumors in animals.

Other in vitro and in vivo cardiovascular, endothelial cell and angiogenesis assays known in the art are also suitable herein.

ii. Tissue distribution

The results of the cardiovascular, endothelial cell and angiogenesis assay herein can be demonstrated by measuring mRNA expression in different studies, such as various human tissues.

As described above, gene amplification and / or gene expression in a variety of tissues may be accomplished by conventional Southern blotting using a suitable labeled probe based on the sequences provided herein, Northern blotting to quantify transcription of mRNA Thomas, Proc. Natl. Acad. Sci. USA, 77: 5201-5205 (1980)), dodblotting (DNA analysis) or in situ hybridization. Alternatively, an antibody capable of recognizing a specific double strand, including DNA double strand, RNA double strand and DNA-RNA hybrid double strand or DNA-protein double strand, can be used.

Alternatively, gene expression of various tissues may be determined by immunological methods, such as immunohistological staining of tissue sections; And assaying cell culture or body fluids to directly quantify the expression of the gene product. Antibodies useful for immunohistological staining and / or assay of sample fluids can be monoclonal or polyclonal, and can be produced in any mammal. Conveniently, an antibody against a synthetic peptide based on a native-sequence PRO polypeptide, or an exogenous sequence coupled to a PRO DNA, encoding the DNA sequence provided herein or a specific antibody epitope can be produced. General techniques for generating antibodies, and specific protocols for in situ hybridization are provided below.

iii. Antibody binding study

The results of cardiovascular, endothelial cell and angiogenesis studies can be further substantiated by antibody binding studies, which inhibit the effects of PRO polypeptides on endothelial cells or other cells used in cardiovascular, endothelial cell and angiogenesis assays in the above antibody binding studies The ability of the anti-PRO antibody to test is tested. Exemplary antibodies include polyclonal antibodies, monoclonal antibodies, humanized antibodies, bispecific antibodies, and heteroconjugate antibodies, the manufacture of which will be described below.

Antibody binding studies can be performed using any known assay method, such as competitive binding assays, direct and indirect sandwich assays and immunoprecipitation assays (Zola, Monoclonal Antibodies: A Manual of Techniques (CRC Press, Inc., 1987) , pp. 147-158).

Competitive binding assays depend on the ability of the labeled standard to compete with the test sample analyte for binding with a limited amount of antibody. The amount of target protein in the test sample is inversely proportional to the amount of standard that is bound to the antibody. In order to make it easier to measure the amount of standard to be combined, it is preferred to insolubilize the antibody before or after the competition to conveniently separate standards and analytes that bind to the antibody from the standard and analytes remaining in the unbound state can do.

Sandwich assays use two antibodies that can bind to different immunogenic regions or epitopes, respectively, of the protein to be detected. In a sandwich assay, the test sample analyte binds to a first antibody attached to a solid support, and a second antibody binds to the analyte to form an insoluble tri-conjugate (see, for example, U.S. Patent No. 4,376,110) . The second antibody may itself be labeled with a detectable moiety (direct sandwich assay) or may be assayed using an anti-immunoglobulin antibody labeled with a detectable moiety (indirect sandwich assay). For example, one type of sandwich assay is an ELISA assay in which the detectable residue is an enzyme.

In the case of immunohistochemistry, the tissue sample may be fresh or frozen, or it may be impregnated with paraffin and fixed with a preservative such as, for example, formalin.

iv. Tumor assay using cells

The cell-based assays and animal models of cardiovascular, endothelial and angiogenic diseases such as tumors are used to demonstrate the discovery of the cardiovascular, endothelial cell and angiogenesis assay methods herein, and further to the genes identified herein and unwanted cardiovascular Can be used to understand the relationship between the development and pathology of cells, endothelial cells and angiogenic cells proliferation. The role of the gene product identified herein in undesired cardiovascular, endothelial and angiogenic cell proliferation, e.g., tumor cell development and pathology, may be assessed by comparing the cell or cell line identified to be stimulated or inhibited by the PRO polypeptide herein Can be used. Such cells include, for example, those described in the Examples below.

In another method, cells of a cell type known to be associated with a particular cardiovascular disease, endothelial cell disease and angiogenesis disease are transfected with the present cDNA and the ability of these cDNAs to induce excessive proliferation or inhibit proliferation is analyzed. In the case of cardiovascular disease, endothelial cell disease and angiogenesis, suitable tumor cells include, for example, B104-1-1 cell line (stable NIH-3T3 cell line transfected with neu oncogene) and ras -transfected NIH-3T3 Cells, which can be transfected with the desired gene and observed for tumor growth. These transfected cell lines are then used to express cell-active or cytotoxic activity against proliferation of transformed cells, or to inhibit tumor cell proliferation by mediating cytotoxicity (ADCC) of antibody-dependent cells Can be used to test the ability of an antibody, monoclonal antibody or antibody composition. Cells transfected with the coding sequences of the genes identified herein may also be used to identify drug candidates for the treatment of cardiovascular, endothelial, and angiogenic diseases, such as cancer.

In addition, although a stable cell line is preferred, a primary culture derived from a tumor of a transgenic animal (described above) may be used in the assay of cell usage herein. Techniques for deriving continuous cell lines from transgenic animals are well known in the art (see, for example, Small et al., Mol. Cell. Biol., 5: 642-648 (1985)).

v. Gene therapy

The polypeptides, polypeptidyl agonists and polypeptidyl antagonists of the present invention may be used in combination with the compounds of the present invention in accordance with the present invention The polypeptide can be used to express it, which is often referred to as gene therapy.

There are two methods of introducing a nucleic acid (optionally contained in a vector) into a patient cell: in vivo and in vitro. In the case of in vivo delivery, the nucleic acid will usually be in the region required for PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887 polypeptides, PRO279, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, and PRO247, if known, and the synthetic sites of the PRO724, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885, (E.g., wound) where the biological activity of the PRO327, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887 polypeptide is required. In the case of in vitro treatment, the patient's cells are harvested, the nucleic acid is introduced into these isolated cells, and the transformed cells are then administered directly to the patient, or encapsulated in a porous membrane implanted into the patient, (See, for example, U.S. Patent Nos. 4,892,538 and 5,283,187). There are a variety of techniques available for introducing nucleic acids into viable cells. This technique varies depending on whether the nucleic acid is delivered into a cultured cell in vitro or into an intended host cell in vivo. Suitable techniques for delivering nucleic acids into mammalian cells in vitro include use of liposomes, electroporation, microinjection, transduction, cell fusion, DEAE-dextran, calcium phosphate precipitation, and the like. Transfection involves binding a cell receptor to a clone-defective recombinant virus (preferably retrovirus) particle, and then introducing the nucleic acid contained in the particle into the cell. A commonly used vector for in vitro delivery of a gene is retrovirus.

The presently preferred in vivo nucleic acid delivery techniques include but are not limited to viral vectors or vectors that are not viral (e.g., adenovirus, lentivirus, herpes simplex I virus or adeno-associated virus (AAV)) and lipid- Include DOTMA, DOPE and DC-Chol, for example, see Tonkinson et al., Cancer Investigation, 14 (1): 54-65 (1996)). The most preferred vector for use in gene therapy is a virus, most preferably an adenovirus, AAV, lentivirus or retrovirus. Viral vectors, such as retroviral vectors, may also contain one or more transcriptional promoters / enhancers or locus-defining element (s), or alternatively splicing, nuclear RNA export, or in other ways such as post- And other factors that regulate expression. It is also contemplated that a viral vector such as a retrovirus may be transcribed in the presence of a gene encoding a PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887 polypeptide , The vector includes a nucleic acid molecule that is operably linked to the gene to serve as a translational initiation sequence. Such vector constructs also include packaging signals, long terminal repeats (LTRs) or portions thereof, negative strand primer binding sites (if they are not already present in the viral vector) suitable for the virus being used. Such vectors also include the secretion of the polypeptide from host cells, typically comprising PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887 polypeptides Lt; / RTI &gt; Preferably, the signal sequence for this purpose is selected from the mammalian signal sequence, most preferably PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, Or a PRO887 polypeptide. Optionally, the vector construct may include one or more restriction enzyme sites and translation termination sequences, as well as signals that direct polyadenylation. For example, such vectors will typically include a 5'LTR, a tRNA binding site, a packaging signal, a second strand DNA originator, and a 3'LTR or a portion thereof. Other vectors that are not viruses such as cationic lipids, polylysine and dendrimers can be used.

In some cases, it may be desirable to provide the nucleic acid source with a targeting molecule, such as a cell surface membrane protein or an antibody specific for the target cell, a ligand for the receptor of the target cell, and the like. When liposomes are used, the proteins that bind to cell surface membrane proteins associated with endocytosis include, for example, fusid proteins or fragments thereof that are specific to a particular cell type, antibodies to proteins that undergo cycling siRNA internalization, and Can be used to target and / or readily accept proteins that target intracellular localization and increase intracellular half life. Techniques for receptor-mediated intracellular transfer are described, for example, in Wu et al., J. Biol. Chem., 262: 4429-4432 (1987); and Wagner et al., Proc. Natl. USA, 87: 3410-3414 (1990)). See Anderson et al., Science, 256: 808-813 (1992) for a review of currently known gene marking and gene therapy protocols. See also WO93 / 25673 and the references cited herein.

Suitable gene therapy and methods for making retroviral particles and structural proteins can be found, for example, in U.S. Patent No. 5,681,746.

vi. Use of the gene as diagnostic means

The present invention also relates to the use of genes encoding PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887 polypeptides as diagnostic means. Detection of PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887 polypeptides in the mutant forms of PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760 , Endothelial cell disease and angiogenic disease, or susceptibility to these diseases, as the mutations of the PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887 polypeptides can cause tumors Will be able to advance.

Encoding human PRO179, human PRO238, human PRO364, human PRO844, human PRO846, human PRO1760, human PRO205, human PRO321, human PRO333, human PRO840, human PRO877, human PRO878, human PRO879, human PRO882, human PRO885 or human PRO887 polypeptides Individuals with mutations in the gene of interest can be detected at the DNA level with a variety of techniques. The nucleic acid for diagnosis can be obtained from the cells of a patient such as blood, urine, saliva, tissue biopsy, and test substance. Genomic DNA can be used directly for detection or can be enzymatically amplified using PCR (Saiki et al., Nature, 324: 163-166 (1986)) prior to analysis. RNA or cDNA may be used for the same purpose. For example, PRO179, PRO238, or PRO238 using a PCR primer complementary to the nucleic acid encoding the PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887 polypeptides , PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887 polypeptide mutants can be identified and analyzed. For example, deletion and insertion can be detected by the size change of the amplified product when compared to the normal genotype. The point mutation may be a radiolabeled RNA encoding a PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887 polypeptide, Can be identified by hybridizing the amplified DNA with the radiolabeled antisense DNA sequence encoding the PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887 polypeptides. Fully matched sequences can be distinguished from unmatched double strands by RNase A cleavage, or by differences in melting point.

Genetic testing based on DNA sequence differences can be achieved by detecting changes in electrophoretic migration of DNA fragments in gels with or without denaturants. Small sequence deletions and insertions can be observed by high resolution electrophoresis. DNA fragments of various sequences can be distinguished in denaturing formamidine concentration gradient gels where the mobility of various DNA fragments is delayed at various positions of the gel depending on their particular melting or partial melting point (see, e.g., Myers et al. , Science, 230: 1242 (1985)).

Sequence changes at a particular site may be indicated by, for example, RNase and the protection method of S1 or the chemical cleavage method (Cotten et al., Proc. Natl. Acad. Sci. USA, 85: 4397 -4401 (1985)).

Thus, specific DNA sequences can be detected by methods such as hybridization, RNase protection, chemical cleavage, direct DNA sequencing, use of restriction enzymes such as restriction fragment length polymorphism (RFLP), and Southern blotting of genomic DNA.

vii. For the detection of PRO polypeptide concentration

In addition to conventional gel electrophoresis and DNA sequencing, mutants can also be detected by in situ analysis.

Expression of a nucleic acid encoding a PRO polypeptide may be associated with vascular disease or angiogenesis associated with tumorigenesis. If the PRO polypeptide has a signal sequence and the mRNA is highly expressed in endothelial cells and expressed in lesser concentrations in smooth muscle cells, this indicates that the PRO polypeptide is present in the serum. Thus, anti-PRO polypeptide antibodies can be used to diagnose vascular disease or angiogenesis associated with tumor formation, since the altered concentration of this PRO polypeptide may be an indication of such a disease.

Competitive assays can also be used wherein an antibody specific for the PRO polypeptide is attached to a solid support, a labeled PRO polypeptide and a sample derived from the host are passed through the solid support, and the detection amount of the label attached to the solid support is There may be a correlation with the amount of PRO polypeptide in the sample.

viii. Chromosome mapping

The sequence of the present invention is also valuable for chromosome identification. The present sequence can be specifically targeted to a specific position on an individual human chromosome and hybridize with the specific position. Moreover, it is necessary to identify a specific site on the present chromosome. Presently, a small number of chromosome display reagents based on actual sequence data (repetitive polymorphism) can be used to indicate the position on a chromosome. According to the present invention, the mapping of DNA to a chromosome is an important first step in linking the DNA sequence with a gene associated with the disease.

Briefly, sequences can be chromosomally mapped by preparing PCR primers (preferably 15-25 bp) from the cDNA. Computer analysis of the 3'-untranslated region takes advantage of the rapid selection of primers that do not span more than one exon in the genomic DNA, thus complicating the amplification process. These primers are then used for PCR screening of somatic cell hybrids containing individual human chromosomes. Only hybrids containing human genes corresponding to the primers will provide amplified fragments.

PCR mapping of somatic cell hybrids is a rapid way to assign specific DNA to specific chromosomes. Using the present invention, which uses the same oligonucleotide primers, sublocalization can be performed in a similar manner to a fragment panel obtained from a particular chromosome or large population of genomic clones. Other methods of mapping that can be used analogously to chromosomal mapping include in situ hybridization, preliminary screening using labeled flow-class chromosomes, and pre-screening by hybridization to produce chromosome-specific cDNA libraries.

Fluorescent-spot hybridization (FISH) of cDNA clones and mid-term chromosome spreads can be used to locate chromosomes precisely in one step. This technique can use cDNA as short as 500 or 600 bases, but clones larger than 2,000 bp are more likely to bind at unique chromosomal sites with signal strength sufficient for simple detection. FISH requires the use of clones derived from genes encoding the PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887 polypeptides, The longer the clone, the better. For example, 2,000 bp is good, 4,000 bp is better, but more than 4,000 bp is not necessary to get the right ratio of time and good results. For a review of this technique, see Verma et al., Human Chromosomes: a Manual of Basic Techniques (Pergamin Press, New York, 1988).

Once the sequence is mapped to the correct chromosomal location, the physical location of the sequence on the chromosome may be correlated with the genetic map data. Such data can be found, for example, in the literature (V. McKusick, Mendelian Inheritance in Man, available online from John Hopkins University Welch Medical Library). Next, the linkage between genes and diseases that are mapped in the same chromosomal region is identified through linkage analysis (co-inheritance of physically contiguous genes).

Next, it is necessary to determine the difference in the cDNA or genomic sequence between diseased and non diseased individuals. If the mutation is observed in some or all of the affected individuals, but not in any normal individuals, this mutation may be the cause of the disease.

Given the current resolution of physical mapping and genetic mapping techniques, there are 50-500 cDNAs located precisely in the chromosome region associated with the disease (assuming that the mapping resolution is 1 mega base and there is one gene per 20 kb) May be one of the potential causative genes of &lt; RTI ID = 0.0 &gt;

ix. Screening assay method for drug candidates

The present invention provides compounds (agonists) that mimic PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887 polypeptides, or PRO179, PRO238, PRO364 (Antagonists) that interfere with the effects of the PRO844, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887 polypeptides. Screening assays for antagonist drug candidate substances can be performed using the PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887 polypeptides encoded by the genes identified herein Or a compound that forms a complex, or a compound that interferes with the interaction of another cell protein with a coded polypeptide. Such screening assays will include assays that can screen large-scale chemical libraries, making them especially suitable for identifying small molecule drug candidates.

The assay can be performed in various formats including protein-protein binding assay, biochemical screening assay, immunoassay and cell-based assay, and their characteristics are well known in the art.

All assays for antagonists are carried out in the presence of a candidate agent, such as PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887 In that they require contact of these two components for a sufficient time under conditions sufficient to interact with the polypeptide.

In the binding assay, the interaction is a bond and the formed conjugate can be isolated or detected in the reaction mixture. In a specific embodiment, the PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887 polypeptides or drug candidate substances encoded by the genes identified herein Such as a microtiter plate, by covalent bonding or noncovalent bonding. Non-covalent attachment is generally achieved by coating the solid surface with PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887 polypeptide solutions and drying. Alternatively, monoclonal antibodies specific for the antibody to be attached, such as PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887 polypeptides, Antibodies can be used to attach PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887 polypeptides to solid surfaces. The assay is carried out by adding unattached components, which may be labeled with a detectable label, to a coated surface containing an attached component, for example, an attached component. When the reaction is complete, the unreacted components are removed, for example, by washing, and the bound substance attached to the solid surface is detected. If the originally unattached component involves a detectable label, detection of the label attached on the surface indicates that bond formation has occurred. Where the originally unattached component is not accompanied by a label, formation of the complex can be detected using, for example, a labeled antibody that specifically binds to the attached complex.

The candidate compounds may interact with specific PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887 polypeptides encoded by the genes identified herein, If not, the interaction of the polypeptide with the candidate compound may be assayed by known methods for detecting protein-protein interactions. Such assays include, for example, conventional methods such as cross-linking, co-immunoprecipitation, and concentration gradient or co-purification through a chromatographic column. Protein-protein interactions have also been reported by Fields and co-workers as described in Chevray and Nathans, Proc. Natl. Acad. Sci. USA, 89: 5789-5793 (1991) The yeast genetic system described in K. Song, Nature, London, 340: 245-246 (1989); Chien et al., Proc. Natl. Acad. Sci. USA, 88: 9578-9582 (1991) . Many transcriptional activators, such as yeast GAL4, consist of two physically distinct regulatory domains, one functioning as a DNA-binding domain and the other as a transcription-activation domain. A yeast expression system (commonly referred to as a "two-hybrid system") described in the above document uses two hybrid proteins using this property, wherein one hybrid protein encodes a target protein in the DNA-binding domain of GAL-4 And another hybrid protein is one in which the candidate activation protein is bound to the activation domain. Expression of the GAL1- lac Z reporter gene under the control of a GAL4-activated promoter depends on the reconstitution of GAL4 activity through protein-protein interactions. Clones containing interacting polypeptides are detected as color matrices for? -Galactosidase. A complete kit (MATCHMAKER TM) for identifying protein-protein interactions between two specific proteins using two-hybrid techniques is available from Clontech. This system can be used not only to pinpoint amino acid residues important for these interactions but also to map protein domains involved in specific protein interactions.

The interaction of the gene encoding other intracellular or extracellular components with the gene encoding the PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, Compounds that interfere with the action can be tested as follows. Typically, a reaction mixture containing the product of the gene and an intracellular or extracellular component is prepared for a sufficient time under conditions that allow the two products to interact and bind. To test the ability of a candidate compound to inhibit binding, the reaction is carried out in the presence and absence of the test compound. In addition, placebo can be added to the third reaction mixture and used as a positive control. The binding between the test compound present in the mixture and intracellular or extracellular components (formation of the conjugate) is observed as described above. The absence of a conjugate in the reaction mixture in which the conjugate is formed in the reference reactant (s), but not in the reaction mixture containing the test compound, indicates that the test compound interferes with the interaction of the candidate compound with its reactive partner.

If the PRO polypeptide has the ability to stimulate the proliferation of endothelial cells in the presence of co-mitogen, ConA, there is an example of a screening method that exploits this capability. Specifically, human umbilical vein endothelial cells were obtained in a proliferation assay and cultured in 96-well plate-bottom culture plates (Costar, Cambridge, Mass.) And incubated with a reaction mixture suitable for promoting cell proliferation, Con-A (Calbiochem, La Jolla, Calif.). Con-A and the compounds to be screened were added and incubated at 37 ° C, ³ H-thymidine was then added to the culture via pulse and cells were collected on a glass fiber filter (phD; Cambridge Technology, Watertown, Mass.). Calculate the average of a liquid scintillation counter using (Beckman Instrument, Irvine, CA) triple culture water ³ H- thymidine insertion amount (cpm). Significant ³ H-thymidine inserts indicate stimulation of endothelial cell proliferation.

To test for antagonists, the assay is performed in which the ability of a compound to add a PRO polypeptide together with the compound to be screened and inhibit ³ (H) -thymidine insertion in the presence of a PRO polypeptide indicates that the compound is PRO Lt; / RTI &gt; is an antagonist to the polypeptide. Alternatively, antagonists can be detected by conjugating PRO polypeptides and potential antagonists to membrane bound PRO polypeptide receptors or recombinant receptors under conditions suitable for competitive inhibition assays. Since the PRO polypeptide can be labeled as being radioactivity, the potency of a potential antagonist can be measured by counting the number of PRO polypeptides bound to the receptor. Gene encoding the receptor can be confirmed by a number of methods known in the art, such as ligand panning and FACS classification (Coligan et al., Current Protocols in Immun., 1 (2): Chapter 5 (1991)). Preferably, expression cloning is used, wherein the polyadenylated RNA is prepared from cells that respond to the PRO polypeptide, and the cDNA library made from the RNA is divided into groups to produce COS cells or other cells that do not respond to the PRO polypeptide Used to infect. Transfected cells grown on glass slides are exposed to labeled PRO polypeptides. PRO polypeptides can be labeled in a variety of ways involving iodination or inclusion of recognition sites for site-specific protein kinases. After fixation and incubation, the slides are analyzed by radiography. A positive clone is identified and a sub-population is prepared and then transfected again using interactive sub-pooling and re-screening methods to obtain a single clone that eventually encodes the potential receptor.

As an alternative to receptor recognition, the labeled PRO polypeptide may photo-affinity bind to a cell membrane or extract expressing the receptor molecule. The crosslinked material is resolved by PAGE and exposed to an X-ray film. The labeled conjugate containing the receptor can be excised and resolved into peptide fragments, and the proteins can be micro-sequenced. To identify genes coding for potential receptors, a set of degenerate oligonucleotide probes can be designed for screening cDNA libraries using amino acid sequences obtained from micro-sequencing.

In another assay for antagonists, the mammalian cell or membrane preparation expressing the receptor is incubated with the labeled PRO polypeptide in the presence of the candidate compound. Next, the ability of the compound to elevate or block this interaction can be measured.

Compositions useful for the treatment of cardiovascular diseases, endothelial cell diseases and angiogenic diseases include, but are not limited to, antibodies, small organic and inorganic molecules, peptides, phosphopeptides, antisense and ribozyme molecules that inhibit the expression and / - helical molecules, and the like.

More specific examples of potential antagonists include oligonucleotides that bind to fusions of PRO polypeptides and immunoglobulins, and specifically human antibodies and antibody fragments as well as polyclonal antibodies and monoclonal antibodies, antibody fragments, single chain antibodies , Anti-idiotypic antibodies, and antibodies, including chimeric or humanized antibodies of such antibodies or fragments. Alternatively, a potential antagonist can be a mutated form of a PRO polypeptide that competitively inhibits the action of a PRO polypeptide without recognizing closely related proteins, e. G., Receptors, but without effect.

Another potential PRO polypeptide antagonist or agonist is an antisense RNA or DNA construct made using antisense technology wherein the antisense RNA or DNA molecule hybridizes directly with the target mRNA to interfere with protein translation, . Antisense technology can be used to regulate gene expression through triple helix formation or antisense DNA or RNA, both of which are based on the binding of DNA or RNA and polynucleotides. For example, the 5 'coding portion of the polynucleotide sequence encoding the mature PRO polypeptide of the present disclosure is used to design antisense RNA oligonucleotides of about 10 to 40 bp in length. DNA oligonucleotides can be synthesized by transcription (triple helix - Lee et al., Nucl. Acids Res., 6: 3073 (1979); Cooney et al., Science, 241: 456 1360 (1991)), which is complementary to the region of the gene involved in the transcription and production of PRO polypeptides. Antisense RNA oligonucleotides hybridize with mRNAs in vivo to block translation of mRNA molecules into PRO polypeptides (Antisense-Okano, Neurochem., 56: 560 (1991); Oligodeoxynucleotides as Antisense Inhibitors of Gene Expression Raton, FL, 1988). The oligonucleotide may be transferred to cells to express antisense RNA or DNA in vivo to inhibit the production of PRO polypeptide. When antisense DNA is used, oligodeoxyribonucleotides derived from a sequence between the translation-initiation site of the target gene nucleotide sequence, for example, between about -10 and +10 positions, are preferred.

The length of the antisense RNA or DNA molecule is generally at least about 5 bases, at least about 10 bases, at least about 15 bases, at least about 20 bases, at least about 25 bases, at least about 30 bases, at least about 35 bases At least about 40 bases, at least about 45 bases, at least about 50 bases, at least about 55 bases, at least about 60 bases, at least about 65 bases, at least about 70 bases, at least about 75 bases, At least about 80 bases, at least about 85 bases, at least about 90 bases, at least about 95 bases, at least about 100 bases, or more.

Potential antagonists include active moieties, receptor binding sites, or small molecules that bind to the proliferation factors or other related binding sites of PRO polypeptides. Examples of small molecules include, but are not limited to, small peptides or peptide-like molecules, preferably soluble peptides, and synthetic non-peptidyl organic or inorganic compounds.

Ribozymes are enzymatic RNA molecules capable of catalyzing the specific cleavage of RNA. Ribozymes act through endonucleolytic cleavage of nucleic acids following sequence-specific hybridization with complementary target RNAs.

Specific ribozyme cleavage sites within a potential RNA target can be identified by known techniques. For more information, see Rossi, Current Biology, 4: 469-471 (1994), and PCT Publication No. WO 97/33551 (published September 18, 1997).

The nucleic acid molecule in triple-helix formation used to inhibit transcription is single-stranded and consists of deoxynucleotides. The base composition of these oligonucleotides is generally designed to promote triple helix formation through Hoogsteen base-pairing rules, in which a fairly large strain of purine or pyrimidine must be present in one strand of the double strand. For further details, reference is made to the document (PCT Publication No. WO 97/33551).

These small molecules may be identified by one or more of the screening assays discussed herein and / or by any other screening technique well known to those skilled in the art.

x. Types of Cardiovascular Disease, Endothelial Cell Disease, and Angiogenic Disease to be Treated

PRO polypeptides, agonists or antagonists thereof, and / or their gene products that are found to be located in the cardiovascular system that exhibit activity in the cardiovascular, endothelial cell and angiogenesis assay described herein are useful for the treatment of systemic diseases affecting blood vessels Can be used for the treatment of various cardiovascular diseases, endothelial cell diseases and angiogenesis diseases. Their therapeutic uses include diseases of the arteries, capillaries, veins, and / or lymphatic vessels. Examples of therapies include, but are not limited to, treatment of muscle wasting disease, treatment of osteoporosis, stimulation of cell proliferation around the implant, increased stability of IGF in the adjuvant, tissue, or serum in fixation of the implant to facilitate attachment of the intended site and implant, , If applicable, because of the increased binding to the IGF receptor (because IGF appears to promote human bone marrow red blood cells and granular progenitor cell proliferation in vitro).

PRO polypeptides, agonists or antagonists thereof stimulate erythropoietic or granulocyte hematopoiesis; To stimulate wound or tissue regeneration and associated therapies associated with repopulation of tissues such as connective tissue, skin, bone, cartilage, muscle, lung or kidney; To promote angiogenesis; To stimulate or inhibit endothelial cell migration; And to increase vascular smooth muscle proliferation and endothelial cell production. Increased angiogenesis mediated by PRO polypeptides or antagonists is beneficial in the lateral coronary development of the heart, which involves ischemic tissue and coronary stenosis. Antagonists are used to inhibit the action of these polypeptides, for example, if the PRO polypeptide promotes the production of excessive connective tissue during wound healing or pulmonary fibrosis processes. This will include the treatment of acute myocardial infarction and heart failure.

In addition, the present invention relates to the treatment of hyperhidrosis regardless of the underlying cause by administering a therapeutically effective amount of a PRO polypeptide, an agonist or an antagonist thereof, regardless of the underlying cause. If the purpose is treatment of a human patient, recombinant human PRO polypeptides (rhPRO polypeptides) are preferred as PRO polypeptides. Treatment of cardiac hypertrophy can be performed at any of a variety of stages, which can occur from a variety of pathological conditions including myocardial infarction, hypertension, acute cardiomyopathy, and plaque reflux. Treatment extends to all progressive stages of hyperhidrosis with or without structural damage to the myocardium, regardless of the underlying cardiac disease.

Determining whether to use the molecule itself or its agonist for any particular symptom that acts in opposition to an antagonist to the molecule will depend on whether the molecule promotes cardiovascular formation, endothelial cell production or angiogenesis, It mainly depends on suppressing these states. For example, if a molecule promotes angiogenesis, its antagonist is useful in the treatment of diseases that are required to limit or interfere with angiogenesis. Examples of such diseases include angioma such as angioma; Tumor angiogenesis; Diabetic retinopathy or immature retinopathy of prematurity, or retina, choroid, corneal angiogenesis associated with macular degeneration and proliferative vitreoretinopathy; Rheumatoid arthritis; Crohn &apos; s disease, atherosclerosis, ovarian hyperstimulation syndrome, psoriasis, endometriosis associated with angiogenesis, recurrent stenosis after balloon angioplasty, such as excessive scar tissue formation in post-operative keloid, fibrosis after myocardial infarction, There is associated fiber damage.

However, if the molecule inhibits angiogenesis, the molecule may be used directly in the treatment of the disease.

On the other hand, when the molecule stimulates angiogenesis, it can be used as a therapeutic agent for peripheral blood diseases such as peripheral vascular diseases, hypertension, inflammatory vasculitis, Reynaud's disease and Reinawid syndrome, aneurysm, aortic recurrent stenosis, thrombophlebitis, lymphangiectasia, (Or an agonist thereof) for diseases in which angiogenesis is desirable, such as heart failure, myocardial infarction such as ischemia, reperfusion injury, angina pectoris, acute myocardial infarction, cardiac failure such as chronic heart disease, congestive heart failure and osteoporosis.

However, if the molecule inhibits angiogenesis, the antagonist of the molecule may be used for the treatment of the above-mentioned diseases in which angiogenesis is desirable.

Certain types of diseases are described below, wherein the PRO polypeptides or antagonists thereof are useful for targeting vascular-related drugs or as therapeutic targets for the treatment or prevention of the following diseases. Atherosclerosis is a disease characterized by accumulation of endothelial hyperplasia of the artery due to lipid accumulation in arterial wall, proliferation of smooth muscle cells and formation of fibrous tissue. The disease may affect the aorta, middle artery and small artery in any organ. Changes in endothelial cell and vascular smooth muscle cell function are known to play an important role in regulating the accumulation and degeneration of these plaques.

Hypertension is characterized by elevated blood pressure in the systemic artery, pulmonary artery or portal vein. Elevated blood pressure may result from damaged endothelial cell function and / or vascular disease, or may result in damaged endothelial cell function and / or vascular disease.

Inflammatory vasculitis includes, but is not limited to, giant cell arteritis, Takayasu's arteritis, nodular polyarteritis (including microangiopathic forms), Kawasaki's disease, microscopic polyarteritis, Wegener's granulomatosis, And vascular disease (including Henoch-Schonlein purpura). The altered endothelial cell function was found to be important in these diseases.

Reynaud's disease and Reynaud's syndrome are characterized by abnormal intermittent damage to the circulation through the limb when exposed to cold. The altered endothelial cell function appears to be important in this disease.

The aneurysm is an epidermal or spindle-shaped swelling of the arterial or venous system associated with altered endothelial cells and / or vascular smooth muscle cells.

Arterial recurrent stenosis (recurrent stenosis of the arterial wall) may occur after angioplasty as a result of changes in function and proliferation of endothelial and vascular smooth muscle cells.

Thrombotic phlebitis and lymphatic tuberculosis are inflammatory diseases of the veins and lymphatic vessels, respectively, that can result from altered endothelial function and / or cause altered endothelial function. Similarly, lymphatic edema is a disease involving damaged lymphatic vessels arising from endothelial cell function.

Benign and malignant angiomas are characterized by abnormal proliferation and proliferation of vascular cell elements. For example, lymphangioma is a benign tumor of the lymphatic system, a congenital lymphatic malformation (often cystic) that is common in neonates. Cystic tumors tend to proliferate into adjacent tissues. Cystic tumors usually occur in the uterine and axillary regions. These can also occur in the soft tissues of the extremities. The main symptom is a bulbous, often net-shaped lymphatic vessel, and a lymphocyte surrounded by connective tissue. Lymphangiomas are thought to be caused by improperly associated embryonic lymph vessels or their deficiencies. Damaged local lymphatic output is the result (Griener et al., Lymphology, 4: 140-144 (1971)).

Another use of the PRO polypeptides or antagonists of the present application is in the prevention of tumor angiogenesis involving angiogenesis of tumors which allows the tumor to proliferate and / or metastasize. This process depends on the proliferation of new blood vessels. Examples of tumors and related diseases involving tumor angiogenesis include breast cancer, lung cancer, stomach cancer, esophageal cancer, colorectal cancer, liver cancer, ovarian cancer, ovarian cancer, male germ cell tumor, uterine cancer, endometrial cancer, endometrial hyperplasia, endometriosis, The present invention provides a method of treating a cancer selected from the group consisting of sarcoma, sarcoma, head and neck cancer, nasopharyngeal cancer, laryngeal cancer, hepaticoblastoma, Kaposi sarcoma, melanoma, skin cancer, hemangioma, cavernous hemangioma, angioblastoma, pancreatic cancer, retinoblastoma, astrocytoma, (Such as those associated with brain tumors) and meiosis associated with osteosarcoma, neuroblastoma, rhabdomyosarcoma, osteosarcoma, leiomyosarcoma, urethral sarcoma, thyroid cancer, Wilms' tumor, renal cell carcinoma, prostate cancer, There is Meigs syndrome.

Age-related macular degeneration (AMD) is a major cause of severe visual loss in the older population. The features of the AMD exudative form are coronary angiogenesis and retinal pigment epithelial cell desorption. Because the context angiogenesis is associated with a sharp deterioration in prognosis, PRO polypeptides or antagonists thereof are expected to be useful in alleviating the severity of AMD.

The wound healing, such as wound healing and tissue repair, is another use of the PRO polypeptides or antagonists of the present invention. New blood vessel formation and degeneration are essential for tissue healing and recovery. This category includes bone, cartilage, tendons, ligaments and / or nerve tissue proliferation or regeneration, as well as wound healing and tissue repair and replacement in the treatment of burns, incisions and ulcers. The PRO polypeptide or antagonist thereof which induces cartilage and / or osteoprogenia under an environment in which bone is not normally formed is applied in the treatment of bone fractures and cartilage damage or defects in humans and other animals. A formulation comprising a PRO polypeptide or an antagonist thereof may be used for open fracture as well as for occlusive fracture relief and may be used to improve fixation of the artificial joint. New osteogenesis induced by osteogenic agents contributes to the recovery of congenital cranial facial defects, trauma-induced cranial facial defects, tumorous cranial facial defects, or incision-induced cranial facial defects, useful.

PRO polypeptides or antagonists thereof may be useful for promoting improved or faster closing of non-healing wounds, including, but not limited to, pressure ulcers, ulcers associated with vascular defects, surgical and traumatic wound healing, and the like .

The PRO polypeptide or antagonist thereof may be used to generate or regenerate other tissues such as organs (e.g., pancreas, liver, bowel, kidney, skin or endothelium), muscles (smooth muscle, skeletal muscle or myocardium), and blood vessels (including vascular endothelial) Or to promote the proliferation of cells constituting these tissues. Among the desired effects is regeneration of normal tissue by inhibition or regulation of fibrous scar formation.

The PRO polypeptides or antagonists herein may be useful for the treatment of diseases arising from digestive tract protection or regeneration, and lung or liver fibrosis, reperfusion injury of various tissues, and systemic cytokine damage. In addition, the PRO polypeptide or antagonist thereof may be useful for promoting or inhibiting the differentiation of said tissue from a progenitor or progenitor cell, or may be useful for inhibiting the proliferation of said tissue.

PRO polypeptides or antagonists thereof may also be used in the treatment of periodontal disease and other tooth-restoring processes. Such agents can provide an environment that attracts bone-forming cells, stimulates proliferation of bone-forming cells, or induces differentiation of bone-forming cell precursors. The PRO polypeptides or antagonists herein may be useful for the treatment of osteoporosis or osteoarthritis through stimulation of bone and / or cartilage recovery, or may be useful in the treatment of tissue destruction (such as collagenase activity, osteoclast activity Etc.) may be useful in the treatment of osteoporosis or osteoarthritis because the blood vessels play an important role in regulating bone replacement and proliferation.

Another category of tissue regeneration activity that can be attributed to the PRO polypeptides or antagonists herein is tendon / ligament formation. Proteins that induce tendon / ligament-like tissue or other tissue formation in an environment where these tissues are not normally formed can be used for the healing of tendon or ligament leak, malformation, and other tendon or ligament defects in humans and other animals. These agents can be used to improve fixation of tendons or ligaments in bone or other tissues and to repair defects in tendons or ligament tissues, as well as to prevent damage to tendons or ligament tissues. New tendon / ligament-like tissue formation induced by compositions of PRO polypeptides or antagonists of the present invention may contribute to congenital tendon or ligament defects, trauma-induced tendon or ligament defects, or other tendon or ligament defects of other origin , Cosmetic surgery for attaching or restoring tendons or ligaments. The compositions herein can be used to attract tendon or ligament-forming cells, to stimulate proliferation of tendon or ligament-forming cells, to induce differentiation of precursors of tendon or ligament-forming cells, to induce tendon / ligament cell or progenitor extracellularly in vitro Lt; Desc / Clms Page number 2 &gt; The compositions herein may be useful for the treatment of tendinitis, carpal tunnel syndrome and other tendon or ligament defects. The composition may also comprise suitable matrices and / or molecular entrapping agents as well known in the art.

The PRO polypeptide or antagonist thereof is useful for the proliferation of nerve cells and the regeneration of nerve tissue and brain tissue, including mechanical and traumatic disorders, as well as central and peripheral nervous system diseases and neurological disorders involving degeneration, death or trauma of nerve cells or nerve tissue It may be useful for the treatment of pathologies. More specifically, PRO polypeptides or antagonists thereof are useful for the treatment and / or prevention of peripheral nervous system disorders such as peripheral nerve damage, peripheral neuropathy and focal neuropathy, as well as Alzheimer's disease, Parkinson's disease, Huntington's disease, amyotrophic lateral sclerosis and Shy-Drager ) Syndrome. &Lt; / RTI &gt; Additional diseases treatable in accordance with the present invention include cerebrovascular diseases such as mechanical and traumatic diseases such as spinal cord diseases, head trauma, and stroke. Peripheral neuropathy resulting from chemotherapy or other medical therapies may also be treated using the PRO polypeptides or antagonists of the present invention.

Ischemia-reperfusion injury is another disease. Endothelial dysfunction may be important in both the initiation and regulation of sequelae following ischemia-reperfusion injury.

Rheumatoid arthritis is another disease. Vascular proliferation through the vasculature and targeting of inflammatory cells are important components in the pathology of rheumatoid arthritis and serum-negative form of arthritis.

Administration of PRO polypeptides or antagonists to patients with CPA may prevent the progression of CPA and avoid sudden death, including death of asymptomatic patients. In the case of patients diagnosed with extensive left ventricular hypertrophy (the maximum wall thickness of 35 mm or more in the case of adults, or comparable values in the case of children), and in cases where blood hemodynamic overload of the heart is fairly strong, .

PRO polypeptides or antagonists thereof may be useful in the management of atrial fibrillation that develops in some patients who have been diagnosed with substantially asymptomatic cardiomyopathy.

Additional diseases include angina pectoris, myocardial infarction such as acute myocardial infarction, and heart failure such as congestive heart failure. Additional non-tumorous diseases include psoriasis, diabetic retinopathy, and other proliferative retinopathies including retinopathy of prematurity, posterior capsular hyperplasia, neovascular glaucoma, hyperthyroidism (including Graves' disease), corneal and other tissue grafts, Chronic inflammation, pulmonary inflammation, nephrotic syndrome, pre-eclampsia, ascites, pericardial effusion (such as those associated with the pericardium), and pleural effusion.

In view of the above, the PRO polypeptides, agonists or antagonists described herein, which appear to alter or damage endothelial function, proliferation and / or morphology, may be useful for the treatment of a number of diseases or all diseases, And may act as therapeutic targets to augment or inhibit these processes or in targeting vascular-related drugs in these diseases.

xi. Dosage protocols, schedules, dosages and formulations

The molecules and agonists and antagonists of the present invention are useful as pharmaceuticals for the prevention and treatment of various diseases and disorders described above.

The therapeutic compositions of PRO polypeptides, agonists or antagonists may be prepared by mixing the desired molecules of suitable purity in the form of lyophilized formulations or aqueous solutions, optionally with a pharmaceutically acceptable carrier, excipient or stabilizer (Remington's Pharmaceutical Science, 16th edition, Osol, A. ed. (1980)). Acceptable carriers, excipients or stabilizers are those which are non-toxic to the recipient in the amounts and concentrations employed, such as buffers such as phosphate, citrate and other organic acids; Antioxidants including ascorbic acid and methionine; Preservatives such as octadecyldimethylbenzylammonium chloride, hexamethonium chloride, benzalkonium chloride, benzethonium chloride, phenol, butyl or benzyl alcohol, alkyl parabens such as methyl or propyl paraben, catechol, resorcinol , Cyclohexanol, 3-pentanol and m-cresol; Polypeptides of low molecular weight (less than about 10 residues); Proteins such as serum albumin, gelatin or immunoglobulin; Hydrophilic polymers such as polyvinylpyrrolidone; Amino acids such as glycine, glutamine, asparagine, histidine, arginine or lysine; Monosaccharides, disaccharides, and other carbohydrates including glucose, mannose, and dextrins; Chelating agents such as EDTA; Sugars such as sucrose, mannitol, trehalose or sorbitol; Salt-forming counterions such as sodium; Metal complexes (e.g., Zn-protein complexes); And / or non-ionic surfactants such as TWEEN (trade name), PLURONICS (trade name) or polyethylene glycol (PEG).

Other examples of such carriers include serum proteins such as ion exchangers, alumina, aluminum stearate, lecithin, human serum albumin, buffer substances such as phosphate, glycine, sorbic acid, potassium sorbate, partial glyceride mixtures of saturated vegetable fatty acids Water, a salt or an electrolyte, and examples of the electrolyte include protamine sulfate, disodium hydrogen phosphate, potassium hydrogen phosphate, sodium chloride, zinc salt, silica colloid, magnesium trisilicate, polyvinylpyrrolidone, cellulose- Base material and polyethylene glycol. Carriers for topical or gel-based antagonists include polysaccharides such as sodium carboxymethylcellulose or methylcellulose, polyvinylpyrrolidone, polyacrylates, polyoxyethylene-polyoxypropylene-block polymers, polyethylene glycols and There is wood wax alcohol. For all administrations, a conventional depot form is used as appropriate. Such forms include, for example, microcapsules, nano-capsules, liposomes, bandages, inhalation forms, nasal sprays, sublingual tablets and western preparations. The PRO polypeptide, agonist or antagonist thereof will typically be formulated with the vehicle at a concentration of from about 0.1 mg / ml to 100 mg / ml.

Other agents include incorporating PRO polypeptides or antagonists thereof into the formed product. These products can be used to regulate endothelial cell proliferation and angiogenesis. In addition, tumor invasion and metastasis can also be controlled by the above products.

The PRO polypeptide or antagonist used for in vivo administration should be sterile. This can be easily accomplished by filtration through a sterile filter membrane before or after lyophilization and reconstitution. When administered systemically, the PRO polypeptide will typically be stored in lyophilized form or in solution. In the lyophilized form, the PRO polypeptide or antagonist thereof is formulated in the form of a combination with other ingredients for reconstitution with a diluent suitable for normal use. Examples of liquid formulations of PRO polypeptides or antagonists thereof are sterile, clear, colorless, unfilled solutions filled into subcutaneous injection single dose vials. Antiseptic pharmaceutical compositions suitable for repeated use will depend mainly on the prescription and polypeptide type,

a) a PRO polypeptide, an agonist or antagonist thereof,

b) a buffer capable of maintaining a pH (preferably about 4 to 8) at which the polypeptide or other molecule can be maximally stabilized in solution,

c) a detergent and a surfactant which primarily stabilize the polypeptide or molecule against agglomeration induced by agitation,

d) isotonifiers,

e) a preservative selected from the group of phenol, benzyl alcohol and benzethonium halide (e.g. chloride) and

f) Water

&Lt; / RTI &gt;

When the detergent used is non-ionic, the detergent may be, for example, polysorbate (e.g., POLYSORBATE, TWEEN 20, 80, etc.) or poloxamer (For example, POLOXAMER 188). The use of non-ionic surfactants can expose the agent to shear surface stresses without causing denaturation of the polypeptide. In addition, such surfactant-containing preparations can be administered with an aerosol device such as that used in pulmonary administration, and a needleless jet injector gun (see EP 257,956).

An isotonic agent may be present to maintain isotonicity of the liquid composition of the PRO polypeptide or its antagonist, examples of which include polyhydric alcohols, preferably glycerin, erythritol, arabitol, xylitol, sorbitol and mannitol Trihydric or higher sugar alcohols. These sugar alcohols can be used singly or in combination. Alternatively, sodium chloride or other suitable inorganic salt may be used to make the solution an isotonic solution.

The buffer may be, for example, acetate, citrate, succinate or phosphate buffer depending on the desired pH. The pH of one type of liquid formulation of the present invention is buffered to about 4 to 8, preferably to about physiological pH.

Preservatives such as phenol, benzyl alcohol, and benzethonium halide (e.g., chloride) are known antimicrobial agents that can be used.

Typically, the therapeutic PRO polypeptide composition for therapeutic use is placed in a container with a sterile inlet, for example, an intravenous injection bag, a vial having a plug through which a hypodermic needle can penetrate. Preferably, the formulation is administered repeatedly by intravenous (iv), subcutaneous (sc) or intramuscular (im) injection, or as an aerosol formulation suitable for intranasal or intrapulmonary delivery 257,956).

In addition, the PRO polypeptide may be administered in the form of a sustained release formulation. Suitable examples of sustained-release preparations include semipermeable matrices of solid hydrophobic polymers containing the proteins, wherein the matrix is in the form of a molded article, such as a film or microcapsule. Examples of sustained release matrices include polyester, Langer et al., J. Biomed. Mater. Res., 15: 167-277 (1981) and Langer, Chem. Tech., 12: 98-105 (1982) (E.g., poly (2-hydroxyethyl-methacrylate)), polylactide (US Patent 3,773,919 and EP 58,481), L-glutamic acid and gamma ethyl-L- Vinyl acetate (Langer et al., Supra), Lupron Depot TM (lactic acid-glycolic acid copolymer, glutamate copolymer) (Sidman et al., Biopolymers, 22: 547-556 (1983) (-) - 3-hydroxybutyric acid (EP No. 133,988), as well as degradable lactic acid-glycolic acid copolymers such as poly

Polymers such as ethylene-vinyl acetate and lactic acid-glycolic acid release molecules for more than 100 days, but some hydrogels release proteins for shorter periods of time. If the encapsulated protein remains in the body for an extended period of time, the protein may denature or aggregate upon exposure to moisture at 37 &lt; 0 &gt; C to reduce biological activity and alter immunogenicity. Rational strategies can be designed according to the mechanisms involved to stabilize the protein. For example, if it is found that the aggregation mechanism is an intramolecular SS bond formation through thio-disulfide interchange, it is possible to formulate sulfhydryl moieties, freeze drying from acidic solutions, control of moisture content, Lt; RTI ID = 0.0 &gt; polymeric &lt; / RTI &gt; matrix composition.

In addition, the sustained release PRO polypeptide composition may include a PRO polypeptide captured by the liposome. Liposomes containing PRO polypeptides have been described in the literature (DE 3,218,121; Epstein et al., Proc Natl Acad Sci USA, 82: 3688 (1985); Hwang et al., Proc. Natl Acad. 77: 4030 (1980), EP 52,322, EP 36,676, EP 88,046, EP 143,949, EP 142,641, Japanese Patent Application No. 83-118008, US 4,485,045, 4,544,545; and EP 102,324). Typically, the liposomes are of a single size (about 200 to 800 ANGSTROM) of a single size, which is higher in lipid content than about 30 mol% of cholesterol and can be optimally treated by adjusting the selected ratio.

The therapeutically effective amount of the PRO polypeptide or its antagonist will, of course, be dependent upon the pathological condition to be treated (including prophylactic), the mode of administration, the type of compound used in the therapy, any adjunctive therapies involved, the age of the patient, Etc., and the decision will be made by a specialist. Thus, the therapist needs to determine the dosage required to achieve the greatest therapeutic effect and to change the route of administration. When the host range of the PRO polypeptide is narrow, the agent comprising the human PRO polypeptide is preferred for the treatment of a human patient, and a formulation containing a natural sequence of a human PRO polypeptide is more preferred. The clinician will administer the PRO polypeptide until the dose achieves the effect necessary for the treatment of the condition. For example, if the therapeutic purpose is treatment of CHF, the dose is an amount that inhibits progressive cardiac hypertrophy associated with CHF. The progress of this therapy can be easily observed by performing ultrasonic electrocardiography. Similarly, in patients with acromegaly cardiomyopathy, PRO polypeptides may be administered based on clinical trials.

According to the above guidelines, an effective dose is usually about 0.001 to about 1.0 mg / kg, more preferably about 0.01 to 1.0 mg / kg, most preferably about 0.01 to 0.1 mg / kg.

In the case of parenteral administration for adult hypertension, intravenous injection is carried out once to three times per day in the form of injections of about 0.01 to 50 mg, preferably 0.05 to 20 mg, and most preferably 1 to 20 mg of PRO polypeptide per 1 kg of body weight It is advantageous to administer. In the case of oral administration, it is preferable to administer about 5 mg to 1 g, preferably 10 to 100 mg, of the PRO polypeptide molecule per 1 kg body weight 1 to 3 times a day. It should be noted that contamination of endotoxins should be minimized, for example, to a safe level of less than 0.5 ng per mg of protein. In addition, when administered to humans, it is desirable that the formulation meet the sterility, exothermicity, overall safety and purity required by the FDA and the biological standard.

Dosage regimens of a pharmaceutical composition containing a PRO polypeptide used for regeneration of tissues are well known to those of ordinary skill in the art in view of the variety of factors that alter the action of the polypeptide, such as the weight of the tissue to be formed, the site of injury, The type of tissue (e.g., bone), the age, sex and diet of the patient, the severity of any infection, the time of administration, and other clinical factors. The dosage may vary depending on the type of matrix used for reconstitution, and whether other proteins are included in the pharmaceutical composition. For example, the addition of other known growth factors, such as IGF-I, to the final composition may also affect the dosage. The progress of the treatment can be observed, for example, by periodically measuring the growth and / or recovery of tissue and bone through X-ray, histomorphometric measurements and tetracycline markers.

The PRO polypeptide, agonist or antagonist may be administered in a manner known per se, for example, intravenously, intramuscularly, intrathecally, intraperitoneally, intracerebroventricularly, subcutaneously, intravenously, intraarterally, intraocularly, intrathecally, Or via a sustained-release system as described below. In addition, the PRO polypeptide or antagonist thereof can be suitably administered through intra-tumor, peritumoral, intradermal, or peri-articular routes to demonstrate local and systemic therapeutic effects. For example, intraperitoneal administration in the treatment of ovarian cancer is believed to be particularly useful.

When a peptide or small molecule is used as an antagonist or agonist, it is preferably orally or parenterally administered to the mammal in liquid or solid form.

Examples of pharmacologically acceptable salts of the molecules which form salts and are useful herein below include, but are not limited to, alkali metal salts such as sodium salts and potassium salts, alkaline earth metal salts such as calcium salts and magnesium salts, Salts of organic acids (e.g., acetate, oxalate, p-toluenesulfonate), basic salts such as pyridine salts and triethylamine salts, inorganic acid salts such as hydrochloride, .

For compositions of the present invention useful for bone, cartilage, tendon or ligament regeneration, methods of treatment include topical, systemic or local administration of the composition as a implant or device. When administered, the therapeutic composition used is a pyrogen-free and physiologically acceptable form. In addition, the composition is preferably encapsulated or injected in the form of a mucilage for delivery to the bony, cartilaginous or tissue injury sites. Topical administration may be appropriate for wound healing and tissue repair. Preferably, in the case of bone and / or cartilage formation, the protein-containing composition can be delivered to the bone and / or cartilage damage site, provides a structure for the developing bone and cartilage, &Lt; / RTI &gt; may be included in the composition. These matrices may be in the form of materials currently used in other implantable medicine fields.

The choice of matrix material is based on bio-compatibility, biodegradability, mechanical properties, appearance and interfacial properties. A suitable formulation method will be determined according to the specific use of the composition. Potential matrices of the composition may be biodegradable and may be chemically defined calcium sulfate, tricalcium phosphate, hydroxyapatite, polylactic acid, polyglycolic acid and polyanhydrides. Other potential materials are biodegradable and biologically well defined, such as bone or subcutaneous collagen. Other matrices consist of pure protein or extracellular matrix components. Other potential matrices are non-degradable and chemically defined such as sintered hydroxyapatite, bioglass, aluminate or other ceramics. The matrix may be composed of polylactic acid and hydroxyapatite, or a combination of any of the above materials, such as collagen and tricalcium phosphate. Bioceramics can be changed in compositions such as calcium-aluminate-phosphate and can be processed for changes in pore size, particle size, particle shape, and biodegradability.

One particular embodiment is a copolymer of lactic acid and glycolic acid (50:50 (molar weight), in the form of porous particles of 150 to 800 microns in diameter. In some fields, using an isolating agent such as carboxymethylcellulose or autologous coagulation It will be useful to prevent the polypeptide composition from separating from the matrix.

Suitable sequestrants are cellulosic materials such as alkylcelluloses (including hydroxyalkylcelluloses), including methylcellulose, ethylcellulose, hydroxyethylcellulose, hydroxypropylcellulose, hydroxypropylmethylcellulose, and carboxymethylcellulose, Cationic salts of carboxymethylcellulose (CMC) are preferred. Other preferred sequestrants include hyaluronic acid, sodium alginate, poly (ethylene glycol), polyoxyethylene oxide, carboxyvinyl polymer, and poly (vinyl alcohol). The amount of isolating agent useful herein is from 0.5 to 20% by weight, preferably from 1 to 10% by weight, based on the total weight of the formulation, which prevents the polypeptide (or its antagonist) from being desorbed from the polymer matrix, But is not an amount that the polypeptide (or its antagonist) provides an opportunity to assist the osteogenesis activity of the parental cell by preventing the parental cell from infiltrating the matrix.

xii. Combination therapy

The effect of PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887 polypeptides, agonists or antagonists thereof, The active agent may be administered sequentially, or the active agent may be improved either in the same composition or as a separate composition in combination with other agents effective for the purpose.

For example, when treating cardiac hypertrophy, the PRO polypeptide treatment may be an inhibitor of known &lt; RTI ID = 0.0 &gt; myocardial &lt; / RTI &gt; hypertrophic factor, for example, an inhibitor of an alpha adrenergic agonist such as phenylpyridine; Endothelin-1 inhibitors such as BOSENTAN (R) and Moxonodin (MOXONODIN); Inhibitors for CT-1 (U. S. Patent No. 5,679, 543); Inhibitors for LIF; ACE inhibitors; Des-aspartate-angiotensin I inhibitor (US Patent No. 5,773,415) and angiotensin II inhibitor).

For the treatment of hypercardia associated hypertension, PRO polypeptides may be administered in combination with a beta-adrenergic receptor blocker such as propranolol, timolol, tertarolol, carthiolo, nadolol, betasol, phentolol, acetobutolol , Atenolol, metoprolol and carvedilol; ACE inhibitors such as quinapril, captopril, enalapril, ramipril, benazepril, posinopril or lisinopril; Diuretics such as chlorothiazide, hydrochlorothiazide, hydrofluorometazide, methylcothiazide, benzthiazide, dichlorphenamide, acetazolamide or indapamide; And / or calcium channel blockers such as diltiazem, nifedipine, verapamil, or nicardipine. Pharmaceutical compositions comprising a therapeutic agent as identified by the generic name herein are commercially available and will be administered in accordance with the manufacturer's instructions for dosage, administration, side effects, contraindications, etc. (Physicians' Desk Reference (Medical Economics Data Production Co .: Montvale, NJ, 1997), 51 ed.).

Preferred candidates for combination therapy in the treatment of acromegaly cardiomyopathy include beta-adrenergic blocking drugs (e.g., propranolol, timolol, tertarolol, carthorol, nadolol, betasolol, &Lt; / RTI &gt; hydroxypropylmethylcellulose, hydroxypropylmethylcellulose, hydroxypropylmethylcellulose, hydroxypropylmethylcellulose, hydroxypropylmethylcellulose, hydroxypropylmethylcellulose, Treatment of hypertension associated hypertension may include administration of calcium channel blockers such as diltiazem, nifedipine, verapamil or nicardipine; β-adrenergic blockers; Diuretics such as chlorothiazide, hydrochlorothiazide, hydrofluorometazide, methylcothiazide, benzthiazide, dichlorphenamide, acethazolamide or indapamide; And / or ACE inhibitors such as quinapril, captopril, enalapril, ramipril, vinazepril, posinopril, or ricinopril.

In the case of other conditions, the PRO polypeptide or antagonist thereof may be used in combination with bone and / or cartilage defects, wounds, or other agents beneficial for the treatment of such tissue. Such agents include various growth factors such as EGF, PDGF, TGF-? Or TGF- ?, IGF, FGF, and CTGF.

In addition, the PRO polypeptide or antagonist thereof used in the treatment of cancer may be used in combination with a cytotoxic agent, chemotherapeutic agent or proliferation inhibitor as described above. Further, in the case of cancer treatment, it is suitable to administer the PRO polypeptide or an antagonist thereof continuously, or to administer the PRO polypeptide or an antagonist thereof in combination with radiation therapy, or radiation therapy including administration of a radioactive substance.

The effective amount of the therapeutic agent in combination with the PRO polypeptide or its antagonist will depend on the discretion of the physician or veterinarian. Dosages are adjusted and adjusted to maximize treatment of symptoms to be treated. For example, in the case of hypertension treatment, an effective amount is ideally suited to the use of diuretic or cardiotonic agents and to consider such symptoms as hypertension or hypotension, kidney damage, and the like. In addition, the dosage will vary depending on such factors as the type of therapeutic agent to be used and the type of patient being treated. Usually, the amount used will be the same amount as when the therapeutic agent is administered without the PRO polypeptide.

xiii. product

Or an agonist or antagonist thereof, useful for the diagnosis or treatment of the above-described diseases. The term &quot; therapeutically effective amount &quot; Products such as kits include at least containers and labels. Suitable containers include, for example, bottles, vials, syringes and test tubes. The container may be formed of various materials such as glass or plastic. The container contains a composition that is effective for the diagnosis or treatment of symptoms, and includes a sterile inlet port (e.g., a container for an intravenous solution, or a vial with a stopper for piercing a hypodermic needle. May be present). The active agents in the composition are PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887 polypeptides, agonists or antagonists thereof. A label on the container or attached to the container indicates that the composition is used for the diagnosis or treatment of the selected condition. The article of manufacture may further comprise a second container comprising a pharmaceutically-acceptable buffer, such as phosphate-buffered saline, Ringer's solution and dextrose solution. The product may further include other materials desirable from a commercial point of view and from the user's perspective, including other buffer solutions, diluents, filters, needles, syringes, and package inserts containing instructions for use. The product may also comprise a second or third container containing other active agents as described above.

E. Antibodies

Some of the most promising drug candidates according to the present invention are antibodies and antibody fragments that are capable of inhibiting the production of the gene product identified herein or reducing the activity of the gene product.

i. Polyclonal antibody

Methods for producing polyclonal antibodies are known to those skilled in the art. A polyclonal antibody can be produced in a mammal, for example, by injecting the immunizing agent and, if necessary, an adjuvant more than once. In general, the immunizing agent and / or adjuvant is injected into the mammal through several subcutaneous or intraperitoneal injections. The immunizing agent may include PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887 polypeptides or fusion proteins thereof. It may be useful to conjugate the immunizing agent to a protein known to be immunogenic in the mammal to be immunized. Examples of such immunogenic proteins include, but are not limited to, keyhole limpet hemocyanin, serum albumin, sorbitol globulin, and soybean trypsin inhibitor. Examples of adjuvants that may be used include Freund's complete adjuvant and MPL-TDM adjuvant (monophosphoryl lipid A or synthetic trehalose decolinomicolate). Immunization methods can be screened by those skilled in the art without undue experimentation.

ii. Monoclonal antibody

Alternatively, the anti-PRO179, anti-PRO238, anti-PRO364, anti-PRO844, anti-PRO846, anti-PRO1760, anti- PRO205, anti- PRO321, anti- PRO333, anti- PRO840, anti- , Anti-PRO879, anti-PRO882, anti-PRO885 or anti-PRO 887 antibodies may be monoclonal antibodies. Monoclonal antibodies can be prepared using hybridoma methods as described in Kohler and Milstein, Nature, 256: 495 (1975). In a hybridoma method, a mouse, hamster or other suitable host animal is typically immunized with an immunizing agent to induce a lymphocyte capable of producing or producing an antibody that specifically binds to the immunizing agent. Alternatively, the lymphocytes can be immunized in vitro.

The immunizing agent will generally comprise PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887 polypeptides or fusion proteins thereof. Generally, peripheral blood lymphocytes (" PBL ") are used when cells of human origin are desired, whereas spleen cells or lymph node cells are used when a non-human mammalian source is desired. Subsequently, a suitable fusion agent, such as polyethylene glycol, is used to fuse lymphocytes and infinite proliferation cell lines to form hybridoma cells (Goding, Monoclonal Antibodies: Principle and Practice, Academic Press, (1986) pp. 59-103). Infinitely proliferating cell lines are generally transformed mammalian cells, particularly myeloma cells of rodent, bovine, and human origin. Generally, a rat or mouse myeloma cell line is used. The hybridoma cells can preferably be cultured in a suitable culture medium containing one or more substances that inhibit the proliferation or survival of unfused infinitely proliferating cells. For example, in the absence of hypoxanthine guanine phosphoribosyltransferase (HGPRT or HPRT) in a parent cell, the hybridoma culture medium will typically include hypoxanthine, aminopterin and thymidine ("HAT medium") , These substances inhibit the proliferation of HGPRT-deficient cells.

Preferred infinite proliferating cell lines are those that efficiently fuse, maintain stable stigma of the antibody by the selected antibody-producing cells, and are sensitive to media such as HAT medium. More preferred infinite proliferating cell lines are, for example, the murine myeloma cell line available from the Salk Institute Cell Distribution Center (San Diego, CA) and the American Type Culture Collection (Manassas, Va., USA) to be. Human myeloma cell lines and mouse-human heteromyeloma cell lines have also been described for the production of human monoclonal antibodies (Kozbor, J. Immunol., 133: 3001 (1984); Brodeur et al, Monoclonal Antibody Production Techniques and Applications , Marcel Dekker, Inc., New York, (1987) pp. 51-63).

The culture medium in which the hybridoma cells are cultured is then incubated with monoclonal antibodies against PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887 polypeptides. The presence of antibodies can be analyzed. Preferably, the binding specificity of the monoclonal antibody produced by the hybridoma cells is determined by immunoprecipitation or by in vitro binding assays such as radioimmunoassay (RIA) or enzyme-linked immunosorbent assay (ELISA) . Such techniques and analyzes are well known in the art. The binding affinity of the monoclonal antibody can be measured, for example, by Scatchard analysis (Munson and Pollard, Anal. Biochem., 107: 220 (1980)).

After identifying the desired hybridoma cells, the clones are subcloned by limiting dilution and cultured by standard methods (Goding, supra). Suitable culture media for this purpose include, for example, Dulbecco's Modified Eagle's Medium or RPMI-1640 medium. Alternatively, hybridoma cells can be cultivated in vivo as multiple tumors in an animal.

The monoclonal antibody secreted by the subclone may be cultured by conventional immunoglobulin purification methods such as, for example, protein A-Sepharose, hydroxylapatite chromatography, gel electrophoresis, dialysis or affinity chromatography Can be isolated and purified from a medium or a plurality of liquids.

In addition, monoclonal antibodies can also be prepared by recombinant DNA methods such as those described in U.S. Patent No. 4,816,567. The DNA encoding the monoclonal antibody of the present invention can be easily isolated using a conventional method (for example, using an oligonucleotide probe capable of specifically binding to a gene encoding a heavy chain and a light chain of a murine antibody) Can be sequenced. The hybridoma cells of the present invention serve as a desirable source of such DNA. The DNA may be inserted into an expression vector once isolated and then transfected into host cells such as monkey COS cells, Chinese hamster ovary (CHO) cells, or myeloma cells that do not separately produce immunoglobulin protein, A monoclonal antibody can be synthesized. Also, for example, DNA can be obtained by inserting sequences encoding human heavy and light chain constant domains in place of homologous murine sequences (U.S. Pat. No. 4,816,567; Morrison et al., Supra), or in non-immunoglobulin polypeptides Can be modified by covalently linking all or part of the coding sequence to the immunoglobulin coding sequence. Such a biimugoglobulin polypeptide may be substituted for the constant domain of the antibody of the invention, or alternatively substituted for a variable domain of an antibody-binding site of the antibody of the invention to generate a chimeric divalent antibody.

The antibody may be a monovalent antibody. Methods for making monovalent antibodies are known in the art. For example, one method involves the recombination of an immunoglobulin light chain with a modified heavy chain. To prevent heavy chain cross-linking, the ends are typically truncated at any point in the Fc region of the heavy chain. Alternatively, to prevent cross-linking, the relevant cysteine residue is replaced with another amino acid residue or deleted.

In addition, in vitro methods are suitable for the production of antibodies. Cleavage of antibodies to produce antibody fragments, particularly Fab fragments, can be accomplished using techniques commonly known in the art.

iii. Human antibodies and humanized antibodies

Anti-PR059, anti-PR059, anti-PR078, anti-PR08, PRO879, anti-PRO882, anti-PRO885 or anti-PRO 887 antibodies may further comprise humanized antibodies or human antibodies. Humanized forms of non-human (e.g., murine) antibodies include chimeric immunoglobulins, immunoglobulin chains or fragments thereof (e.g., Fv, Fab, Fab ', F (ab &apos;) ₂ or other antigen binding sequence of the antibody). Humanized antibodies are human immunoglobulins (CDRs) that have replaced residues of the complementarity determining region (CDR) of the recipient with residues of CDRs of a non-human species (donor antibody) such as mouse, rat or rabbit, Acceptor antibody). In some cases, Fv framework residues of human immunoglobulin are replaced with corresponding non-human residues. In addition, the humanized antibody may comprise a residue that is not found in the recipient antibody nor is found in the introduced CDR or framework sequence. In general, a humanized antibody will comprise substantially all of one or more, typically two or more, variable domains, wherein all or substantially all of the CDR regions correspond to regions of non-human immunoglobulin, and all or substantially all of the FR regions Corresponds to the region of the human immunoglobulin consensus sequence. In addition, the humanized antibody will comprise an immunoglobulin constant region (Fc), generally at least a portion of the constant region of a human immunoglobulin (Jones et al., Nature, 321: 522-525 (1986); Riechmann et al., Nature, 332: 323-327 (1988); and Presta, Curr. Op. Struct. Biol. 2: 593-596 (1992)).

Methods for humanizing non-human antibodies are well known in the art. Generally, humanized antibodies comprise one or more amino acid residues introduced into an antibody derived from a non-human source. These non-human amino acid residues are often referred to as " import " residues and are typically obtained from the " import " Humanization can be accomplished essentially by the method of Winter et al., Nature, 321: 522-525 (1986); Riechmann et al., Nature (1986)) by using rodent CDRs or CDR sequences instead of the corresponding sequences of human antibodies , 332: 323-327 (1988); Verhoeyen et al., Science, 239: 1534-1536 (1988)). Thus, such " humanized " antibodies are chimeric antibodies (U.S. Patent No. 4,816,567) in which substantially less intact human variable domains are replaced by corresponding sequences from non-human species. Indeed, humanized antibodies are typically human antibodies in which some CDR residues and possibly some FR residues have been replaced with residues derived from the homologous region of the rodent antibody.

Human antibodies can also be prepared using a variety of techniques known in the art including phage display libraries (Hoogenboom et al., J. Mol. Biol., 227: 381 (1991); Marks et al. Mol. Bio., 222: 581-597 (1991)). Also, techniques such as Coulter et al. And Boerner et al. Can also be used to prepare human monoclonal antibodies (Cole et al., Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, p. 77 (1985) and Boerner et al , J. Immunol., 147 (1): 86-95 (1991)] Similarly, human antibodies can be produced by introducing human immunoglobulin loci in transgenic animals, e. After immunization, human antibody production was observed, which was very similar to that observed in humans in all respects, including gene rearrangement, assembly, and antibody repertoire. This method For example, in US 5,545,807, US 5,545,806, US 5,569,825, US 5,625,126, US 5,633,425, US 5,661,016, and scientific publications (Marks et al., Bio / Technology 10 , 779-783 (1992); Lonberg et al. , Nature 368, 856-859 (1994), Morrison, Nature 368, 812-13 (1994); Fishwild et al., Nature Biotechnology 14, 845-51 (1996); Neuberger, Nature Biotechnology 14, 826 (1996); Lonberg and Huszar, Intern. Rev. Immunol. 13 65-93 (1995)).

iv. Bispecific antibody

Bispecific antibodies are monoclonal, preferably human or humanized, antibodies that exhibit binding specificity for two or more different antigens. In this case, one of the binding specificities is the binding specificity for PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887 polypeptides, Binding specificity to other antigens, preferably to cell surface proteins, receptors or receptor subunits.

Methods for producing bispecific antibodies are known in the art. Typically, recombinant production of bispecific antibodies is based on the co-expression of two pairs of immunoglobulin heavy / light chains, where the two heavy chains exhibit different specificities (Millstein and Cuello, Nature, 305: 537-539 1983). Due to the random classification of immunoglobulin heavy and light chains, these hybridomas (quadromas) produce a possible mixture of 10 different antibody molecules, only one of which has an accurate bispecific structure. Purification of the correct molecule is generally achieved with an affinity chromatographic step. Similar methods are described in WO 93/08829 (published May 13, 1993) and in Traunecker et al., EMBO J., 10: 3655-3659 (1991).

The antibody variable domain (antibody-antigen binding site) exhibiting the desired binding specificity can bind immunoglobulin constant domain sequences. The linkage is preferably a bond with an immunoglobulin heavy chain constant domain comprising at least a portion of the hinge, CH2 and CH3 regions. It is preferred that a first heavy chain constant region (CH1) comprising a site necessary for light chain bonding is present in at least one of said conjugates. The immunoglobulin heavy chain conjugate and, if desired, the DNA encoding the immunoglobulin light chain are inserted into separate expression vectors and co-transfected into a suitable host organism. For more details on producing bispecific antibodies see, for example, Suresh et al., Methods in Enzymology, 121: 210 (1986).

v. Heterozygous antibody

A heterozygous antibody consists of two covalently linked antibodies. Such antibodies are useful, for example, for targeting immune system cells to undesired cells (US Patent No. 4,676,980) and for the treatment of HIV infection (WO 91/00360, WO 92/200373, and EP 03089). It is believed that the heterologous antibody can be prepared in vitro using methods known in the art of synthetic protein chemistry, including methods using cross-linking agents. For example, immunotoxins can be prepared by using a disulfide exchange reaction or by forming thioether linkages. Examples of reagents suitable for this purpose include iminothiolate and methyl-4-mercaptobutyrimidate and reagents disclosed in U.S. Patent No. 4,676,980.

vi. Operation of effect function

For example, in order to increase the effect of an antibody in the treatment of cancer, it may be desirable to modify the effector function of the antibody of the present invention. For example, cysteine residues can be introduced into the Fc region to form interchain disulfide bonds within this region. The allogeneic antibody thus generated can be enhanced in internalizing capacity and / or increased complement-mediated cell death and antibody-dependent cellular cytotoxicity (Caron et al., J. Exp Med 176: 1191-1195 (1992) and Shopes, J. Immunol., 148: 2918-2922 (1992)). In addition, heterobifunctional crosslinkers described in the literature (Wolff et al. Cancer Research, 53: 2560-2565 (1993)) may be used to prepare homodimeric antibodies exhibiting elevated anti-tumor activity. Alternatively, antibodies comprising dual Fc regions can be engineered to increase the complement solubility and ADCC capabilities of the antibody (Stevenson et al., Anti-Cancer Drug Design, 3: 219-230 (1989)).

vii. Immunoconjugate

The invention also encompasses a method of treating or preventing a cytotoxic agent such as a chemotherapeutic agent, a toxin (e.g., an enzymatically active bacterial, fungal, plant or animal toxin, or a fragment thereof) or a radioactive isotope Binding &lt; / RTI &gt; antibody).

Chemotherapeutic agents useful for the production of the immunoconjugate are described above. Enzyme active toxins and fragments thereof that may be used include diphtheria A chain, unbound active fragment of diphtheria toxin, exotoxin A chain (derived from Pseudomonas aeruginosa ), lysine A chain, Aleurites fordii protein, dianthine protein, Phytolaca americana protein (PAPI, PAPII and PAP-S), bitter melon ( momordica charantia ) inhibitor, Leucine, croutine, sapaonaria officinalis inhibitor, gelonin , mitogelin, restricotisin, penomycin, enomycin, and tricothecenes. Several radionuclides can be used in the preparation of radiolabeled antibodies. Examples include ²¹² Bi, ¹³¹ I, ¹³¹ In, ⁹⁰ Y, and ¹⁸⁶ Re.

Various difunctional protein-coupling agents such as N-succinimidyl-3- (2-pyridyldithiol) propionate (SPDP), iminothiolane (IT), bifunctional derivatives of imidoesters (For example, dimethyl adipimidate HCl), active esters (e.g., disuccinimidylsuberate), aldehydes (e.g., glutaraldehyde), bis-azido compounds Diazonium derivatives such as bis- (p-diazonium benzoyl) -ethylenediamine), diisocyanates (e.g., toluene 2,6-diisocyanate), bis And a bis-active fluorine compound (e.g., 1,5-difluoro-2,4-dinitrobenzene) can be used to make a conjugate of an antibody and a cytotoxic agent. For example, ricin immunotoxins can be prepared as described in Vitetta et al., Science, 238: 1098 (1987). Carbon-14-labeled 1-isothiocyanatobenzyl-3-methyldiethylenetriamine pentaacetic acid (MX-DTPA) is an exemplary chelating agent that binds an antibody with a radioactive nucleotide (see WO 94/11026 ).

In another embodiment, the antibody can be conjugated to a " receptor " (e.g., streptavidin) used in tumor preliminary targeting wherein the antibody-receptor conjugate is administered to the patient, Ligand " (e.g., avidin) bound to a cytotoxic agent (e. G., A radionucleotide) after removing the unbound conjugate from the cell.

viii. Immunoliposome

The antibodies disclosed herein may also be formulated as an immunoliposome. Liposomes comprising this antibody can be prepared by methods known in the art, for example, as described in Epstein et al., Proc. Natl. Acad. Sci. USA, 82: 3688 (1985); Hwang et al., Proc. Acad. Sci. USA, 77: 4030 (1980); and U.S. Pat. Nos. 4,485,045 and 4,544,545). Liposomes with increased circulation time are disclosed in U.S. Patent No. 5,013,556.

Particularly useful liposomes can be produced by reverse phase evaporation using lipid compositions containing phosphatidylcholine, cholesterol, and phosphatidylethanolamine (PEG-PE) derived from PEG. The liposomes are extruded through a filter of constant pore size to obtain liposomes of the desired size in diameter. Fab 'fragments of the antibodies of the invention can be linked to liposomes via a disulfide-interchange reaction as described in Martin et al., J. Biol. Chem., 257: 286-288 (1982) . Chemotherapeutic agents (e. G., Doxorubicin) are optionally included in liposomes (see Gabizon et al., J. National Cancer Inst., 81 (19): 1484 (1989)).

ix. The pharmaceutical composition of the antibody

For the treatment of the various diseases described above and below, the specificity of the PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887 polypeptides identified herein , And other molecules identified by the screening assays described above, may be administered in the form of pharmaceutical compositions.

When the polypeptide is an intracellular polypeptide and the whole antibody is used as an inhibitor, the internalizing antibody is preferably used in the case where the PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, Do. However, lipofection or liposomes can also be used to deliver an antibody or antibody fragment into a cell. When an antibody fragment is used, a minimal inhibitory fragment that specifically binds to the binding domain of the target protein is preferred. For example, a peptide molecule having the ability to bind to a target protein sequence can be designed based on the variable-region sequence of the antibody. Such peptides can be chemically synthesized and / or produced using recombinant DNA technology (see, for example, Marasco et al., Proc. Natl. Acad. Sci. USA, 90: 7889-7893 (1993) ) Reference).

In addition, the formulations of the present invention may comprise one or more active compounds, if desired, depending on the particular condition being treated, preferably a compound with complementary activity that does not adversely affect one another. Alternatively, or in addition, the composition may comprise a substance that enhances its function, for example, a cytotoxic agent, a cytokine, a chemotherapeutic agent, or a proliferation inhibitor. Such molecules are suitably combined in an amount effective for the intended purpose.

The active ingredient may be prepared, for example, by coacervation techniques or by interfacial polymerization techniques, for example, in a colloidal drug delivery system (e.g., liposomes, albumin microspheres, microemulsions, Capsules) or hydroxymethylcellulose or gelatin-microcapsules in the form of macroemulsions and poly- (methylmethacrylate) microcapsules. Such techniques are described in Remington ' s Pharmaceutical Sciences, supra.

The formulation used for in vivo administration should be sterilized. This is easily accomplished by filtration through a sterile filter membrane.

Sustained release formulations may also be prepared. Suitable examples of sustained-release preparations are semi-permeable matrices of solid hydrophobic polymers containing antibodies, which are in the form of shaped articles, for example films or microcapsules. Examples of sustained release matrices include polyesters, hydrogels (e.g., poly (2-hydroxyethyl-methacrylate) or poly (vinyl alcohol)), polylactides (U.S. Patent No. 3,773,919), L- And copolymers of? Ethyl-L-glutamate, non-degradable ethylene-vinyl acetate, degradable lactic acid-glycolic acid copolymers such as LUPRON DEPOT (registered trademark) (lactic acid-glycolic acid copolymer and leuprolide acetate Injectable microspheres), and poly-D - (-) - 3-hydroxybutyric acid. Polymers such as ethylene-vinyl acetate and lactic acid-glycolic acid can release molecules for more than 100 days, but some hydrogels release proteins for shorter periods of time. If the encapsulated antibody remains in the body for a long time, the antibody may denature or aggregate upon exposure to moisture at 37 &lt; 0 &gt; C to lose biological activity and change its immunogenicity. Rational strategies can be designed according to the relevant mechanisms for stabilization. For example, if it is found that the cohesion mechanism is an intermolecular SS bond formation through a thio-disulfide interchange, it may be desirable to formulate a sulfhydryl moiety using the formula of the sulfhydryl moiety, lyophilization from an acidic solution, Stabilization can be achieved through the development of the composition.

x. Treatment with antibodies

Antibodies to PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887 polypeptides may be used to treat a variety of cardiovascular diseases, It can be used to treat new diseases.

The antibody may be administered by intravenous administration as a bolus or by a known method such as intramuscular, intraperitoneal, intracerebral, subcutaneous, intraarticular, intracisternal, intrathecal, oral, To a mammal, preferably a human. Intravenous administration of the antibody is preferred.

Other therapies may be contemplated with the administration of the antibody of the present invention. For example, when the antibody is to treat cancer, the patient treated with the antibody may receive radiation therapy concurrently. Alternatively, or in addition, a chemotherapeutic agent may be administered to the patient. The manufacture and administration schedule of such a chemotherapeutic agent can be determined empirically according to the manufacturer's instructions or by a person skilled in the art. In addition, the preparation and administration schedule of such chemotherapeutic agents is described in the literature (Chemotherapy Service Ed., M. C. Perry, Williams & Wilkins, Baltimore, MD, 1992). The chemotherapeutic agent may be administered before or after administration of the antibody, or may be administered simultaneously. Anti-estrogen compounds such as tamoxifen or EVISTA (EVISTA), or anti-progesterone compounds such as onafristone (see EP 616812) may be administered with the antibody in known doses.

It may also be desirable to administer antibodies to other tumor-associated antigens such as antibodies that bind to one or more of ErbB2, EGFR, ErbB3, ErbB4 or VEGF receptors when the antibody is used to treat cancer. They also include the agents described above. In addition, the antibody is preferably administered consecutively, or in combination with radiotherapeutic treatment such as administration of radiation or radioactive material. Alternatively, or additionally, the same antigen as the antigen described herein, or two or more antibodies that bind to two or more different antigens may be co-administered to a patient. Often, it may be beneficial to administer the patient one or more cytokines to the patient. In a preferred embodiment, the antibody of the present invention may be administered concurrently with the proliferation inhibitor. For example, the antibody of the present invention can be administered after first administering a proliferation inhibitor. However, simultaneous administration or prior administration of the antibody of the present invention may also be considered. The proper dosage of the proliferation inhibitor is the dose currently used, and the dose may be lowered due to the complex action (synergism) of the proliferation inhibitor and the present antibody.

In one embodiment, angiogenesis of the tumor is attacked in combination therapy. Anti-PRO polypeptide antibodies and other antibodies (e. G., Anti-VEGF) are administered to a patient suffering from a tumor in a therapeutically effective amount as determined by observing tumor necrosis or metastasis thereof. This treatment continues until no beneficial effect is observed or until the clinical examination shows no evidence of tumor or any metastatic lesion. TNF may then be administered alone or in combination with other agents such as alpha-beta-or gamma-interferon, anti-HER2 antibody, heregulin, anti-herlaurogulin antibody, D-factor, interleukin- Protein C antibody, an anti-protein S antibody or a C4b binding protein (e. G., IL-2), granulocyte- macrophage colony stimulating factor (GM-CSF), or substances that promote microvascular clotting in tumors ; WO 91/01753, published Feb. 21, 1991) or administered in parallel with heat or radiation therapy.

Because the adjuvants have varying effects, it is desirable to compare the effect of adjuvants on tumors via matrix screening in a conventional manner. Administration of the anti-PRO polypeptide antibody and TNF is repeated until the desired clinical effect is achieved. Alternatively, the anti-PRO polypeptide antibody is administered with TNF and optionally an adjuvant. When the solid tumor is found in a limb, or other location that is susceptible to separation from the general circulation, the therapeutic agent of the present invention is administered to a separate tumor or organ. In another embodiment, an FGF or PDGF antagonist, such as an anti-FGF or anti-PDGF neutralizing antibody, is administered to a patient with an anti-PRO polypeptide antibody. Preferably, treatment with an anti-PRO polypeptide antibody can be stopped during wound healing or desired angiogenesis.

In the prevention or treatment of cardiovascular disease, endothelial cell disease and angiogenesis, the appropriate dosage of the antibody herein is determined by the type of disease to be treated, the severity and course of the disease as defined above, whether the antibody is administered for prophylactic purposes, , The prior therapy, the patient's clinical history and response to the antibody, and the judgment of the primary care physician. It is preferred that the antibody is administered to the patient once or in a series of treatments.

For example, depending on the type and severity of the disease, from about 1 [mu] g / kg to 15 mg / kg (e.g., 0.1 to 20 mg / kg) of the antibody may be administered to the patient It is a candidate dose. Typical daily or weekly dosages are from about 1 [mu] g / kg to 100 mg / kg or more, depending on the factors mentioned above. In the case of repeated administrations over several days depending on the symptoms, the treatment repeats or persists until the symptoms of the disease are suppressed as desired. However, other dosages may be effective. The progress of this therapy can be readily observed with conventional techniques and assays (e. G., Radioactive tumor imaging).

xi. Products containing antibodies

Products with a container containing an antibody and a label are also provided. These products are as described above and the active ingredients are selected from the group consisting of anti-PRO179, anti-PRO238, anti-PRO364, anti-PRO844, anti- PRO846, anti- PRO1760, anti- PRO205, anti- -PRO840, anti-PRO877, anti-PRO878, anti-PRO879, anti-PRO882, anti-PRO885 or anti-

xii. Diagnosis and prognosis of tumors using antibodies

Cell-surface proteins, such as proliferative receptors that are overexpressed in certain tumors, are excellent targets for the treatment of drug candidates or tumors (e.g., cancer), but when the condition in which the antibody is used is cancer, Can also be used after diagnosis and examples. For example, antibodies directed against PRO polypeptides can be used as diagnostic or prognostic agents in tumors.

For example, antibodies, including antibody fragments, can be used to qualitatively or quantitatively detect the expression of a gene comprising a gene encoding a PRO polypeptide. Preferably, the antibody is attached to a detectable label, such as, for example, a fluorescent label, and the binding of the antibody can be detected by optical microscopy, flow cytometry, fluorescence or other techniques known in the art Can be observed. This binding assay is performed essentially as described above.

In situ detection of antibody binding to marker gene products can be performed using, for example, immunofluorescence microscopy or immunoelectron microscopy. For this purpose, the labeled antibody is reacted with the sample by isolating the histological sample from the patient, preferably by placing the antibody on the biological sample. This method also allows to know the distribution of marker gene products in irradiated tissues. It will be apparent to those skilled in the art that various histological methods may be readily employed for in situ detection.

The following examples are provided for illustrative purposes only and are not intended to limit the scope of the invention in any way.

The disclosures of all patents and documents cited herein are incorporated herein by reference.

Commercial reagents mentioned in the examples were used according to manufacturer's instructions unless otherwise indicated. In the following examples and throughout the specification, the source of cells identified by ATCC Accession No. is the American Type Culture Collection (Manassas, Va.). Unless otherwise stated, the present invention is contemplated as described in Sambrook et al., Supra; Ausubel et al., Current Protocols in Molecular Biology (Green Publishing Associates and Wiley Interscience, NY, 1989); Innis et al. , PCR Protocols: A Guide to Methods and Applications (Academic Press, Inc., NY, 1990); Harlow et al., Antibodies: A Laboratory Manual (Cold Spring Harbor Press; Cold Spring Harbor, 1988); Gait, Oligonucleotide Synthesis The standard method of recombinant DNA technology as described in Freshney, Animal Cell Culture, 1987; Coligan et al., Current Protocols in Immunology, 1991) was used.

Example 1: Extracellular domain homology screening to identify novel polypeptides and cDNA encoding them

The EST database was searched using extracellular domain (ECD) sequences (including secretory signal sequences, if present) from about 950 known secreted proteins from the Swiss-Prot public database. The EST database includes an open database (e.g., GenBank) and a private database (e.g., LIFESEQ ™ (Incyte Pharmaceuticals, Palo Alto, Calif.). BLAST-2 (Altschul et al., Methods in Enzymology 266: 460-480 (1996)) as a comparison of the ECD protein sequence for the 6-frame translation of the EST sequence. Comparisons with a non-coding 70 (or even 90 in some cases) Blast score were clustered and analyzed using a consensus DNA sequence using the program " phrap " (Phil Green, University of Washington, Seattle, WA) Assembly.

Using these extracellular domain homology screens, the consensus DNA sequence was assembled against other EST sequences identified using the probes. Also, repeated cycles of BLAST or BLAST-2 and Frap were used to elongate the consensus sequence as long as possible, often but not always, using the EST sequence sources discussed above.

Oligonucleotides were then synthesized based on the consensus sequence obtained as described above, used to identify cDNA libraries containing sequences of interest by PCR, and probes for cloning full-length coding sequences for PRO polypeptides Lt; / RTI &gt; The forward and reverse PCR primers generally range from 20 to 30 nucleotides and are often designed to provide PCR products of about 100 to 1000 bp in length. The probe sequence is usually 40-55 bp in length. In some cases, if the consensus sequence is greater than about 1 to 1.5 kbp, additional oligonucleotides are synthesized. To screen several libraries for full-length clones, DNA from these libraries was screened by PCR amplification according to the literature (Ausubel et al., Current Protocols in Molecular Biology) using PCR primer pairs. Clones encoding the gene of interest were then isolated using the probe oligonucleotide and one of the primer pairs by using a positive library.

The cDNA library used to isolate cDNA clones was prepared by standard methods using commercially available reagents such as reagents from Invitrogen (San Diego, Calif.). The cDNA was primed with oligo dT with the NotI site, ligated to the SalI hemi kinase-coupled adapter at the blunt end, cleaved with NotI, classified into appropriate sizes by gel electrophoresis, and cloned into a suitable cloning vector (e. g., pRKB Or pRKD; pRK5B is a precursor of pRK5D that does not contain the SfiI site; see the Holmes et al., Science, 253: 1278-1280 (1991)) .

Example 2: Isolation of cDNA clone using amylase screening

1. Construction of oligo dT primed cDNA library

MRNA was isolated from human tissues using Invitrogen (San Diego, Calif.) Reagent and protocol (Fast Track 2). The above RNA was used to generate a vector pRK5D raised and dT-primed cDNA library using Life Technologies's SuperScript Plasmid System, Gettersburg, MD, USA. In this procedure, the size of the double-stranded cDNA was selected to be larger than 1000 bp, and the SalI / NotI linker cDNA was cloned into the XhoI / NotI cut vector. pRK5D is a cloning vector containing the sp6 transcription initiation site, the SfiI restriction enzyme site and the XhoI / NotI cDNA cloning site in this order.

2. Construction of randomly primed cDNA library

A secondary cDNA library was generated to preferentially provide the 5 'end of the primary cDNA clone. Sp6 RNA was generated from the primary library (as described above) and a randomly primed cDNA library was generated with the RNA using Life Technologies' SuperScript Plasmid System (as described above) . In this process, the double-stranded cDNA was made to have a size of 500 to 1000 bp, ligated smoothly to the NotI adapter, cut into SfiI and cloned into the SfiI / NotI cleavage vector. pSST-AMY.0 is a cloning vector having a yeast alcohol dehydrogenase promoter in front of a cDNA cloning site and a mouse amylase sequence (mature sequence, no secretion signal) and having a yeast alcohol dehydrogenase terminator behind the cloning site. Thus, the cDNA cloned into the vector, which is associated with an amylase sequence within the frame, can secrete the amylase from appropriately transfected yeast colonies.

3. Transformation and detection

DNA from the library described in paragraph 2 above was cooled on ice and 20 ml of electorcompetent DH10B bacteria (Life Technologies) was added. The bacteria and the vector mixture were then electroporated according to the manufacturer's instructions. Subsequently, 1 ml of SOC medium (Life Technologies) was added and the mixture was incubated at 37 [deg.] C for 30 minutes. Thereafter, the transformants were plated in 20 ampicillin-containing 150 mm LB plates and incubated at 37 DEG C for 16 hours. Positive colonies were detached from the plate and DNA was isolated from the bacterial pellet using standard protocols, such as the CsCl-concentration gradient method. The following yeast protocols were performed using the purified DNA.

Yeast methods are classified into three categories: 1) transformation of yeast using a plasmid / cDNA combination vector, 2) detection and isolation of a yeast clone that secretes amylase, and 3) direct PCR amplification of the insert from yeast colonies, Purification of DNA for sequencing and further analysis.

The yeast used was HD56-5A (ATCC-90785). This strain represents a genotype of MAT alpha, ura3-52, leu2-3, leu2-112, his3-11, his3-15, MAL ⁺ , SUC ⁺ , GAL ⁺ . Preferably, yeast mutants without a post-translational pathway can be used. These variants may have a defective allele due to translocation in sec71, sec72, sec62, preferably in sec71 with a truncated terminus. Alternatively, antagonists that interfere with the normal functioning of the gene or that interfere with the formation of other proteins (e.g., SEC61p, SEC72p, SEC62p, SEC63p, TDJ1p or SSA1p-4p) Antisense nucleotides and / or ligands).

Transformation was carried out on the basis of the protocol described in the literature (Gietz et al., Nucl. Acid. Res., 20: 1425 (1992)). Subsequently, the transformed cells were inoculated from agar into 100 ml of YEPD complex broth and incubated overnight at 30 ° C. YEPD broth was prepared as described in Kaiser et al., Methods in Yeast Genetics, Cold Spring Harbor Press, Cold Spring Harbor, NY, p. 207 (1994). The overnight culture was diluted to about 2 x 10 ⁶ cells / ml (approximately OD ₆₀₀ = 0.1) with 500 ml fresh YEPD broth and cultured at about 1 x 10 ⁷ cells / ml (about OD ₆₀₀ = 0.4-0.5) Respectively.

Cells were harvested and transfected, transferred to a GS3 rotorbelt in a Sorval GS3 rotor and centrifuged at 5,000 rpm for 5 minutes, the supernatant discarded and resuspended in sterile water in a 50 ml Falcon tube And centrifuged again at 3,500 rpm on a Beckman GS-6KR centrifuge. The supernatant was discarded and the cells were washed with LiAc / TE (10 ml, 10 mM Tris-HCl, 1 mM EDTA pH 7.5, 100 mM Li ₂ OOCCH ₃ ) and resuspended in LiAc / TE (2.5 ml).

In a microcentrifuge tube, 100 [mu] l of the prepared cells were mixed with fresh modified single stranded salmon testis DNA (Lofstrand Lab, Gageburg, Md.) And 1 [mu] g of transformed DNA (volume <10 [mu] l). And then briefly vortexed to mix the mixture, 40% PEG / TE 600 ㎕ (40% polyethylene glycol -4000, 10 mM Tris-HCl, 1 mM EDTA, 100 mM Li 2 OOCCH 3, pH 7.5) was added. The mixture was gently mixed and incubated at 30 [deg.] C with stirring for 30 minutes. Heat shock was then added to the cells for 15 minutes at 42 DEG C and the supernatant was discarded by centrifugation of the reaction vessel at 12,000 rpm for 5 to 10 seconds in a microcentrifuge and 500 [mu] l of TE (10 mM Tris-HCl, 1 mM EDTA pH7 .5), and then re-centrifuged. The cells were diluted with 1 ml of TE and 200 [mu] l of aliquots were plated on pre-prepared selection media in 150 mm growth plates (VWR).

Alternatively, transfection was performed using a single large-scale reaction while increasing the amount of reagent instead of a small reaction over several rounds.

The selection medium used is a synthetic full deck without uracil prepared as described in Kaiser et al., Methods in Yeast Genetics, Cold Spring Harbor Press, Cold Spring Harbor, NY, p. 208-210 (1994) It was Strosa (SCD-Ura). The transformants were cultured at 30 DEG C for 2 to 3 days.

Detection of colonies secreting amylase was carried out by incorporating red starch into the selective proliferation medium. Starch was combined with a red dye (reactive Red-120, Sigma) according to the method as described in Biely et al., Anal. Biochem., 172: 176-179 (1988). The bound starch was added to the SCD-Ura agar plate at a final concentration of 0.15% (w / v) and buffered to pH 7.0 (final concentration 50-100 mM) using potassium phosphate.

Positive colonies were screened and streaked on a new selection medium (on a 150 mm plate) to obtain a single colloid that was well isolated and identifiable. Red starch was added directly to the buffered SCD-Ura agar to detect well-isolated single colonies positive for amylase secretion. Positive colonies having the ability to produce transparent halo around positive colonies that can be identified by direct decomposition of starch were screened.

4. Isolation of DNA by PCR amplification

When isolating positive colonies, a portion thereof was detached with a toothpick and diluted with 30 μl of sterilized water in a 96-well plate. At this time, positive colonies were frozen and stored or immediately amplified for subsequent analysis. (Clontech, Palo Alto, CA), 4.0 μl of 10 mM dNTP (Perkin Elmer-Cetus), 2.5 μl of Clontech buffer (Clontech), 0.25 μl of omni-directional oligonucleotide 1, 0.5 μl of reverse oligonucleotide 2 0.25 [mu] l of distilled water and 12.5 [mu] l of distilled water was used as a template in a 25 [mu] l volume PCR reaction. The sequence of omni-directional oligonucleotide 1 is as follows:

5'-TGTAAAACGACGGCCAGT TAAATAGACCTGCAATTATTAATCT -3 '(SEQ ID NO: 33)

The sequence of reverse oligonucleotide 2 is as follows:

5'-CAGGAAACAGCTATGACC ACCTGCACACCTGCAAATCCATT -3 '(SEQ ID NO: 34)

Then, the PCR was carried out as follows.

a. Denaturation at 92 [deg.] C for 5 minutes,

b. Denaturation at 92 캜 for 30 seconds, annealing at 59 캜 for 30 seconds, elongation at 72 캜 for 60 seconds,

c. Denaturation at 92 캜 for 30 seconds, annealing at 57 캜 for 30 seconds, elongation at 72 캜 for 60 seconds,

d. Denaturation at 92 캜 for 30 seconds, annealing at 55 캜 for 30 seconds, elongation at 72 캜 for 60 seconds,

e. Gt; 4 C. &lt; / RTI &gt;

The underlined region of the oligonucleotide was annealed to the ADH promoter region and the amylase region, respectively, and the 307 bp region was amplified from the vector pSST-AMY.O when no insert was present. Typically, the first 18 nucleotides at the 5 ' end of the oligonucleotide comprise the annealing site of the sequencing primer. Thus, the total product of the PCR reaction from the empty vector was 343 bp. However, cDNA coupled with the signal sequence produced a significantly longer nucleotide sequence.

After PCR, 5 μl of an aliquot of the reaction solution was examined by 1% agarose gel electrophoresis using a Tris-Borate-EDTA (TBE) buffer system described in Sambrook et al., Supra. Clones producing a strong single PCR product greater than 400 bp were purified with a 96-well Qiaquick PCR clean-up column (Qiagen Inc., Chatsworth, CA) and further sequenced by DNA sequencing Respectively.

Example 3: Isolation of cDNA clone using signal analysis method

(E. G., Genbank) and / or &lt; / RTI &gt; nucleic acid sequences encoding a variety of polypeptides using a proprietary signal sequence search algorithm developed by Genentech, Inc., South San Francisco, Calif. (EST from LIFESEQ (R), Incyte Pharmaceuticals, Inc., Palo Alto, CA) database and dense and assembled EST fragments. The signal sequence algorithm computes the secretory signal score based on the characteristics of the DNA nucleotides around the first and optionally the second methionine codon (ATG) at the 5'-end of the target sequence or sequence. The nucleotides following the first ATG should code for over 35 distinct amino acids without any stop codon. When the first ATG had a predetermined amino acid, the second ATG did not. If this requirement is not met, the score for the candidate sequence is not calculated. To determine whether the EST sequence contained a clear signal sequence, one set of seven sensors (evaluation parameters) known to be associated with the secretory signal was used to score the amino acid sequence around the DNA and ATG codon. This algorithm was used to identify many polypeptide-coding nucleic acid sequences.

Example 4: Isolation of cDNA clones encoding human PRO179

The cDNA sequence was isolated by screening as described above in Example 2. The cDNA sequence isolated in the screening contained a sequence identical to the nucleotide sequence encoding various angiopoietin proteins through BLAST and FastA sequence alignment It turned out. This cDNA sequence is referred to herein as DNA10028 and / or DNA25250.

Next, an oligonucleotide probe was prepared from the sequence of the DNA 10028 molecule based on the sequence homology, and the probe was used to screen the human fetal liver library (LIB6) prepared as described in paragraph 1 of Example 2 above Respectively. The cloning vector is pRK5B (a precursor of pRK5B that does not contain the SfiI site; Holmes et al., Science, 253: 1278-1280 (1991)) in which each of the XhoI and NotI sites is one and the truncated cDNA size is less than 2800 bp .

The DNA sequence of the clone isolated as described above was used to obtain the full-length DNA sequence of PRO179 and the protein sequence derived from PRO179. The full-length nucleotide sequence of DNA16451-1388 is shown in Figure 1 (SEQ ID NO: 1). Clone DNA 16451-1388 contains a single open reading frame with a pronounced translational initiation site at nucleotide positions 37 to 39 and a distinct stop codon at nucleotide positions 1417 to 1419 (Fig. 1). The expected length of the polypeptide precursor is 460 amino acids (Figure 2, SEQ ID NO: 2). The predicted molecular weight of the full-length PRO179 protein shown in Figure 2 is about 53,637 daltons and the pI is about 6.61.

Analysis of the full-length PRO179 sequence shown in Figure 2 (SEQ ID NO: 2) demonstrates the presence of a variety of important polypeptide domains as shown in Figure 2, wherein the locations of these important polypeptide domains are roughly as shown above. Analysis of the full-length PRO179 sequence (Figure 2; SEQ ID NO: 2) shows that the amino acid position of the signal peptide is from about 1 to about 16; The amino acid position of the leucine zipper pattern is from about 120 to about 142, and from about 127 to about 149; The amino acid position of the N-glycosylation site is from about 23 to about 27, from about 115 to about 119, from about 296 to about 300, and from about 357 to about 361; The amino acid positions of the fibrinogen beta and gamma chain C-terminal domains are from about 271 to about 310, from about 312 to about 322, from about 331 to about 369, and from about 393 to about 424.

The clone DNA16451-1388 was deposited with the ATCC on April 14, 1998, and assigned the ATCC No. 209776 accession number. Considering the sequence, the deposited clone contains the correct sequence, and the sequences provided herein are based on known sequencing techniques.

Amino acid sequence analysis of the full-length PRO179 polypeptide suggests that PRO179 may be a novel member of the angiopoietin family because the PRO179 polypeptide is quite similar to the protein of the Angiofietin family. More specifically, the analysis of the De Hoop database (version 35.45 Swiss Prob 35) demonstrates that there is substantial homology between the PRO179 amino acid sequence and the following De Hoop sequence: AF004326_1, P_R94605, HSU83508_1, P_R94603, P_R94317, AF025818_1, HSY16132_1 , P_R65760, I37391 and HUMRSC192_1.

Example 5: Isolation of cDNA clones encoding human PRO238

Consensus DNA sequences were assembled for different EST sequences using the phrap described in Example 1 above. This consensus sequence was referred to herein as DNA30908. Based on the DNA30908 consensus sequence, oligonucleotides were synthesized to 1) identify a cDNA library containing the desired sequence by PCR, and 2) use as a probe to isolate clones of the full-length coding sequence for PRO238. Also, a synthetic oligonucleotide hybridization probe was prepared from the consensus DNA 30908 sequence.

The library DNA was screened by PCR amplification using the following PCR primer pairs according to the method of Ausubel et al., Current Protocols in Molecular Biology, in order to screen various libraries and obtain full-length clone circles. The positive libraries were then used to isolate clones encoding the PRO238 gene using either of the following probe oligonucleotides and the following PCR primers.

The oligonucleotide sequences used in the above method are as follows:

Omni-directional PCR primer 1:

5'-GGTGCTAAACTGGTGCTCTGTGGC-3 '(SEQ ID NO: 35)

Forward PCR primer 2:

5'-CAGGGCAAGATGAGCATTCC-3 '(SEQ ID NO: 36)

Reverse PCR primer

5'-TCATACTGTTCCATCTCGGCACGC-3 '(SEQ ID NO: 37)

Hybridization probes:

5'-AATGGTGGGGCCCTAGAAGAGCTCATCAGAGAACTCACCGCTTCTCATGC-3 '(SEQ ID NO: 38)

The RNA for constructing the cDNA library was isolated from human fetal liver tissue. The cDNA library used to isolate cDNA clones was prepared by standard methods using commercially available reagents such as those from Invitrogen (San Diego, Calif.). The cDNA was primed with oligo dT containing the Not I site and ligated to the Sal I hemimineralization adapter at the blunt end and then digested with Not I and roughly classified by size by gel electrophoresis and then cloned into a suitable cloning vector For example, pRKB or pRKD; pRKB5 is a precursor of pRK5D without the SfiI site; see Homles et al., Science, 253: 1278-1280 (1991)).

The isolated clone DNA as described above was sequenced to obtain the full-length DNA sequence of PRO238 (referred to herein as DNA35600-1162) (Fig. 3, SEQ ID NO: 3) and the derived protein sequence of PRO238.

The entire nucleotide sequence of DNA35600-1162 is shown in Figure 3 (SEQ ID NO: 3). Clone DNA 35600-1162 contains a single open reading frame with a clear translation initiation site at nucleotide positions 134-136 and terminating at a stop codon at nucleotide positions 1064-1066 (Figure 3). The predicted length of the polypeptide precursor is 310 amino acids (Fig. 4; SEQ ID NO: 4), the approximate molecular weight is about 33,524 daltons and pI is about 9.55.

The results of the analysis of the full-length PRO238 sequence shown in Figure 4 (SEQ ID NO: 4) demonstrate the presence of a variety of important polypeptide domains, as shown in Figure 4, where the location of each of the important polypeptide domains is approximate as described above. Analysis of the full-length PRO238 sequence (FIG. 4; SEQ ID NO: 4) shows that the amino acid position of the signal peptide is about 1-21; The amino acid position of the transmembrane domain is about 102 to 119 and about 278 to about 292; The amino acid position of the N-glycosylation site is from about 228 to about 232; The amino acid position of the glycosaminoglycan attachment site is from about 47 to about 51; The amino acid position of the tyrosine kinase phosphorylation site is from about 145 to about 153; The N-myristoylation site has an amino acid position of about 44 to about 50, about 105 to about 111, about 238 to about 244, about 242 to about 248, and about 291 to about 297; The amino acid position of the amidated portion is about 265 to 269; Progesterone membrane lipoprotein lipid attachment site is about 6-17. Clone DNA35600-1162 was deposited on Oct. 16, 1997 and deposited with ATCC 209370.

Amino acid sequence analysis of the full-length PRO238 polypeptide suggests that the PRO238 may be a novel reductase, since some of the PRO238s exhibit substantial homology with the reductase, particularly the oxydorodicta.

Example 6: Isolation of cDNA clones encoding human PRO364

(Incyte EST No.), Which shows homology with members of tumor necrosis factor (TNFR) family polypeptides by searching the expression sequence tag (EST) DNA database (LIFESEQ®, Incyte Pharmaceuticals, Palo Alto, CA) 3003460).

Using Incidence EST 3003460 and other EST sequences using a repetition cycle of BLAST (Altshul et al., Methods in Enzymology 266: 460-480 (1996)) and "phrap" (Phil Green, University of Washington, Seattle, Washington) Lt; RTI ID = 0.0 &gt; DNA < / RTI > This consensus sequence was referred to herein as " <consen01> &quot; and was also referred to as DNA44825. 1) identify a cDNA library containing the desired sequence by PCR, and 2) use an oligonucleotide probe based on DNA44825 and the " <consen01> &quot; consensus sequence for use as a probe to isolate clones of the full length coding sequence for PRO364 Were synthesized. The lengths of forward and reverse PCR primers are typically 20-30 nucleotides and are often designed to yield PCR products of about 100-1000 bp in length. The length of the probe sequence is typically 40-55 bp. To screen full length clones by screening several libraries, the DNA of the library was screened by PCR amplification using PCR primer pairs as described in Ausubel et al., Current Protocols in Molecular Biology. The positive libraries were then used to isolate clones encoding the desired gene using one of the following probe oligonucleotides and the following pair of primers.

The following pairs of PCR primers (forward and backward) were synthesized:

Forward PCR primer (44825.fl):

5'-CACAGCACGGGGCGATGGG-3 '(SEQ ID NO: 39)

Forward PCR primer (44825.f2):

5'-GCTCTGCGTTCTGCTCTG-3 '(SEQ ID NO: 40)

Forward PCR primer (44825.GITR.f):

5'-GGCACAGCACGGGGCGATGGGCGCGTTT-3 '(SEQ ID NO: 41)

Reverse PCR primer (44825.rl):

5'-CTGGTCACTGCCACCTTCCTGCAC-3 '(SEQ ID NO: 42)

Reverse PCR primer (44825.r2):

5'-CGCTGACCCAGGCTGAG-3 '(SEQ ID NO: 43)

Reverse PCR primer (44825.GITR.r):

5'-GAAGGTCCCCGAGGCACAGTCGATACA-3 '(SEQ ID NO: 44)

In addition, synthetic oligonucleotide hybridization probes, in which the nucleotide sequence is as follows, are prepared from the DNA44825 consensus sequence:

Hybridization probe (44825.p1):

5'-GAGGAGTGCTGTTCCGAGTGGGACTGCATGTGTGTCCAGC-3 '(SEQ ID NO: 45)

Hybridization probe (44825.GITR.p):

5'-AGCCTGGGTCAGCGCCCCACCGGGGGTCCCGGGTGCGGCC-3 '(SEQ ID NO: 46)

The library DNA was screened by PCR amplification using PCR primer pairs as described above to screen various libraries and obtain full length clone circles. The positive libraries were used to isolate clones encoding the PRO364 gene using one of the following probe oligonucleotides and the following PCR primers.

The RNA for constructing the cDNA library was isolated from human bone marrow tissue. The cDNA library used to isolate cDNA clones was prepared by standard methods using reagents commercially available from companies such as Invitrogen (San Diego, Calif.). CDNA was primed with oligo dT containing the Not I site, blunt ended to a SalI hemi kinase adapter, cut into Not I, roughly sorted by size by gel electrophoresis, and then cloned into a suitable cloning vector For example, pRKB or pRKD; pRKB5 is a precursor of pRK5D without the SfiI site; see Homles et al., Science, 253: 1278-1280 (1991)).

cDNA clones were identified and the entire sequence was sequenced. The entire nucleotide sequence of DNA47365-1206 is shown in Figure 5 (SEQ ID NO: 5). Clone DNA47365-1206 contains a single open reading frame with a constant translational initiation site at nucleotide positions 121 to 123 and a stop codon at nucleotide positions 844 to 846 (Figure 5, SEQ ID NO: 5). The expected length of the polypeptide precursor is 241 amino acids, the expected molecular weight is about 26,000 daltons, and the estimated pi is about 6.34. The full length PRO364 protein is shown in Figure 6 (SEQ ID NO: 6).

The analysis of the full-length PRO364 sequence shown in Figure 6 (SEQ ID NO: 6) demonstrates the presence of the major polypeptide domain, as shown in Figure 6, where the position of the important polypeptide domain is roughly indicated above. Analysis of the full-length PRO364 sequence (Figure 6; SEQ ID NO: 6) shows that the amino acid position of the signal peptide is from about 1 to about 25; The amino acid position of the domain likely to be transmembrane domain is from about 162 to about 180; The amino acid position of the N-glycosylation site is from about 146 to about 150; Wherein the amino acid position of the N-myristoylation region is from about 5 to about 11, from about 8 to about 14, from about 25 to about 31, from about 30 to about 36, from about 33 to about 39, from about 118 to about 124, 128, and about 156 to about 162; The amino acid position of the prokaryotic membrane lipoprotein lipid attachment site is from about 166 to about 177; The amino acid position of the leucine zipper pattern is from about 171 to about 193. Clone DNA47365-1206 was deposited with the ATCC on November 7, 1997 and deposited with ATCC 209436. It should be appreciated that the deposited clone has a substantially more accurate sequence than the sequence provided herein.

Amino acid sequencing of the full-length PRO364 polypeptide suggests that a portion of the polypeptide is substantially homologous to members of the tumor necrosis factor receptor family, so that PRO364 may be a new member of the tumor necrosis factor receptor family. The intracellular domain of PRO364 contains a motif similar to the minimal domain in the CD30 receptor, which appears to be required for TRAF2 binding and is present in TNFR2 (within amino acid 207-214 region). There are three distinct extracellular cysteine-rich domains (CDRs) characteristic of the TNFR family (Naismith and Sprang, Trends Biochem. Sci., 23: 74-79 (1998)), 3 &lt; / RTI &gt; rather than 4 or 6, which is the typical number of cysteines of the TNFR family CDRs. When PRO364 is compared to GITR (described below) in mice, the GITR of the mouse contains 5 cystines in CRD1 whereas the PRO364 amino acid sequence contains 8 cysteines in CRD1 and the GITR of the mouse contains N-linked While there are four domains that are likely to be glycosylation sites, there is one domain in the ECD that is likely to be an N-linked glycosylation site.

A detailed investigation of the potential amino acid sequence of the full-length PRO364 polypeptide and the nucleotide sequence encoding this amino acid sequence is described in Nocenti et al., Proc. Natl. Acad. Sci. USA. 94: 6216-6221 (1997) It is demonstrated that homologous with the reported mouse GITR protein. Thus, PRO364 may be the corresponding protein of the murine GITR protein reported in the literature.

Example 7: Isolation of cDNA clones encoding human PRO844

(EST) DNA database (LIFESEQ (R), Incyte Pharmaceuticals, Palo Alto, Calif.) To find ESTs showing sequence identity with LP. Based on the information and findings provided herein, Insight clone 2657496, a clone for this EST, was further examined in a lung cancer cell library (309-LUNGTUT09).

cDNA clones were identified and the entire sequence was sequenced. The entire nucleotide sequence of DNA59838-1462 is shown in Figure 7 (SEQ ID NO: 7). Clone DNA59838-1462 contains a single open reading frame with a constant translational initiation site at nucleotide positions 5-7 and a stop codon at nucleotide positions 338-340 (FIG. 7; SEQ ID NO: 7). The expected length of the polypeptide precursor is 111 amino acids, the expected molecular weight is about 12,050 daltons, and the estimated pi is about 5.45. The full length PRO844 protein is shown in Figure 8 (SEQ ID NO: 8).

Analysis of the full-length PRO844 sequence shown in Figure 8 (SEQ ID NO: 8) demonstrates the presence of the major polypeptide domain as shown in Figure 8, with the position of the major polypeptide domain being roughly indicated above. Analysis of the full-length PRO844 sequence (FIG. 8; SEQ ID NO: 8) shows that the amino acid position of the signal peptide is from about 1 to about 19; The N-myristoylation site has an amino acid position of about 23 to about 29, about 27 to about 33, about 32 to about 38, and about 102 to about 108; Demonstrates that the amino acid position of the WAP-type ' 4-disulfide core ' domain signal region is from about 49 to about 63.

Clone DNA59838-1462 was deposited with the ATCC on June 16, 1998 and was assigned the accession number ATCC 209976. It should be appreciated that the deposited clone actually contains a more accurate sequence than is provided herein.

The amino acid sequence analysis of the full-length PRO844 polypeptide suggests that PRO844 may be a novel protease inhibitor since the polypeptide exhibits significant identity with serine protease inhibitors. More specifically, the results of the analysis of the De Hoop database (version 35.45 Swiss Prob 35) demonstrate that there is substantial homology between the PRO844 amino acid sequence and at least the following De Hoop sequences: ALK1_HUMAN, P_P82403, P_P82402, ELAF_HUMAN and P_P60950.

Example 8: Isolation of cDNA clones encoding human PRO846

Consensus DNA sequences were assembled for different EST sequences using phrap as described in Example 1 above. This consensus sequence is referred to herein as DNA39949 and &quot; <consen1322> ". 1) identify a cDNA library containing the desired sequence by PCR, and 2) use the oligonucleotides based on the DNA39949 consensus sequence and the &quot; <consen1322> " sequence to use as probes to isolate clones of the full length coding sequence for PRO846 Were synthesized. PCR primers (forward and reverse) were synthesized based on the consensus sequence of DNA39949 and &quot; <consen1322> &quot;. In addition, synthetic oligonucleotide hybridization probes were generated from the consensus DNA 30908 sequence.

To screen full length clones by screening several libraries, the DNA of the library was screened by PCR amplification using PCR primer pairs as described in Ausubel et al., Current Protocols in Molecular Biology. The positive libraries were then used to isolate clones encoding the PRO846 gene using one of the following probe oligonucleotides and the following pairs of primers.

The oligonucleotide sequences used in the above method are as follows:

Forward PCR primer (39949.fl):

5'-CCCTGCAGTGCACCTACAGGGAAG-3 '(SEQ ID NO: 47)

Reverse PCR primer (39949.r1):

5'-CTGTCTTCCCCTGCTTGGCTGTGG-3 '(SEQ ID NO: 48).

In addition, synthetic oligonucleotide hybridization probes, in which the nucleotide sequence is as follows, are prepared from the consensus DNA39949 sequence:

Hybridization probe (39949.p1):

5'-GGTGCAGGAAGGGTGGGATCCTCTTCTCTCGCTGCTCTGGCCACATC-3 '(SEQ ID NO: 49).

The RNA for making the cDNA library was isolated from human fetal kidney tissue (LIB227). The cDNA library used to isolate cDNA clones was prepared by standard methods using reagents commercially available from companies such as Invitrogen (San Diego, Calif.). CDNA was primed with oligo dT containing the Not I site, blunt ended to a SalI hemi kinase adapter, cut into Not I, roughly sorted by size by gel electrophoresis, and then cloned into a suitable cloning vector For example, pRKB or pRKD; pRKB5 is a precursor of pRK5D without the SfiI site; see Homles et al., Science, 253: 1278-1280 (1991)).

The DNA sequence of the isolated clone as described above yielded a full-length DNA sequence for PRO846 (referred to herein as DNA44196-1353) (FIG. 9, SEQ ID NO: 9) and a derived protein sequence for PRO846.

The entire nucleotide sequence of DNA44196-1353 is shown in Figure 9 (SEQ ID NO: 9). Clone DNA44196-1353 contains a single open reading frame with a constant translational initiation site at nucleotide positions 25-27 and a stop codon at nucleotide positions 1021-1023 (Figure 9). The expected length of the polypeptide precursor is 332 amino acids, the expected molecular weight is about 36,143 daltons, and the estimated pI is about 5.89 (Figure 10, SEQ ID NO: 10).

Analysis of the full-length PRO846 sequence shown in Figure 10 (SEQ ID NO: 10) demonstrates the presence of a variety of important polypeptide domains, as shown in Figure 10, wherein the positions of the important polypeptide domains are roughly indicated above. Analysis of the full-length PRO846 sequence (Figure 10; SEQ ID NO: 10) shows that the amino acid position of the signal peptide is from about 1 to about 17; The amino acid position of the transmembrane domain is from about 248 to about 269; The amino acid position of the N-glycosylation site is from about 96 to about 100; The amino acid positions of the fibrinogen beta-chain and the gamma chain C-terminal domain are from about 104 to about 114; Lt; RTI ID = 0.0 &gt; Ig-like &lt; / RTI &gt; V-type domain is from about 13 to about 128. Clone DNA44196-1353 was deposited with the ATCC on May 6, 1998 and deposited with ATCC 209847.

Example 9: Isolation of cDNA clones encoding human PRO1760

The EST cluster sequence was found from the Insight database using the signal sequence algorithm described in Example 3 above. The EST cluster sequence was then compared to a published EST database (e.g., Genebank) and a non-published EST DNA database (LIFESEQ (R), Incyte Pharmaceuticals, Palo Alto , CA) and a variety of fermentation sequence tags (EST) databases. One or more ESTs were obtained from the prostate tumor library. Homologous searches were performed using the computer program BLAST or BLAST2 (Altshul et al., Methods in Enzymology, 266: 460-480 (1996)). ESTs with a BLAST score of 70 (or, in some cases, 90 or more) that do not code known proteins were collected and assembled into consensus DNA sequences using the program "phrap" (Phil Green, University of Washington, Seattle, Washington). The consensus sequence obtained from this is referred to herein as DNA58798.

Because it was confirmed that there was a sequence homologous between the DNA58798 consensus sequence and the insight EST 3358745, a clone containing this EST was purchased and a cDNA insert was obtained and sequenced. The insert has been found herein to encode a full-length protein. The sequence of this cDNA insert is shown in Figure 11 (SEQ ID NO: 11) and is referred to herein as DNA76532-1702.

Clone DNA76532-1702 contains a single open reading frame with a constant translational initiation site at nucleotide positions 60-62 and a stop codon at nucleotide positions 624-626 (Figure 11). The length of the predicted polypeptide precursor is 188 amino acids (Figure 12, SEQ ID NO: 12). The predicted molecular weight of the full-length PRO1760 protein shown in Figure 12 is approximately 21,042 daltons and the estimated pi is approximately 5.36.

Analysis of the full-length PRO1760 sequence shown in Figure 12 (SEQ ID NO: 12) demonstrates the presence of a variety of important polypeptide domains as shown in Figure 12, with the positions of the important polypeptide domains being roughly indicated above. Analysis of the full-length PRO1760 sequence shows that the amino acid position of the signal peptide is from about 1 to about 20; The N-glycosylation site has an amino acid position of about 121 to about 125, and about 171 to 175; The amino acid position of the tyrosine kinase phosphorylation site is from about 25 to about 32; The amino acid position of the N-myristoylation site is from about 54 to about 60, and from about 160 to 166. Clone DNA76532-1702 was deposited with the ATCC on Nov. 17, 1998, and was assigned the accession number ATCC 203473.

Analysis of the De Hoop database (version 35.45 Switzerland plot 35) using the WU-BLAST2 sequence alignment analysis of the full-length sequence shown in Figure 12 (SEQ ID NO: 12) revealed that the PRO1760 amino acid sequence is homologous : CELT07F12-2, T22J18-16, ATF1C12_3, APE3_YEAST, P_W22471, SAU56908_1, SCPA_STRPY, ATACOO423817, SAPURCLUS_2 and AF041468_9.

Example 10: Stimulation of neonatal hypercardia (test 1)

This assay is designed to measure the ability of PRO polypeptides to stimulate hyperbilirubinemia in neonates. Myocardial cells were obtained from 1-day-old Harlan Sprague Dawleyyrat. On day 1, cells (density of 7.5 x 10 ⁴ / ml, 180 μl, serum <0.1%, freshly isolated) were added to 96-well plates previously coated with DMEM / F12 + 4% FCS. On day 1, a test sample containing the test PRO polypeptide or a test sample (negative control) containing the propagation medium (20 [mu] l / well) was added directly to the wells. Next, PGF (20 [mu] l / well) was added to the final concentration of 10 &lt; ^-6 &gt; M on the second day. The cells were then stained on day 4 and visually observed on day 5, where cells not increased in size (compared to negative control) were recorded as 0.0 and compared to negative control ) Cells with small or medium increase in size were recorded at 1.0, and cells with a large increase in size (compared to negative control) were recorded at 2.0. The positive result in this assay is 1.0 or more.

PRO882 was positive in this assay as shown in Table 4 below.

<Table 4>

PRO number Concentration / dilution Relative increase in size (when compared to negative control) PRO882 0.01% 3 PRO882 0.01% 3 PRO882 0.10% 4 PRO882 0.10% 4 PRO882 1.00% 6 PRO882 1.00% 6 PRO882 0.01% 3 PRO882 0.10% 4.5 PRO882 1.00% 6 PRO882 1.00% 5.5 PRO882 2.6 nM 5.75

Example 11: Inhibition of Endothelial Cell Proliferation Stimulated by Vascular Endothelial Growth Factor (VEGF) (Test 9)

The ability of various PRO polypeptides to inhibit VEGF-stimulated endothelial cell proliferation was tested. Polypeptides identified as positive in this assay are useful for inhibiting endothelial cell proliferation in mammals when the inhibitory effect of endothelial cell proliferation is beneficial, i.e., inhibiting tumor proliferation.

Specifically, bovine adrenocortical capillary endothelial cells (ACE) (cells passed max 12-14 times from the primary culture) were plated in 96-well plates at 500 cells / well per 100 쨉 l. The assay medium contains low glucose concentrations of DMEM, 10% bovine serum, 2 mM glutamine and 1 × penicillin / streptomycin / funnzone. (2) ACE cells alone, (3) ACE cells + 5 ng / ml FGF, (4) ACE cells + 3 ng / ml VEGF, ACE cells + 3 ng / ml VEGF + 1 ng / ml TGF-beta, and (6) ACE cells + 3 ng / ml VEGF + 5 ng / ml LIF. A PRO polypeptide test sample labeled with poly-His (100 ul volume) was added to the wells (diluted to 1%, 0.1% and 0.01%, respectively). The cell culture was incubated at 37 ° C and 5% CO ₂ for 6 to 7 days. After incubation, the medium was removed from the wells and the cells were washed with 1X PBS. Then, an acid phosphatase reaction mixture (100 μl: 0.1 M sodium acetate, pH 5.5, 0.1% Triton X-100, 10 mM p-nitrophenyl phosphate) was added to each well. After incubation at 37 ° C for 2 hours, 10 μl of 1N NaOH was added to stop the reaction. Optical density (OD) was measured in a 405 nm microplate reader.

The activity of the PRO polypeptide was calculated as the inhibition rate of proliferation (calculated by measuring acid phosphatase activity at OD 405 nm) stimulated by VEGF (3 ng / ml) against unstimulated cells. Since TGF-beta inhibits VEGF-stimulated ACE cell proliferation by 70-90%, TGF-beta was used as the activity criterion measured at 1 ng / ml. The results as shown in Table 5 below imply that PRO polypeptides are useful at the time of cancer treatment and, in particular, in inhibiting tumor angiogenesis. The numerical values (relative inhibition rate) shown in Table 5 are used to calculate the inhibition rate of VEGF-stimulated proliferation for unstimulated cells and to estimate the inhibition rate by 70-90% inhibition of VEGF-stimulated ACE cell proliferation And the inhibition rate obtained with TGF-beta (1 ng / ml). If the PRO polypeptide inhibits VEGF-stimulated endothelial cell proliferation by more than 30% (relative inhibition rate of 30% or more), it is considered a positive result.

<Table 5>

Inhibition of endothelial cell proliferation stimulated by VEGF PRO Name PRO concentration Relative inhibition (%) PRO333PRO333PRO333 0.01% 0.10% 1.00% 97.090.063.0 PRO877PRO877PRO877PRO877PRO877PRO877 0.01% 0.01% 0.10% 0.10% 1.00% 1.00% 101.0108.086.099.046.046.0 PRO879PRO879PRO879 0.01% 0.01% 0.10% 100.0105.097.0 PRO879PRO879PRO879 0.10% 1.00% 1.00% 101.055.066.0 PRO882PRO882PRO882 0.01% 0.10% 1.00% 96.086.070.0 PRO885PRO885PRO885 0.01% 0.10% 1.00% 100.093.064.0

Example 12: c-fos induction in endothelial cells (test 34)

This assay is designed to determine whether PRO polypeptides are capable of inducing c-fos in endothelial cells. PRO polypeptides that are positively identified in this assay are expected to be useful in the treatment of angiogenesis-favoring symptoms or diseases, including wound healing, and the like, as are agonists of these PRO polypeptides. Antagonists of PRO polypeptides positively identified in this assay are expected to be useful in the treatment of malignant tumors.

The cells were cultured in human medium in growth medium (containing 50% Ham's F12 without GHT: low glucose and 50% DMEM: NaHCO ₃ , 1% glutamine, 10 mM HEPES, 10% PBS, 10 ng / ml bFGF without glycine) umbilical vein endothelial cells were plated (HUVEC, cell Systems) to 1 × 10 ⁴ cell density to play a 96-well microtiter plates in. On the next day after plating, the cells were cultured in the presence of 100 μl of test sample and control (positive control: proliferation medium; negative control: 10 mM HEPES, 140 mM NaCl, 4% v) mannitol, pH 6.8). The cells were incubated at 37 ° C and 5% CO _{2 for} 30 minutes. The sample was removed and the method described in Part 1 of the protocol of the bDNA kit (Chiron Diagnostics, Cat. No. 6005-037) available for the reagents / buffers described below was performed.

Briefly, the amounts of TM lysis buffer and probe required for the test were calculated based on the information provided by the manufacturer. Appropriate amount of thawed probe was added to TM lysis buffer. Capture Hybridization Buffer was warmed to room temperature. bDNA strips were placed in metal strip holders and 100 μl of Capture Hybridization Buffer was added to each of the required b-DNA wells and incubated for at least 30 minutes. After the test plate containing the cells was removed from the incubator, the medium was slowly removed using a vacuum manifold. 100 [mu] l of the solution-containing hybridization buffer containing the probe was rapidly added to each well of the microtiter plate with a pipette. The plate was then incubated at 55 DEG C for 15 minutes. The plate was removed from the incubator and placed on a vortex mixer equipped with a microtitre adapter head and vortexed for 1 minute with set to # 2. 80 [mu] l of the lysate was aliquoted and added to the bDNA well containing Capture Hybridization Buffer, then top and bottom were mixed well using a pipette. The plate was incubated at 53 DEG C for at least 16 hours.

The next day, the method described in Part 2 of the bDNA kit protocol was performed. Specifically, the plate was taken out of the incubator, placed on a bench and allowed to cool for 10 minutes. The volume of required additives was calculated based on the information provided by the manufacturer. The amplified concentrate was diluted 1: 100 with an AL hybridization buffer to prepare an amplifying working solution. The hybridization mixture was removed from the plate and washed twice with Wash A. 50 [mu] l of amplified working solution was added to each well, and each well was incubated at 53 [deg.] C for 30 minutes. The plate was then removed from the incubator and allowed to cool for 10 minutes. Labeled concentrate (40 pmole / liter) was diluted 1: 100 with AL hybridization buffer to prepare Label Probe Working Solution. After cooling for 10 minutes, the amplified hybridization mixture was removed and the plate was washed twice with Wash A. 50 [mu] l of a labeled probe running solution was added to each well, and each well was incubated at 53 DEG C for 15 minutes. After cooling for 10 minutes, the substrate was allowed to warm to room temperature. 3 μl of Substrate Enhancer is added to 1 ml of each substrate required for assay and the plate is allowed to cool for 10 minutes before the label hybridization mixture is removed and the plate is washed twice with Wash A and with Wash D Washed three times. 50 [mu] l of substrate solution containing the enhancer was added to each well. The plates were incubated for 30 min at 37 [deg.] C and RLU was read on a suitable Luminometer.

The measurement was averaged twice and the deviation constant was determined. The activity measured as an increase over the value of the negative control (HEPES buffer as described above) is expressed in chemiluminescent units (RLU). The results are shown in Table 6 below and considered positive if the PRO polypeptide shows a value more than 2 times that of the negative control. Negative control = 1.00% dilution 1.00 RLU, positive control = 1.00% dilution 8.39 RLU.

<Table 6>

C-fos induction of endothelial cells PRO Name PRO concentration RLU value PRO321PRO321PRO321PRO321PRO321PRO321 0.011 nM0.11 nM1.1 nM0.011 nM0.11 nM1.10 nM 1.511.072.112.132.272.65 PRO840PRO840PRO840PRO840PRO840PRO840 2.44 nM24.4 nM244 nM2.44 nM24.4 nM244 nM 1.852.213.042.822.901.01 PRO878PRO878PRO878PRO878PRO878PRO878 0.0.1% 0.10% 1.00% 0.01% 0.10% 1.00% 2.432.711.392.482.451.89 PRO879PRO879PRO879PRO879PRO879PRO879 0.01% 0.10% 1.00% 0.01% 0.10% 1.00% 1.231.332.542.061.652.25

Example 13: Aggravation of F2a-induced neonatal hyperhidrosis

This assay is designed to measure the ability of PRO polypeptides to stimulate hyperbilirubinemia in neonates. The PRO polypeptides identified positively in this assay are expected to be useful in the treatment of various heart failure diseases.

Myocardial cells were obtained from 1 day old Harlan Sprague Dawley rats. On day 1, cells (density of 7.5 x 10 ⁴ / ml, 180 μl, serum <0.1%, freshly isolated) were added to 96-well plates previously coated with DMEM / F12 + 4% FCS. On day 1, a test sample (20 [mu] l / well) containing the test PRO polypeptide was added directly to the well. Next, PGF (20 [mu] l / well) was added to the final concentration of 10 &lt; ^-6 &gt; M on the second day. Then, the cells were stained on the fourth day and observed visually on the fifth day. The visible score is based on cell size, where cells that did not increase in size compared to negative control were recorded at 0.0 and cells with small or medium increase in size compared to negative control were recorded at 1.0 , And 2.0 cells with a larger size increase compared to the negative control. A score of 1.0 or higher was considered positive.

Since calcium concentration is crucial to the assay reaction, PBS was not included. Plates were coated with DMEM / F12 + 4% FCS (200 [mu] l / well). In the assay medium, DMEM / F12 (containing 2.44 mg of bicarbonate), 10 μg / ml of transferrin, 1 μg / ml of insulin, 1 μg / ml of aprotinin, 2 mmol / Penicillin G, and 100 μg / ml streptomycin. Protein buffer containing mannitol (4%) showed a positive signal (score 3.5) at 1/10 (0.4%) and 1/100 (0.04%) but not at 1/1000 (0.004%). Therefore, test sample buffer containing mannitol was not tested. PRO205, PRO882 and PRO887 polypeptides were positive in this assay.

Example 14: Suppression of Adult Cardiomyopathy (Test 42)

This test was designed to measure the inhibition of adult hypertrophy. PRO polypeptides identified positively in this assay may be useful in the treatment of heart disease associated with cardiac hypertrophy.

Ventricular myocytes were freshly isolated from matured Sprague Dawley rats (250 g) and 180 [mu] l of these cells were plated (2000 / well). On the second day, a test sample (20 μl) containing the test PRO polypeptide was added. On day 5, the cells were fixed and stained. The increase in ANP message of the cells may be measured by PCR several hours later. The results are based on a visual score of cell size: 0 = no inhibition, -1 = slightly inhibited, -2 = strongly inhibited. A score of 0 or less is considered an aspect. The activity criterion corresponds to the activity of the positive control, 0.1 mM phenylephrine (PE). The black medium was supplemented with M199 (modified - no glutamine), NaHCO ₃ , phenol red, supplemented with 100 nM insulin, 0.2% BSA, 5 mM creatine, 2 mM L- carnitine, 5 mM taurine, 100 U / ml Penicillin G, and 100 μg / ml streptomycin (CCT medium). Only 60 internal wells were used in a 96 well plate. Six of these wells were used as negative and positive (PE) controls.

The PRO878 polypeptide showed a score of less than zero in this assay.

Example 15: Induction of endothelial cell apoptosis (Assay 73)

The PRO polypeptide, which induces apoptosis of endothelial cells, was tested in human umbilical vein endothelial cells (HUVEC, Cell Systems). Positive in this assay indicates the usefulness of the polypeptide in treating tumors as well as vascular disease in which induction of apoptosis of endothelial cells is advantageous.

The ability of PRO polypeptides to induce apoptosis of endothelial cells using a 96-well format with 0% serum medium supplemented with 100 ng / ml VEGF was tested in human umbilical vein endothelial cells (HUVEC, Cell Systems) Since the cells are easily detached from the plating surface, all pipetting done in the wells is as weak as possible).

The medium was aspirated off and the cells were washed once with PBS. 5 ml of 1 x trypsin is added to the cells in a T-175 flask and the cells are allowed to stand until the cells are detached from the plate (about 5-10 minutes). 5 ml of growth medium was added to stop trypsin action. The cells were centrifuged at 4 ° C for 5 minutes at 1000 rpm. The medium was removed and the cells resuspended in 10 ml of medium containing 10% serum (containing Cell System, 1 x penicillin / streptomycin).

Cells were cultured in 96-well microtiter plates (Amersham Life Science, cytostar-T scintillating microplate) supplemented with 10% serum (CSG-medium, Cell System) to a total volume of 100 μl (density 2 x 10 ⁴ cells / , RPNG160, sterilized, tissue culture treated, individually packaged). Each of the test polypeptide samples was diluted 3 times with 1%, 0.33% and 0.11% per sample. Cell-free wells were used as blanks and wells containing only cells were used as negative control. 50 [mu] l of 3 x staurosporine stock solution was serially diluted 1: 3 and used as a positive control. The ability of the tested PRO polypeptides to induce apoptosis was determined using Annexin-V, a member of the calcium and phospholipid binding proteins that detect apoptosis.

0.2 ml of the stock solution of annexin V-biotin (100 g / ml) was diluted with 4.6 ml of 2 x Ca ²⁺ binding buffer and 2.5% BSA (diluted 1: 25). 50 [mu] l of the diluted Annexin V-biotin solution was added to each well to a final concentration of 1.0 [mu] g / ml (control was excluded). The sample was incubated with annexin-biotin for 10-15 minutes before adding ³⁵ S-streptavidin directly. ³⁵ S-streptavidin was diluted with 2 x Ca ²⁺ binding buffer and 2.5% BSA and added to all wells to a final concentration of 3 x 10 ⁴ cpm / well. The plate was then sealed, centrifuged at 1000 rpm for 15 minutes, and placed on an orbital shaker for 2 hours. 1450 &lt; / RTI &gt; microbeta Trilux (Wallac). The results are shown in Table 7, wherein the background ratio represents the counts per minute (%) of the negative control. Those who were more than 30% higher than the background rate were regarded as positive.

PRO333, PRO364 and PRO879 showed positive results in the assays described above.

<Table 7>

Induction of endothelial cell apoptosis PRO Name PRO concentration Background rate PRO333 0.11% 61.7% PRO333 0.33% 37.6% PRO364 2.99 nM 19.3% PRO364 8.99 nM 6.9% PRO364 27.23 nM 31.5% PRO879 1.00% 64.2% PRO879 0.11% 65.5% PRO879 0.33% 14.7%

Example 16: Inhibition of LIF + endothelin-1 (ET-1) induced neonatal hypercardia (test 74)

This assay is intended to determine whether the PRO polypeptides of the invention exhibit the ability to inhibit LIF and endothelin-1 (ET-1) induced neonatal hyperhidrosis. Test compounds that are positive in this assay will be useful in the treatment of heart failure diseases and disorders characterized by undesired myocardial hypertrophy or associated with such myocardial hypertrophy.

One day old Harlan Sprague Dawley myocardial cells (180 쨉 l of 7.5 x 10 ⁴ / ml, serum <0.1, freshly isolated) were plated on a 96-well plate pre-coated with DMEM / F12 + 4% Lt; / RTI &gt; Then, on the second day of the test, a 20 [mu] l volume of the test PRO polypeptide sample or the proliferating strain (negative control) was added directly to the well. Then, on the third day, LIF + ET-1 was added to the wells. Cells were cultured for 2 days and stained, and then scored on the next day visually. In this test, the muscle cells treated with PRO polypeptide were recorded as positive on average when they were smaller or fewer in number than those of untreated muscle cells. PRO238 and PRO1760 polypeptides showed a positive reaction in this assay.

Example 17: Endothelial tube formation - stimulation of Sprout formation (black 86)

This assay is intended to determine whether PRO polypeptides show the ability to promote vacuole and lumen formation of endothelial cells in the absence of exogenous proliferation factors. PRO polypeptides that are positive in this assay may be useful for the treatment of endothelial cell vacuolization and / or lumen formation, for example, where favorable stimulation of pinocytosis, ion pumping, tube permeability and / or junction formation Are expected to be useful in the treatment of beneficial diseases.

HUVEC cells mixed with (Passage <from primary culture 8 subculture) to ml per 6 x 10 ⁵ cells to a density of type I rat tail collagen and vacuoles while the (final concentration 2.6 mg / ml), cells in the presence of PRO polypeptide formed , 50 [mu] l per well of M199 culture medium containing 1 [mu] M of 6-FAM-FITC dye and 1% FBS was plated. The cells were then incubated at 37 ° C, 5% CO ₂ for 48 hours, fixed with 3.7% formalin for 10 minutes at room temperature, washed five times with M199 medium and then incubated overnight at 4 ° C with Rh- Stained with Paloidin, and then stained with 4 μM DAPI. In this assay, the positive result is less than 2 [1 = all cells are round, 2 = longer cells, 3 = cells form some connected tubes, 4 = cells form a complex coronary network].

The PRO179 polypeptide was positive in this assay.

Example 18 Induction of Endothelial Cell Apoptosis (ELISA) (Assay 109)

Using the 96-well format, the PRO polypeptide in human umbilical vein endothelial cells (HUVEC, Cell Systems) in 0% serum medium supplemented with 100 ng / ml VEGF, 0.1% BSA, IX penicillin / streptomycin, The ability to induce apoptosis was tested. Positive results in this assay indicate that the polypeptide is useful for treating various various symptoms associated with undesired endothelial cell proliferation, including, for example, inhibition of tumor proliferation. The 96-well plates used were made in Falcon (No. 3072, Falcon). Coating of 96-well plates was made by allowing gelatinization to occur for more than 30 minutes with 100 [mu] l of 0.2% gelatin in PBS solution. After the gelatin mixture was inhaled and removed, HUVE cells (100 μl per well) were plated in a 10% serum containing medium to a final concentration of 2 × 10 ⁴ cells / ml. After incubating the cells for 24 hours, a test sample containing the desired PRO polypeptide was added.

100 μl of 0% serum cells (Cell Systems) supplemented with 100 ng / ml VEGF, 0.1% BSA, 1 × penicillin / streptomycin was added to all wells. A test sample containing the PRO polypeptide was added to three dilutions (1%, 0.33% and 0.11%). Cell-free wells were used as blanks and cell-only wells were used as negative control. As a positive control, 50 쨉 l of a 1: 3 serial dilution of staurosporine 3 X stock solution was used. Cells were incubated for 24-35 hours before ELISA.

The solution was prepared according to the Boehringer manual [Boehringer, Cell Death Detection ELISA Plus, Cat. No. 1 920 685] and ELISA was used to measure the degree of apoptosis. Preparation of sample: A 96-well plate was centrifuged at 1000 rpm (200 g) for 10 minutes, and the supernatant was quickly removed by inverting it. The supernatant was then inverted on the paper towel, and the remaining supernatant was discarded. 200 [mu] l of 1X lysis buffer was added to each well and incubated for 30 minutes at room temperature without shaking. Plates were centrifuged at 1000 rpm for 10 min and 20 μl of lysate (cytoplasmic fraction) was transferred to MTP coated with streptavidin. 80 [mu] l of immunizing reagent mixture was added to 20 [mu] l lysis solution in each well. The MTP was covered with an adhesive foil, then placed on an orbital shaker (200 rpm) and incubated at room temperature for 2 hours. After 2 hours, the supernatant was removed by inhalation and the wells were washed three times (250 μl of 1X incubation buffer per well) (the buffer was removed by inhalation). Substrate solution (100 [mu] L) was added to the wells and incubated at room temperature orbital shaker at 250 rpm until color development was sufficient for spectroscopic analysis (approximately 10-20 minutes). Using a 96-well reader, 492 nm was read at 405 nm with a reference wavelength. The value obtained for PIN32 (control buffer) was set at 100%. Samples greater than 130% were considered positive for apoptosis induction. In this assay, PRO846 and PRO844 polypeptides were positive.

Example 19: In situ hybridization ( In situ Hybridization)

Place hybridization is a powerful and versatile technique for detecting and locating nucleic acid sequences in cell and tissue specimens. For example, it may be useful in identifying gene expression sites, analyzing tissue distribution of transcripts, identifying viral infections and identifying infection sites, changing in specific mRNA synthesis, and assisting in chromosomal mapping.

In situ hybridization was performed according to an optimized version of the protocol of Lu and Gillett, Cell Vision 1: 169-176 (1994) using a ³³ P-labeled riboprobe obtained by PCR. In brief, human tissues immobilized with formalin and buried in paraffin were cut and the paraffin was removed. Proteins were then removed with protease K (20 g / ml) for 15 minutes at 37 ° C, Lu and Gillett). The antisense riboprobe labeled with [ ³³ P] -UTP was obtained from the PCR product and hybridized overnight at 55 ° C. The slide was soaked in a Kodak NTB2 (TM) nuclear track emulsion and exposed for 4 weeks.

< ³³ P-riboprobe synthesis>

(125 mCi) of ³³ P-UTP (Amersham BF 1002, SA < 2000 Ci / mmol) was dried under high speed vacuum. The following ingredients were added to each tube containing dried ³³ P-UTP:

2.0 [mu] l 5x transcription buffer

1.0 μl DTT (100 mM)

2.0㎕ NTP mix (2.5mM: 10mM of GTP, CTP and ATP 10㎕ 10㎕ + H ₂ O, respectively)

1.0 μl UTP (50 μM)

1.0 RNA RNAsin

1.0 l DNA template (lg)

1.0 μl H ₂ O

1.0 [mu] l RNA polymerase (usually T3 = AS, T7 = S for PCR products)

The tubes were incubated at 37 [deg.] C for 1 hour. A total of 1.0 占 퐇 of RQ1 DNase was added, followed by incubation at 37 占 폚 for 15 minutes. A total of 90 μl of TE (10 mM Tris (pH 7.6) and 1 mM EDTA (pH 8.0)) was added and the mixture was pipetted onto DE81 paper. The remaining solution was loaded into a Microcon-50 (trade name) ultrafiltration unit and spun for 6 minutes using program 10. The filtration unit was placed upside down on the second tube and spun for 3 minutes using Program 2. A total of 100 μl of TE was added before final recovery and then 1 μl of the final product was pipetted onto DE81 paper And counted in 6 ml of Bioflour II.

The probe was electrophoresed on TBE / urea gel. 1 to 3 [mu] l of probe or 5 [mu] l of RNA MrkII was added to 3 [mu] l of loading buffer. After heating in a 95 ° C heat block for 3 minutes, the gel was immediately placed on ice. After washing the wells of the gel, the samples were loaded and electrophoresed at 180-250 volts for 45 minutes. The gel was wrapped in saran (SARAN (TM) brand) lap and exposed to XAR film on a signal intensifying screen for 1 hour to overnight in a -70 ° C freezer.

< ³³ P-hybridization>

A. Pretreatment of frozen sections

The slide was taken out from the freezer and placed on an aluminum tray and thawed at room temperature for 5 minutes. To reduce condensation, the tray was placed in an incubator at 55 캜 for 5 minutes. The slides were fixed in a fume hood with ice-cold 4% paraformaldehyde for 10 minutes and washed with 0.5 x SSC (25 ml 20 x SSC + 975 ml SQ H ₂ O) for 5 minutes at room temperature. The protein was removed with 0.5 μg / ml protease K for 10 minutes at 37 ° C. (12.5 μl of a 10 mg / ml stock solution in 250 ml of pre-warmed RNase buffer without RNase) and the section was incubated for 10 min in 0.5 × SSC And washed. The fragments were dehydrated in 70%, 95%, and 100% ethanol for 2 minutes each.

B. Pretreatment of sections embedded in paraffin

The paraffin was removed from the slide, placed in SQ H ₂ O and washed 2 x SSC at room temperature for 5 min each. In the case of human embryo tissues, proteins were removed from the sections using proteolytic enzyme K (500 μl of a 10 mg / ml solution in 250 ml of RNase buffer without RNase, at 37 ° C. for 15 minutes) and the formalin tissue , Proteins were removed from the sections using 8x protease K (100 μl in 250 ml of RNase buffer, 37 ° C, 30 minutes). Thereafter, it was washed with 0.5 x SSC as described above and proteins were removed.

C. Prehybridization

The slide was placed in a plastic box divided into sections by filter paper saturated with Box buffer (4 x SSC, 50% formamide). 50 μl of hybridization buffer (3.75 g dextran sulfate / 6 ml SQ H ₂ O) was dropped onto the tissue and after vortexing, the lid was loosened and heated in a microwave oven for 2 minutes. After cooling on ice, 18.75 ml of formamide, 3.75 ml of 20 x SSC and 9 ml of SQ H ₂ O were added and the tissue was well vortexed and then incubated at 42 ° C for 1-4 hours.

D. Hybridization

1.0 占¹⁰⁶ cpm of probe and tRNA (50 mg / ml stock solution) per slide were heated at 95 占 폚 for 3 minutes. The slides were cooled on ice and 48 혼 of hybridization buffer per slide was added. After vortexing, 50 μl of the ³³ P mixture was added to 50 μl of the slide prehybridization sample. The slides were incubated overnight at 55 ° C.

E. Wash

After washing with 2 x SSC, EDTA twice at room temperature (20x SSC 400ml + 0.25M EDTA 16ml, final volume = 4L), the cells were treated with RNase A for 30 min at 37 ° C (10 mg / ml in 250 ml RNase buffer RNase 500 [mu] l = 20 [mu] g / ml). The slides were washed twice with 2 x SSC, EDTA for 10 min at room temperature. Strict washing conditions are as follows: 55 ° C, 0.1x SSC and EDTA for 2 hours (20x SSC 20ml + EDTA 16ml, final volume = 4L).

F. oligonucleotides

In situ analysis was performed on three of the DNA sequences disclosed herein. The oligonucleotides used in this assay are as follows:

(1) DNA47365-1206 (PRO364) (TNF receptor homolog)

p1: 5'-GGA TTC TAA TAC GAC TCA CTA TAG GGC AAC CCG AGC ATG GCA CAG CAC-3 '(SEQ ID NO: 50)

p2: 5'-CTA TGA AAT TAA CCC TCA CTA AAG GGA TCT CCC AGC CGC CCC TTC TC-3 '(SEQ ID NO: 51)

(2) DNA30868 (PRO205) (polystatin homolog)

p1: 5'-GGA TTC TAA TAC GAC TCA CTA TAG GGC AGA GAC AGG GCA AGC AGA ATG-3 '(SEQ ID NO: 52)

p2: 5'-CTA TGA AAT TAA CCC TCA CTA AAG GGA GAA GGG GAT GAC TGG AGG AAC-3 '(SEQ ID NO: 53)

(3) DNA41374 (PRO333) (CD33 homolog)

5'-GGA TTC TAA TAC GAC TCA CTA TAG GGC CTC CAC AGA ACC TCG CCA TCA-3 '(SEQ ID NO: 54)

5'-CTA TGA AAT TAA CCC TCA CTA AAG GGA TGG GGC AAG ACT CAC AAG CAG-3 '(SEQ ID NO: 55)

G. Results

In situ analysis was performed on the three DNA sequences disclosed herein. The following results were obtained from this analysis.

(1) DNA47365-1206 (PRO364) (TNF receptor homolog)

It was expressed on the anterior surface of the lining of the vertebral body of the fetus. It was also expressed in the fetal retina. However, it was expressed at low levels in fetal neurons. But not in all other tissues.

(2) DNA30868 (PRO205) (polystatin homolog)

Spinal cord, autonomic ganglia, intestine, sacrum, peripheral and cranial nerves of fetal tissues. But not in all other fetal and adult tissues.

The examined fetal tissues (12-16 weeks) can be classified as placenta, umbilical cord, liver, kidney, adrenal, thyroid, lung, heart, large blood vessel, esophagus, stomach, small intestine, spleen, thymus, pancreas, , Uterus and not.

Adult tissues are liver, kidney, adrenal, myocardium, aorta, spleen, lymph node, pancreas, lung and skin.

(3) DNA41374 (PRO333) (CD33 homolog)

This molecule appears to be immunostimulatory (promoting T lymphocyte proliferation in lymphocyte reactions mixed in the same way during T lymphocyte co-stimulation assays). The distribution pattern of this molecule was investigated with limited tissue screening, including tissue available at the beginning of this study. Among the multiple tissues examined, a slightly dispersed expression was detected in the thymus T lymphocytes (no spleen and lymph nodes were examined). This result was confirmed in a subsequent in situ hybridization study. The results of the in situ hybridization study showed similarly low expression in human monocytes of non-human primate thymus and T lymphocyte specific regions. The limited distribution pattern implies expression by T lymphocytes or T cells closely related to T lymphocytes such as antigen-expressing cells (dendritic cell population, etc.). In the presence of significant inflammatory human tissue and reactive follicular formation of lymphocyte inflammation, there was no detectable expression in the area containing a significant number of T lymphocytes.

This distribution difference (ie, expressed in the T lymphocyte region of the thymus and tonsil, but not in the T lymphocyte inflammatory region) suggests the following possibilities:

1. There is (limited) expression in a subpopulation of T lymphocytes that is present in the lymph nodes of the thymus and tonsil but not in the inflammatory tissue. Nonmature immature T lymphocytes are present in both tonsils and thymus but may not be a major group in chronic inflammatory tissue.

2. The expression of T in lymphocytes is weakly or differently detected in tissues with T lymphocytes, rather than reflecting the type of T lymphocyte population, reflects RNA quality in the tissue sections.

3. Expression in the thymus and tonsil is not expression from lymphocytes, but expression from specific cell populations closely related to T lymphocytes, absent in irradiated inflammatory lungs or intestines. One group of cells that may be the cell population is a subpopulation of dendritic cells.

In nonhuman primates, there was a weak diffuse expression in the thymus lymphocytes.

In subsequent studies, the following results were reported:

Inflammatory lungs (chronic lymphocytic pneumonia and granulomatous pneumonia): Weak signals or negative signals were observed in the epilepsy compared to the control sense probes, and weak expression was observed in the normal chimpanzee thymus (human thymus is not available) and in the human tonsil. It was mainly expressed in the T lymphocyte region and the thymus - dependent layer (paracortex) of these structures including the normal chimpanzee thymus and the human tonsil, and the periplasmic layer.

Chronic inflammatory bowel disease (8 patient specimens), chronic inflammation and normal lung (6 patient specimens), chronic sclerosis nephritis (1 patient specimen), chronic and acute inflammation and cirrhotic liver (10 specimens multublock) Skin, and peripheral lymph nodes (non-reactive).

Example 20 Use of PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887 as Hybridization Probes

The following methods describe the use of nucleotide sequences encoding PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887 as hybridization probes.

DNA comprising the coding sequences of full length or mature PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, , 23, 25, 27, 29 and 31, respectively), or fragments thereof, can be obtained from DNAs homologous in human tissue cDNA libraries or human tissue genomic libraries (PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333 , PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887).

A filter containing one of the two library DNAs is hybridized and washed under the following high stringency conditions. The radiolabeled probes derived from the genes encoding the PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887 polypeptides were dissolved in 50% Was added to the filter for 20 hours in a solution containing SSC, 0.1% SDS, 0.1% sodium pyrosulfate, 50 mM sodium phosphate, pH 6.8, 2x Denhard's solution and 10% dextran sulfate Lt; / RTI &gt;

Next, using standard techniques known in the art, DNA that encodes the full-length native sequence can be identified that exhibits the desired sequence identity.

Example 21 Expression of Nucleic Acids Encoding PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887 in E. coli

This example demonstrates that recombinant expression in E. coli results in the production of non-glycosylated forms of PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887 .

First, the selected PCR primers were used to amplify the PCR primers of SEQ ID NOs: 1, 3, 5, 7 (SEQ ID NO: 1), SEQ ID NO: 3, SEQ ID NO: , 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29 and 31). The primer should contain a restriction enzyme site corresponding to the restriction enzyme site in the selected expression vector. A variety of expression vectors can be used. An example of a suitable vector is pBR322 (derived from E. coli; see Bolivar et al., Gene, 2: 95 (1997)) containing the ampicillin and tetracycline resistance gene. Preferably, the vector comprises an antibiotic resistance gene, a trp promoter, a poly-His leader (the first six STII codons, the poly-His sequence And an enterokinase cleavage site), regions coding for PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887, &Lt; / RTI &gt;

The ligation mixture was then used to transform selected E. coli strains using the method described in the above-mentioned Sambrook et al. (Sambrook et al.,). The transformants were identified by the ability of E. coli to proliferate on LB plates and antibiotic resistant colonies were selected. Plasmid DNA was isolated and confirmed by restriction enzyme analysis and DNA sequencing.

Selected clones can be cultured overnight in culture media such as LB broth containing antibiotics. Subsequently, large-scale cultures were inoculated using overnight cultures. The cells were then incubated to the desired optical density while the expression promoter was running.

After culturing the cells for several hours, cells were collected by centrifugation. The cell pellet obtained by centrifugation can be dissolved using a variety of materials known in the art and then dissolved in a solution of the dissolved PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887 polypeptides can be purified using metal-chelating columns under conditions permitting strong binding of the polypeptides.

PRO238, PRO364 and PRO1760 were successfully expressed in Escherichia coli in a form tagged with poly-His by this method.

Example 22 Expression of Nucleic Acids Encoding PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887 in Mammalian Cells

This example describes recombinant expression in mammalian cells to produce PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887, which are likely to be in glycosylated form . &Lt; / RTI &gt;

Vector, pRK5 (see European Patent No. 307, 247 published March 15, 1989) was used as an expression vector. Optionally, PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887 DNA can be generated using the ligation method as described in the above- Were ligated with pRK5 with a selected restriction enzyme that allowed the insertion of DNA encoding PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887. The resulting vector was called pRK5- (PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887).

In one embodiment, the selected host cell is a 293 cell. Human 293 cells (ATCC CCL 1573) were preincubated in tissue culture plates with medium such as fetal bovine serum and, optionally, DMEM containing nutrients and / or antibiotics. About 10 의 of pRK-5 DNA (DNA encoding PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887) Thimmappaya et al., Cell, 31: 543 (1982)) and dissolved in 500 μl of buffer (1 mM Tris-HCl, 0.1 mM EDTA, 0.227 M CaCl ₂ ). 500 μl of a solution (50 mM HEPES (pH 7.35), 280 mM NaCl, 1.5 mM NaPO ₄ ) was added dropwise to the mixture and a precipitate was formed at 25 ° C for 10 minutes. The precipitate was suspended and added to the 293 cells, and then allowed to stand at 37 DEG C for about 4 hours. The culture medium was aspirated off and 20% glycerol in PBS was added for 30 seconds. The 293 cells were then washed with serum-free medium, fresh medium was added, and the cells were incubated for about 5 days.

After transfection approximately 24 hours, removing the culture medium, and changing only the culture medium or changed in culture medium containing ³⁵ S- cysteine and 200 μCi / ml ³⁵ S- methionine of the 200 μCi / ml. After incubation for 12 hours, the red application medium was collected, concentrated on a rotary filter, and loaded onto 15% SDS gel. The treated gel was dried and exposed to film for a period of time to confirm the presence of the PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887 polypeptides there was. Cultures containing transfected cells were further incubated (incubated in serum-free medium) and this medium was tested in a selected bioassay.

Alternatively, genes encoding PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887 are described in Somparyrac et al., Proc. Natl. Acad. Sci., 12: 7575 (1981)). 293 cells were cultured to a maximum density in a spinning flask and 700 μg of pRK5 (PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887 DNA) was added. The cells were first concentrated from the spinning flask by centrifugation and washed with PBS. The DNA-dextran precipitate was incubated on the cell pellet for several hours. Cells were treated with 20% glycerol for 90 seconds, washed with tissue culture medium and reintroduced into a spinning flask containing tissue culture medium, 5 [mu] g / ml bovine insulin and 0.1 [mu] g / ml bovine transferrin. After about several days, the conditioned medium was centrifuged and filtered to remove cell and cell debris. Next, a sample containing the expression gene encoding the PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887 polypeptide is concentrated, &Lt; / RTI &gt; and / or column chromatography.

In another embodiment, genes encoding PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887 can be expressed in CHO cells. pRK5 known as (PRO179, PRO238, PRO364, PRO844 , PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, DNA encoding the PRO885 or PRO887) nucleic acid CaPO ₄ or DEAE- dextran RTI ID = 0.0 &gt; CHO &lt; / RTI &gt; cells. As described above, the cell culture can be incubated and the medium can be replaced with a culture medium (alone), or a medium containing a radioactive label such as ³⁵ S-methionine. After confirming the presence of PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887 polypeptides, the culture medium can be replaced with serum free medium. Preferably, the cultures were incubated for about 6 days and then the conditioned media was collected. The medium containing the expressed PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887 was then concentrated and purified by any selected method Can be purified.

A gene to which an epitope tag is attached, which encodes a PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887 polypeptide, . The genes encoding PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887 can be obtained from the pRK5 vector. The subclone insert can be PCR amplified and bound in-frame with selected epitope tags such as the poly-His tag in a baculovirus expression vector. The gene insert coding for PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887 to which the poly- Cloned into an SV40 derived vector containing a selectable marker such as DHFR for selection. Finally, CHO cells can be transfected with the SV40-derived vector (as described above). In order to confirm the expression, it can be labeled as described above. Thereafter, the expression vector containing an expression gene encoding PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887 to which the poly- The culture medium can be concentrated and purified by any selected method such as Ni ²⁺ -chelate affinity chromatography.

PRO179, PRO364, PRO840, PRO844, PRO846 and PRO205 were stably expressed in CHO cells by the method described above. In addition, PRO364 and PRO846 were expressed in CHO cells as transient transfection methods.

Example 23 Expression of Nucleic Acids Encoding PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887

Recombinant expression of genes encoding PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887 in yeast is described in the following method.

First, it is possible to generate PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887 polypeptides in cells under the control of the ADH2 / GAPDH promoter An expression vector for secretion of the polypeptide into a cell was prepared. DNA and promoters encoding the PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887 were inserted into the appropriate restriction enzyme sites in the selected plasmids, , PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887 were directly expressed in the cells. The signal peptide of the ADH2 / GAPDH promoter, natural PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887 signal peptide, For example, a yeast alpha-factor or an invertase secretion signal (leader) sequence, and (if necessary) PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882 , PRO885 or PRO887 with the DNA encoding the linker sequence for expression of the gene encoding the PRO885 or PRO887. Alternatively, the DNA encoding PRO887 can be cloned into a selected plasmid.

Yeast cells such as yeast strain AB110 can then be transformed with the expression plasmids and cultured in selected fermentation media. The transformed yeast supernatant can be analyzed by precipitation with 10% trichloroacetic acid and separation by SDS-PAGE, followed by staining the gel with blue staining of the comas.

The recombinant PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887 were isolated and centrifuged to remove yeast cells from the fermentation medium Purification can be achieved by concentrating the medium using a selected cartridge filter. The selected column chromatography resin can be used to further purify concentrates containing PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887 have.

Example 24 Expression of Nucleic Acids Encoding PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887 in Baculovirus Infected Insect Cells

The following methods are described for recombinant expression in goblet cells infected with baculovirus.

The sequences encoding PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887 are referred to as upstream sequences of epitope tags contained within the baculovirus expression vector Lt; / RTI &gt; Such epitope tags include a poly-His tag and an immunoglobulin tag (such as the Fc region of IgG). A variety of plasmids can be used, including plasmids from commercially available plasmids such as pVL1393 (Novagen). A sequence encoding PRO179, PRO238, PRO364, PRO844, PRO846, PRO864, PRO878, PRO878, PRO879, PRO882, PRO885 or PRO887, In some of the coding regions of the coding sequence of the PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887 sequences [eg, sequences encoding extracellular domains of transmembrane proteins, Mature protein] was amplified by PCR using primers complementary to the 5 'and 3' regions. The 5 'primers can introduce flanking (selected) restriction enzyme sites. The product was then digested with the selected restriction enzymes and subcloned into an expression vector.

The plasmid and BaculoGold virus DNA (Pharmingen) were transfected into Spodoptera frugiperda (" Sf9 &quot;) cells (ATCC CRL 1711) using lipofectin (commercially available from GIBO-BRL) At the same time, recombinant baculovirus was obtained by transfection. After incubation for 4 to 5 days at 28 &lt; 0 &gt; C, the exported viruses were collected and used for further amplification. Viral infections and protein expression were performed as described in O'Reilley et al., Baculovirus Expression Vectors: A Laboratory Manual (Oxford: Oxford University Press, 1994).

Then, the expressed poly-His tag- [PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887] Ni ²⁺ - chelate affinity chromatography. Extracts were obtained from recombinant virus-infected Sf9 cells as described in Rupert et al., Nature, 362: 175-179 (1993). In short, the cleaning Sf9 cells, and sonication buffer, resuspended in (25 mM Hepes, pH 7.9; 12.5 mM MgCl 2; 0.1 mM EDTA; 10% glycerol;; 0.1% NP-40 0.4 M KCl), and the supernatant Diluted 50-fold with loading buffer (50 mM phosphate, 300 mM NaCl, 10% glycerol, pH 7.8) and filtered through a 0.45 [mu] m filter. A Ni ²⁺ -NTA agarose column (commercially available from Qiagen) with a bead volume of 5 ml was prepared, washed with 25 ml of water and equilibrated with 25 ml of loading buffer. The filtered cell extract was loaded onto the column at 0.5 ml per minute. The column was washed with loading buffer to a reference value A ₂₈₀ , which is the point at which the fractions begin to collect. Next, the column was washed with secondary washing buffer (50 mM phosphate; 300 mM NaCl, 10% glycerol, pH 6.0) eluting non-specifically bound proteins. After again reaching the reference value A ₂₈₀ , the column was developed with a 0-500 mM imidazole concentration gradient in the secondary wash buffer. 1 ml fractions were collected, analyzed by SDS-PAGE, and Western blot using silver stain or alkaline phosphatase (Qiagen) conjugated with Ni ²⁺ -NTA. Fractions containing each of the eluted His ₁₀ -tagged [PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887] were collected and resuspended in loading buffer Lt; / RTI &gt;

Alternatively, the IgG-tag- [PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887] Can be purified using known chromatographic techniques, including chromatography.

Actually, it was expressed on a scale of 0.5 to 2 L, but it can easily be increased in scale for larger-scale expression (for example, 8 L). The protein was expressed as a form in which the extracellular domain of the protein was bound to an IgG construct (immunohedhedin) or a poly-His tag, which was bound to an IgG1 constant region sequence containing hinge, CH2 and CH3 domains.

After PCR amplification, each coding sequence was subcloned into a baculovirus expression vector (pb.PH.IgG in the case of an IgG conjugate and pb.PH.His.c in the case of a poly-His tagged protein) , The vector and Baculov gold baculovirus DNA (Pharmingen) were co-transfected into 105 Spodoptera frugiperda ("Sf9") cells (ATCC CRL 1711) using lipofectin (Gibco BRL) Infected. pb.PH.IgG and pb.PH.His are commercially available baculovirus expression vectors pVL1393 (Pharmingen) in which polylinker regions are modified to include His or Fc tag sequences. Cells were cultured in Hink's TNM-FH medium containing 10% FBS (Hyclone). The cells were incubated at 28 [deg.] C for 5 days. After collecting the supernatant, Sf9 cells were used for first viral amplification by infecting with a multiplicity of infection (MOI) of about 10 in Hink's TNM-FH medium containing 10% FBS. The cells were incubated at 28 [deg.] C for 3 days. The supernatant is collected and 1 ml of the supernatant is bound to 25 ml of Ni ²⁺ -NTA beads (Qiagen) in the case of a histidine tagged protein and the protein-A Sepharose CL-4B The degree of expression of the constructs in the baculovirus expression vector was determined by performing an SDS-PAGE analysis comparing the known concentrations of the protein standards with blue staining after conjugation to the beads (Pharmacia).

The first viral amplification supernatant was used to infect a round of culture (500 ml) of Sf9 cells cultured in ESF-921 medium (expression system LLC) at a multiplicity of infection of about 0.1. The cells were incubated at 28 [deg.] C for 3 days. The supernatant was collected and filtered. If necessary, batch binding and SDS-PAGE analysis were repeated until expression of the spin culture was confirmed.

The transformed medium (0.5-3 L) from the transfected cells was collected by centrifugation and filtered through a 0.22 micron filter. For structures with poly-His tags, the protein constructs were purified using a Ni ²⁺ -NTA column (Qiagen). Prior to purification, imidazole was added to the medium to a concentration of 5 mM. The medium was loaded onto a Ni ²⁺ -NTA column equilibrated with 20 mM Hepes, pH 7.4 buffer containing 0.3 M NaCl and 5 mM imidazole at a flow rate of 4-5 ml / min at 4 ° C. After loading, the column was washed with equilibration buffer and the protein was eluted with equilibration buffer containing 0.25 M imidazole. The highly purified protein was then desalted into storage buffer (10 mM Hepes, 0.14 M NaCl and 4% mannitol, pH 6.8) using 25 ml of G25 Superfine (Pharmacia) column and stored at -80 ° C .

The immunoaffeicin (Fc containing) structure of the protein was purified as follows from the medium in which the state changed. The conditioned media was loaded onto a 5 ml protein A column (Pharmacia) equilibrated with 20 mM sodium phosphate buffer (pH 6.8). After loading, the column was thoroughly washed with equilibration buffer and eluted with 100 mM citric acid (pH 3.5). The eluted proteins were immediately neutralized by collecting 1 ml fractions in tubes containing 1 M Tris buffer (pH 9). The highly purified protein was then desalted into storage buffer as in the case of the poly-His tag-protein. Homogeneity of the protein was confirmed by SDS polyacrylamide gel (PEG) electrophoresis and N-terminal amino acid sequencing by Edman degradation.

PRO205, PRO321, PRO840, PRO846, PRO885 and PRO887 were successfully expressed in baculovirus-infected insect Sf9 cells in the manner described above.

Alternatively, when using high-5 cells, a modified baculovirus method can be used. In this method, the DNA encoding the desired sequence is amplified with a suitable system such as Pfu (Stratagene) and bound to the 5'-upstream of the epitope tag contained in the baculovirus expression vector. These epitope tags include the poly-His tag and the immunoglobulin tag (similar to the Fc region of IgG). A variety of plasmids can be used, including plasmids derived from commercially available plasmids such as pIE1-1 (Novagen). The pIE1-1 and pIE1-2 vectors were designed to express the recombinant protein at basal concentrations from the baculovirus ie1 promoter in stably transformed insect cells. The plasmid differs only in the orientation of the multiple cloning site and contains all the promoter sequences known to be important for the expression of the hr1 enhancer element as well as the iel-mediated gene in uninfected scarlet cells. pIE1-1 and pIE1-2 contain translation initiation sites and can be used to generate fusion proteins. Briefly, the desired sequence or a portion of the desired sequence (e. G., The sequence encoding the extracellular domain of the transmembrane protein) was amplified by PCR using primers corresponding to the 5 'and 3' regions. The 5 ' primer can introduce a flanking (selected) restriction enzyme site. The product was then cut with the selected restriction enzymes and subcloned into an expression vector. For example, a derivative of pIE1-1 can comprise the Fc region of human IgG (pb.PH.IgG) or 8 histidine (pb.PH.His) tags 3'-downstream of the desired sequence. Preferably, the vector construct was sequenced and verified.

High-5 cells were cultured at 27 占 폚 without CO ₂ and penicillin / streptomycin to a full growth rate of 50%. For each 150 mm plate, 30 ㎍ of the pIE-based vector containing the sequence was added to 1 ml of Ex-cell medium (medium: Ex-cell 401 + 1/100 L-Glu JRH Biosciences # 14401-78P (Light sensitive)) and 100 [mu] l cell pectin (GibcoBRL # 10362-010 (mixed by vortexing)) in another tube was mixed with 1 ml of Ex-cell medium. The two solutions were combined and incubated at room temperature for 15 minutes. 8 ml of Ex-cell medium was added to 2 ml of DNA / cell pectin mixture, which was added to the Hi-5 cells once washed with Ex-cell medium. The plate was then incubated for 1 hour in a dark room at room temperature. Subsequently, the DNA / cell pectin mixture was aspirated off, the cells were washed once with Ex-Cell medium to remove residual cell pectin, 30 ml of fresh Ex-Cell medium was added, Lt; / RTI &gt; For the histidine-tagged protein, 1 ml of the supernatant was bound to 25 ml of Ni ²⁺ -NTA beads (Qiagen), and for IgG-tagged proteins, 1 ml of the supernatant was added to the Protein-A Sepharose Expression of the sequence in the baculovirus expression vector was determined by performing an SDS-PAGE analysis after batch binding to CL-4B beads (Pharmacia) followed by comparison to known concentrations of protein standards by blue staining in comas.

The transformed medium from the transfected cells (0.5-3 L) was centrifuged to remove cells and filtered through a 0.22 micron filter. For poly-His tagged constructs, proteins containing sequences are purified using a Ni ²⁺ -NTA column (Qiagen). Imidazole was added to the medium to a concentration of 5 mM before purification. The medium was pumped onto a Ni ²⁺ -NTA column [equilibrated with 20 mM HEPES buffer (pH 7.4, containing 0.3 M NaCl and 5 mM imidazole) at a flow rate of 4-5 ml / min at 48 ° C] Respectively. After loading, the column was washed with equilibration buffer and the protein eluted with equilibration buffer containing 0.25 M imidazole. The highly purified protein was then desalted into storage buffer (containing 10 mM HEPES, 0.14 M NaCl and 4% mannitol, pH 6.8) using a 25 ml G25 Superfine, Pharmacia column, And stored at 80 ° C.

The protein muonoadhesin (Fc-containing) preparation was purified from a medium in which the conditions were changed as follows. The medium was pumped onto a Protein A column (Pharmacia) equilibrated with 20 mM sodium phosphate buffer (pH 6.8). After loading, the column was thoroughly washed with equilibration buffer and eluted with 100 mM citric acid (pH 3.5). The eluted proteins were immediately neutralized by collecting 1 ml fractions into tubes containing 275 ml of 1 M Tris buffer (pH 9). Next, the highly purified protein was desalted into the storage buffer as in the case of the poly-His tagged protein. The homogeneity of the sequences was investigated by SDS polyacrylamide gel, N-terminal sequence sequencing by Edman degradation and other analytical methods if necessary or desirable.

PRO179, PRO205, PRO321, PRO333, PRO364, PRO844, PRO846, PRO877, PRO879, PRO882, PRO885 and PRO1760 were expressed in high-5 cells as described above.

Example 25: Preparation of antibodies that bind to PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887

The production of monoclonal antibodies capable of specifically binding to PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, .

Techniques for the production of monoclonal antibodies are known in the art and are described, for example, in the Golding literature. Exemplary immunogens include, but are not limited to, purified PRO179, PRO238, PRO364, PRO844, PRO238, PRO364, PRO844, including PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO327, PRO878, PRO878, PRO879, PRO279, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO338, PRO879, PRO882, PRO885 or PRO887 fusion proteins on the cell surface, There are cells expressing genes encoding PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887. Those skilled in the art can select immunogens without undue experimentation.

(Freund ' s adjuvant) and immunoprecipitated with 1 to 100 micrograms of the immunogen (s) in a Freund &apos; s adjuvant, wherein the adjuvant is selected from the group consisting of &lt; RTI ID = 0.0 & Mice such as Balb / c were immunized by subcutaneous or intraperitoneal administration of the dose.

Alternatively, the immunogen was emulsified in MPL-TDM adjuvant (Ribi Immunochemical Research, Hamilton, MT) and injected into the back pad of the animal. Then, 10 to 12 days later, the immunized mice were boosted with additional immunogen emulsified in the selected adjuvant. Thereafter, mice may be boosted by additional immunization for several weeks. Anti-PR059, anti-PR059, anti-PR078, anti-PR08, Serum samples can be obtained periodically from the mice via post orbital bleeding for testing in ELISA assays to detect PRO879, anti-PRO882, anti-PRO885 or anti-PRO887 antibodies.

After detection of the appropriate antibody titer, animals displaying a " positive " response to the antibody are finally treated with an anti-IL- Alternatively, PRO887 can be injected intravenously. After 3 to 4 days, mice are sacrificed and spleen cells are harvested. The spleen cells are then fused with selected murine myeloma cell lines such as P3X63AgU.1 (ATCC No. CRL1597) (using 35% polyethylene glycol). This fusion resulted in hybridoma cells that could be plated on 96-well tissue culture plates containing HAT medium to inhibit the proliferation of unfused cells, sarcoma hybrids and spleen cell hybrids.

The responsiveness of the hybridoma cells to the PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887 will be screened in an ELISA. &Quot; Positive " hybridoma cells that secrete the desired monoclonal antibodies to PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887, It can be discriminated.

Positive hybridoma cells were intraperitoneally injected into Balb / c mice in the genetically-derived strain of mice to induce anti-PR179, anti-PRO238, anti-PRO364, anti-PRO844, anti-PRO846, anti-PRO1760, anti- , Anti-PRO333, anti-PRO840, anti-PRO877, anti-PRO878, anti-PRO879, anti-PRO882, anti-PRO885 or anti-PRO 887 monoclonal antibodies. Alternatively, the hybridoma cells can be cultured in tissue culture flasks or roller bottles. The monoclonal antibody contained in the plurality can be purified using ammonium sulfate precipitation followed by gel-exclusion chromatography. Alternatively, an affinity chromatography based on the binding of the protein A or protein G to the antibody can be used.

<Donation of substance>

The following material (s) were deposited with the American Culture Collection (10801 University Blvd., Manassas, VA 20110-2209, USA (ATCC)).

matter ATCC Accession Number Date of deposit DNA16451-1388 209776 April 14, 1998 DNA35600-1162 209370 October 16, 1997 DNA47365-1206 209436 November 7, 1997 DNA59838-1462 209976 June 16, 1998 DNA44196-1353 209847 May 6, 1998 DNA76532-1702 203473 November 17, 1998 DNA34433 209719 March 31, 1998 DNA53987 209858 May 12, 1998

The deposit was made under the provisions of the Budapest Treaty on the International Recognition of Microorganism Deposit under the Patent Procedure and its Rules (Budapest Treaty). This ensures the maintenance of the survival culture of the deposit for 30 years from the date of deposit. The deposit shall be sold under the agreement of the Budapest Treaty with ATCC, under the agreement between Genentech Inc. and the ATCC, upon the grant of the relevant US patent or upon the publication of the US or foreign patent application (first of these) (C) to ensure a permanent and unrestricted sale of the progeny of water, and to the United States Patent and Trademark Office in accordance with the provisions of 35 USC § 122 and the United States Patent and Trademark Office Regulations therefor, including 37 CFR §1.14, in particular 886 OG 638 We guarantee the sale of the progeny to those who decide to have the right to do so.

The assignee of the present application agrees that if the culture of the deposited material is killed, lost or destroyed when cultivated under suitable conditions, the substance will be immediately replaced with another identical substance upon notification. The sale of the deposited material shall not be construed as permitting the implementation of the invention in violation of the rights granted by the national government under its patent law.

The foregoing specification is believed to be sufficient to enable those skilled in the art to practice the invention. The invention is not limited to the scope of the deposited structure, and any functionally equivalent structure is within the scope of the present invention, as the deposited embodiment is intended as an illustration of certain aspects of the invention. The deposit of a substance here does not mean that the description contained herein is inappropriate to carry out any aspect including the best mode of the present invention and is intended to limit the scope of the claims to the specific description presented in the specification It should not be interpreted. Indeed, various modifications of the invention in addition to those shown and described herein will become apparent to those skilled in the art from the foregoing detailed description, which is within the scope of the appended claims.

Claims (80)

PRO289, PRO887, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887 polypeptides, agonists or antagonists thereof in admixture with a pharmaceutically acceptable carrier / RTI &gt; 7. The composition of claim 1 comprising a therapeutically effective amount of said polypeptide, an agonist thereof or an antagonist. The method of claim 1, wherein the agonist is selected from the group consisting of anti-PRO179, anti-PRO238, anti-PRO364, anti-PRO844, anti-PRO846, anti- PRO1760, anti- PRO205, anti- PRO321, anti- Anti-PRO877, anti-PRO878, anti-PRO879, anti-PRO882, anti-PRO885 or anti-PRO 887 antibody. The composition according to claim 1, wherein the antagonist is selected from the group consisting of anti-PRO 179, anti-PRO238, anti-PRO364, anti-PRO844, anti-PRO846, anti- PRO1760, anti-PRO205, anti- PRO321, anti- -PRO877, anti-PRO878, anti-PRO879, anti-PRO882, anti-PRO885 or anti-PRO 887 antibody. The composition of claim 1, further comprising a cardiovascular agent, an endothelial system agent, an angiogenesis agent or an angiogenesis inhibitor. The invention includes mixing a polypeptide, an agonist or an antagonist thereof with a pharmaceutically acceptable carrier, such as, for example, PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, Lt; RTI ID = 0.0 &gt; 1, &lt; / RTI &gt; (B) PRO179, PRO238, PRO364, PRO844, PRO864, PRO878, PRO878, PRO879, PRO879, PRO885 or PRO887 polypeptides, Or (c) an agonist of the PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO337, PRO326, PRO337, PRO356, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, A composition comprising an antagonist of PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887 polypeptide in admixture with a pharmaceutically acceptable carrier; (2) a container containing the composition; And (3) A label attached to the container or a package insert contained in the container, which describes the use of the composition in the treatment of cardiovascular disease, endothelial cell disease and angiogenic disease &Lt; / RTI &gt; 9. The method of claim 7, wherein the agonist is selected from the group consisting of anti-PRO179, anti-PRO238, anti-PRO364, anti-PRO844, anti-PRO846, anti- PRO1760, anti- PRO205, anti- PRO321, anti- Anti-PRO877, anti-PRO878, anti-PRO879, anti-PRO882, anti-PRO885 or anti-PRO887 antibodies. 9. The composition of claim 7, wherein the antagonist is selected from the group consisting of anti-PRO179, anti-PRO238, anti-PRO364, anti-PRO844, anti-PRO846, anti- PRO1760, anti- PRO205, anti- PRO321, anti- -PRO877, anti-PRO878, anti-PRO879, anti-PRO882, anti-PRO885 or anti-PRO 887 antibody. 8. The product of claim 7, wherein said composition comprises a therapeutically effective amount of said polypeptide, agonist or antagonist thereof in admixture with a pharmaceutically acceptable carrier. (a) contacting a test compound to be screened with a cell for a cell response normally induced by a PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887 polypeptide Contacting under conditions suitable for induction; (b) identifying an agonist of said polypeptide, wherein said test compound is an effective agonist; and determining the induction of said cellular response (indicating that the test compound is an effective agonist) to determine if said test compound is an effective agonist. 12. The method of claim 11, wherein the cellular response normally induced by the polypeptide is stimulation of cell proliferation. The test compound is contacted with PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887 polypeptides for sufficient time under conditions that they can interact, Identifying a compound that inhibits the activity of the polypeptide, comprising ascertaining that the activity of the polypeptide is inhibited. (a) contacting the test compound to be screened with the cells with a compound that is normally induced by the presence of the PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887 polypeptide Contacting under conditions suitable for induction of cellular responses; (b) identifying the induction of said cellular response to determine if the test compound is an effective antagonist. 15. The method of claim 14, wherein the cellular response normally induced by the polypeptide is a stimulation of cell proliferation. The cells and the test compounds are contacted under conditions suitable for expressing the PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887 polypeptides, Wherein the expression of the polypeptide is suppressed in a cell normally expressing the polypeptide. An agonist of a PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887 polypeptide. Antagonists of the PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887 polypeptides. A compound that inhibits the expression of said polypeptide in a mammalian cell expressing said PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887 polypeptide. 20. The compound of claim 19, which is an antisense oligonucleotide. The isolated antibodies that bind to the PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887 polypeptides. 22. The antibody of claim 21, which is a monoclonal antibody. 22. The antibody of claim 21, wherein the antibody fragment is an antibody fragment. 22. The antibody of claim 21, which is a single chain antibody. The presence or absence of a mutation in a polypeptide-coding nucleic acid sequence, which is a mutation-related disorder or a mutation in the mutation, or a mutation in the mutation in the polypeptide-coding nucleic acid sequence, A nucleic acid sequence encoding said polypeptide-encoding nucleic acid sequence, and identifying a susceptibility to said disease. PRO279, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO329, and PRO840 were tested in a sample of (a) a test sample of tissue cells obtained from a mammal and (b) a control sample of known normal tissue cells of the same cell type. Expression of the gene encoding the PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887 polypeptide (higher expression or lower expression in the test sample as compared to the control sample is indicative of a cardiovascular disease, endothelial cell disease or angiogenic disease 0.0 &gt; vascular &lt; / RTI &gt; disease, angiogenic disease or angiogenic disease of a mammal. The presence or absence of PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887 polypeptides in the test samples of tissue cells obtained from mammals Wherein the presence or absence of the polypeptide in the sample is indicative of the presence of a cardiovascular disease, endothelial cell disease or angiogenesis disease in the mammal, such as a cardiovascular disease, endothelial cell disease or angiogenic disease . (a) a test sample of tissue cells obtained from a mammal and a test sample of anti-PRO179, anti-PRO238, anti-PRO364, anti-PRO844, anti-PRO846, anti-PRO1760, anti- PRO205, anti- (B) contacting said antibody with said antibody against PRO179, PRO238, PRO364, PRO844, or PRO844 in said test sample; and (b) contacting said antibody with said anti-PRO840, anti-PRO877, anti- PRO878, anti- PRO879, anti- PRO882, anti- The formation of a conjugate between a polypeptide of the PRO846, the PRO1760, the PRO205, the PRO321, the PRO333, the PRO840, the PRO877, the PRO878, the PRO879, the PRO882, the PRO885 or the PRO887 polypeptide (the presence of a cardiovascular disease, 0.0 &gt; a &lt; / RTI &gt; method of diagnosing a cardiovascular disease, endothelial cell disease or angiogenesis disease in a mammal. Samples suspected of containing PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887 polypeptides were tested for anti- PR179, anti- Anti-PR864, anti-PRO864, anti-PRO864, anti-PRO864, anti-PRO864, anti-PRO864, anti- A method for identifying the presence of said polypeptide in said sample, said method comprising contacting said sample with an anti-PRO887 antibody and confirming the binding of said antibody to said component of said sample. In a suitable package, anti-PR179, anti-PRO238, anti-PRO364, anti-PRO844, anti-PRO846, anti-PRO1760, anti-PRO205, anti- PRO321, anti- , Anti-PRO879, anti-PRO882, anti-PRO885 or anti-PRO 887 antibody and carrier. Comprising administering to a mammal a therapeutically effective amount of PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887 polypeptides, agonists or antagonists thereof, , Cardiovascular disease, endothelial cell disease or angiogenic disease of mammals. 32. The method of claim 31, wherein the mammal is a human. 33. The method of claim 32, wherein the human is suffering from myocardial infarction. 33. The method of claim 32, wherein the human is suffering from cirrhosis, trauma, cancer, or age-related macular degeneration. 35. The method of claim 34, wherein said hypercardia that is characterized by the presence of high levels of PGF _2α. 34. The method of claim 31, wherein the PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887 polypeptides are selected from the group consisting of cardiovascular agents, Or a pharmaceutically acceptable salt thereof. 35. The method of claim 34, wherein the PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887 polypeptides are administered after primary angioplasty . 32. The method of claim 31, wherein said cardiovascular disease, endothelial cell disease or angiogenic disease is cancer. 41. The method of claim 38, wherein the PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887 polypeptide is a chemotherapeutic, &Lt; / RTI &gt; 32. The method of claim 31, wherein the agonist is selected from the group consisting of anti-PRO179, anti-PRO238, anti-PRO364, anti- PRO844, anti- PRO846, anti- PRO1760, anti- PRO205, anti- PRO321, anti- Anti-PRO877, anti-PRO878, anti-PRO879, anti-PRO882, anti-PRO885 or anti-PRO 887 antibody. 32. The method of claim 31, wherein said antagonist is selected from the group consisting of anti-PRO179, anti-PRO238, anti-PRO364, anti-PRO844, anti-PRO846, anti- PRO1760, anti- PRO205, anti- PRO321, anti- -PRO877, anti-PRO878, anti-PRO879, anti-PRO882, anti-PRO885 or anti-PRO887 antibodies. It may be advantageous to administer to a mammal a nucleic acid molecule encoding a polypeptide, an agonist or an antagonist thereof, such as PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, A method for the treatment of a cardiovascular disease, endothelial cell disease or angiogenic disease of a mammal. 43. The method of claim 42, wherein the agonist is selected from the group consisting of anti-PRO179, anti-PRO238, anti-PRO364, anti-PRO844, anti-PRO846, anti- PRO1760, anti- PRO205, anti- Anti-PRO877, anti-PRO878, anti-PRO879, anti-PRO882, anti-PRO885 or anti-PRO 887 antibody. 43. The method of claim 42, wherein said antagonist is selected from the group consisting of anti-PRO179, anti-PRO238, anti-PRO364, anti-PRO844, anti-PRO846, anti- PRO1760, anti- PRO205, anti- PRO321, anti- -PRO877, anti-PRO878, anti-PRO879, anti-PRO882, anti-PRO885 or anti-PRO887 antibodies. 43. The method of claim 42, wherein the mammal is a human. 43. The method of claim 42, wherein the nucleic acid molecule is administered via an in vitro gene therapy method. (2) PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887 polypeptides, agonists or antagonists thereof, And (3) a retroviral vector consisting of a cell division cost signal sequence of the polypeptide, wherein the retroviral structural protein is combined with a retroviral structural protein. (2) PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887 polypeptides , A nucleic acid encoding an agonist or antagonist thereof, and (3) a nucleic acid construct comprising a retroviral vector consisting of a cell division cost signal sequence of said polypeptide, wherein said recombinant retrovirus particle is produced by combining with a structural protein An in vitro produced cell that packages a retroviral vector. PRO333, PRO364, PRO877, PRO879, PRO882 or PRO885 polypeptides or agonists thereof to a mammal. A method of stimulating endothelial cell proliferation in a mammal comprising administering to the mammal a PRO179, PRO321, PRO840, PRO844, PRO846, PRO878 or PRO879 polypeptide or agonist thereof. Comprising administering to a mammal an antagonist of PRO179, PRO321, PRO840, PRO844, PRO846, PRO878 or PRO879 polypeptides. A method of stimulating endothelial cell proliferation in a mammal comprising administering to the mammal an antagonist of PRO333, PRO364, PRO877, PRO879, PRO882 or PRO885 polypeptide. 0.0 &gt; PRO205, &lt; / RTI &gt; PRO882 or PRO887 polypeptide or agonist thereof in a mammal. 0.0 &gt; PRO238, &lt; / RTI &gt; PRO878 or PRO1760 polypeptide or an agonist thereof to a mammal. Comprising administering to a mammal an antagonist of a PRO238, PRO878 or PRO1760 polypeptide. Lt; RTI ID = 0.0 &gt; PRO205, &lt; / RTI &gt; PRO882 or PRO887 polypeptide to a mammal. The use of PRO179, PRO321, PRO840, and PRO840 in a mammal comprising administering to the mammal a therapeutically effective amount of an anti-PRO179, anti-PRO321, anti-PRO840, anti- PRO844, anti- PRO846, anti- PRO878, or anti- A method of inhibiting angiogenesis induced by a PRO844, PRO846, PRO878 or PRO879 polypeptide. A method of stimulating angiogenesis induced by a polypeptide in a mammal comprising administering to the mammal a therapeutically effective amount of a PRO179, PRO321, PRO840, PRO844, PRO846, PRO878 or PRO879 polypeptide. (SEQ ID NO: 2), FIG. 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 20 (SEQ ID NO: 22), 24 (SEQ ID NO: 24), 26 (SEQ ID NO: 26), 28 (SEQ ID NO: 30) and FIG. 32 (SEQ ID NO: 32), wherein the nucleotide sequence is at least 80% identical to the nucleotide sequence encoding the amino acid sequence selected from the group consisting of the amino acid sequences shown in FIGS. (SEQ ID NO: 1), FIG. 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, (SEQ ID NO: 15), FIG. 17 (SEQ ID NO: 17), FIG. 19 (SEQ ID NO: 19), FIG. (SEQ ID NO: 29) and FIG. 31 (SEQ ID NO: 31), wherein the nucleotide sequence is at least 80% identical to the nucleotide sequence selected from the group consisting of the nucleotide sequence shown in FIG. (SEQ ID NO: 1), FIG. 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, (SEQ ID NO: 15), FIG. 17 (SEQ ID NO: 17), FIG. 19 (SEQ ID NO: 19), FIG. (SEQ ID NO: 29) and FIG. 31 (SEQ ID NO: 31), wherein the nucleotide sequence is at least 80% identical to the nucleotide sequence selected from the group consisting of the full length coding sequence of the nucleotide sequence shown in FIG. Nucleic acid sequence identity to the full-length coding sequence of the DNA of ATCC Accession Nos. 209776, 209370, 209436, 209976, 209847, 203473, 209719 or 209858 is 80% Nucleic acid. 62. A vector comprising the nucleic acid of any one of claims 59-62. 65. The vector of claim 63, operably linked to a regulatory sequence recognized by a host cell transformed with the vector. 63. A host cell comprising the vector of claim 63. 65. The host cell of claim 65, wherein the host cell is a CHO cell. 66. The host cell of claim 65, wherein the host cell is E. coli . 65. The host cell of claim 65, wherein the host cell is a yeast cell. 65. The host cell of claim 65, wherein the host cell is an insect cell infected with baculovirus. The host cell of claim 65 is cultivated under conditions suitable for expression of PRO179, PRO238, PRO364, PRO844, PRO846, PRO1760, PRO205, PRO321, PRO333, PRO840, PRO877, PRO878, PRO879, PRO882, PRO885 or PRO887 polypeptides, And recovering the polypeptide from water. (SEQ ID NO: 2), FIG. 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 20 (SEQ ID NO: 22), 24 (SEQ ID NO: 24), 26 (SEQ ID NO: 26), 28 (SEQ ID NO: 30) and FIG. 32 (SEQ ID NO: 32), wherein the amino acid sequence is at least 80% identical to the amino acid sequence selected from the group consisting of SEQ ID NOs: (SEQ ID NO: 2), FIG. 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 20 (SEQ ID NO: 22), 24 (SEQ ID NO: 24), 26 (SEQ ID NO: 26), 28 (SEQ ID NO: 30) and FIG. 32 (SEQ ID NO: 32), as compared to the amino acid sequence selected from the group consisting of the amino acid sequence shown in SEQ ID NO: Amino acid sequence identity with the amino acid sequence encoded by the full-length coding sequence of the DNA of ATCC Accession Nos. 209776, 209370, 209436, 209976, 209847, 203473, 209719 or 209858 Is 80% or more. 73. A chimeric molecule comprising a polypeptide according to any one of claims 71 to 73 linked to a heterologous amino acid sequence. 74. The chimeric molecule of claim 74, wherein said heterologous amino acid sequence is an epitope tag sequence. 74. The chimeric molecule of claim 74, wherein the heterologous amino acid sequence is an Fc region of an immunoglobulin. 73. An antibody that specifically binds to a polypeptide according to any one of claims 71 to 73. 77. The antibody of claim 77, which is a monoclonal antibody, humanized antibody or single chain antibody. (a) SEQ ID NO. 2, SEQ ID NO. 4, SEQ ID NO. 6, SEQ ID NO. 8, SEQ ID NO. 10 and SEQ ID NO. 12, (SEQ ID NO: 14), FIG. 16, FIG. 18, FIG. 18, FIG. 20, , 28 (SEQ ID NO: 28), 30 (SEQ ID NO: 30) and 32 (SEQ ID NO: 32); (b) a nucleic acid sequence encoding a signal peptide having a binding signal peptide comprising the amino acid sequence of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: (SEQ ID NO: 14), FIG. 16, FIG. 18, FIG. 18, FIG. 20, , 28 (SEQ ID NO: 28), 30 (SEQ ID NO: 30) and 32 (SEQ ID NO: 32); or (c) the sequences of Figures 2 (SEQ ID NO: 2), 4 (SEQ ID NO: 4), 6 (SEQ ID NO: 6), 8 (SEQ ID NO: 14), FIG. 16, FIG. 18, FIG. 18, FIG. 20, , The nucleotide sequence encoding the extracellular domain of the polypeptide shown in Figure 28 (SEQ ID NO: 28), Figure 30 (SEQ ID NO: 30) and Figure 32 &Lt; RTI ID = 0.0 &gt; 80% &lt; / RTI &gt; (a) SEQ ID NO. 2, SEQ ID NO. 4, SEQ ID NO. 6, SEQ ID NO. 8, SEQ ID NO. 10 and SEQ ID NO. 12, (SEQ ID NO: 14), FIG. 16, FIG. 18, FIG. 18, FIG. 20, , 28 (SEQ ID NO: 28), 30 (SEQ ID NO: 30) and 32 (SEQ ID NO: 32); (b) a nucleic acid sequence encoding a signal peptide having a binding signal peptide comprising the amino acid sequence of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: (SEQ ID NO: 14), FIG. 16, FIG. 18, FIG. 18, FIG. 20, , The extracellular domain of the polypeptide shown in Figure 28 (SEQ ID NO: 28), Figure 30 (SEQ ID NO: 30) and Figure 32 (SEQ ID NO: 32); or (c) the sequences of Figures 2 (SEQ ID NO: 2), 4 (SEQ ID NO: 4), 6 (SEQ ID NO: 6), 8 (SEQ ID NO: 14), FIG. 16, FIG. 18, FIG. 18, FIG. 20, , The extracellular domain of the polypeptide shown in Figure 28 (SEQ ID NO: 28), Figure 30 (SEQ ID NO: 30) and Figure 32 (SEQ ID NO: 32) &Lt; / RTI &gt; is greater than or equal to 80%.