Classifications

• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
  • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
  • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
  • C07K14/70578—NGF-receptor/TNF-receptor superfamily, e.g. CD27, CD30, CD40, CD95
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P11/00—Drugs for disorders of the respiratory system
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P13/00—Drugs for disorders of the urinary system
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P17/00—Drugs for dermatological disorders
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P19/00—Drugs for skeletal disorders
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P25/00—Drugs for disorders of the nervous system
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P27/00—Drugs for disorders of the senses
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P3/00—Drugs for disorders of the metabolism
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P33/00—Antiparasitic agents
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P35/00—Antineoplastic agents
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P35/00—Antineoplastic agents
  • A61P35/04—Antineoplastic agents specific for metastasis
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P37/00—Drugs for immunological or allergic disorders
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P7/00—Drugs for disorders of the blood or the extracellular fluid
  • A61P7/04—Antihaemorrhagics; Procoagulants; Haemostatic agents; Antifibrinolytic agents
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P9/00—Drugs for disorders of the cardiovascular system
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K38/00—Medicinal preparations containing peptides

Definitions

• the present invention relates to a novel human gene encoding a polypeptide which is a member of the Tumor Necrosis Factor Receptor or "TNFR" family. More specifically, the present invention relates to a polynucleotide encoding a novel human polypeptide named TNFR Related Gene 12, or "TRI 2.” This invention also relates to TRI 2 polypeptides, as well as vectors, host cells, antibodies directed to TRI 2 polypeptides, and to chemical and recombinant methods for producing the same. Also provided are diagnostic methods for detecting disorders related to the immune system, hemostasis, angiogenesis, tumor metastasis, cellular migration, or neurogenesis, and therapeutic methods for treating such disorders. The invention further relates to screening methods for identifying agonists and antagonists of TRI 2 activity.
• TNF- ⁇ and ⁇ are related members of a broad class of polypeptide mediators, which includes the interferons, interleukins and growth factors, collectively called cytokines (Beutler, B . and Cerami, A., Annu. Rev. Immunol, 7:625-655 (1989)).
• TNF- ⁇ and TNF- ⁇ Tumor necrosis factor
• TNF- ⁇ also known as CDw40
• OX40 OX40
• 4- IBB receptors These proteins have conserved C-terminal sequences and variable N-terminal sequences which are often used as membrane anchors, with the exception of TNF- ⁇ . Both TNF- ⁇ and TNF- ⁇ function as homotrimers when they bind to TNF receptors. TNF is produced by a number of cell types, including monocytes, fibroblasts,
• TNF- ⁇ has been reported to have a role in the rapid necrosis of tumors, immunostimulation, autoimmune disease, graft rejection, producing an anti-viral response, septic shock, cerebral malaria, cytotoxicity, protection against deleterious effects of ionizing radiation produced during a course of chemotherapy, such as denaturation of enzymes, lipid peroxidation and DNA damage (Nata, et al., J. Immunol. 136:2483 (1987)), growth regulation, vascular endothelium effects and metabolic effects.
• TNF- ⁇ also triggers endothelial cells to secrete various factors, including PAI-1, IL-1, GM-CSF and IL-6 to promote cell proliferation.
• TNF- ⁇ up-regulates various cell adhesion molecules such as E-Selectin, ICAM-1 and VCAM-1.
• TNF- ⁇ and the Fas ligand have also been shown to induce programmed cell death.
• TNF- ⁇ has many activities, including induction of an antiviral state and tumor necrosis, activation of polymorphonuclear leukocytes, induction of class I major histocompatibility complex antigens on endothelial cells, induction of adhesion molecules on endothelium and growth hormone stimulation (Ruddle, N. and Homer, R., Prog. Allergy 40: 162-182 (1988)).
• TNF- ⁇ and TNF- ⁇ are involved in growth regulation and interact with hemopoietic cells at several stages of differentiation, inhibiting proliferation of various types of precursor cells, and inducing proliferation of immature myelomonocytic cells (Porter, A., Tibtech 9:158-162 (1991)).
• mice deficient in TNF- ⁇ production show abnormal development of the peripheral lymphoid organs and morphological changes in spleen architecture (reviewed by Aggarwal, et al, Eur Cytokine Netw, 7:93-124 (1996)).
• the lymphoid organs the popliteal, inguinal, para-aortic, mesenteric, axillary and cervical lymph nodes failed to develop in
• TNF- ⁇ -/- mice TNF- ⁇ -/- mice.
• peripheral blood from TNF- ⁇ -/- mice contained a three fold reduction in white blood cells as compared to normal mice. Peripheral blood from
• TNF- ⁇ -/- mice contained four fold more B cells as compared to their normal counterparts. Further, TNF- ⁇ , in contrast to TNF- ⁇ , has been shown to induce proliferation of EB V-infected B cells. These results indicate that TNF- ⁇ is involved in lymphocyte development.
• TNF- ⁇ or TNF- ⁇ is their binding to specific cell surface or soluble receptors.
• TNF-RI Two distinct TNF receptors of approximately 55-KDa
• TNF-RII 75-KDa
• human and mouse cDNAs corresponding to both receptor types have been isolated and characterized (Loetscher, et al, Cell, 61:351 (1990)).
• Both TNF-Rs share the typical structure of cell surface receptors including extracellular, transmembrane and intracellular regions.
• TNF-RI and TNF-RII share 28% identity and are characterized by four repeated cysteine-rich motifs with significant intersubunit sequence homology.
• the majority of cell types and tissues appear to express both TNF receptors and both receptors are active in signal transduction, however, they are able to mediate distinct cellular responses. Further, TNF-RII was shown to exclusively mediate human T-cell proliferation by TNF as shown in PCT WO 94/09137.
• TNF-RI dependent responses include accumulation of C-FOS, IL-6, and manganese superoxide dismutase mRNA, prostaglandin E2 synthesis, IL-2 receptor and MHC class I and II cell surface antigen expression, growth inhibition, and cytotoxicity.
• TNF-RI also triggers second messenger systems such as phospholipase A, protein kinase C, phosphatidylcholine-specific phospholipase C and sphingomyelinase (Pfefferk, et al, Cell, 73:457-467 (1993)).
• TNF receptors Several interferons and other agents have been shown to regulate the expression of TNF receptors.
• Retinoic acid for example, has been shown to induce the production of TNF receptors in some cells type while down regulating production in other cells.
• TNF- ⁇ has been shown to affect the localization of both types of receptor. TNF- ⁇ induces internalization of TNF-RI and secretion of TNF-RII
• TNF-Rs both TNF-Rs
• yeast two hybrid system and co-precipitation and purification have been used to identify ligands which associate with both types of the TNF-Rs (reviewed by Aggarwal, et al., supra; Vandenabeele, et al, Trends in Cell Biol. 5:392-399 (1995)).
• Several proteins have been identified which interact with the cytoplasmic domain of a murine TNF-R. Two of these proteins appear to be related to the baculovirus inhibitor of apoptosis, suggesting a direct role for TNF-R in the regulation of programmed cell death.
• polypeptides that function as a receptor for cytokines and cytokine like molecules which are involved in the regulation of cellular processes, such as cell growth and differentiation since disturbances of such regulation may be involved in disorders relating to hemostasis, angiogenesis, tumor metastasis, cellular migration, or neurogenesis. Therefore, there is a need for identification and characterization of such human polypeptides which can play a role in detecting, preventing, ameliorating or correcting such disorders.
• the present invention provides nucleic acid molecules comprising a polynucleotide sequence encoding the TRI 2 receptor having the amino acid sequence shown in SEQ ID NO:2 or the amino acid sequence encoded by the cDNA deposited as American Type Culture Collection ("ATCC") Deposit No._203365.
• the present invention also relates to recombinant vectors, which include the isolated nucleic acid molecules of the present invention, and to host cells containing the recombinant vectors, as well as to methods of making such vectors and host cells and for using them for production of TR12 polypeptides by recombinant techniques.
• the invention further provides isolated TRI 2 polypeptides having an amino acid sequence encoded by a polynucleotide described herein and recombinant and synthetic methods for producing these polypeptides.
• diagnostic methods for detecting disorders relating to the polypeptides and therapeutic methods for treating such disorders.
• the invention further relates to screening methods for identifying binding partners of TRI 2 polypeptides.
• the present invention also provides a screening method for identifying compounds capable of enhancing or inhibiting a cellular response induced by TRI 2 polypeptides, which involves contacting cells which express TRI 2 polypeptides with the candidate compound, assaying a cellular response, and comparing the cellular response to a standard cellular response, the standard being assayed when contact is made in absence of the candidate compound; whereby, an increased cellular response over the standard indicates that the compound is an agonist and a decreased cellular response over the standard indicates that the compound is an antagonist.
• a screening assay for agonists and antagonists involves determining the effect a candidate compound has on the binding of ligands to TRI 2 polypeptides.
• the method involves contacting TRI 2 polypeptides with a ligand polypeptide and a candidate compound and determining whether ligand binding to the TRI 2 polypeptide is increased or decreased due to the presence of the candidate compound.
• the invention further provides a diagnostic method useful during diagnosis or prognosis of a disease states resulting from alterations in TRI 2 polypeptide expression.
• An additional aspect of the invention is related to a method for treating an individual in need of an increased level of a TRI 2 polypeptide activity in the body comprising administering to such an individual a composition comprising a therapeutically effective amount of isolated TRI 2 polypeptide of the invention, or an agonist thereof.
• a still further aspect of the invention is related to a method for treating an individual in need of a decreased level of a TRI 2 polypeptide activity in the body comprising, administering to such an individual a composition comprising a therapeutically effective amount of a TRI 2 antagonist.
• the invention additionally provides soluble forms of the polypeptides of the present invention.
• Soluble polypeptides comprise TRI 2 polypeptide sequences lacking a transmembrane domain. Such soluble forms of TRI 2 are useful as antagonists of the membrane bound forms of the receptor.
• Figures 1A-C shows the nucleotide sequence (SEQ ID NO:l) and the deduced amino acid sequence (SEQ ID NO: 2) of TRI 2.
• the predicted leader sequence is located at about amino acids 1-25 (underlined); amino acids from about 26 to about 164 are predicted to constitute the TRI 2 extracellular domain; amino acids from about 48 to about 71 are predicted to constitute the TRI 2 cysteine rich domain; amino acids from about 165 to about 181 are predicted to constitute the TRI 2 transmembrane domain; and amino acids from about 182 to about 430 are predicted to constitute the TR 12 intracellular domain .
• Figure 2 shows the regions of identity between the amino acid sequence of the TR12 protein (SEQ ID NO:2) and the translation product of the human OX40 Cell Surface Antigen (gi/913406) (SEQ ID NO:3), determined by BLAST analysis. Identical amino acids between the two polypeptides are shaded, while conservative amino acids are boxed. By examining the regions of amino acids shaded and/or boxed, the skilled artisan can readily identify conserved domains between the two polypeptides. These conserved domains are preferred embodiments of the present invention.
• Figure 3 shows an analysis of the TRI 2 amino acid sequence.
• Alpha, beta, turn and coil regions; hydrophilicity and hydrophobicity; amphipathic regions; flexible regions; antigenic index and surface probability are shown, and all were generated using the default settings of the recited computer program.
• the positive peaks indicate locations of the highly antigenic regions of the TR12 protein, i.e., regions from which epitope-bearing peptides of the invention can be obtained.
• isolated refers to material removed from its original environment (e.g., the natural environment if it is naturally occurring), and thus is altered “by the hand of man” from its natural state.
• an isolated polynucleotide could be part of a vector or a composition of matter, or could be contained within a cell, and still be “isolated” because that vector, composition of matter, or particular cell is not the original environment of the polynucleotide.
• isolated does not refer to genomic or cDNA libraries, whole cell total or mRNA preparations, genomic DNA preparations (including those separated by electrophoresis and transferred onto blots), isolated chromosomes, sheared whole cell genomic DNA preparations or other compositions where the art demonstrates no distinguishing features of the polynucleotide/sequences of the present invention.
• a "secreted" TRI 2 protein refers to a protein capable of being directed to the ER, secretory vesicles, or the extracellular space as a result of a signal sequence, as well as a TRI 2 protein released into the extracellular space without necessarily containing a signal sequence. If the TRI 2 secreted protein is released into the extracellular space, the TRI 2 secreted protein can undergo extracellular processing to produce a "mature" TR12 protein. Release into the extracellular space can occur by many mechanisms, including exocytosis and proteolytic cleavage.
• a TR12 "polynucleotide” refers to a molecule having a nucleic acid sequence contained in SEQ ID NO: l, the cDNA contained within the plasmid deposited with the ATCC (Deposit No. 203365), a nucleic acid sequence encoding a polypeptide sequence encoded by SEQ ID NO: l, or a nucleic acid sequence encoding a polypeptide sequence encoded by the deposited plasmid.
• the TR12 polynucleotide can contain the nucleotide sequence of the full length cDNA sequence, including the 5' and 3' untranslated sequences, the coding region, with or without the signal sequence, the secreted protein coding region, as well as fragments, epitopes, domains, and variants of the nucleic acid sequence.
• a TRI 2 "polypeptide" refers to a molecule having the translated amino acid sequence generated from the polynucleotide as broadly defined.
• the full length TRI 2 sequence identified as SEQ ID NO:l was generated by overlapping sequences of the deposited plasmid (contig analysis).
• a representative plasmid containing all or most of the sequence for SEQ ID NO:l was deposited with the American Type Culture Collection ("ATCC”) on October
• the ATCC is located at 10801 University Boulevard, Manassas, VA 20110-2209, USA.
• the ATCC deposit was made pursuant to the terms of the Budapest Treaty on the international recognition of the deposit of microorganisms for purposes of patent procedure.
• a TRI 2 "polynucleotide” also includes those polynucleotides capable of hybridizing, under stringent hybridization conditions, to sequences contained in, for example, SEQ ID NO:l, the complement thereof, a polynucleotide fragment described herein, or the cDNA within the deposited plasmid.
• “Stringent hybridization conditions” refers to an overnight incubation at 42 degree C in a solution comprising 50% formamide, 5x SSC (750 mM NaCl, 75 mM sodium citrate), 50 mM sodium phosphate (pH 7.6), 5x Denhardt's solution, 10% dextran sulfate, and 20 ⁇ g/ml denatured, sheared salmon sperm DNA, followed by washing the filters in O.lx SSC at about 65 degree C.
• nucleic acid molecules that hybridize to the TRI 2 polynucleotides at moderatetly high stringency hybridization conditions. Changes in the stringency of hybridization and signal detection are primarily accomplished through the manipulation of formamide concentration (lower percentages of formamide result in lowered stringency); salt conditions, or temperature.
• washes performed following stringent hybridization can be done at higher salt concentrations (e.g. 5X SSC).
• blocking reagents include Denhardt's reagent, BLOTTO, heparin, denatured salmon sperm DNA, and commercially available proprietary formulations.
• the inclusion of specific blocking reagents may require modification of the hybridization conditions described above, due to problems with compatibility.
• polynucleotide which hybridizes only to polyA+ sequences (such as any 3' terminal polyA+ tract of a cDNA shown in the sequence listing), or to a complementary stretch of T (or U) residues, would not be included in the definition of "polynucleotide,” since such a polynucleotide would hybridize to any nucleic acid molecule containing a poly (A) stretch or the complement thereof (e.g., practically any double-stranded cDNA clone generated using oligo dT as a primer).
• the TRI 2 polynucleotide can be composed of any polyribonucleotide or poly deoxyribonucleotide, which may be unmodified RNA or DNA or modified RNA or DNA.
• TRI 2 polynucleotides can be composed of single- and double- stranded DNA, DNA that is a mixture of single- and double-stranded regions, single- and double-stranded RNA, and RNA that is mixture of single- and double-stranded regions, hybrid molecules comprising DNA and RNA that may be single-stranded or, more typically, double-stranded or a mixture of single- and double-stranded regions.
• TRI 2 polynucleotides can be composed of triple-stranded regions comprising RNA or DNA or both RNA and DNA.
• TRI 2 polynucleotides may also contain one or more modified bases or DNA or RNA backbones modified for stability or for other reasons.
• Modified bases include, for example, tritylated bases and unusual bases such as inosine.
• polynucleotide embraces chemically, enzymatically, or metabolically modified forms.
• TRI 2 polypeptides can be composed of amino acids joined to each other by peptide bonds or modified peptide bonds, i.e., peptide isosteres, and may contain amino acids other than the 20 gene-encoded amino acids.
• the TRI 2 polypeptides may be modified by either natural processes, such as posttranslational processing, or by chemical modification techniques which are well known in the art. Such modifications are well described in basic texts and in more detailed monographs, as well as in a voluminous research literature. Modifications can occur anywhere in the TRI 2 polypeptide, including the peptide backbone, the amino acid side -chains and the amino or carboxyl termini.
• TR12 polypeptides may be branched , for example, as a result of ubiquitination, and they may be cyclic, with or without branching. Cyclic, branched, and branched cyclic TRI 2 polypeptides may result from posttranslation natural processes or may be made by synthetic methods.
• Modifications include acetylation, acylation, ADP-ribosylation, amidation, covalent attachment of flavin, covalent attachment of a heme moiety, covalent attachment of a nucleotide or nucleotide derivative, covalent attachment of a lipid or lipid derivative, covalent attachment of phosphotidylinositol, cross-linking, cyclization, disulfide bond formation, demethylation, formation of covalent cross-links, formation of cysteine, formation of pyroglutamate, formylation, gamma-carboxylation, glycosylation, GPI anchor formation, hydroxylation, iodination, methylation, myristoylation, oxidation, pegylation, proteolytic processing, phosphorylation, prenylation, racemization, selenoylation, sulfation, transfer-RNA mediated addition of amino acids to proteins such as arginylation, and ubiquitination. (See, for instance,
• the TRI 2 polypeptides of the invention may be in monomers or multimers (i.e., dimers, trimers, tetramers and higher multimers). Accordingly, the present invention relates to monomers and multimers of the TRI 2 polypeptides of the invention, their preparation, and compositions (preferably, pharmaceutical compositions) containing them.
• the polypeptides of the invention are monomers, dimers, trimers or tetramers.
• the multimers of the invention are at least dimers, at least trimers, or at least tetramers.
• Multimers encompassed by the invention may be homomers or heteromers.
• the term homomer refers to a multimer containing only TRI 2 polypeptides of the invention (including TR12 fragments, variants, splice variants, and fusion proteins, as described herein). These homomers may contain TR12 polypeptides having identical or different amino acid sequences.
• a homomer of the invention is a multimer containing only TRI 2 polypeptides having an identical amino acid sequence.
• a homomer of the invention is a multimer containing TRI 2 polypeptides having different amino acid sequences.
• the multimer of the invention is a homodimer (e.g., containing TR12 polypeptides having identical or different amino acid sequences) or a homotrimer (e.g., containing TR12 polypeptides having identical and/or different amino acid sequences).
• the homomeric multimer of the invention is at least a homodimer, at least a homotrimer, or at least a homotetramer.
• heteromer refers to a multimer containing one or more heterologous polypeptides (i.e., polypeptides of different proteins) in addition to the TRI 2 polypeptides of the invention.
• the multimer of the invention is a heterodimer, a heterotrimer, or a heterotetramer.
• the heteromeric multimer of the invention is at least a heterodimer, at least a heterotrimer, or at least a heterotetramer.
• Multimers of the invention may be the result of hydrophobic, hydrophilic, ionic and or covalent associations and/or may be indirectly linked, by for example, liposome formation.
• multimers of the invention such as, for example, homodimers or homotrimers, are formed when polypeptides of the invention contact one another in solution.
• heteromultimers of the invention such as, for example, heterotrimers or heterotetramers, are formed when polypeptides of the invention contact antibodies to the polypeptides of the invention (including antibodies to the heterologous polypeptide sequence in a fusion protein of the invention) in solution.
• multimers of the invention are formed by covalent associations with and/or between the TR12 polypeptides of the invention.
• covalent associations may involve one or more amino acid residues contained in the polypeptide sequence (e.g., that recited in SEQ ID NO:2, or contained in the polypeptide encoded by the clone HMUAN45).
• the covalent associations are cross-linking between cysteine residues located within the polypeptide sequences which interact in the native (i.e., naturally occurring) polypeptide.
• the covalent associations are the consequence of chemical or recombinant manipulation.
• such covalent associations may involve one or more amino acid residues contained in the heterologous polypeptide sequence in a TR12 fusion protein.
• covalent associations are between the heterologous sequence contained in a fusion protein of the invention (see, e.g., US Patent Number 5,478,925).
• the covalent associations are between the heterologous sequence contained in a TR12-Fc fusion protein of the invention (as described herein).
• covalent associations of fusion proteins of the invention are between heterologous polypeptide sequence from another TNFR family member that is capable of forming covalently associated multimers, such as for example, oseteoprotegerin (see, e.g., International Publication No. WO 98/49305, the contents of which are herein incorporated by reference in its entirety).
• the multimers of the invention may be generated using chemical techniques known in the art.
• polypeptides desired to be contained in the multimers of the invention may be chemically cross-linked using linker molecules and linker molecule length optimization techniques known in the art (see, e.g., US Patent Number 5,478,925, which is herein incorporated by reference in its entirety).
• linker molecules and linker molecule length optimization techniques known in the art
• multimers of the invention may be generated using techniques known in the art to form one or more inter-molecule cross-links between the cysteine residues located within the sequence of the polypeptides desired to be contained in the multimer (see, e.g., US Patent Number 5,478,925, which is herein incorporated by reference in its entirety).
• polypeptides of the invention may be routinely modified by the addition of cysteine or biotin to the C terminus or N-terminus of the polypeptide and techniques known in the art may be applied to generate multimers containing one or more of these modified polypeptides (see, e.g., US Patent Number 5,478,925, which is herein incorporated by reference in its entirety). Additionally, techniques known in the art may be applied to generate liposomes containing the polypeptide components desired to be contained in the multimer of the invention (see, e.g., US Patent Number 5,478,925, which is herein incorporated by reference in its entirety).
• multimers of the invention may be generated using genetic engineering techniques known in the art.
• polypeptides contained in multimers of the invention are produced recombinantly using fusion protein technology described herein or otherwise known in the art (see, e.g., US Patent Number 5,478,925, which is herein incorporated by reference in its entirety).
• polynucleotides coding for a homodimer of the invention are generated by ligating a polynucleotide sequence encoding a polypeptide of the invention to a sequence encoding a linker polypeptide and then further to a synthetic polynucleotide encoding the translated product of the polypeptide in the reverse orientation from the original C-terminus to the N-terminus (lacking the leader sequence) (see, e.g., US Patent Number 5,478,925, which is herein incorporated by reference in its entirety).
• recombinant techniques described herein or otherwise known in the art are applied to generate recombinant polypeptides of the invention which contain a transmembrane domain (or hyrophobic or signal peptide) and which can be incorporated by membrane reconstitution techniques into liposomes (see, e.g., US Patent Number 5,478,925, which is herein incorporated by reference in its entirety).
• SEQ LD NOT refers to a TR12 polynucleotide sequence while “SEQ ID NO:2” refers to a TR12 polypeptide sequence.
• TR12 polypeptide "having biological activity” refers to polypeptides exhibiting activity similar, but not necessarily identical to, an activity of a TRI 2 polypeptide, including mature forms, as measured in a particular biological assay, with or without dose dependency. In the case where dose dependency does exist, it need not be identical to that of the TR12 polypeptide, but rather substantially similar to the dose- dependence in a given activity as compared to the TR12 polypeptide (i.e., the candidate polypeptide will exhibit greater activity or not more than about 25-fold less and, preferably, not more than about tenfold less activity, and most preferably, not more than about three-fold less activity relative to the TRI 2 polypeptide.)
• Clone HMUAN45 was isolated from a myeloid progenitor cell line cDNA library. This clone contains the entire coding region encoding the polypeptide identified as SEQ LD NO:2.
• the deposited plasmid contains a cDNA having a total of 2701 nucleotides, which encodes a predicted open reading frame of 430 amino acid residues. (See Figures lA-C.)
• the open reading frame begins at a N-terminal methionine located at nucleotide position 244, and ends at a stop codon at nucleotide position 1533.
• the predicted molecular weight of the TRI 2 protein is 46 kDa.
• TRI 2 is expressed in peripheral blood lymphocytes, spleen, colon, thymus, testis, and skeletal muscle tissues, a pattern consistent TR12's involvement in regulation of the immune system, hemostasis, angiogenesis, tumor metastasis, cellular migration, and or neurogenesis.
• SEQ ID NO:2 was found to be homologous to members of the Tumor Necrosis Factor Receptor (TNFR) family. Particularly, SEQ ID NO:2 contains domains homologous to the translation product of the human mRNA for OX40 Cell Surface Antigen (gi/913406) ( Figure 2) (SEQ ID NO:3), including the following conserved domains: (a) a predicted transmembrane domain located at about amino acids 165-181; (b) a predicted extracellular domain located at about amino acids 26-164; and (c) a predicted cytoplasmic tail domain located at about amino acids 182- 430. These polypeptide fragments of TR12 are specifically contemplated in the present invention.
• OX40 Cell Surface Antigen (gi/913406) is thought to be important as a receptor for OX40L/GP34 cytokines, the homology between OX40 Cell Surface Antigen (gi/913406) and TRI 2 suggests that TRI 2 may also function as a receptor for cytokines and cytokine like molecules which are involved in the regulation of cellular processes, such as cell growth and differentiation.
• the encoded polypeptide has a predicted leader sequence located at about amino acids 1-25. (See Figures lA-C.) Also shown in Figures 1A-C, the predicted mature protein encompasses about amino acids 26 to 430, while the predicted extracellular domain of TRI 2 encompasses about amino acids 26-164.
• the TRI 2 nucleotide sequence identified as SEQ LD NOT was assembled from partially homologous ("overlapping") sequences obtained from the deposited plasmid. The overlapping sequences were assembled into a single contiguous sequence of high redundancy resulting in a final sequence identified as SEQ ID NO: 1.
• SEQ ID NOT and the translated SEQ LD NO:2 are sufficiently accurate and otherwise suitable for a variety of uses well known in the art and described further below.
• SEQ LD NOT have uses that include, but are not limited to, designing nucleic acid hybridization probes that will detect nucleic acid sequences contained in SEQ LD NO: 1 or the cDNA contained in the deposited plasmid. These probes will also hybridize to nucleic acid molecules in biological samples, thereby enabling a variety of forensic and diagnostic methods of the invention.
• polypeptides identified from SEQ LD NO:2 may be used to generate antibodies which bind specifically to TRI 2 .
• DNA sequences generated by sequencing reactions can contain sequencing errors.
• the errors exist as misidentified nucleotides, or as insertions or deletions of nucleotides in the generated DNA sequence.
• the erroneously inserted or deleted nucleotides cause frame shifts in the reading frames of the predicted amino acid sequence.
• the predicted amino acid sequence diverges from the actual amino acid sequence, even though the generated DNA sequence may be greater than 99.9% identical to the actual DNA sequence (for example, one base insertion or deletion in an open reading frame of over 1000 bases).
• the present invention provides not only the generated nucleotide sequence identified as SEQ ID NO: 1 and the predicted translated amino acid sequence identified as SEQ LD NO:2, but also a sample of plasmid DNA containing a human cDNA of TR12 deposited with the ATCC.
• the nucleotide sequence of the deposited TRI 2 plasmid can readily be determined by sequencing the deposited plasmid in accordance with known methods. The predicted TRI 2 amino acid sequence can then be verified from the deposit.
• amino acid sequence of the protein encoded by the deposited plasmid can also be directly determined by peptide sequencing or by expressing the protein in a suitable host cell containing the deposited human TRI 2 cDNA, collecting the protein, and determining its sequence.
• the present invention also relates to the TR12 gene corresponding to SEQ LD
• the TR12 gene can be isolated in accordance with known methods using the sequence information disclosed herein. Such methods include, but are not limited to, preparing probes or primers from the disclosed sequence and identifying or amplifying the TRI 2 gene from appropriate sources of genomic material. Also provided in the present invention are species homologs of TRI 2. Species homologs may be isolated and identified by making suitable probes or primers from the sequences provided herein and screening a suitable nucleic acid source for the desired homologue.
• the TRI 2 polypeptides can be prepared in any suitable manner.
• Such polypeptides include isolated naturally occurring polypeptides, recombinantly produced polypeptides, synthetically produced polypeptides, or polypeptides produced by a combination of these methods. Means for preparing such polypeptides are well understood in the art.
• the TRI 2 polypeptides of the invention may be in the form of the secreted protein, including the mature form, or may be a part of a larger protein, such as a fusion protein (see below). It is often advantageous to include an additional amino acid sequence which contains secretory or leader sequences, pro-sequences, sequences which aid in purification, such as multiple histidine residues, or an additional sequence for stability during recombinant production. As indicated, the present invention also provides polynucleotides encoding the mature form(s) of the TRI 2 polypeptides of the present invention and the polypeptide sequences encoded thereby.
• proteins secreted by mammalian cells have a signal or secretory leader sequence which is cleaved from the mature protein once export of the growing protein chain across the rough endoplasmic reticulum has been initiated.
• Most mammalian cells and even insect cells cleave secreted proteins with the same specificity.
• cleavage of a secreted protein is not entirely uniform, which results in two or more mature species on the protein.
• the cleavage specificity of a secreted protein is ultimately determined by the primary structure of the complete protein, that is, it is inherent in the amino acid sequence of the polypeptide.
• the present invention provides a nucleotide sequence encoding the mature TRI 2 polypeptide having the amino acid sequence encoded by the cDNA contained in the plasmid identified as ATCC Deposit No. 203365, and as shown in Figures 1A-C (SEQ ID NO: 2).
• the mature TRI 2 polypeptide having the amino acid sequence encoded by the cDNA contained in the plasmid identified as ATCC Deposit No. 203365 is meant the mature form(s) of the TR12 polypeptide produced by expression in a mammalian cell (e.g., COS cells, as described below) of the complete open reading frame encoded by the human DNA sequence in the deposited plasmid.
• the mature TRI 2 polypeptide having the amino acid sequence encoded by the cDNA contained in ATCC Deposit No. 203365 may or may not differ from the predicted mature TR12 protein shown in SEQ ID NO:2 (amino acids from about 26 to about 430) depending on the accuracy of the predicted cleavage site based on computer analysis.
• PSORT is an expert system for predicting the cellular location of a protein based on the amino acid sequence. As part of this computational prediction of localization, the methods of McGeoch and von Heinje are incorporated. The analysis by the PSORT program predicted the cleavage site between amino acids 25 and 26 in SEQ LD NO:2. Thereafter, the complete amino acid sequences were further analyzed by visual inspection, applying a simple form of the (-1,-3) rule of von Heinje. von Heinje, supra. Thus, the leader sequence for the TRI 2 protein is predicted to consist of amino acid residues from about 1 to about 25 in SEQ LD NO:2, while the mature TRI 2 protein is predicted to consist of residues from about 26 to 430 in SEQ ID NO:2.
• the predicted TRI 2 polypeptide encoded by the deposited cDNA comprises about 430 amino acids, but may be anywhere in the range of 420 to 440 amino acids; and the predicted leader sequence of this protein is about 25 amino acids, but may be anywhere in the range of about 15 to about 35 amino acids.
• the domains described herein have been predicted by computer analysis, and accordingly, that depending on the analytical criteria used for identifying various functional domains, the exact "address" of, for example, the extracelluar domain, intracelluar domain, and transmembrane domain of TR12 may differ slightly.
• the exact location of the TRI 2 extracellular domain in Figures 1 A-C may vary slightly (e.g., the address may "shift" by about 1 to about 20 residues, more likely about 1 to about 5 residues) depending on the criteria used to define the domain.
• the invention further provides polypeptides having various residues deleted from the N-terminus and/or C-terminus of the complete TRI 2, including polypeptides lacking one or more amino acids from the N-termini of the extracellular domain described herein, which constitute soluble forms of the extracellular domain of the TRI 2 polypeptides.
• TRI 2 polypeptides are preferably provided in an isolated form, and preferably are substantially purified.
• a recombinantly produced version of a TRI 2 polypeptide, including the secreted polypeptide, can be substantially purified by the one-step method described in Smith and Johnson, Gene 67:31-40 (1988).
• TR12 polypeptides also can be purified from natural or recombinant sources using antibodies of the invention raised against the TRI 2 protein in methods which are well known in the art.
• the present invention is further directed to fragments of the isolated nucleic acid molecules described herein. By a fragment of an isolated nucleic acid molecule having, for example, the nucleotide sequence of the deposited cDNA (ATCC Deposit No.
• nucleotide sequence encoding the polypeptide sequence encoded by the deposited cDNA is intended fragments at least 15 nt, and more preferably at least about 20 nt, still more preferably at least about 30 nt, and even more preferably, at least about 40, 50, 100, 150, 200, 250, 300, 325, 350, 375, 400, 450, 500, 550, or 600 nt in length.
• fragments have numerous uses that include, but are not limited to, diagnostic probes and primers as discussed herein.
• larger fragments such as those of 501-1500 nt in length are also useful according to the present invention as are fragments corresponding to most, if not all, of the nucleotide sequences of the deposited cDNA (ATCC Deposit No. 203365) or as shown in Figures 1A-C (SEQ ID NOT).
• a fragment at least 20 nt in length for example, is intended fragments which include 20 or more contiguous bases from, for example, the nucleotide sequence of the deposited cDNA, or the nucleotide sequence as shown in Figures 1A-C (SEQ LD NOT).
• the polynucleotides fragments of the invention described above comprise, or alternatively consist of, nucleotides 140 to 160, 300 to 320, 470 to 490, and or 545 to 570 of the nucleotide sequence shown in Figures 1 A-C (SEQ ID NOT)
• representative examples of TRI 2 polynucleotide fragments include, for example, fragments that comprise or alternatively consist of, a sequence from about nucleotide number 1-50, 51-100, 101-150, 140-160, 151-200, 201-250, 251-300, 300-320, 301-350, 351-400, 401-450, 451-500, 470-490, 501-550, 545-570, 551- 600, 651-700, 701-750, 751-800, 800-850, 851-900, 901-950, 951
• the polynucleotide fragments of the invention comprise, or alternatively consist of, a sequence from nucleotide about 244 to about 318, about 319 to about 735, about 385 to about 456, about 736 to about 786, about 787 to about 1533 of SEQ ID NOT, or the complementary strand thereto, or the cDNA contained in the deposited plasmid.
• "about” includes the particularly recited ranges, and ranges larger or smaller by several (5, 4, 3, 2, or 1) nucleotides, at either terminus or at both termini. Polypeptides encoded by these polynucleotides are also encompassed by the invention.
• the polynucleotide fragments of the invention encode a polypeptide which demonstrates a TRI 2 functional activity.
• a polypeptide demonstrating a TRI 2 "functional activity” is meant, a polypeptide capable of displaying one or more known functional activities associated with a full-length (complete) TR12 protein.
• Such functional activities include, but are not limited to, biological activity, antigenicity [ability to bind (or compete with a TRI 2 polypeptide for binding) to an anti-TR12 antibody], immunogenicity (ability to generate antibody which binds to a TRI 2 polypeptide), ability to form multimers with TRI 2 polypeptides of the invention, and ability to bind to a receptor or ligand for a TRI 2 polypeptide.
• the functional activity of TRI 2 polypeptides, and fragments, variants derivatives, and analogs thereof can be assayed by various methods.
• various immunoassays known in the art can be used, including but not limited to, competitive and non-competitive assay systems using techniques such as radioimmunoassays, ELISA (enzyme linked immunosorbent assay), "sandwich” immunoassays, immunoradiometric assays, gel diffusion precipitation reactions, immunodiffusion assays, in situ immunoassays (using colloidal gold, enzyme or radioisotope labels, for example), western blots, precipitation reactions, agglutination assays (e.g., gel agglutination assays, hemagglutination assays), complement fixation assays, immunofluorescence assays, protein A assays, and immunoelectrophoresis assays, etc.
• competitive and non-competitive assay systems using techniques such as radioimmunoassays, ELISA (enzyme linked immunosorbent assay), "sandwich” immunoassays, immunoradiometric
• antibody binding is detected by detecting a label on the primary antibody.
• the primary antibody is detected by detecting binding of a secondary antibody or reagent to the primary antibody.
• the secondary antibody is labeled. Many means are known in the art for detecting binding in an immunoassay and are within the scope of the present invention.
• binding can be assayed, e.g., by means well-known in the art, such as, for example, reducing and non-reducing gel chromatography, protein affinity chromatography, and affinity blotting. See generally, Phizicky, E., et al., Microbiol. Rev. 59:94-123 (1995).
• physiological correlates of TR12 binding to its substrates can be assayed.
• assays described herein may routinely be applied to measure the ability of TRI 2 polypeptides and fragments, variants derivatives and analogs thereof to elicit TRI 2 related biological activity (either in vitro or in vivo).
• Other methods will be known to the skilled artisan and are within the scope of the invention.
• Preferred polynucleotide fragments of the present invention include polynucleotides encoding a member selected from the group: a polypeptide comprising or alternatively, consisting of, the TR12 extracellular domain (amino acid residues from about 1 to about 164 in Figures 1A-C SEQ ID NO:2); a polypeptide comprising or alternatively consisting of, the mature TRI 2 extracellular domain (amino acid residues from about 26 to about 164 in Figures 1A-1C and SEQ LD NO:2); a polypeptide comprising or alternatively, consisting of, the TR12 cysteine rich domain (amino acid residues from about 48 to about 71 in Figures 1A-C and SEQ ID NO:2); a polypeptide comprising or alternatively, consisting of, the TRI transmembrane domain (amino acid residues from about 165 to about 181 in Figures 1A-C and SEQ LD NO:2); and a polypeptide comprising or alternatively,
• amino acid residues constituting these domains may vary slightly (e.g., by about 1 to 15 amino acid residues) depending on the criteria used to define each domain.
• Polypeptides encoded by these polynucleotides are also encompassed by the invention.
• Preferred polynucleotide fragments of the invention encode a full-length TRI 2 polypeptide lacking the nucleotides encoding the amino terminal methionine (nucleotides 244 to 246 in SEQ ID NOT), as it is known that the methionine is cleaved naturally and such sequences may be useful in genetically engineering TRI 2 expression vectors.
• Polypeptides encoded by such polynucleotides are also contemplated by the invention.
• Preferred polynucleotide fragments of the present invention further include polynucleotides encoding epitope-bearing portions of the TRI 2 protein.
• such polynucleotide fragments of the present invention include, but are not limited to, polynucleotides encoding: a polypeptide comprising amino acid residues from 32 to 47, 50 to 55, 61 to 73, 84 to 97, 117 to 133, 138 to 160, 185 to 192, 195 to 210, 212 to 224, 231 to 241, 243 to 254, 256 to 270, 275 to 280, 290 to 304, 324 to 342, 354 to 363, 365 to 371, 373 to 393, 397 to 419, and 423 to 428 in Figures 1A-C (SEQ ID NO: 2).
• polypeptide fragments are antigenic regions of the TR12 protein.
• “about” includes the particularly recited range, and ranges larger or smaller by several (5, 4, 3, 2, or 1) nucleotides at either or at both termini. Methods for determining other such epitope-bearing portions of the TRI 2 protein are described in detail below. Polypeptides encoded by these polynucleotides are also encompassed by the invention. It is believed that of the extracellular cysteine rich domain of TRI 2 disclosed in
• Figures 1A-C is important for interactions between TR12 and its ligands. Accordingly, specific embodiments of the invention are directed to polynucleotides encoding polypeptides which comprise, or alternatively consist of, the amino acid sequence of amino acid residues 48 to 71 of SEQ LD NO:2. Polypeptides encoded by these polynucleotides are also encompassed by the invention.
• polynucleotides of the invention encode polypeptides having functional attributes of TR12.
• Preferred embodiments of the invention in this regard include polynucleotides encoding polypeptide fragments that comprise, or alternatively consist of, alpha-helix and alpha-helix forming regions ("alpha-regions"), beta-sheet and beta-sheet forming regions ("beta-regions"), turn and turn-forming regions ("turn-regions"), coil and coil-forming regions ("coil-regions”), hydrophilic regions, hydrophobic regions, alpha amphipathic regions, beta amphipathic regions, flexible regions, surface-forming regions and high antigenic index regions of TR12 (see Figure 3 and/or Table I). Polypeptides encoded by these polynucleotides are also encompassed by the invention.
• Certain preferred regions in these regards are set out in Figure 3, but may, as shown in Table I, be represented or identified by using tabular representations of the data presented in Figure 3.
• the DNA*STAR computer algorithm used to generate Figure 3 was used to present the data in Figure 3 in a tabular format (See Table I).
• the tabular format of the data in Figure 3 may be used to easily determine specific boundaries of a preferred region.
• the above-mentioned preferred regions set out in Figure 3 and in Table I include, but are not limited to, regions of the aforementioned types identified by analysis of the amino acid sequence set out in Figure 1.
• such preferred regions include Garnier-Robson alpha-regions, beta-regions, turn-regions, and coil-regions, Chou-Fasman alpha-regions, beta-regions, and turn-regions, Kyte-Doolittle hydrophilic regions and Hopp- Woods hydrophobic regions, Eisenberg alpha- and beta-amphipathic regions, Karplus-Schulz flexible regions, Jameson- Wolf regions of high antigenic index and Emini surface-forming regions.
• Figure 3 and or Table I was generated using the various modules and algorithms of the DNA*STAR set on default parameters.
• the data presented in columns VIII, IX, XIII, and XIV of Table I can be used to determine regions of TRI 2 which exhibit a high degree of potential for antigenicity. Regions of high antigenicity are determined from the data presented in columns VIII, XII, XIII, and XV by choosing values which represent regions of the polypeptide which are likely to be exposed on the surface of the polypeptide in an environment in which antigen recognition may occur in the process of initiation of an immune response.
• Val 103 B C 0.29 0.49 . * . -0.40 0.40
• Trp 113 B 0.08 0.91 -0.40 0.22
• Trp 405 B 1.57 -0.49 . * p 2.16 1.77
• the invention provides an isolated nucleic acid molecule comprising a polynucleotide which hybridizes to a portion of the polynucleotide in a nucleic acid molecule of the invention described above, for instance, the cDNA contained in the plasmid deposited as ATCC Deposit No. 203365, the coding sequence of SEQ ID NOT, or the complementary strand thereto, or one of the polynucleotide fragments described herein.
• a polynucleotide which hybridizes to a "portion" of a polynucleotide is intended a polynucleotide (either DNA or RNA) hybridizing to at least about 15 nucleotides (nt), and more preferably at least about 20 nt, still more preferably at least about 30 nt, and even more preferably about 30-70 nt of the reference polynucleotide.
• nt nucleotides
• the polynucleotides of the invention are less than 100000 kb, 50000 kb, 10000 kb, 1000 kb, 500 kb, 400 kb, 350 kb, 300 kb, 250 kb, 200 kb, 175 kb, 150 kb, 125 kb, 100 kb, 75 kb, 50 kb, 40 kb, 30 kb, 25 kb, 20 kb, 15 kb, 10 kb, 7.5 kb, or 5 kb in length.
• polynucleotides of the invention comprise at least 15, at least 30, at least 50, at least 100, or at least 250, at least 500, or at least 1000 contiguous nucleotides of TR12 coding sequence, but consist of less than or equal to 1000 kb, 500 kb, 250 kb, 200 kb, 150 kb, 100 kb, 75 kb, 50 kb, 30 kb, 25 kb, 20 kb, 15 kb, 10 kb, or 5 kb of genomic DNA that flanks the 5' or 3' coding nucleotide set forth in Figures 1A-C (SEQ ID NOT).
• polynucleotides of the invention comprise at least 15, at least 30, at least 50, at least 100, or at least 250, at least 500, or at least 1000 contiguous nucleotides of TRI 2 coding sequence, but do not comprise all or a portion of any TRI 2 intron.
• the nucleic acid comprising TRI 2 coding sequence does not contain coding sequences of a genomic flanking gene (i.e., 5' or 3' to the TR12 gene in the genome).
• the polynucleotides of the invention do not contain the coding sequence of more than 1000, 500, 250, 100, 50, 25, 20, 15, 10, 5, 4, 3, 2, or 1 genomic flanking gene(s).
• polynucleotides of the present invention which encode a TRI 2 polypeptide may include, but are not limited to the-coding sequence for the mature polypeptide, by itself; the coding sequence for the mature polypeptide and additional sequences, such as those encoding a leader or secretory sequence, such as a pre-, or pro- or prepro- protein sequence; the coding sequence of the mature polypeptide, with or without the aforementioned additional coding sequences, together with additional, non-coding sequences, including for example, but not limited to introns and non-coding 5' and 3' sequences, such as the transcribed, non-translated sequences that play a role in transcription, mRNA processing - including splicing and polyadenylation signals, for example - ribosome binding and stability of mRNA: additional coding sequence which codes for additional amino acids, such as those which provide additional functionalities.
• the polypeptide may be fused to a marker sequence, such as a peptide, which facilitates purification of the fused polypeptide.
• the marker sequence is a hexa-histidine peptide, such as the tag provided in a pQE vector (Qiagen, Inc.), among others, many of which are commercially available.
• hexa-histidine provides for convenient purification of the fusion protein.
• the "HA” tag is another peptide useful for purification which corresponds to an epitope derived from the influenza hemagglutinin protein, which has been described by Wilson et al, Cell 37:161-11 (1984).
• other such fusion proteins include the TRI 2 receptor fused to an Fc domain at the N- or C-terminus.
• Protein fragments of the present invention include polypeptides comprising or alternatively, consisting of, an amino acid sequence contained in SEQ ID NO:2, encoded by the cDNA contained in the deposited plasmid, or encoded by polynucleotides which hybridize (e.g., under stringent hybridization conditions) to the nucleotide sequence contained in the deposited plasmid, or shown in Figures 1A-C (SEQ ID NOT) or the complementary strand thereto. Protein fragments may be "free- standing," or comprised within a larger polypeptide of which the fragment forms a part or region, most preferably as a single continuous region.
• polypeptide fragments of the invention include, for example, fragments from about amino acid number 1-20, 21-40, 41-60, 61-80, 81-100, 102-120, 121-140, 141-160, 161-180, 181-200, 201-220, 221-240, 241-260, 261-280, 281-300, 301-320, 321- 340, 341-360, 361-380, 381-400, and or 401 to 430, of SEQ ID NO:2.
• polypeptide fragments can be at least about 20, 30, 40, 50, 60, 70, 80, 90, 100, 1 10, 120, 130, 140, or 150 amino acids in length.
• polypeptide fragments of the invention include, for example, fragments that comprise or alternatively, consist of from about amino acid residues: 1 to 25, 15 to 25, 26 to 50, 51 to 75, 75 to 85, 76 to 100, 100 to 110, 101 to 124, 125 to 164, 165 to 181, 182 to 250, 251 to 300, 301 to 350, 351 to 400, and/or 401 to 430 of SEQ ID NO:2.
• polypeptide fragments can be at least about 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 175 or 200 amino acids in length.
• “about” includes the particularly recited ranges or sizes, and ranges or sizes larger or smaller by several (5, 4, 3, 2, or 1) amino acids, at either extreme or at both extremes.
• Polynucleotides encoding these polypeptides are also encompassed by the invention.
• the polypeptide fragments of the invention comprise, or alternatively consist of, one or more TRI 2 domains.
• Preferred polypeptide fragments of the present invention include a member selected from the group: (a) a polypeptide comprising, or alternatively, consisting of, the TRI 2 extracellular domain (predicted to constitute amino acid residues from about 1 to about 164 of Figures 1A-C and SEQ ID NO:2); (b) a polypeptide comprising, or alternatively, consisting of, the mature TRI 2 extracellular domain (predicted to constitute amino acid residues from about 26 to about 164 of Figure 1A-C and SEQ ID NO:2); (c) a polypeptide comprising, or alternatively, consisting of, the TRI 2 cysteine rich domain (predicted to constitute amino acid residues from about 48 to about 71 of Figures 1A-C, and SEQ ID NO:2); (d) a polypeptide comprising, or alternatively, consisting of, the TR12 transmembrane domain (predicted to constitute amino acid residues from about 165 to about 181 of Figures 1A-C and SEQ ID
• polypeptide fragments of the invention comprise, or alternatively consist of, amino acid residues 48 to 71 of SEQ ID NO:2. Polynucleotides encoding these polypeptides are also encompassed by the invention.
• the polynucleotides of the invention encode functional attributes of TRI 2.
• Preferred embodiments of the invention in this regard include fragments that comprise one, two, three, four, five or more alpha-helix and alpha-helix forming regions ("alpha-regions"), beta-sheet and beta-sheet forming regions ("beta-regions"), turn and turn-forming regions ("turn-regions”), coil and coil-forming regions ("coil-regions”), hydrophilic regions, hydrophobic regions, alpha amphipathic regions, beta amphipathic regions, flexible regions, surface-forming regions and high antigenic index regions of TRI 2.
• Polynucleotides encoding these polypeptides are also encompassed by the invention.
• the data representing the structural or functional attributes of TRI 2 set forth in Figure 1 and/or Table I was generated using the various modules and algorithms of the DNA*STAR set on default parameters.
• the data presented in columns VIII, IX, XIII, and XIV of Table I can be used to determine regions of TRI 2 which exhibit a high degree of potential for antigenicity. Regions of high antigenicity are determined from the data presented in columns VIII, IX, XIII, and/or IV by choosing values which represent regions of the polypeptide which are likely to be exposed on the surface of the polypeptide in an environment in which antigen recognition may occur in the process of initiation of an immune response.
• the above-mentioned preferred regions set out in Figure 3 and in Table I include, but are not limited to, regions of the aforementioned types identified by analysis of the amino acid sequence set out in Figure 1.
• such preferred regions include Gamier-Robson alpha-regions, beta-regions, turn-regions, and coil-regions, Chou-Fasman alpha-regions, beta-regions, and coil-regions, Kyte-Doolittle hydrophilic regions and hydrophobic regions, Eisenberg alpha- and beta-amphipathic regions, Karplus-Schulz flexible regions, Emini surface-forming regions and Jameson-Wolf regions of high antigenic index.
• highly preferred fragments in this regard are those that comprise regions of TRI 2 that combine several structural features, such as two, three, four, five or more of the features set out above.
• the invention also encompassed fragments corresponding to N-terminus and/or C-terminus deletions of the amino acid sequence depicted in Figures 1A-C (SEQ ID NO:2) or the amino acid sequence encoded by the cDNA in the deposited plasmid.
• the present invention further provides polypeptides having one or more residues deleted from the amino terminus of the TRI 2 amino acid sequence shown in Figures 1A-C, up to the serine residue at position number 426 and polynucleotides encoding such polypeptides.
• the present invention provides TRI 2 polypeptide described by the general formula m-430, where m is an integer from 2 to 426, where m corresponds to the position of the amino acid residue identified in SEQ ID NO:2.
• N-terminal deletions of the TR12 polypeptide of the invention shown as SEQ ID NO:2 include polypeptides comprising, or alternatively consisting of, the amino acid sequence of residues: K-2 to 1-430; P-3 to I- 430; S-4 to 1-430; L-5 to 1-430; L-6 to 1-430; C-7 to 1-430; R-8 to 1-430; P-9 to 1-430; L-10 to 1-430; S-l 1 to 1-430; C-12 to 1-430; F-13 to 1-430; L-14 to 1-430; M-15 to I- 430; L-16 to 1-430; L-17 to 1-430; P-18 to 1-430; W-19 to 1-430; P-20 to 1-430; L-21 to 1-430; A-22 to 1-430; T-23 to 1-430; L-24 to 1-430; T-25 to 1-430; S-26 to 1-430; T-27 to 1-430; T-28 to 1-430; L-29 to 1-430; W-30 to 1-430; Q-31 to 1-430; C-32 to 1-430; P- 33 to 1-
• polypeptides are also encompassed by the invention.
• especially preferred embodiments of the invention are N-terminal deletions of the mature extracellular or soluble portion of the TR-12 polypeptide and comprise, or alternatively consist of, the amino acid sequence of residues: S-26 to A- 164; T-27 to A- 164; T-28 to A- 164; L-29 to A- 164; W-30 to A- 164; Q-31 to A- 164; C- 32 to A-164; P-33 to A-164; P-34 to A-164; G-35 to A-164; E-36 to A-164; E-37 to A- 164; P-38 to A-164; D-39 to A-164; L-40 to A-164; D-41 to A-164; P-42 to A-164; G- 43 to A-164; Q-44 to A-164; G-45 to A-164; T-46 to A-164; L-47 to A-164;
• deletion of one or more amino acids from the C-terminus of a protein results in modification of loss of one or more biological functions of the protein
• other functional activities e.g., biological activities, ability to multimerize, ability to bind TRI 2 ligand
• the ability of the shortened TR12 mutein to induce and/or bind to antibodies which recognize the complete or mature forms of the polypeptide generally will be retained when less than the majority of the residues of the complete or mature polypeptide are removed from the C-terminus.
• Whether a particular polypeptide lacking C-terminal residues of a complete polypeptide retains such immunologic activities can readily be determined by routine methods described herein and otherwise known in the art. It is not unlikely that an TRI 2 mutein with a large number of deleted C-terminal amino acid residues may retain some biological or immunogenic activities. In fact, peptides composed of as few as six TR12 amino acid residues may often evoke an immune response.
• the present invention further provides polypeptides having one or more residues deleted from the carboxy terminus of the amino acid sequence of the TR12 polypeptide shown in Figures 1A-C (SEQ ID NO:2).
• C-terminal deletions of the TRI 2 polypeptide can also be described by the general formula 1-n, where n is an integer from 2 to 429, where n corresponds to the position of amino acid residue identified in SEQ ID NO:2.
• C- terminal deletions of the TR12 polypeptide of the invention shown as SEQ ID NO:2 include polypeptides comprising, or alternatively, consisting of, the amino acid sequence of residues: M-l to V-429; M-l to L-428; M-l to N-427; M-l to S-426; M-l to E-425; M-l to S-424; M-l to L-423; M-l to R-422; M-l to V-421; M-l to V-420; M-l to Y-419; M-l to R-418; M-l to N-417; M-l to E-416; M-l to E-415; M-l to A- 414; M-l to K-413; M-l to N-4
• especially preferred embodiments of the invention are C-terminal deletions of the mature extracellular or soluble portion of the TR-12 polypeptide and comprise, or alternatively consist of, the amino acid sequence of residues: S-26 to Y- 163; S-26 to Q-162; S-26 to A-161; S-26 to A-160; S-26 to T-159; S-26 to E-158; S- 26 to E-157; S-26 to P-156; S-26 to G-155; S-26 to G-154; S-26 to A-153; S-26 to R- 152; S-26 to T-151; S-26 to G-150; S-26 to N-149; S-26 to G-148; S-26 to P-147; S- 26 to Q-146; S-26 to R-145; S-26 to T-144; S-26 to E-143; S-26 to G-142; S-26 to G- 141; S-26 to S-140; S-26 to S-139; S-26
• any of the above listed N- or C-terminal deletions can be combined to produce a N- and C-terminal deleted TRI 2 polypeptide.
• the invention also provides polypeptides having one or more amino acids deleted from both the amino and the carboxyl termini, which may be described generally as having residues m-n of SEQ ID NO:2, where n and m are integers as described above. Polynucleotides encoding these polypeptides are also encompassed by the invention.
• nucleotide sequence encoding a polypeptide consisting of a portion of the complete TRI 2 amino acid sequence encoded by the cDNA contained in ATCC Deposit No. 203365, where this portion excludes any integer of amino acid residues from 1 to about 420 amino acids from the amino terminus of the complete amino acid sequence encoded by the cDNA contained in ATCC Deposit No. 203365, or any integer of amino acid residues from 1 to about 420 amino acids from the carboxy terminus, or any combination of the above amino terminal and carboxy terminal deletions, of the complete amino acid sequence encoded by the cDNA plasmid contained in ATCC Deposit No. 203365.
• Polynucleotides encoding all of the above deletion mutant polypeptide forms also are provided.
• the present invention is also directed to proteins containing polypeptides at least 90%, 95%, 96%, 97%, 98% or 99% identical to the TR12 polypeptide sequence set forth herein m-n.
• the application is directed to proteins containing polypeptides at least 90%, 95%, 96%, 97%, 98% or 99% identical to polypeptides having the amino acid sequence of the specific TRI 2 N- and C-terminal deletions recited herein. Polynucleotides encoding these polypeptides are also encompassed by the invention.
• Biologically active fragments are those exhibiting activity similar, but not necessarily identical, to an activity of the TRI 2 polypeptide.
• the biological activity of the fragments may include an improved desired activity, or a decreased undesirable activity.
• the invention provides polypeptides comprising epitope-bearing portions of the TRI 2 polypeptides of the present invention.
• These epitopes are immunogenic and/or antigenic epitopes of the polypeptides of the present invention.
• An "immunogenic epitope” is defined as a part of a protein that elicits an antibody response in vivo when the whole polypeptide of the present invention, or fragment thereof, is the immunogen.
• a region of a polypeptide to which an antibody can bind is defined as an "antigenic determinant" or "antigenic epitope.”
• the number of in vivo immunogenic epitopes of a protein generally is less than the number of antigenic epitopes.
• antibodies can be made to any antigenic epitope, regardless of whether it is an immunogenic epitope, by using methods such as phage display. See e.g., Petersen G. et al. (1995) Mol. Gen. Genet. 249:425-431. Therefore, included in the present invention are both immunogenic epitopes and antigenic epitopes.
• Table 1 A list of exemplified amino acid sequences comprising immunogenic epitopes are shown in Table 1. It is pointed out that Table 1 only lists amino acid residues comprising epitopes predicted to have the highest degree of antigenicity using the algorithm of Jameson and Wolf, (1988) Comp. Appl. Biosci. 4: 181-186 (said references incorporated by reference in their entireties). The Jameson -Wolf antigenic analysis was performed using the computer program PROTEAN, using default parameters (Version 3.1 1 for the Power Macintosh, DNASTAR, Inc., 1228 South Park Street Madison, WI). Portions of polypeptides not listed in Table 1 are not considered non-immunogenic.
• the immunogenic epitopes of Table 1 is an exemplified list, not an exhaustive list, because other immunogenic epitopes are merely not recognized as such by the particular algorithm used.
• Amino acid residues comprising other immunogenic epitopes may be routinely determined using algorithms similar to the Jameson-Wolf analysis or by in vivo testing for an antigenic response using methods known in the art. See, e.g., Geysen et al., supra; U.S. Patents 4,708,781; 5 , 194,392; 4,433,092; and 5,480,971 (said references incorporated by reference in their entireties).
• amino acid sequences of Table 1 comprise immunogenic epitopes.
• Table 1 lists only the critical residues of immunogenic epitopes determined by the Jameson-Wolf analysis. Thus, additional flanking residues on either the N-terminal, C-terminal, or both N- and C-terminal ends may be added to the sequences of Table 1 to generate an epitope-bearing polypeptide of the present invention. Therefore, the immunogenic epitopes of Table 1 may include additional N- terminal or C-terminal amino acid residues.
• flanking amino acid residues may be contiguous flanking N-terminal and/or C-terminal sequences from the polypeptides of the present invention, heterologous polypeptide sequences, or may include both contiguous flanking sequences from the polypeptides of the present invention and heterologous polypeptide sequences.
• Polypeptides of the present invention comprising TRI 2 polypeptide immunogenic or antigenic epitopes are at least 7 amino acids residues in length. "At least” means that a polypeptide of the present invention comprising an immunogenic or antigenic epitope may be 7 amino acid residues in length or any integer between 7 amino acids and the number of amino acid residues of the full length polypeptides of the invention. Preferred polypeptides comprising immunogenic or antigenic epitopes are at least 7, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100 amino acid residues in length.
• antigenic epitopes contain a sequence between about 15 to about 30 amino acids.
• antigenic polypeptides or peptides that can be used to generate TRI 2 -specific antibodies include: a polypeptide comprising, or alternatively, consisting of, amino acid residues 32-47, 50-55, 61-73, 84-97, 117-133, 138-160, 185-192, 195-210, 212-224, 231-241, 243-254, 256-270, 275-280, 290-304, 324-342, 354-363, 365-371, 373- 393, 397-419, and or 423-428 in Figures 1A-C (SEQ ID NO:2). These polypeptide fragments have been determined to bear antigenic epitopes of the TRI 2 protein by the analysis of the Jameson-Wol
• the irnmuno and/or antigenic epitope-bearing fragments may be specified by either the number of contiguous amino acid residues, as described above, or further specified by N-terminal and C-terminal positions of these fragments on the amino acid sequence of SEQ ID NO:2. Every combination of a N-terminal and C-terminal position that a fragment of, for example, at least 7 or at least 15 contiguous amino acid residues in length could occupy on the amino acid sequence of SEQ ID NO:2 is included in the invention.
• "at least 7 contiguous amino acid residues in length” means 7 amino acid residues in length or any integer between 7 amino acids and the number of amino acid residues of the full length polypeptide of the present invention.
• each and every integer between 7 and the number of amino acid residues of the full length polypeptide are included in the present invention.
• Immunogenic and antigenic epitope-bearing polypeptides of the invention are useful, for example, to make antibodies which specifically bind the epitope of the invention (see, for instance, Wilson et al., Cell 37:767-778 (1984); Sutcliffe et al., Science 219:660-666 (1983)), and in immunoassays to detect the polypeptides of the present invention.
• the antibodies are useful, for example, in affinity purification of the polypeptides of the present invention.
• the antibodies may also routinely be used in a variety of qualitative or quantitative immunoassays, specifically for the polypeptides of the present invention using methods known in the art. See, e.g., Harlow et al., Antibodies: A Laboratory Manual, (Cold Spring Harbor Laboratory Press; 2nd Ed. 1988).
• epitope-bearing polypeptides of the present invention may be produced by any conventional means for making polypeptides including synthetic and recombinant methods known in the art.
• epitope-bearing peptides may be synthesized using known methods of chemical synthesis.
• Houghten has described a simple method for the synthesis of large numbers of peptides, such as 10-20 mgs of 248 individual and distinct 13 residue peptides representing single amino acid variants of a segment of the HA1 polypeptide, all of which were prepared and characterized (by ELISA-type binding studies) in less than four weeks (Houghten, R. A. Proc. Natl. Acad. Sci. USA 82:5131-5135 (1985)).
• Epitope-bearing polypeptides of the present invention may be used to induce antibodies according to methods well known in the art including, but not limited to, in vivo immunization, in vitro immunization, and phage display methods. See, e.g., Sutcliffe, et al., supra; Wilson, et al., supra, and Bittle, et al. (1985) J. Gen. Virol. 66:2347-2354.
• animals may be immunized with free peptide; however, anti-peptide antibody titer may be boosted by coupling of the peptide to a macromolecular carrier, such as keyhole limpet hemacyanin (KLH) or tetanus toxoid.
• KLH keyhole limpet hemacyanin
• peptides containing cysteine residues may be coupled to a carrier using a linker such as -maleimidobenzoyl- N-hydroxysuccinimide ester (MBS), while other peptides may be coupled to carriers using a more general linking agent such as glutaraldehyde.
• Animals such as rabbits, rats and mice are immunized with either free or carrier-coupled peptides, for instance, by intraperitoneal and/or intradermal injection of emulsions containing about 100 ⁇ gs of peptide or carrier protein and Freund's adjuvant. Several booster injections may be needed, for instance, at intervals of about two weeks, to provide a useful titer of anti-peptide antibody which can be detected, for example, by ELISA assay using free peptide adsorbed to a solid surface.
• the titer of anti-peptide antibodies in serum from an immunized animal may be increased by selection of anti-peptide antibodies, for instance, by adsorption to the peptide on a solid support and elution of the selected antibodies according to methods well known in the art.
• a preferred immunogenic epitope includes the cysteine-rich domain of TRI 2.
• the immunogenic epitopes may be presented together with a carrier protein, such as an albumin, to an animal system (such as rabbit or mouse) or, if it is long enough (at least about 25 amino acids), without a carrier.
• a carrier protein such as an albumin
• immunogenic epitopes comprising as few as 8 to 10 amino acids have been shown to be sufficient to raise antibodies capable of binding to, at the very least, linear epitopes in a denatured polypeptide (e.g., in Western blotting.)
• SEQ ID NO:2 was found antigenic at amino acids: 32-47, 50-55, 61-73, 84-97, 117-133, 138-160, 185-192, 195-210, 212-224, 231- 241, 243-254, 256-270, 275-280, 290-304, 324-342, 354-363, 365-371, 373-393, 397-419, and 423-428.
• these regions could be used as epitopes to produce antibodies against the TRI 2 protein.
• polynucleotide sequences such as EST sequences
• SEQ ID NO: 1 amino acid sequences
• SEQ ID NO: 1 amino acid sequences
• amino acid sequences are related to SEQ ID NO: 1 and may have been publicly available prior to conception of the present invention.
• polynucleotides are specifically excluded from the scope of the invention.
• a-b a nucleotide sequence described by the general formula of a-b, where a is any integer between 1 to 2687 of SEQ ID NOT, b is an integer of 15 to 2701, where both a and b correspond to the positions of nucleotide residues shown in SEQ ID NOT, and where the b is greater than or equal to a + 14.
• Specific related polynucleotides that are specifically excluded from the scope of the present invention, include, but are not limited to, the sequence of HUMGS00627, Genbank Accession No. gb/AA354094 (SEQ ID NO:34), Genbank Accession No. gb/AA251791 (SEQ ID NO:35), Genbank Accession No. gb/H45305 (SEQ ID NO:36), Genbank Accession No. gb/AA922638 (SEQ ID NO:37), Genbank Accession No. gb/D19672 (SEQ ID NO:38), Genbank Accession No. gb/AA928313 (SEQ ID NO:39), Genbank Accession No.
• gb/R74251 Genbank Accession No. gb/H45245 (SEQ ID NO:41), Genbank Accession No. gb/AA339800 (SEQ ID NO42), Genbank Accession No. gb/AI040104 (SEQ ID NO:43), Genbank Accession No. gb/AI023763 (SEQ ID NO:44), Genbank Accession No. gb/2281065 (SEQ ID NO:45), and Accession No. T19562 (SEQ ID NO:46).
• HJPBN79R SEQ ID NO:5
• HCEDD08R SEQ ID NO:6
• HMQCO51RA SEQ ID NO:7
• HFEAG46R SEQ ID NO:8
• HTXGJ20R SEQ ID NO:9
• variants refers to a polynucleotide or polypeptide differing from the TRI 2 polynucleotide or polypeptide, but retaining essential properties thereof. Generally, variants are overall closely similar, and, in many regions, identical to the TR 12 polynucleotide or polypeptide.
• nucleic acid molecules comprising or alternatively, consisting of, a polynucleotide having a nucleotide sequence at least 90% identical, and more preferably at least 95%, 96%, 97%, 98%, or 99% identical to: (a) a nucleotide sequence encoding the polypeptide having the amino acid sequence in SEQ ID NO:2; (b) a nucleotide sequence encoding the polypeptide having the amino acid sequence in SEQ ID NO: 2, but lacking the amino terminal methionine; (c) a nucleotide sequence encoding the polypeptide having the amino acid sequence at positions about 26 to about 164 in SEQ ID NO:2; (d) a nucleotide sequence encoding the polypeptide having the amino acid sequence at positions about 26 to about 430 in SEQ ID NO:2; (e) a nucleotide sequence encoding the TR12 polypeptide having the amino acid sequence encoded by the cDNA plasmi
• nucleotide sequence of the polynucleotide is identical to the reference sequence except that the polynucleotide sequence may include up to five point mutations per each 100 nucleotides of the reference nucleotide sequence encoding the TRI 2 polypeptide.
• a polynucleotide having a nucleotide sequence at least 95% identical to a reference nucleotide sequence up to 5% of the nucleotides in the reference sequence may be deleted or substituted with another nucleotide, or a number of nucleotides up to 5% of the total nucleotides in the reference sequence may be inserted into the reference sequence.
• the query sequence may be an entire sequence shown of SEQ ID NOT, the ORF (open reading frame), or any fragment as described herein.
• nucleic acid molecule or polypeptide is at least 90%, 95%, 96%, 97%, 98% or 99% identical to a nucleotide sequence of the present invention can be determined conventionally using known computer programs.
• a preferred method for determining the best overall match between a query sequence (a sequence of the present invention) and a subject sequence, also referred to as a global sequence alignment can be determined using the FASTDB computer program based on the algorithm of Brutlag et al. (Comp. App. Biosci. 6:237- 245(1990))
• a sequence alignment the query and subject sequences are both DNA sequences.
• An RNA sequence can be compared by converting U's to T's.
• the result of said global sequence alignment is in percent identity.
• the percent identity is corrected by calculating the number of bases of the query sequence that are 5' and 3' of the subject sequence, which are not matched/aligned, as a percent of the total bases of the query sequence. Whether a nucleotide is matched/aligned is determined by results of the FASTDB sequence alignment.
• This percentage is then subtracted from the percent identity, calculated by the above FASTDB program using the specified parameters, to arrive at a final percent identity score.- This corrected score is what is used for the purposes of the present invention. Only bases outside the 5' and 3' bases of the subject sequence, as displayed by the FASTDB alignment, which are not matched/aligned with the query sequence, are calculated for the purposes of manually adjusting the percent identity score.
• a 90 base subject sequence is aligned to a 100 base query sequence to determine percent identity.
• the deletions occur at the 5' end of the subject sequence and therefore, the FASTDB alignment does not show a matched/aligmeld of the first 10 bases at 5' end.
• the 10 unpaired bases represent 10% of the sequence (number of bases at the 5' and 3' ends not matched/total number of bases in the query sequence) so 10% is subtracted from the percent identity score calculated by the FASTDB program. If the remaining 90 bases were perfectly matched the final percent identity would be 90%.
• a 90 base subject sequence is compared with a 100 base query sequence.
• deletions are internal deletions so that there are no bases on the 5' or 3' of the subject sequence which are not matched/aligned with the query.
• percent identity calculated by FASTDB is not manually corrected.
• bases 5' and 3' of the subject sequence which are not matched/aligned with the query sequnce are manually corrected for. No other manual corrections are made for the purposes of the present invention.
• the present invention is directed to polynucleotides comprising, or alternatively, consisting of, a nucleotide sequence at least 90%, 95%, 96%, 97%, 98%, or 99% identical to the polynucleotide sequence for example, shown in SEQ ID NOT, the polynucleotide sequence of the coding region of the deposited cDNA, or a fragment thereof, irrespective of whether they encode a polypeptide having TRI 2 receptor functional activity.
• polynucleotide molecule does not encode a polypeptide having TRI 2 functional activity
• one of skill in the art would still know how to use the polynucleotide molecule, for instance, as a hybridization probe or a polymerase chain reaction (PCR) primer.
• PCR polymerase chain reaction
• polynucleotide molecules of the present invention that do not encode a polypeptide having TRI 2 receptor activity include, but are not limited to, inter alia: (1) isolating the TR12 receptor gene or allelic variants thereof in a cDNA library; (2) in situ hybridization (e.g., "FISH") to metaphase chromosomal spreads to provide precise chromosomal location of the TR12 receptor gene, as described in Verma et al, Human Chromosomes: A Manual of Basic Techniques, Pergamon Press, New York (1988); and (3) Northern Blot analysis for detecting TRI 2 receptor mRNA expression in specific tissues.
• FISH in situ hybridization
• polynucleotides comprising, or alternatively, consisting of, a nucleotide sequence at least 90%, 95%, 96%, 97%, 98% or 99% identical to for example, the polynucleotide sequence shown in SEQ ID NOT, the nucleic acid sequence of the coding region of the deposited cDNA or a fragment thereof, which do, in fact, encode a polypeptide having TRI 2 receptor functional activity.
• a polypeptide having TR12 functional receptor activity is intended polypeptides exhibiting activity similar, but not necessarily identical, to an activity of the TR12 receptor of the invention (either the full-length protein or, preferably, the mature protein), as measured in a particular assay (e.g., biological assay).
• a TRI 2 functional activity can routinely be measured by determining the ability of a TRI 2 polypeptide to bind a TRI 2 ligand.
• TRI 2 functional activity may also be measured by determining the ability of a polypeptide, such as cognate ligand which is free or expressed on a cell surface, to induce cells expressing the polypeptide.
• polypeptides of the present invention include a polypeptide comprising, or alternatively, consisting of, the TRI 2 polypeptide encoded by the deposited cDNA including the leader; a polypeptide comprising, or alternatively, consisting of, the mature TR12 polypeptide encoded by the deposited cDNA minus the leader (i.e., the mature protein); a polypeptide comprising, or alternatively, consisting of, amino acids from about 1 to about 430 in SEQ ID NO:2; a polypeptide comprising, or alternatively, consisting of, amino acids from about 2 to about 430 in SEQ ID NO:2; a polypeptide comprising, or alternatively, consisting of, amino acids from about 26 to about 164 in SEQ ID NO:2; a polypeptide comprising, or alternatively consisting of, amino acids from about 26 to about 430 in SEQ ID NO:2; a polypeptide comprising, or alternatively, consisting of, the TRI 2 extracellular domain; a polypeptide comprising,
• a polypeptide having an amino acid sequence at least, for example, 95% "identical" to a query amino acid sequence of the present invention it is intended that the amino acid sequence of the subject polypeptide is identical to the query sequence except that the subject polypeptide sequence may include up to five amino acid alterations per each 100 amino acids of the query amino acid sequence.
• the amino acid sequence of the subject polypeptide may include up to five amino acid alterations per each 100 amino acids of the query amino acid sequence.
• up to 5% of the amino acid residues in the subject sequence may be inserted, deleted, (indels) or substituted with another amino acid.
• These alterations of the reference sequence may occur at the amino or carboxy terminal positions of the reference amino acid sequence or anywhere between those terminal positions, interspersed either individually among residues in the reference sequence or in one or more contiguous groups within the reference sequence.
• any particular polypeptide is at least 90%, 95%, 96%, 97%, 98% or 99% identical to, for instance, the amino acid sequences shown in SEQ ID NO: 2 the amino acid sequence encoded by deposited cDNA plasmid, or a polypeptide fragment thereof, can be determined conventionally using known computer programs.
• a preferred method for determing the best overall match between a query sequence (a sequence of the present invention) and a- subject sequence, also referred to as a global sequence alignment, can be determined using the FASTDB computer program based on the algorithm of Brutlag et al. (Comp. App. Biosci. (1990) 6:237- 245).
• the query and subject sequences are either both nucleotide sequences or both amino acid sequences.
• the result of said global sequence alignment is in percent identity.
• the percent identity is corrected by calculating the number of residues of the query sequence that are N- and C-terminal of the subject sequence, which are not matched/aligned with a corresponding subject residue, as a percent of the total bases of the query sequence. Whether a residue is matched/aligned is determined by results of the FASTDB sequence alignment.
• This percentage is then subtracted from the percent identity, calculated by the above FASTDB program using the specified parameters, to arrive at a final percent identity score.
• This final percent identity score is what is used for the purposes of the present invention. Only residues to the N- and C-termini of the subject sequence, which are not matched/aligned with the query sequence, are considered for the purposes of manually adjusting the percent identity score. That is, only query residue positions outside the farthest C-terminal residues of the subject sequence.
• a 90 amino acid residue subject sequence is aligned with a 100 residue query sequence to determine percent identity.
• the deletion occurs at the N- terminus of the subject sequence and therefore, the FASTDB alignment does not show a matching alignment of the first 10 residues at the N-terminus.
• the 10 unpaired residues represent 10% of the sequence (number of residues at the N- and C- termini not matched/total number of residues in the query sequence) so 10% is subtracted from the percent identity score calculated by the FASTDB program. If the remaining 90 residues were perfectly matched the final percent identity would be 90%.
• a 90 residue subject sequence is compared with a 100 residue query sequence.
• deletions are internal deletions so there are no residues at the N- or C- termini of the subject sequence which are not matched/aligned with the query.
• percent identity calculated by FASTDB is not manually corrected.
• residue positions outside the N- and C-terminal ends of the subject sequence, as displayed in the FASTDB alignment, which are not matched/aligned with the query sequence are manually corrected for. No other manual corrections are made for the purposes of the present invention.
• the present invention is also directed to proteins cotaining polypeptides at least 90%, 95%, 96%, 97%, 98% or 99% identical to the TR12 polypeptide sequence set forth as n-m herein.
• the application is directed to proteins containing polypeptides at least 90%, 95%, 96%, 97%, 98% or 99% identical to polypeptides having the amino acid sequence of the specific TRI 2 N- and C-terminal deletions recited herein. Polynucleotides encoding these polypeptides are also encompassed by the invention.
• TRI 2 proteins of the invention comprise fusion proteins as described herein wherein the TRI 2 polypeptides are those described as n-m herein.
• the application is directed to nucleic acid molecules at least 90%, 95%, 96%, 97%, 98% or 99% identical to the nucleic acid sequences encoding polypeptides having the amino acid sequence of the specific N- and C-terminal deletions recited herein. Polypeptides encoded by these nucleic acid molecules are also encompassed by the invention.
• the TRI 2 variants of the invention may contain alterations in the coding regions, non-coding regions, or both.
• polynucleotide variants containing alterations which produce silent substitutions, additions, or deletions, but do not alter the properties or activities of the encoded polypeptide.
• Nucleotide variants produced by silent substitutions due to the degeneracy of the genetic code are preferred.
• variants in which 5-10, 1-5, or 1-2 amino acids are substituted, deleted, or added in any combination are also preferred.
• the number of substitutions, additions or deletions in the amino acid sequence of Figures 1A-C and/or any of the polypeptide fragments described herein is 75, 70, 60, 50, 40, 35, 30, 25, 20, 15, 10, 9, 8, 7, 6, 5, 4, 3, 2, 1 or 30-20, 20-15, 20-10, 15-10, 10-1, 5-10, 1-5, 1-3 or 1- 2.
• TRI 2 polynucleotide variants can be produced for a variety of reasons, e.g., to optimize codon expression for a particular host (change codons in the human mRNA to those preferred by a bacterial host such as E. col ⁇ ).
• Naturally occurring TR12 variants are called "allelic variants," and refer to one of several altemate forms of a gene occupying a given locus on a chromosome of an organism. (Genes II, Lewin, B., ed., John Wiley & Sons, New York (1985).) These allelic variants can vary at either the polynucleotide and/or polypeptide level. Alternatively, non-naturally occurring variants may be produced by mutagenesis techniques or by direct synthesis.
• changes are preferably of a minor nature, such as conservative amino acid substitutions that do not significantly affect the folding or activity of the protein (see Table 2).
• Amino acids in TRI 2 that are essential for function can be identified by methods known in the art, such as site-directed mutagenesis or alanine-scanning mutagenesis (Cunningham and Wells, Science 244: 1081-1085 (1989)). The latter procedure introduces single alanine mutations at every residue in the molecule. The resulting mutant molecules are then tested for functional activkiy, e.g., biological activity, such as receptor binding or in vitro activity. Sites that are critical for ligand-receptor binding can also be determined by structural analysis such as crystallization, nuclear magnetic resonance or photoaffinity labeling (Smith et al, J. Mol. Biol. 224:899-904 (1992) and de Vos et al. Science 255:306-312 (1992)).
• variants may be generated to improve or alter the characteristics of the TR12 polypeptides. For instance, one or more amino acids can be deleted from the N- terminus or C-terminus of the secreted protein without substantial loss of biological function.
• Interferon gamma exhibited up to ten times higher activity after deleting 8-10 amino acid residues from the carboxy terminus of this protein. (Dobeli et al., J. Biotechnology 7: 199-216 (1988).)
• the invention further includes TRI 2 polypeptide variants which show substantial functional activity (e.g., biological activity).
• Such variants include deletions, insertions, inversions, repeats, and substitutions selected according to general rules known in the art so as to have little effect on activity.
• an example of guidance concerning how to make phenotypically silent amino acid substitutions is provided in Bowie et al., Science 247: 1306-1310 (1990), wherein the authors indicate there are two main strategies for studying the tolerance of an amino acid sequence to change.
• the first strategy exploits the tolerance of amino acid substitutions by natural selection during the process of evolution. By comparing amino acid sequences in different species, conserved amino acids can be identified. These conserved amino acids are likely important for protein function. In contrast, the amino acid positions where substitutions have been tolerated by natural selection indicates that these positions are not critical for protein function. Thus, positions tolerating amino acid substitution could be modified while still maintaining biological activity of the protein.
• the second strategy uses genetic engineering to introduce amino acid changes at specific positions of a cloned gene to identify regions critical for protein function. For example, site directed mutagenesis or alanine-scanning mutagenesis (introduction of single alanine mutations at every residue in the molecule) can be used. (Cunningham and Wells, Science 244:1081-1085 (1989).) The resulting mutant molecules can then be tested for biological activity.
• tolerated conservative amino acid substitutions involve replacement of the aliphatic or hydrophobic amino acids Ala, Val, Leu and He; replacement of the hydroxyl residues Ser and Thr; replacement of the acidic residues Asp and Glu; replacement of the amide residues Asn and Gin, replacement of the basic residues Lys, Arg, and His; replacement of the aromatic residues Phe, Tyr, and Trp, and replacement of the small-sized amino acids Ala, Ser, Thr, Met, and Gly.
• variants of TR12 include (i) substitutions with one or more of the non-conserved amino acid residues, where the substituted amino acid residues may or may not be one encoded by the genetic code, or (ii) substitution with one or more of amino acid residues having a substituent group, or (iii) fusion of the mature polypeptide with another compound, such as a compound to increase the stability and/or solubility of the polypeptide (for example, polyethylene glycol), or (iv) fusion of the polypeptide with additional amino acids, such as an IgG Fc fusion region peptide, or leader or secretory sequence, or a sequence facilitating purification.
• Such variant polypeptides are deemed to be within the scope of those skilled in the art from the teachings herein.
• protein engineering may be employed to improve or alter the characteristics of TRI 2 polypeptides.
• Recombinant DNA technology known to those skilled in the art can be used to create novel mutant proteins or "muteins including single or multiple amino acid substitutions, deletions, additions or fusion proteins.
• modified polypeptides can show, e.g., enhanced activity or increased stability.
• they may be purified in higher yields and show better solubility than the corresponding natural polypeptide, at least under certain purification and storage conditions.
• Non-naturally occurring variants may be produced using art-known mutagenesis techniques, which include, but are not limited to oligonucleotide mediated mutagenesis, alanine scanning, PCR mutagenesis, site directed mutagenesis (see e.g., Carter et al, Nucl. Acids Res. 13:4331 (1986); and Zoller et al, Nucl. Acids Res. 70:6487 (1982)), cassette mutagenesis (see e.g., Wells et al., Gene 34:315 (1985)), restriction selection mutagenesis (see e.g., Wells et al, Philos. Trans. R. Soc. London SerA 317:415 (1986)).
• art-known mutagenesis techniques include, but are not limited to oligonucleotide mediated mutagenesis, alanine scanning, PCR mutagenesis, site directed mutagenesis (see e.g., Carter et al
• the invention also encompasses TRI 2 derivatives and analogs that have one or more amino acid residues deleted, added, or substituted to generate TRI 2 polypeptides that are better suited for expression, scale up, etc., in the host cells chosen.
• TRI 2 polypeptide variants containing amino acid substitutions of charged amino acids with other charged or neutral amino acids may produce proteins with improved characteristics, such as less aggregation. Aggregation of pharmaceutical formulations both reduces activity and increases clearance due to the aggregate's immunogenic activity.
• cysteine residues are deleted or substituted with another amino acid residue in order to eliminate disulfide bridges and or N-linked glycosylation sites are altered or eliminated to achieve, for example, expression of a homogeneous product that is more easily recovered and purified from yeast hosts which are known to hyperglycosylate N-linked sites.
• one or more of the amino acid residues of the polypeptides of the invention may be deleted or substituted with another residue to eliminate undesired protease cleavage of the TRI 2 polypeptides of the invention by proteases such as, for example, furins or kexins.
• proteases such as, for example, furins or kexins.
• one or both of the arginine amino acid residues at positions 75 and 76 of SEQ ID NO:2 and/or 129 and 130 are deleted or substituted with another amino acid residue (preferably not lysine) in order to eliminate protease cleavage resulting in lower yields of the TRI 2 protein.
• DNA shuffling may be employed to modulate the activities of TRI 2 thereby effectively generating agonists and antagonists of TRI 2.
• DNA shuffling may be employed to modulate the activities of TRI 2 thereby effectively generating agonists and antagonists of TRI 2.
• alteration of TR12 polynucleotides and corresponding polypeptides may be achieved by DNA shuffling.
• DNA shuffling involves the assembly of two or more DNA segments into a desired TRI 2 molecule by homologous, or site-specific, recombination.
• TRI 2 polynucleotides and corresponding polypeptides may be alterred by being subjected to random mutagenesis by error-prone PCR, random nucleotide insertion or other methods prior to recombination.
• one or more components, motifs, sections, parts, domains, fragments, etc., of TR12 may be recombined with one or more components, motifs, sections, parts, domains, fragments, etc. of one or more heterologous molecules.
• the heterologous molecules are TNFR family members.
• the heterologous molecule is selected from the group consisting of: soluble forms of TNF-alpha, lymphotoxin- alpha (LT-alpha, also known as TNF-beta), LT-beta (found in complex heterotrimer LT-alpha2-beta), OPGL, FasL, CD27L, CD30L, CD40L, 4-1BBL, DcR3, OX40L, TNF-gamma (International Publication No. WO 96/14328), ALM-I (International Publication No. WO 97/33899), endokine-alpha (International Publication No. WO 98/07880), OPG, and Neutrokine-alpha (International Publication No.
• WO 98/18921 OX40, and nerve growth factor (NGF), and soluble forms of Fas, CD30, CD27, CD40 and 4-IBB, TR2 (International Publication No. WO 96/34095), DR3 (International Publication No. WO 97/33904), DR4 (International Publication No. WO 98/32856), TR5 (International Publication No. WO 98/30693), TR6 (International Publication No. WO 98/30694), TR7 (International Publication No. WO 98/41629), TRANK, TR9 (International Publication No. WO 98/56892), TR12 (International Publication No. WO 98/54202), 312C2 (International Publication No.
• the heterologous molecule is a growth factor such as, for example, platelet-derived growth factor (PDGF), insulin-like growth factor (IGF-I), transforming growth factor (TGF)-alpha, epidermal growth factor (EGF), fibroblast growth factor (FGF), TGF-beta, bone morphogenetic protein (BMP)-2, BMP-4, BMP-5, BMP-6, BMP-7, activins A and B, decapentaplegic (dpp), 60A, OP-2, dorsalin, growth differentiation factors (GDFs), nodal, MIS, inhibin-alpha, TGF- beta 1, TGF-beta2, TGF-beta3, TGF-beta5, and glial-derived neurotrophic factor (GDNF).
• PDGF platelet-derived growth factor
• IGF-I insulin-like growth factor
• TGF transforming growth factor
• EGF epidermal growth factor
• FGF fibroblast growth factor
• TGF-beta TGF-
• the invention also encompasses TRI 2 fusion proteins and polynucleotides encoding these fusion proteins.
• Any TRI 2 polypeptide sequence of the invention may be a component of a TRI 2 fusion protein of the invention.
• the TRI 2 polypeptide when fused to a second protein, is used as an antigenic tag.
• antibodies raised against the TRI 2 polypeptide can be used to indirectly detect the second protein by binding to the TRI 2.
• the TRI 2 polypeptides can be used as a targeting molecule once fused to other proteins.
• TRI 2 proteins of the invention comprise fusion proteins comprising a TR12 polypeptide sequence described above as m-n.
• the application is directed to polypeptides containing an amino acid sequence at least 90%, 95%, 96%, 97%, 98% or 99% identical to the amino acid sequence of the specific N- and C-terminal deletions recited herein. Polynucleotides encoding by these polypeptides are also encompassed by the invention.
• fusion proteins may also be engineered to improve characteristics of the TRI 2 polypeptide. For instance, a region of additional amino acids, particularly charged amino acids, may be added to the N-terminus of the TR12 polypeptide to improve stability and persistence during purification from the host cell or subsequent handling and storage. Also, peptide moieties may be added to the TR12 polypeptide to facilitate purification. Such regions may be removed prior to final preparation of the TRI 2 polypeptide. The addition of peptide moieties to facilitate handling of polypeptides are familiar and routine techniques in the art.
• TR12 polypeptides can be fused to heterologous polypeptide sequences.
• the polypeptides of the present invention may be fused with the constant domain of immunoglobulins (IgA, IgE, IgG, IgM), or portions thereof (CHI, CH2, CH3, any combination thereof including both entire domains and portions thereof) resulting in chimeric polypeptides.
• immunoglobulins IgA, IgE, IgG, IgM
• CHI constant domain of immunoglobulins
• CH2, CH3 any combination thereof including both entire domains and portions thereof
• Nucleic acids encoding the above epitopes can also be recombined with a gene of interest as an epitope tag to aid in detection and purification of the expressed polypeptide.
• EP-A-O 464 533 (Canadian counterpart 2045869) discloses fusion proteins comprising various portions of constant region of immunoglobulin molecules together with another human protein or part thereof.
• the Fc part in a fusion protein is beneficial in therapy and diagnosis, and thus can result in, for example, improved pharmacokinetic properties.
• EP-A 0232 262. Alternatively, deleting the Fc part after the fusion protein has been expressed, detected, and purified, would be desired.
• the Fc portion may hinder therapy and diagnosis if the fusion protein is used as an antigen for immunizations.
• human proteins such as hIL-5
• Fc portions for the purpose of high-throughput screening assays to identify antagonists of hIL-5.
• the TRI 2 polypeptides can be fused to marker sequences, such as a peptide which facilitates purification of TRI 2.
• the marker amino acid sequence is a hexa-histidine peptide, such as the tag provided in a pQE vector (QIAGEN, Inc., 9259 Eton Avenue, Chatsworth, CA, 91311), among others, many of which are commercially available.
• a pQE vector QIAGEN, Inc., 9259 Eton Avenue, Chatsworth, CA, 91311)
• hexa-histidine provides for convenient purification of the fusion protein.
• Another peptide tag useful for purification, the "HA" tag corresponds to an epitope derived from the influenza hemagglutinin protein. (Wilson et al., Cell 37:767 (1984).)
• any of these above fusions can be engineered using the TR12 polynucleotides or the polypeptides.
• Preferred Fc fusions of the present invention include, but are not limited to constructs comprising, or alternatively consisting of, amino acid residues 1 to 164, 26 to 164, 48 to 71, 32 to 47, 50 to 55, 61 to 73, 84 to 97, 117 to 133, 138 to 160, 185 to 192, 195 to 210, 212 to 224, 231 to 241, 243 to 254, 256 to 270, 275 to 280, 290 to 304, 324 to 342, 354 to 363, 365 to 371, 373 to 393, 397 to 419, and 423 to 428 of SEQ ID NO:2.
• Polynucleotides encoding these Fc fusions are also encompassed by the invention.
• the present invention also relates to vectors containing the TRI 2 polynucleotide, host cells, and the production of polypeptides by recombinant and synthetic techniques.
• the vector may be, for example, a phage, plasmid, viral, or retroviral vector.
• Retroviral vectors may be replication competent or replication defective. In the latter case, viral propagation generally will occur only in complementing host cells.
• TRI 2 polynucleotides may be joined to a vector containing a selectable marker for propagation in a host.
• a plasmid vector is introduced in a precipitate, such as a calcium phosphate precipitate, or in a complex with a charged lipid. If the vector is a virus, it may be packaged in vitro using an appropriate packaging cell line and then transduced into host cells.
• the TRI 2 polynucleotide insert should be operatively linked to an appropriate promoter, such as the phage lambda PL promoter, the E. coli lac, trp, phoA and tac promoters, the SV40 early and late promoters and promoters of retroviral LTRs, to name a few.
• an appropriate promoter such as the phage lambda PL promoter, the E. coli lac, trp, phoA and tac promoters, the SV40 early and late promoters and promoters of retroviral LTRs, to name a few.
• Other suitable promoters will be known to the skilled artisan.
• the expression constructs will further contain sites for transcription initiation, termination, and, in the transcribed region, a ribosome binding site for translation.
• the coding portion of the transcripts expressed by the constructs will preferably include a translation initiating codon at the beginning and a termination codon (UAA, UGA or UAG) appropriately positioned at the end of the polypeptide to be translated.
• the expression vectors will preferably include at least one selectable marker.
• markers include dihydrofolate reductase, G418 or neomycin resistance for eukaryotic cell culture and tetracycline, kanamycin or ampicillin resistance genes for culturing in E. coli and other bacteria.
• Representative examples of appropriate hosts include, but are not limited to, bacterial cells, such as E.
• coli Streptomyces and Salmonella typhimurium cells
• fungal cells such as yeast cells
• insect cells such as Drosophila S2 and Spodoptera Sf9 cells
• animal cells such as CHO, COS, 293, and Bowes melanoma cells
• plant cells Appropriate culture mediums and conditions for the above-described host cells are known in the art.
• vectors preferred for use in bacteria include pQE70, pQE60 and pQE-9, available from QIAGEN, Inc.; pBluescript vectors, Phagescript vectors, pNH8A, pNH16a, pNH18A, pNH46A, available from Stratagene Cloning Systems, Inc.; and ptrc99a, pKK223-3, pKK233-3, pDR540, pRIT5 available from Pharmacia Biotech, Inc.
• eukaryotic vectors are pWLNEO, pSV2CAT, pOG44, pXTl and pSG available from Stratagene; and pSVK3, pBPV, pMSG and pSVL available from Pharmacia.
• Other suitable vectors will be readily apparent to the skilled artisan.
• TR12 polypeptides may in fact be expressed by a host cell lacking a recombinant vector.
• TRI 2 polypeptides can be recovered and purified from recombinant cell cultures by well-known methods including ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxylapatite chromatography and lectin chromatography. Most preferably, high performance liquid chromatography (“HPLC”) is employed for purification.
• HPLC high performance liquid chromatography
• TRI 2 polypeptides and preferably the secreted form, can also be recovered from: products purified from natural sources, including bodily fluids, tissues and cells, whether directly isolated or cultured; products of chemical synthetic procedures; and products produced by recombinant techniques from a prokaryotic or eukaryotic host, including, for example, bacterial, yeast, higher plant, insect, and mammalian cells.
• a prokaryotic or eukaryotic host including, for example, bacterial, yeast, higher plant, insect, and mammalian cells.
• the TRI 2 polypeptides may be glycosylated or may be non-glycosylated.
• TRI 2 polypeptides may also include an initial modified methionine residue, in some cases as a result of host-mediated processes.
• N-terminal methionine encoded by the translation initiation codon generally is removed with high efficiency from any protein after translation in all eukaryotic cells. While the N-terminal methionine on most proteins also is efficiently removed in most prokaryotes, for some proteins, this prokaryotic removal process is inefficient, depending on the nature of the amino acid to which the N-terminal methionine is covalently linked.
• the invention also encompasses primary, secondary, and immortalized host cells of vertebrate origin, particularly mammalian origin, that have been engineered to delete or replace endogenous genetic material (e.g., TRI 2 coding sequence), and/or to include genetic material (e.g., heterologous polynucleotide sequences) that is operably associated with TRI 2 polynucleotides of the invention, and which activates, alters, and/or amplifies endogenous TR12 polynucleotides.
• endogenous genetic material e.g., TRI 2 coding sequence
• genetic material e.g., heterologous polynucleotide sequences
• heterologous control regions e.g., promoter and or enhancer
• endogenous TRI 2 polynucleotide sequences via homologous recombination
• heterologous control regions e.g., promoter and or enhancer
• endogenous TRI 2 polynucleotide sequences via homologous recombination
• the polypeptide may be expressed in a modified form, such as a fusion protein (comprising the polypeptide joined via a peptide bond to a heterologous protein sequence (of a different protein)), and may include not only secretion signals but also additional heterologous functional regions.
• a fusion protein can be made by protein synthetic techniques, e.g., by use of a peptide synthesizer.
• a region of additional amino acids, particularly charged amino acids may be added to the N-terminus of the polypeptide to improve stability and persistence in the host cell, during purification or during subsequent handling and storage.
• peptide moieties may be added to the polypeptide to facilitate purification. Such regions may be removed prior to final preparation of the polypeptide.
• polypeptide moieties to polypeptides to engender secretion or excretion, to improve stability and to facilitate purification, among others, are familiar and routine techniques in the art.
• polynucleotides encoding TRI 2 polypeptides of the invention may be fused to the pelB pectate lyase signal sequence to increase the efficiency to expression and purification of such polypeptides in Gram-negative bacteria. See, US Patent Nos. 5,576,195 and 5,846,818, the contents of which are herein incorporated by reference in their entireties.
• a preferred fusion protein comprises a heterologous region from immunoglobulin that is useful to solubilize proteins.
• EP-A-O 464 533 (Canadian counte ⁇ art 2045869) discloses fusion proteins comprising various portions of constant region of immunoglobin molecules together with another human protein or part thereof.
• the Fc part in a fusion protein is thoroughly advantageous for use in therapy and diagnosis and thus results, for example, in improved pharmacokinetic properties (EP-A 0232 262).
• Fc portion proves to be a hindrance to use in therapy and diagnosis, for example, when the fusion protein is to be used as an antigen for immunizations.
• human proteins such as the ML5 -receptor
• Fc portions for the purpose of high-throughput screening assays to identify antagonists of hIL-5. See, D. Bennett et al, Journal of Molecular Recognition 8:52-58 (1995) and K. Johanson et al., The Journal of Biological Chemistry 270: 16:9459-9471 (1995).
• Polypeptides of the invention can be chemically synthesized using techniques known in the art (e.g., see Creighton, 1983, Proteins: Structures and Molecular Principles, W.H. Freeman & Co., N.Y., and Hunkapiller, M., et al., 1984, Nature 310: 105-111).
• a peptide corresponding to a fragment of the TR12 polypeptides of the invention can be synthesized by use of a peptide synthesizer.
• nonclassical amino acids or chemical amino acid analogs can be introduced as a substitution or addition into the TRI 2 polynucleotide sequence.
• Non-classical amino acids include, but are not limited to, to the D-isomers of the common amino acids, 2,4-diaminobutyric acid, a-amino isobutyric acid, 4- aminobutyric acid, Abu, 2-amino butyric acid, g-Abu, e-Ahx, 6-amino hexanoic acid, Aib, 2-amino isobutyric acid, 3-amino propionic acid, ornithine, norleucine, norvaline, hydroxyproline, sarcosine, citrulline, homocitrulline, cysteic acid, t-butylglycine, t- butylalanine, phenylglycine, cyclohexylalanine, b-alanine, fluoro-amino acids, designer amino acids such as b-methyl amino acids, Ca-methyl amino acids, Na-methyl amino acids, and amino acid analogs in general. Furthermore, the amino acid can be
• the invention encompasses TRI 2 polypeptides which are differentially modified during or after translation, e.g., by glycosylation, acetylation, phosphorylation, amidation, derivatization by known protecting/blocking groups, proteolytic cleavage, linkage to an antibody molecule or other cellular ligand, etc. Any of numerous chemical modifications may be carried out by known techniques, including but not limited, to specific chemical cleavage by cyanogen bromide, trypsin, chymotrypsin, papain, V8 protease, NaBH 4 ; acetylation, formylation, oxidation, reduction; metabolic synthesis in the presence of tunicamycin; etc.
• Additional post-translational modifications encompassed by the invention include, for example, e.g., N-linked or O-linked carbohydrate chains, processing of N-terminal or C-terminal ends), attachment of chemical moieties to the amino acid backbone, chemical modifications of N-linked or O-linked carbohydrate chains, and addition or deletion of an N-terminal methionine residue as a result of procaryotic host cell expression.
• the polypeptides may also be modified with a detectable label, such as an enzymatic, fluorescent, isotopic or affinity label to allow for detection and isolation of the protein.
• the chemical moieties for derivitization may be selected from water soluble polymers such as polyethylene glycol, ethylene glycol/propylene glycol copolymers, carboxymethylcellulose, dextran, polyvinyl alcohol and the like.
• the polypeptides may be modified at random positions within the molecule, or at predetermined positions within the molecule and may include one, two, three or more attached chemical moieties.
• the polymer may be of any molecular weight, and may be branched or unbranched.
• the preferred molecular weight is between about 1 kDa and about 100 kDa (the term "about” indicating that in preparations of polyethylene glycol, some molecules will weigh more, some less, than the stated molecular weight) for ease in handling and manufacturing.
• Other sizes may be used, depending on the desired therapeutic profile (e.g., the duration of sustained release desired, the effects, if any on biological activity, the ease in handling, the degree or lack of antigenicity and other known effects of the polyethylene glycol to a therapeutic protein or analog).
• the polyethylene glycol molecules (or other chemical moieties) should be attached to the protein with consideration of effects on functional or antigenic domains of the protein.
• polyethylene glycol may be covalently bound through amino acid residues via a reactive group, such as, a free amino or carboxyl group.
• Reactive groups are those to which an activated polyethylene glycol molecule may be bound.
• the amino acid residues having a free amino group may include lysine residues and the N-terminal amino acid residues; those having a free carboxyl group may include aspartic acid residues glutamic acid residues and the C-terminal amino acid residue.
• Sulfhydryl groups may also be used as a reactive group for attaching the polyethylene glycol molecules. Preferred for therapeutic purposes is attachment at an amino group, such as attachment at the N-terminus or lysine group.
• polyethylene glycol as an illustration of the present composition, one may select from a variety of polyethylene glycol molecules (by molecular weight, branching, etc.), the proportion of polyethylene glycol molecules to protein (or peptide) molecules in the reaction mix, the type of pegylation reaction to be performed, and the method of obtaining the selected N-terminally pegylated protein.
• the method of obtaining the N-terminally pegylated preparation i.e., separating this moiety from other monopegylated moieties if necessary
• Selective proteins chemically modified at the N-terminus modification may be accomplished by reductive alkylation which exploits differential reactivity of different types of primary amino groups (lysine versus the N-terminal) available for derivatization in a particular protein. Under the appropriate reaction conditions, substantially selective derivatization of the protein at the N-terminus with a carbonyl group containing polymer is achieved.
• the present invention further relates to antibodies and T-cell antigen receptors (TCR) which specifically bind the polypeptides of the present invention.
• the antibodies of the present invention include IgG (including IgGl, IgG2, IgG3, and IgG4), IgA (including IgAl and IgA2), IgD, IgE, or IgM, and IgY.
• antibody is meant to include whole antibodies, including single-chain whole antibodies, and antigen-binding fragments thereof.
• the antibodies are human antigen binding antibody fragments of the present invention and include, but are not limited to, Fab, Fab' and F(ab')2, Fd, single-chain Fvs (scFv), single-chain antibodies, disulfide-linked Fvs (sdFv) and fragments comprising either a V L or V H domain.
• the antibodies may be from any animal origin including birds and mammals.
• the antibodies are human, murine, rabbit, goat, guinea pig, camel, horse, or chicken.
• Antigen-binding antibody fragments may comprise the variable region(s) alone or in combination with the entire or partial of the following: hinge region, CHI, CH2, and CH3 domains. Also included in the invention are any combinations of variable region(s) and hinge region, CHI, CH2, and CH3 domains.
• the present invention further includes monoclonal, polyclonal, chimeric, humanized, and human monoclonal and human polyclonal antibodies which specifically bind the polypeptides of the present invention.
• the present invention further includes antibodies which are anti-idiotypic to the antibodies of the present invention.
• the antibodies of the present invention may be monospecific, bispecific, trispecific or of greater multispecificity.
• Multispecific antibodies may be specific for different epitopes of a polypeptide of the present invention or may be specific for both a polypeptide of the present invention as well as for heterologous compositions, such as a heterologous polypeptide or solid support material.
• Antibodies of the present invention may be described or specified in terms of the epitope(s) or portion(s) of a polypeptide of the present invention which are recognized or specifically bound by the antibody.
• the epitope(s) or polypeptide portion(s) may be specified as described herein, e.g., by N-terminal and C-terminal positions, by size in contiguous amino acid residues, or listed in the Tables and Figures.
• Antibodies which specifically bind any epitope or polypeptide of the present invention may also be excluded. Therefore, the present invention includes antibodies that specifically bind polypeptides of the present invention, and allows for the exclusion of the same.
• Antibodies of the present invention may also be described or specified in terms of their cross-reactivity. Antibodies that do not bind any other analog, ortholog, or homolog of the polypeptides of the present invention are included. Antibodies that do not bind polypeptides with less than 95%, less than 90%, less than 85%, less than 80%, less than 75%, less than 70%, less than 65%, less than 60%, less than 55%, and less than 50% identity (as calculated using methods known in the art and described herein) to a polypeptide of the present invention are also included in the present invention.
• antibodies which only bind polypeptides encoded by polynucleotides which hybridize to a polynucleotide of the present invention under stringent hybridization conditions are also included in the present invention.
• Preferred binding affinities include those with a dissociation constant or Kd less than 5X10 "6 M, 10 "6 M, 5X10 "7 M, 10 "7 M, 5X10 “8 M, 10 “8 M, 5X10 "9 M, 10 "9 M, 5X10 10 M, 10-'°M, 5X10"M, 10"M, 5X10 "12 M, 10 12 M, 5X10 1 M, 10 "1 M, 5X10 " 14 M, 10 "14 M, 5X10 15 M, and 10 "15 M.
• Antibodies of the present invention have uses that include, but are not limited to, methods known in the art to purify, detect, and target the polypeptides of the present invention including both in vitro and in vivo diagnostic and therapeutic methods.
• the antibodies have use in immunoassays for qualitatively and quantitatively measuring levels of the polypeptides of the present invention in biological samples. See, e.g., Harlow et al., ANTIBODIES: A LABORATORY MANUAL, (Cold Spring Harbor Laboratory Press, 2nd ed. 1988) (incorporated by reference in the entirety).
• the antibodies of the present invention may be used either alone or in combination with other compositions.
• the antibodies may further be recombinantly fused to a heterologous polypeptide at the N- or C-terminus or chemically conjugated (including covalently and non-covalently conjugations) to polypeptides or other compositions.
• antibodies of the present invention may be recombinantly fused or conjugated to molecules useful as labels in detection assays and effector molecules such as heterologous polypeptides, drugs, or toxins. See, e.g., WO 92/08495; WO 91/14438; WO 89/12624; US Patent 5,314,995; and EP 0 396 387.
• the antibodies of the present invention may be prepared by any suitable method known in the art.
• a polypeptide of the present invention or an antigenic fragment thereof can be administered to an animal in order to induce the production of sera containing polyclonal antibodies.
• the term "monoclonal antibody” is nota limited to antibodies produced through hybridoma technology.
• the term “monoclonal antibody” refers to an antibody that is derived from a single clone, including any eukaryotic, prokaryotic, or phage clone, and not the method by which it is produced.
• Monoclonal antibodies can be prepared using a wide variety of techniques known in the art including the use of hybridoma, recombinant, and phage display technology.
• Hybridoma techniques include those known in the art and taught in Harlow et al., ANTIBODIES: A LABORATORY MANUAL, (Cold Spring Harbor Laboratory Press, 2nd ed. 1988); Hammerling, et al., in: MONOCLONAL ANTIBODIES AND T-CELL HYBRIDOMAS 563-681 (Elsevier, N.Y., 1981) (said references incorporated by reference in their entireties).
• Fab and F(ab')2 fragments may be produced by proteolytic cleavage, using enzymes such as papain (to produce Fab fragments) or pepsin (to produce F(ab')2 fragments).
• antibodies of the present invention can be produced through the application of recombinant DNA and phage display technology or through synthetic chemistry using methods known in the art.
• the antibodies of the present invention can be prepared using various phage display methods known in the art.
• phage display methods functional antibody domains are displayed on the surface of a phage particle which carries polynucleotide sequences encoding them.
• Phage with a desired binding property are selected from a repertoire or combinatorial antibody library (e.g. human or murine) by selecting directly with antigen, typically antigen bound or captured to a solid surface or bead.
• Phage used in these methods are typically filamentous phage including fd and Ml 3 with Fab, Fv or disulfide stabilized Fv antibody domains recombinantly fused to either the phage gene III or gene VIII protein.
• Examples of phage display methods that can be used to make the antibodies of the present invention include those disclosed in Brinkman et al., J. Immunol. Methods 182:41-50 (1995); Ames et al., J. Immunol. Methods 184:177-186 (1995); Kettleborough et al., Eur. J. Immunol.
• the antibody coding regions from the phage can be isolated and used to generate whole antibodies, including human antibodies, or any other desired antigen binding fragment, and expressed in any desired host including mammalian cells, insect cells, plant cells, yeast, and bacteria.
• Methods for producing chimeric antibodies are known in the art. See e.g., Morrison, Science 229: 1202 (1985); Oi et al., BioTechniques 4:214 (1986); Gillies et al., (1989) J. Immunol.
• Antibodies can be humanized using a variety of techniques including CDR-grafting (EP 0 239 400; WO 91/09967; US Patent 5,530,101; and 5,585,089), veneering or resurfacing (EP 0 592 106; EP 0 519 596; Padlan E.A., Molecular Immunology 28(4/5):489-498 (1991); Studnicka et al., Protein Engineering 7(6):805-814 (1994); Roguska. et al., PNAS 91:969-973 (1994)), and chain shuffling (US Patent 5,565,332).
• Human antibodies can be made by a variety of methods known in the art including phage display methods described above. See also, US Patent Nos. 4,444,887, 4,716,11 1 , 5,545,806, and 5,814,318; and WO 98/46645, WO 98/50433, WO 98/24893, WO 98/16654, WO 96/34096, WO 96/33735, and WO 91/10741 (said references incorporated by reference in their entireties).
• antibodies recombinantly fused or chemically conjugated (including both covalently and non-covalently conjugations) to a polypeptide of the present invention may be specific for antigens other than polypeptides of the present invention.
• antibodies may be used to target the polypeptides of the present invention to particular cell types, either in vitro or in vivo, by fusing or conjugating the polypeptides of the present invention to antibodies specific for particular cell surface receptors.
• Antibodies fused or conjugated to the polypeptides of the present invention may also be used in in vitro immunoassays and purification methods using methods known in the art. See e.g., Harbor et al.
• the present invention further includes compositions comprising the polypeptides of the present invention fused or conjugated to antibody domains other than the variable regions.
• the polypeptides of the present invention may be fused or conjugated to an antibody Fc region, or portion thereof.
• the antibody portion fused to a polypeptide of the present invention may comprise the hinge region, CHI domain, CH2 domain, and CH3 domain or any combination of whole domains or portions thereof.
• the polypeptides of the present invention may be fused or conjugated to the above antibody portions to increase the in vivo half life of the polypeptides or for use in immunoassays using methods known in the art.
• the polypeptides may also be fused or conjugated to the above antibody portions to form multimers.
• Fc portions fused to the polypeptides of the present invention can form dimers through disulfide bonding between the Fc portions. Higher multimeric forms can be made by fusing the polypeptides to portions of IgA and IgM.
• the invention further relates to antibodies which act as agonists or antagonists of the polypeptides of the present invention.
• the present invention includes antibodies which disrupt the receptor/ligand interactions with the polypeptides of the invention either partially or fully. Included are both receptor-specific antibodies and ligand-specific antibodies. Included are receptor-specific antibodies which do not prevent ligand binding but prevent receptor activation. Receptor activation (i.e., signaling) may be determined by techniques described herein or otherwise known in the art. Also included are receptor-specific antibodies which both prevent ligand binding and receptor activation.
• neutralizing antibodies which bind the ligand and prevent binding of the ligand to the receptor, as well as antibodies which bind the ligand, thereby preventing receptor activation, but do not prevent the ligand from binding the receptor.
• antibodies which activate the receptor may act as agonists for either all or less than all of the biological activities affected by ligand-mediated receptor activation.
• the antibodies may be specified as agonists or antagonists for biological activities comprising specific activities disclosed herein.
• the above antibody agonists can be made using methods known in the art. See e.g., WO 96/40281; US Patent 5,811,097; Deng et al., Blood 92(6): 1981- 1988 (1998); Chen, et al., Cancer Res.
• antibodies to the polypeptides of the invention can, in turn, be utilized to generate anti-idiotype antibodies that "mimic" polypeptides of the invention using techniques well known to those skilled in the art. (See, e.g., Greenspan & Bona, FASEB J. 7(5):437-444; (1989) and Nissinoff, J. Immunol. 147(8):2429- 2438 (1991)).
• antibodies which bind to and competitively inhibit polypeptide multimerization and/or binding of a polypeptide of the invention to ligand can be used to generate anti-idiotypes that "mimic" the polypeptide mutimerization and/or binding domain and, as a consequence, bind to and neutralize polypeptide and/or its ligand.
• anti-idiotypes or Fab fragments of such anti-idiotypes can be used in therapeutic regimens to neutralize polypeptide ligand.
• anti-idiotypic antibodies can be used to bind a polypeptide of the invention and/or to bind its ligands/receptors, and thereby block its biological activity.
• the invention further relates to a diagnostic kit for use in screening serum containing antibodies specific TR12 polynucleotides and polypeptides.
• a diagnostic kit for use in screening serum containing antibodies specific TR12 polynucleotides and polypeptides.
• a kit may include a substantially isolated polypeptide antigen comprising an epitope which is specifically immunoreactive with at least one anti- polypeptide antigen antibody.
• Such a kit also includes means for detecting the binding of said antibody to the antigen.
• the kit may include a recombinantly produced or chemically synthesized polypeptide antigen.
• the polypeptide antigen of the kit may also be attached to a solid support.
• the detecting means of the above-described kit includes a solid support to which said polypeptide antigen is attached.
• a kit may also include a non-attached reporter-labelled anti-human antibody.
• binding of the antibody to the polypeptide antigen can be detected by binding of the said reporter-labelled antibody.
• the invention further includes a method of detecting proliferative and/or cancerous disorders and conditions in a test subject.
• This detection method includes reacting serum from a test subject (e.g. one in which proliferative and/or cancerous cells or tissues may be present) with a substantially isolated polypeptide and/or polynucleotide antigen, and examining the antigen for the presence of bound antibody.
• the method includes a polypeptide antigen attached to a solid support, and the serum is reacted with the support. Subsequently, the support is reacted with a reporter labelled anti-human antibody. The solid support is then examined for the presence of reporter-labelled antibody.
• the invention includes a proliferative condition vaccine composition.
• the composition includes a substantially isolated polypeptide and/or polynucleotide antigen, where the antigen includes -an epitope which is specifically immunoreactive with at least antibody specific for the epitope.
• the peptide and/or polynucleotide antigen may be produced according to methods known in the art, including recombinant expression or chemical synthesis.
• the peptide antigen is preferably present in a pharmacologically effective dose in a pharmaceutically acceptable carrier.
• the invention includes a monoclonal antibody that is specifically immunoreactive with polypeptide and/or polynucleotide epitopes.
• the invention includes a substantially isolated preparation of polyclonal antibodies specifically immunoreactive with polynucleotides and/or polypeptides of the present invention.
• polyclonal antibodies are prepared by affinity chromatography, in addition to, other methods known in the art.
• the invention includes a method for producing antibodies to polypeptide and/or polynucleotide antigens.
• the method includes administering to a test subject a substantially isolated polypeptide and/or polynucleotide antigen, where the antigen includes an epitope which is specifically immunoreactive with at least one anti- polypeptide and/or polynucleotide antibody.
• the antigen is administered in an amount sufficient to produce an immune response in the subject.
• the invention includes a diagnostic kit for use in screening serum containing antigens of the polypeptide of the invention.
• the diagnostic kit includes a substantially isolated antibody specifically immunoreactive with polypeptide or polynucleotide antigens, and means for detecting the binding of the polynucleotide or polypeptide antigen to the antibody.
• the antibody is attached to a solid support.
• the antibody may be a monoclonal antibody.
• the detecting means of the kit may include a second, labelled monoclonal antibody. Alternatively, or in addition, the detecting means may include a labelled, competing antigen.
• test serum is reacted with a solid phase reagent having a surface-bound antigen obtained by the methods of the present invention.
• the reagent After binding with specific antigen antibody to the reagent and removing unbound serum components by washing, the reagent is reacted with reporter-labelled anti-human antibody to bind reporter to the reagent in proportion to the amount of bound anti- antigen antibody on the solid support.
• the reagent is again washed to remove unbound labelled antibody, and the amount of reporter associated with the reagent is determined.
• the reporter is an enzyme which is detected by incubating the solid phase in the presence of a suitable fluorometric or colorimetric substrate (Sigma, St. Louis, MO).
• the solid surface reagent in the above assay is prepared by known techniques for attaching protein material to solid support material, such as polymeric beads, dip sticks, 96-well plate or filter material. These attachment methods generally include nonspecific adsorption of the protein to the support or covalent attachment of the protein, typically through a free amine group, to a chemically reactive group on the solid support, such as an activated carboxyl, hydroxyl, or aldehyde group. Alternatively, streptavidin coated plates can be used in conjunction with biotinylated antigen(s).
• the invention proviedes an assay system or kit for carrying out this diagnostic method.
• the kit generally includes a support with surface-bound recombinant antigens, and a reporter-labelled anti-human antibody for detecting surface- bound anti-antigen antibody.
• TR12 polynucleotides of the invention can be used in numerous ways as reagents. The following description should be considered exemplary and utilizes known techniques.
• sequences can be mapped to chromosomes by preparing PCR primers (preferably 15-25 bp) from the sequences shown in SEQ ID NOT. Primers can be selected using computer analysis so that primers do not span more than one predicted exon in the genomic DNA. These primers are then used for PCR screening of somatic cell hybrids containing individual human chromosomes. Only those hybrids containing the human TR12 gene corresponding to the SEQ ID NOT will yield an amplified fragment.
• somatic hybrids provide a rapid method of PCR mapping the polynucleotides to particular chromosomes. Three or more clones can be assigned per day using a single thermal cycler. Moreover, sublocalization of the TRI 2 polynucleotides can be achieved with panels of specific chromosome fragments. Other gene mapping strategies that can be used include in situ hybridization, prescreening with labeled flow-sorted chromosomes, and preselection by hybridization to construct chromosome specific-cDNA libraries. Precise chromosomal location of the TRI 2 polynucleotides can also be achieved using fluorescence in situ hybridization (FISH) of a metaphase chromosomal spread.
• FISH fluorescence in situ hybridization
• the TRI 2 polynucleotides can be used individually (to mark a single chromosome or a single site on that chromosome) or in panels (for marking multiple sites and/or multiple chromosomes).
• Preferred polynucleotides correspond to the noncoding regions of the cDNAs because the coding sequences are more likely conserved within gene families, thus increasing the chance of cross hybridization during chromosomal mapping.
• Linkage analysis establishes coinheritance between a chromosomal location and presentation of a particular disease.
• Disease mapping data are found, for example, in V. McKusick, Mendelian Inheritance in Man (available on line through Johns Hopkins University Welch Medical Library) .
• a cDNA precisely localized to a chromosomal region associated with the disease could be one of 50-500 potential causative genes.
• TRI 2 polynucleotide and the corresponding gene between affected and unaffected individuals can be examined.
• visible structural alterations in the chromosomes such as deletions or translocations, are examined in chromosome spreads or by PCR. If no structural alterations exist, the presence of point mutations are ascertained. Mutations observed in some or all affected individuals, but not in normal individuals, indicates that the mutation may cause the disease.
• complete sequencing of the TRI 2 polypeptide and the corresponding gene from several normal individuals is required to distinguish the mutation from a polymo ⁇ hism. If a new polymo ⁇ hism is identified, this polymo ⁇ hic polypeptide can be used for further linkage analysis.
• TR12 polynucleotides can be used to control gene expression through triple helix formation or antisense DNA or RNA. Both methods rely on binding of the polynucleotide to DNA or RNA. For these techniques, preferred polynucleotides are usually 20 to 40 bases in length -and complementary to either the region of the gene involved in transcription (triple helix - see Lee et al., Nucl. Acids Res.
• TRI 2 polynucleotides are also useful in gene therapy.
• One goal of gene therapy is to insert a normal gene into an organism having a defective gene, in an effort to correct the genetic defect.
• TRI 2 offers a means of targeting such genetic defects in a highly accurate manner.
• Another goal is to insert a new gene that was not present in the host genome, thereby producing a new trait in the host cell.
• the TRI 2 polynucleotides are also useful for identifying individuals from minute biological samples.
• the United States military for example, is considering the use of restriction fragment length polymo ⁇ hism (RFLP) for identification of its personnel.
• RFLP restriction fragment length polymo ⁇ hism
• an individual's genomic DNA is digested with one or more restriction enzymes, and probed on a Southern blot to yield unique bands for identifying personnel.
• This method does not suffer from the current limitations of "Dog Tags" which can be lost, switched, or stolen, making positive identification difficult.
• the TRI 2 polynucleotides can be used as additional DNA markers for RFLP.
• the TRI 2 polynucleotides can also be used as an alternative to RFLP, by determining the actual base-by-base DNA sequence of selected portions of an individual's genome. These sequences can be used to prepare PCR primers for amplifying and isolating such selected DNA, which can then be sequenced. Using this technique, individuals can be identified because each individual will have a unique set of DNA sequences. Once an unique ID database is established for an individual, positive identification of that individual, living or dead, can be made from extremely small tissue samples.
• DNA sequences taken from very small biological samples such as tissues, e.g., hair or skin, or body fluids, e.g., blood, saliva, semen, etc.
• DNA sequences amplified from polymo ⁇ hic loci such as DQa class II HLA gene, are used in forensic biology to identify individuals.
• TR12 polynucleotides can be used as polymo ⁇ hic markers for forensic pu ⁇ oses.
• reagents capable of identifying the source of a particular tissue. Such need arises, for example, in forensics when presented with tissue of unknown origin.
• Appropriate reagents can comprise, for example, DNA probes or primers specific to particular tissue prepared from TRI 2 sequences. Panels of such reagents can identify tissue by species and/or by organ type. In a similar fashion, these reagents can be used to screen tissue cultures for contamination.
• TR12 polynucleotides are useful as hybridization probes for differential identification of the tissue(s) or cell type(s) present in a biological sample.
• polypeptides and antibodies directed to TR12 polypeptides are useful to provide immunological probes for differential identification of the tissue(s) or cell type(s).
• TR12 gene expression may be detected in certain tissues (e.g., cancerous and wounded tissues) or bodily fluids (e.g., serum, plasma, urine, synovial fluid or spinal fluid) taken from an individual having such a disorder, relative to a "standard" TR12 gene expression level, i.e., the TR12 expression level in healthy tissue from an individual not having the autoimmune disorder or other disorder of the immune system, or hemostasis, angiogenesis, tumor metastasis, cellular migration, or neurogenesis disorder.
• tissues e.g., cancerous and wounded tissues
• bodily fluids e.g., serum, plasma, urine, synovial fluid or spinal fluid
• the invention provides a diagnostic method of a disorder, which involves: (a) assaying TRI 2 gene expression level in cells or body fluid of an individual; (b) comparing the TR12 gene expression level with a standard TR12 gene expression level, whereby an increase or decrease in the assayed TRI 2 gene expression level compared to the standard expression level is indicative of an autoimmune disorder or other disorder of the immune system, or disorder of hemostasis, angiogenesis, tumor metastasis, cellular migration, or neurogenesis.
• the TRI 2 polynucleotides can be used as molecular weight markers on Southern gels, as diagnostic probes for the presence of a specific mRNA in a particular cell type, as a probe to "subtract-out" known sequences in the process of discovering novel polynucleotides, for selecting and making oligomers for attachment to a "gene chip” or other support, to raise anti-DNA antibodies using DNA immunization techniques, and as an antigen to elicit an immune response.
• TRI 2 polypeptides of the invention can be used in numerous ways. The following description should be considered exemplary and utilizes known techniques.
• TRI 2 polypeptides of the invention can be used to assay protein levels in a biological sample using antibody-based techniques.
• protein expression in tissues can be studied with classical immunohistological methods.
• Other antibody-based methods useful for detecting protein gene expression include immunoassays, such as the enzyme linked immunosorbent assay (ELISA) and the radioimmunoassay (RIA).
• ELISA enzyme linked immunosorbent assay
• RIA radioimmunoassay
• Suitable antibody assay labels are known in the art and include enzyme labels, such as, glucose oxidase, and radioisotopes, such as iodine (1251, 1211), carbon (14C), sulfur (35S), tritium (3H), indium (112In), and technetium (99mTc), and fluorescent labels, such as fluorescein and rhodamine, and biotin.
• enzyme labels such as, glucose oxidase, and radioisotopes, such as iodine (1251, 1211), carbon (14C), sulfur (35S), tritium (3H), indium (112In), and technetium (99mTc)
• fluorescent labels such as fluorescein and rhodamine, and biotin.
• proteins can also be detected in vivo by imaging.
• Antibody labels or markers for in vivo imaging of protein include those detectable by X-radiography, NMR or ESR.
• suitable labels include radioisotopes such as barium or cesium, which emit detectable radiation but are not overtly harmful to the subject.
• suitable markers for NMR and ESR include those with a detectable characteristic spin, such as deuterium, which may be inco ⁇ orated into the antibody by labeling of nutrients for the relevant hybridoma.
• a protein-specific antibody or antibody fragment which has been labeled with an appropriate detectable imaging moiety such as a radioisotope (for example, 1311, 112In, 99mTc), a radio-opaque substance, or a material detectable by nuclear magnetic resonance, is introduced (for example, parenterally, subcutaneously, or intraperitoneally) into the mammal.
• a radioisotope for example, 1311, 112In, 99mTc
• a radio-opaque substance for example, parenterally, subcutaneously, or intraperitoneally
• the quantity of radioactivity injected will normally range from about 5 to 20 millicuries of 99mTc.
• the labeled antibody or antibody fragment will then preferentially accumulate at the location of cells which contain the specific protein.
• In vivo tumor imaging is described in S.W. Burchiel et-al., "Immunopharmacokinetics of Radiolabeled Antibodies and Their Fragments.” (Chapter 13 in Tumor Imaging: The Radiochemical Detection of Cancer, S.W. Burchiel and B. A. Rhodes, eds., Masson Publishing Inc. (1982).)
• the invention provides a diagnostic method of a disorder, which involves
• TRI 2 polypeptides can be used to treat disease.
• patients can be administered TRI 2 polypeptides in an effort to replace absent or decreased levels of the TRI 2 polypeptide, to supplement absent or decreased levels of a different polypeptide, to inhibit the activity of a polypeptide, to activate the activity of a polypeptide (e.g., by binding to a receptor), to reduce the activity of a membrane bound receptor or ligand by competing with it for free ligand (e.g., soluble TNF receptors used in reducing inflammation), or to bring about a desired response (e.g., blood vessel growth and/or formation).
• free ligand e.g., soluble TNF receptors used in reducing inflammation
• antibodies directed to TRI 2 polypeptides can also be used to treat disease.
• administration of an antibody directed to a TRI 2 polypeptide can bind and reduce ove ⁇ roduction of the polypeptide.
• administration of an antibody can activate the polypeptide, such as by binding to a polypeptide bound to a membrane (receptor).
• the TRI 2 polypeptides can be used as molecular weight markers on SDS-PAGE gels or on molecular sieve gel filtration columns using methods well known to those of skill in the art.
• TR12 polypeptides can also be used to raise antibodies, which in turn are used to measure protein expression from a recombinant cell, as a way of assessing transformation of the host cell.
• TRI 2 polypeptides can be used to test for biological activity.
• Tumor Necrosis Factor (TNF) family ligands are known to be among the most pleiotropic cytokines, inducing a large number of cellular responses, including cytotoxicity, anti-viral activity, immunoregulatory activities, and the transcriptional regulation of several genes (Goeddel et al, "Tumor Necrosis Factors: Gene Structure and Biological Activities," Symp. Quant. Biol. 51:591- 609 (1986), Cold Spring Harbor; Beutler and Cerami, Annu. Rev. Biochem. 57:505-518 (1988); Old, Sci. Am. 258:59-15 (1988); Fiers, FEBS Lett. 285: 199-224 (1991)).
• TR12 polynucleotides, polypeptides, agonists and/or antagonists of the invention may be administered to a patient (e.g., mammal, preferably human) afflicted with any disease or disorder mediated (directly or indirectly) by defective, or deficient levels of, TRI 2.
• a gene therapy approach may be applied to treat such diseases or disorders.
• TRI 2 polynucleotide sequences are used to detect mutein TRI 2 genes, including defective genes.
• Mutein genes may be identified in in vitro diagnostic assays, and by comparison of the TRI 2 nucleotide sequence disclosed herein with that of a TRI 2 gene obtained from a patient suspected of harboring a defect in this gene. Defective genes may be replaced with normal TR12-encoding genes using techniques known to one skilled in the art.
• the TR12 polypeptides, polynucleotides, agonists and/or antagonists of the present invention are used as research tools for studying the phenotypic effects that result from inhibiting TNF ligand/TR12 interactions on various cell types.
• TR12 polypeptides and antagonists e.g. monoclonal antibodies to TR12 also may be used in in vitro assays for detecting TRI 2 ligand(s) or TRI 2 or the interactions thereof.
• TR12 polynucleotides, polypeptides, agonists and/or antagonists of the invention are used to inhibit a functional activity of TR12 ligand, in in vitro or in vivo procedures.
• TR12 By inhibiting binding of TR12 ligand to cell surface receptors, TR12 also inhibits biological effects that result from the binding of TRI 2 ligand to endogenous receptors.
• Various forms of TR12 may be employed, including, for example, the above-described TR12 fragments, derivatives, and variants that are capable of binding TRI 2 ligand.
• a soluble TRI 2 is employed to inhibit a functional activity of TRI 2 ligand, e.g., to inhibit TR12 ligand-mediated apoptosis or cell signalling of cells susceptible to such apoptosis or cell signalling.
• TR12 is administered to a mammal (e.g., a human) to treat a TR12 ligand-mediated disorder.
• a mammal e.g., a human
• TR12 ligand-mediated disorders include conditions caused (directly or indirectly) or exacerbated by TRI 2 ligand.
• Polynucleotides and/or polypeptides of the invention and/or agonists and/or antagonists thereof are useful in the diagnosis and treatment or prevention of a wide range of diseases and/or conditions.
• diseases and conditions include, but are not limited to, cancer (e.g., immune cell related cancers, breast cancer, prostate cancer, ovarian cancer, follicular lymphoma, cancer associated with mutation or alteration of p53, brain tumor, bladder cancer, uterocervical cancer, colon cancer, colorectal cancer, non-small cell carcinoma of the lung, small cell carcinoma of the lung, stomach cancer, etc.), lymphoproliferative disorders (e.g., lymphadenopathy), microbial (e.g., viral, bacterial, etc.) infection (e.g., HIV-1 infection, HIV-2 infection, he ⁇ esvirus infection (including, but not limited to, HSV-1, HSV-2, CMV, VZV, HHV-6, HHV-7, EBV), adenovirus infection, po
• osteomyelodysplasia e.g., aplastic anemia, etc.
• liver disease e.g., acute and chronic hepatitis, liver injury, and cirrhosis
• autoimmune disease e.g., multiple sclerosis, rheumatoid arthritis, systemic lupus erythematosus, immune complex glomerulonephritis, autoimmune diabetes, autoimmune thrombocytopenic pu ⁇ ura, Grave's disease, Hashimoto's thyroiditis, etc.
• cardiomyopathy e.g., dilated cardiomyopathy
• diabetes diabetic complications (e.g., diabetic nephropathy, diabetic neuropathy, diabetic retinopathy), influenza, asthma, psoriasis, glomemlonephritis, septic shock, and ulcerative colitis.
• Polynucleotides and/or polypeptides of the invention and/or agonists and/or antagonists thereof are useful in promoting angiogenesis, regulating hematopoiesis and wound healing (e.g., wounds, burns, and bone fractures).
• Polynucleotides and/or polypeptides of the invention and or agonists and/or antagonists thereof are also useful as an adjuvant to enhance immune responsiveness to specific antigen, anti-viral immune responses. More generally, polynucleotides, polypeptides, and/or agonists or antagonists of the invention are useful in regulating (i.e., elevating or reducing) immune response. For example, polynucleotides, polypeptides, and/or agonists or antagonists of the invention may be useful in preparation or recovery from surgery, trauma, radiation therapy, chemotherapy, and transplantation, or may be used to boost immune response and/or recovery in the elderly and immunocompromised individuals.
• polynucleotides, polypeptides, and/or agonists or antagonists of the invention are useful as immunosuppressive agents, for example in the treatment or prevention of autoimmune disorders.
• polynucleotides, polypeptides, and/or agonists or antagonists of the invention are used to treat or prevent chronic inflammatory, allergic or autoimmune conditions, such as those described herein or are otherwise known in the art.
• TRI 2 polynucleotides and polypeptides can be used in assays to test for one or more biological activities. If TR12 polynucleotides and polypeptides, or molecules that bind to TR12, do exhibit activity in a particular assay, it is likely that TR12 may be involved in the diseases associated with the biological activity. Therefore, TR12, or molecules that bind to TRI 2, could be used to treat the associated disease.
• TR12 polynucleotides or polypeptides, or agonists or antagonists of TR12 may be useful in treating deficiencies or disorders of the immune system, by activating or inhibiting the proliferation, differentiation, or mobilization (chemotaxis) of immune cells.
• Immune cells develop through a process called hematopoiesis, producing myeloid (platelets, red blood cells, neutrophils, and macrophages) and lymphoid (B and T lymphocytes) cells from pluripotent stem cells.
• TRI 2 polynucleotides or polypeptides, or agonists or antagonists of TRI 2 can be used as a marker or detector of a particular immune system disease or disorder.
• TR12 polynucleotides or polypeptides, or agonists or antagonists of TR12 may be useful in treating or detecting deficiencies or disorders of hematopoietic cells.
• TR12 polynucleotides or polypeptides, or agonists or antagonists of TR12 could be used to increase differentiation and proliferation of hematopoietic cells, including the pluripotent stem cells, in an effort to treat those disorders associated with a decrease in certain (or many) types hematopoietic cells.
• immunologic deficiency syndromes include, but are not limited to: blood protein disorders (e.g.
• agammaglobulinemia agammaglobulinemia, dysgammaglobulinemia), ataxia telangiectasia, common variable immunodeficiency, Digeorge Syndrome, HIV infection, HTLV-BLV infection, leukocyte adhesion deficiency syndrome, lymphopenia, phagocyte bactericidal dysfunction, severe combined immunodeficiency (SCIDs), Wiskott-Aldrich Disorder, anemia, thrombocytopenia, or hemoglobinuria.
• SIDs severe combined immunodeficiency
• TRI 2 polynucleotides, polypeptides and/or agonists or antagonists of the invention may be employed to inhibit the proliferation and differentiation of hematopoietic cells and therefore may be employed to protect bone marrow stem cells from chemotherapeutic agents during chemotherapy. This antiproliferative effect may allow administration of higher doses of chemotherapeutic agents and, therefore, more effective chemotherapeutic treatment.
• TRI 2 polynucleotides, polypeptides, and/or agonists or antagonists of the invention may be employed to stimulate the proliferation and/or differentiation of hematopoietic cells (e.g., to stimulate lymphopoiesis and or erythropoiesis).
• polynucleotides and/or polypeptides of the invention may also be empolyed for the expansion of immature hematopoeitic progenitor cells, for example, granulocytes, macrophages or monocytes (e.g., CD34+, kit+), by temporarily preventing their differentiation.
• immature hematopoeitic progenitor cells for example, granulocytes, macrophages or monocytes (e.g., CD34+, kit+)
• monocytes e.g., CD34+, kit+
• TR12 may be useful as a modulator of hematopoietic stem cells in vitro for the pu ⁇ ose of bone marrow transplantation and/or gene therapy.
• Stem cells can be enriched by culturing cells in the presence of cytotoxins, such as 5-Fu, which kills rapidly dividing cells, whereas the stem cells will be protected by the TRI 2 polynucleotides, polypeptides, and/or agonists or antagonists.
• cytotoxins such as 5-Fu
• These stem cells can be returned to a bone marrow transplant patient or can then be used for transfection of the desired gene for gene therapy.
• TRI 2 polynucleotides, polypeptides, and/or agonists or antagonists can be injected into animals which results in the release of stem cells from the bone marrow of the animal into the peripheral blood.
• These stem cells can be isolated for the purpose of autologous bone marrow transplantation or manipulation for gene therapy. After the patient has finished chemotherapy or radiation treatment, the isolated stem cells can be returned to the patient.
• TRI 2 polynucleotides or polypeptides, or agonists or antagonists of TRI 2 can also be used to modulate hemostatic (the stopping of bleeding) or thrombolytic activity (clot formation).
• hemostatic the stopping of bleeding
• thrombolytic activity clot formation
• TRI 2 polynucleotides or polypeptides, or agonists or antagonists of TR12 could be used to treat blood coagulation disorders (e.g., afibrinogenemia, factor deficiencies), blood platelet disorders (e.g. thrombocytopenia), or wounds resulting from trauma, surgery, or other causes.
• TRI 2 polynucleotides or polypeptides, or agonists or antagonists of TRI 2 that can decrease hemostatic or thrombolytic activity could be used to inhibit or dissolve clotting, important in the treatment of heart attacks (infarction), strokes, or scarring.
• TRI 2 polynucleotides or polypeptides, or agonists or antagonists of TRI 2 may also be useful in treating or detecting autoimmune disorders.
• Many autoimmune disorders result from inappropriate recognition of self as foreign material by immune cells. This inappropriate recognition results in an immune response leading to the destmction of the host tissue. Therefore, the administration of TRI 2 polynucleotides or polypeptides, or agonists or antagonists of TR12, that can inhibit an immune response, particularly the proliferation, differentiation, or chemotaxis of T-cells, may be an effective therapy in preventing autoimmune disorders.
• autoimmune disorders examples include, but are not limited to: Addison's Disease, hemolytic anemia, antiphospholipid syndrome, rheumatoid arthritis, dermatitis, allergic encephalomyelitis, glomemlonephritis, Goodpasture's Syndrome, Graves' Disease, Multiple Sclerosis, Myasthenia Gravis, Neuritis, Ophthalmia, Bullous Pemphigoid, Pemphigus, Polyendocrinopathies, Pu ⁇ ura, Reiter's Disease, Stiff-Man Syndrome, Autoimmune Thyroiditis, Systemic Lupus Erythematosus, Autoimmune Pulmonary Inflammation, Guillain-Barre Syndrome, insulin dependent diabetes mellitis, and autoimmune inflammatory eye disease.
• TRI 2 polynucleotides or polypeptides may also be treated by TRI 2 polynucleotides or polypeptides, or agonists or antagonists of TRI 2.
• these molecules can be used to treat anaphylaxis, hypersensitivity to an antigenic molecule, or blood group incompatibility.
• TR12 polynucleotides or polypeptides, or agonists or antagonists of TR12 may also be used to treat and/or prevent organ rejection or graft-versus-host disease (GVHD).
• Organ rejection occurs by host immune cell destmction of the transplanted tissue through an immune response.
• an immune response is also involved in GVHD, but, in this case, the foreign transplanted immune cells destroy the host tissues.
• TRI 2 polynucleotides or polypeptides, or agonists or antagonists of TR12, that inhibits an immune response, particularly the proliferation, differentiation, or chemotaxis of T-cells, may be an effective therapy in preventing organ rejection or GVHD.
• TRI 2 polynucleotides or polypeptides, or agonists or antagonists of TR12 may also be used to modulate inflammation.
• TR12 polynucleotides or polypeptides, or agonists or antagonists of TRI 2 may inhibit the proliferation and differentiation of cells involved in an inflammatory response.
• These molecules can be used to treat inflammatory conditions, both chronic and acute conditions, including inflammation associated with infection (e.g., septic shock, sepsis, or systemic inflammatory response syndrome (SIRS)), ischemia-reperfusion injury, endotoxin lethality, arthritis, complement-mediated hyperacute rejection, nephritis, cytokine or chemokine induced lung injury, inflammatory bowel disease, Crohn's disease, or resulting from over production of cytokines (e.g., TNF or IL-1.)
• infection e.g., septic shock, sepsis, or systemic inflammatory response syndrome (SIRS)
• ischemia-reperfusion injury e.g., endotoxin lethality, arthritis, complement-mediated hyperacute rejection, nephritis, cytokine or chemokine induced lung injury, inflammatory bowel disease, Crohn's disease, or resulting from over production of cytokines (e.g.
• TR12 polynucleotides or polypeptides, or agonists or antagonists of TR12
• TR12 e.g., molecules that bind TR12
• TR12 polynucleotides or polypeptides, or agonists or antagonists of TR12 may inhibit the proliferation of the disorder through direct or indirect interactions.
• TRI 2 polynucleotides or polypeptides, or agonists or antagonists of TRI 2 may proliferate other cells which can inhibit the hype ⁇ roliferative disorder.
• hype ⁇ roliferative disorders can be treated.
• This immune response may be increased by either enhancing an existing immune response, or by initiating a new immune response.
• decreasing an immune response may also be a method of treating hype ⁇ roliferative disorders, such as a chemotherapeutic agent.
• hype ⁇ roliferative disorders that can be treated or detected by TRI 2 polynucleotides or polypeptides, or agonists or antagonists of TRI 2, include, but are not limited to neoplasms located in the: abdomen, bone, breast, digestive system, liver, pancreas, peritoneum, endocrine glands (adrenal, parathyroid, pituitary, testicles, ovary, thymus, thyroid), eye, head and neck, nervous (central and peripheral), lymphatic system, pelvic, skin, soft tissue, spleen, thoracic, and urogenital.
• other hype ⁇ roliferative disorders can also be treated or detected by
• hype ⁇ roliferative disorders include, but are not limited to: hypergammaglobulinemia, lymphoproliferative disorders, paraproteinemias, purpura, sarcoidosis, Sezary Syndrome, Waldenstron's Macroglobulinemia, Gaucher's Disease, histiocytosis, and any other hype ⁇ roliferative disease, besides neoplasia, located in an organ system listed above.
• TRI 2 polynucleotides or polypeptides, or agonists or antagonists of TRI 2, encoding TR12 may be used to treat cardiovascular disorders, including peripheral artery disease, such as limb ischemia.
• Cardiovascular disorders include cardiovascular abnormalities, such as arterio- arterial fistula, arteriovenous fistula, cerebral arteriovenous malformations, congenital heart defects, pulmonary atresia, and Scimitar Syndrome.
• Congenital heart defects include aortic coarctation, cor triatriatum, coronary vessel anomalies, crisscross heart, dextrocardia, patent ductus arteriosus, Ebstein's anomaly, Eisenmenger complex, hypoplastic left heart syndrome, levocardia, tetralogy of fallot, transposition of great vessels, double outlet right ventricle, tricuspid atresia, persistent t ncus arteriosus, and heart septal defects, such as aortopulmonary septal defect, endocardial cushion defects, Lutembacher's Syndrome, trilogy of Fallot, ventricular heart septal defects.
• Cardiovascular disorders also include heart disease, such as arrhythmias, carcinoid heart disease, high cardiac output, low cardiac output, cardiac tamponade, endocarditis (including bacterial), heart aneurysm, cardiac arrest, congestive heart failure, congestive cardiomyopathy, paroxysmal dyspnea, cardiac edema, heart hypertrophy, congestive cardiomyopathy, left ventricular hypertrophy, right ventricular hypertrophy, post-infarction heart rupture, ventricular septal mpture, heart valve diseases, myocardial diseases, myocardial ischemia, pericardial effusion, pericarditis (including constrictive and tuberculous), pneumopericardium, postpericardiotomy syndrome, pulmonary heart disease, rheumatic heart disease, ventricular dysfunction, hyperemia, cardiovascular pregnancy complications, Scimitar Syndrome, cardiovascular syphilis, and cardiovascular tuberculosis.
• heart disease such as arrhythmias, carcinoid heart disease, high cardiac output,
• Arrhythmias include sinus arrhythmia, atrial fibrillation, atrial flutter, bradycardia, extrasystole, Adams-Stokes Syndrome, bundle-branch block, sinoatrial block, long QT syndrome, parasystole, Lown-Ganong-Levine Syndrome, Mahaim- type pre-excitation syndrome, Wolff-Parkinson-White syndrome, sick sinus syndrome, tachycardias, and ventricular fibrillation.
• Tachycardias include paroxysmal tachycardia, supraventricular tachycardia, accelerated idioventricular rhythm, atrioventricular nodal reentry tachycardia, ectopic atrial tachycardia, ectopic junctional tachycardia, sinoatrial nodal reentry tachycardia, sinus tachycardia, Torsades de Pointes, and ventricular tachycardia.
• Heart valve disease include aortic valve insufficiency, aortic valve stenosis, hear murmurs, aortic valve prolapse, mitral valve prolapse, tricuspid valve prolapse, mitral valve insufficiency, mitral valve stenosis, pulmonary atresia, pulmonary valve insufficiency, pulmonary valve stenosis, tricuspid atresia, tricuspid valve insufficiency, and tricuspid valve stenosis.
• Myocardial diseases include alcoholic cardiomyopathy, congestive cardiomyopathy, hypertrophic cardiomyopathy, aortic subvalvular stenosis, pulmonary subvalvular stenosis, restrictive cardiomyopathy, Chagas cardiomyopathy, endocardial fibroelastosis, endomyocardial fibrosis, Kearns Syndrome, myocardial reperfusion injury, and myocarditis.
• Myocardial ischemias include coronary disease, such as angina pectoris, coronary aneurysm, coronary arteriosclerosis, coronary thrombosis, coronary vasospasm, myocardial infarction and myocardial stunning.
• coronary disease such as angina pectoris, coronary aneurysm, coronary arteriosclerosis, coronary thrombosis, coronary vasospasm, myocardial infarction and myocardial stunning.
• Cardiovascular diseases also include vascular diseases such as aneurysms, angiodysplasia, angiomatosis, bacillary angiomatosis, Hippel-Lindau Disease, Klippel- Trenaunay-Weber Syndrome, Sturge- Weber Syndrome, angioneurotic edema, aortic diseases, Takayasu's Arteritis, aortitis, Leriche's Syndrome, arterial occlusive diseases, arteritis, enarteritis, polyarteritis nodosa, cerebrovascular disorders, diabetic angiopathies, diabetic retinopathy, embolisms, thrombosis, erythromelalgia, hemorrhoids, hepatic veno-occlusive disease, hypertension, hypotension, ischemia, peripheral vascular diseases, phlebitis, pulmonary veno-occlusive disease, Raynaud's disease, CREST syndrome, retinal
• Aneurysms include dissecting aneurysms, false aneurysms, infected aneurysms, mptured aneurysms, aortic aneurysms, cerebral aneurysms, coronary aneurysms, heart aneurysms, and iliac aneurysms.
• Arterial occlusive diseases include arteriosclerosis, intermittent claudication, carotid stenosis, fibromuscular dysplasias, mesenteric vascular occlusion, Moyamoya disease, renal artery obstruction, retinal artery occlusion, and thromboangiitis obliterans.
• Cerebrovascular disorders include carotid artery diseases, cerebral amyloid angiopathy, cerebral aneurysm, cerebral anoxia, cerebral arteriosclerosis, cerebral arteriovenous malformation, cerebral artery diseases, cerebral embolism and thrombosis, carotid artery thrombosis, sinus thrombosis, Wallenberg's syndrome, cerebral hemorrhage, epidural hematoma, subdural hematoma, subaraxhnoid hemorrhage, cerebral infarction, cerebral ischemia (including transient), subclavian steal syndrome, periventricular leukomalacia, vascular headache, cluster headache, migraine, and vertebrobasilar insufficiency.
• Embolisms include air embolisms, amniotic fluid embolisms, cholesterol embolisms, blue toe syndrome, fat embolisms, pulmonary embolisms, and thromoboembolisms.
• Thrombosis include coronary thrombosis, hepatic vein thrombosis, retinal vein occlusion, carotid artery thrombosis, sinus thrombosis, Wallenberg's syndrome, and thrombophlebitis.
• Ischemia includes cerebral ischemia, ischemic colitis, compartment syndromes, anterior compartment syndrome, myocardial ischemia, reperfusion injuries, and peripheral limb ischemia.
• Vasculitis includes aortitis, arteritis, Behcet's Syndrome, Churg-Strauss Syndrome, mucocutaneous lymph node syndrome, thromboangiitis obliterans, hypersensitivity vasculitis, Schoenlein-Henoch pu ⁇ ura, allergic cutaneous vasculitis, and Wegener's granulomatosis.
• TR12 polynucleotides or polypeptides, or agonists or antagonists of TR12 are especially effective for the treatment of critical limb ischemia and coronary disease.
• TRI 2 polypeptides may be administered using any method known in the art, including, but not limited to, direct needle injection at the delivery site, intravenous injection, topical administration, catheter infusion, biolistic injectors, particle accelerators, gelfoam sponge depots, other commercially available depot materials, osmotic pumps, oral or suppositorial solid pharmaceutical formulations, decanting or topical applications during surgery, aerosol delivery. Such methods are known in the art.
• TRI 2 polypeptides may be administered as part of a pharmaceutical composition, described in more detail below. Methods of delivering TRI 2 polynucleotides are described in more detail herein.
• angiogenesis is stringently regulated and spatially and temporally delimited. Under conditions of pathological angiogenesis such as that characterizing solid tumor growth, these regulatory controls fail. Unregulated angiogenesis becomes pathologic and sustains progression of many neoplastic and non-neoplastic diseases.
• a number of serious diseases are dominated by abnormal neovascularization including solid tumor growth and metastases, arthritis, some types of eye disorders, and psoriasis. See, e.g., reviews by Moses et al, Biotech. 9:630-634 (1991); Folkman et al, N. Engl. J. Med., 333:1151-1163 (1995); Auerbach et al, J. Microvasc. Res. 29:401-411 (1985); Folkman, Advances in Cancer Research, eds. Klein and Weinhouse, Academic Press, New York, pp. 175-203 (1985); Patz, Am. J. Opthalmol 94:715-743 (1982); and Folkman et al, Science 221:119-125 (1983).
• the present invention provides for treatment of diseases or disorders associated with neovascularization by administration of the TRI 2 polynucleotides and/or polypeptides of the invention, as well as agonists or antagonists of TRI 2.
• Malignant and metastatic conditions which can be treated with the polynucleotides and polypeptides, or agonists or antagonists of the invention include, but are not limited to, malignancies, solid tumors, and cancers described herein and otherwise known in the art (for a review of such disorders, see Fishman et al, Medicine, 2d Ed., J. B . Lippincott Co., Philadelphia (1985)):
• Ocular disorders associated with neovascularization which can be treated with the TRI 2 polynucleotides and polypeptides of the present invention (including TRI 2 agonists and/or antagonists) include, but are not limited to: neovascular glaucoma, diabetic retinopathy, retinoblastoma, retrolental fibroplasia, uveitis, retinopathy of prematurity macular degeneration, corneal graft neovascularization, as well as other eye inflammatory diseases, ocular tumors and diseases associated with choroidal or iris neovascularization. See, e.g., reviews by Waltman et al, Am. J.
• disorders which can be treated with the TR12 polynucleotides and polypeptides of the present invention include, but are not limited to, hemangioma, arthritis, psoriasis, angiofibroma, atherosclerotic plaques, delayed wound healing, -granulations, hemophilic joints, hypertrophic scars, nonunion fractures, Osier- Weber syndrome, pyogenic granuloma, scleroderma, trachoma, and vascular adhesions.
• disorders and/or states, which can be treated with be treated with the TR12 polynucleotides and polypeptides of the present invention include, but are not limited to, hemangioma, arthritis, psoriasis, angiofibroma, atherosclerotic plaques, delayed wound healing, -granulations, hemophilic joints, hypertrophic scars, nonunion fractures, Osier- Weber syndrome, pyogenic granuloma, scler
• TRI 2 polynucleotides and polypeptides of the present invention include, but are not limited to, solid tumors, blood born tumors such as leukemias, tumor metastasis, Kaposi's sarcoma, benign tumors, for example hemangiomas, acoustic neuromas, neurofibromas, trachomas, and pyogenic granulomas, rheumatoid arthritis, psoriasis, ocular angiogenic diseases, for example, diabetic retinopathy, retinopathy of prematurity, macular degeneration, corneal graft rejection, neovascular glaucoma, retrolental fibroplasia, rubeosis, retinoblastoma, and uvietis, delayed wound healing, endometriosis, vascluogenesis, granulations, hypertrophic scars (keloids), nonunion fractures, scleroderma,
• a cellular response to a TNF-family ligand is intended any genotypic, phenotypic, and or mo ⁇ hologic change to a cell, cell line, tissue, tissue culture or patient that is induced by a TNF-family ligand. As indicated, such cellular responses include not only normal physiological responses to TNF-family ligands, but also diseases associated with increased apoptosis or cell signaling or the inhibition of apoptosis or cell signaling.
• Apoptosis-programmed cell death-is a physiological mechanism involved in the deletion of peripheral T lymphocytes of the immune system, and its dysregulation can lead to a number of different pathogenic processes (Ameisen, AIDS ST 197-1213 (1994); Krammer et al, Curr. Opin. Immunol. 6:279-289 (1994)).
• cancers such as follicular lymphomas, carcinomas with p53 mutations, and hormone-dependent tumors, including, but not limited to colon cancer, cardiac tumors, pancreatic cancer, melanoma, retinoblastoma, glioblastoma, lung cancer, intestinal cancer, testicular cancer, stomach cancer, neuroblastoma, myxoma, myoma, lymphoma, endothelioma, osteoblastoma, osteoclastoma, osteosarcoma, chondrosarcoma, adenoma, breast cancer, prostate cancer, Kaposi's sarcoma and ovarian cancer); autoimmune disorders (such as, multiple sclerosis, Sjogren's syndrome, Hashimoto's thyroiditis, biliary cir
• TR12 polynucleotides, polypeptides, and/or antagonists of the invention are used to inhibit growth, progression, and/or metasis of cancers, in particular those listed above or in the paragraph that follows.
• Additional diseases or conditions associated with increased cell survival that could be treated or detected by TRI 2 polynucleotides or polypeptides, or agonists or antagonists of TR12, include, but are not limited to, progression, and/or metastases of malignancies and related disorders such as leukemia (including acute leukemias (e.g., acute lymphocytic leukemia, acute myelocytic leukemia (including myeloblastic, promyelocytic, myelomonocytic, monocytic, and erythroleukemia)) and chronic leukemias (e.g., chronic myelocytic (granulocytic) leukemia and chronic lymphocytic leukemia)), polycythemia vera, lymphomas (e.g., Hodgkin's disease and non-Hodgkin's disease), multiple myeloma, Waldenstrom's macroglobulinemia, heavy chain disease, and solid tumors including, but not limited to, sar
• TR12 polynucleotides or polypeptides include AIDS; neurodegenerative disorders (such as Alzheimer's disease, Parkinson's disease, Amyotrophic lateral sclerosis, Retinitis pigmentosa, Cerebellar degeneration and brain tumor or prior associated disease); autoimmune disorders (such as, multiple sclerosis, Sjogren's syndrome, Hashimoto's thyroiditis, biliary cirrhosis.
• neurodegenerative disorders such as Alzheimer's disease, Parkinson's disease, Amyotrophic lateral sclerosis, Retinitis pigmentosa, Cerebellar degeneration and brain tumor or prior associated disease
• autoimmune disorders such as, multiple sclerosis, Sjogren's syndrome, Hashimoto's thyroiditis, biliary cirrhosis.
• myelodysplastic syndromes such as aplastic anemia
• graft v. host disease ischemic injury (such as that caused by myocardial infarction, stroke and reperfusion injury)
• liver injury e.g., hepatitis related liver injury, ischemia/reperfusion injury, cholestosis (bile duct injury) and liver cancer
• toxin-induced liver disease such as that caused by alcohol
• septic shock such as cachexia and anorexia.
• TR12 polynucleotides, polypeptides, and/or TR12 agonists or antagonists of the invention are used to treat AIDS and pathologies associated with AIDS.
• TR12 polynucleotides or polypeptides as well as agonists or antagonists of TR12, for therapeutic pu ⁇ oses, for example, to stimulate epithelial cell proliferation and basal keratinocytes for the pu ⁇ ose of wound healing, and to stimulate hair follicle production and healing of dermal wounds.
• TRI 2 polynucleotides or polypeptides, as well as agonists or antagonists of TRI 2 may be clinically useful in stimulating wound healing including surgical wounds, excisional wounds, deep wounds involving damage of the dermis and epidermis, eye tissue wounds, dental tissue wounds, oral cavity wounds, diabetic ulcers, dermal ulcers, cubitus ulcers, arterial ulcers, venous stasis ulcers, bums resulting from heat exposure or chemicals, and other abnormal wound healing conditions such as uremia, malnutrition, vitamin deficiencies and complications associted with systemic treatment with steroids, radiation therapy and antineoplastic drugs and antimetabolites.
• TR12 polynucleotides or polypeptides, as well as agonists -or antagonists of TRI 2 could be used to promote dermal reestablishment subsequent to dermal loss
• TRI 2 polynucleotides or polypeptides could be used to increase the adherence of skin grafts to a wound bed and to stimulate re-epithelialization from the wound bed.
• TR12 polynucleotides or polypeptides, agonists or antagonists of TR12 could be used to increase adherence to a wound bed: autografts, artificial skin, allografts, autodermic graft, autoepdermic grafts, avacular grafts, Blair-Brown grafts, bone graft, brephoplastic grafts, cutis graft, delayed graft, dermic graft, epidermic graft, fascia graft, full thickness graft, heterologous graft, xenograft, homologous graft, hype ⁇ lastic graft, lamellar graft, mesh graft, mucosal graft, Ollier-Thiersch graft, omenpal graft, patch graft, pedicle graft, penetrating graft, split skin graft, thick split graft.
• TRI 2 polynucleotides or polypeptides, as well as agonists or antagonists of TRI 2 may also produce changes in hepatocyte proliferation, and epithelial cell proliferation in the lung, breast, pancreas, stomach, small intesting, and large intestine.
• TR12 polynucleotides or polypeptides, as well as agonists or antagonists of TR12 may promote proliferation of epithelial cells such as sebocytes, hair follicles, hepatocytes, type II pneumocytes, mucin-producing goblet cells, and other epithelial cells and their progenitors contained within the skin, lung, liver, and gastrointestinal tract.
• TR12 polynucleotides or polypeptides, agonists or antagonists of TRI 2 may promote proliferation of endothelial cells, keratinocytes, and basal keratinocytes.
• TRI 2 polynucleotides or polypeptides, as well as agonists or antagonists of TRI 2 may also be used to reduce the side effects of gut toxicity that result from radiation, chemotherapy treatments or viral infections.
• TRI 2 polynucleotides or polypeptides, as well as agonists or antagonists of TRI 2 may have a cytoprotective effect on the small intestine mucosa.
• TRI 2 polynucleotides or polypeptides, as well as agonists or antagonists of TRI 2 may also stimulate healing of mucositis (mouth ulcers) that result from chemotherapy and viral infections.
• TRI 2 polynucleotides or polypeptides, as well as agonists or antagonists of TRI 2 could further be used in full regeneration of skin in full and partial thickness skin defects, including burns, (i.e., repopulation of hair follicles, sweat glands, and sebaceous glands), treatment of other skin defects such as psoriasis.
• TRI 2 polynucleotides or polypeptides, as well as agonists or antagonists of TRI 2 could be used to treat epidermolysis bullosa, a defect in adherence of the epidermis to the underlying dermis which results in frequent, open and painful blisters by accelerating reepithelialization of these lesions.
• TRI 2 polynucleotides or polypeptides, as well as agonists or antagonists of TRI 2 could also be used to treat gastric and doudenal ulcers and help heal by scar formation of the mucosal lining and regeneration of glandular mucosa and duodenal mucosal lining more rapidly.
• Inflamamatory bowel diseases such as Crohn's disease and ulcerative colitis, are diseases which result in destmction of the mucosal surface of the small or large intestine, respectively.
• TR12 polynucleotides or polypeptides, as well as agonists or antagonists of TR12 could be used to promote the resurfacing of the mucosal surface to aid more rapid healing and to prevent progression of inflammatory bowel disease.
• TRI 2 polynucleotides or polypeptides, agonists or antagonists of TRI 2 may have a significant effect on the production of mucus throughout the gastrointestinal tract and may be used to protect the intestinal mucosa from injurious substances that are ingested or following surgery.
• TRI 2 polynucleotides or polypeptides, as well as agonists or antagonists of TR12, may be used to treat diseases associate with the under expression of TR12.
• TRI 2 polynucleotides or polypeptides could be used to prevent and heal damage to the lungs due to various pathological states.
• TR12 polynucleotides or polypeptides, as well as agonists or antagonists of TRI 2 may stimulate proliferation and differentiation and promote the repair of alveoli and brochiolar epithelium to prevent or treat acute or chronic lung damage.
• TR12 polynucleotides or polypeptides, as well as agonists or antagonists of TRI 2 may be used to stimulate the proliferation of and differentiation of type II pneumocytes, which may help treat or prevent disease such as hyaline membrane diseases, such as infant respiratory distress syndrome and bronchopulmonary displasia, in premature infants.
• TRI 2 polynucleotides or polypeptides may stimulate the proliferation and differentiation of hepatocytes and, thus, could be used to alleviate or treat liver diseases and pathologies such as fulminant liver failure caused by cirrhosis, liver damage caused by viral hepatitis and toxic substances (i.e., acetaminophen, carbon tetraholoride and other hepatotoxins known in the art).
• liver diseases and pathologies such as fulminant liver failure caused by cirrhosis, liver damage caused by viral hepatitis and toxic substances (i.e., acetaminophen, carbon tetraholoride and other hepatotoxins known in the art).
• TRI 2 polynucleotides or polypeptides, as well as agonists or antagonists of TRI 2 may be used treat or prevent the onset of diabetes mellitus.
• TRI 2 polynucleotides or polypeptides could be used to maintain the islet function so as to alleviate, delay or prevent permanent manifestation of the disease.
• TR12 polynucleotides or polypeptides, as well as agonists or antagonists of TRI 2 could be used as an auxiliary in islet cell transplantation to improve or promote islet cell function.
• TRI 2 polynucleotides or polypeptides, or agonists or antagonists of TR12 can be used to treat or detect infectious agents. For example, by increasing the immune response, particularly increasing the proliferation and differentiation of B and/or T cells, infectious diseases may be treated. The immune response may be increased by either enhancing an existing immune response, or by initiating a new immune response. Alternatively, TR12 polynucleotides or polypeptides, or agonists or antagonists of TRI 2, may also directly inhibit the infectious agent, without necessarily eliciting an immune response.
• Vimses are one example of an infectious agent that can cause disease or symptoms that can be treated or detected by TRI 2 polynucleotides or polypeptides, or agonists or antagonists of TRI 2.
• viruses include, but are not limited to the following DNA and RNA viral families: Arbovims, Adenoviridae, Arenaviridae, Arterivirus, Birnaviridae, Bunyaviridae, Caliciviridae, Circoviridae, Coronaviridae, Flaviviridae, Hepadnaviridae (Hepatitis), He ⁇ esviridae (such as, Cytomegalovims, He ⁇ es Simplex, He ⁇ es Zoster), Mononegavims (e.g., Paramyxoviridae, Morbilli virus, Rhabdoviridae), Orthomyxoviridae (e.g., Influenza), Papovaviridae, Parvoviridae, Picornaviridae, Pox
• Vimses falling within these families can cause a variety of diseases or symptoms, including, but not limited to: arthritis, bronchioUitis, encephalitis, eye infections (e.g., conjunctivitis, keratitis), chronic fatigue syndrome, hepatitis (A, B, C, E, Chronic Active, Delta), meningitis, opportunistic infections (e.g., AIDS), pneumonia, Burkitt' s Lymphoma, chickenpox , hemorrhagic fever, Measles, Mumps, Parainfluenza, Rabies, the common cold, Polio, leukemia, Rubella, sexually transmitted diseases, skin diseases (e.g., Kaposi's, warts), and viremia.
• TR12 polynucleotides or polypeptides, or agonists or antagonists of TRI 2 can be used to treat or detect any of these symptoms or diseases.
• bacterial or fungal agents that can cause disease or symptoms and that can be treated or detected by TR12 polynucleotides or polypeptides, or agonists or antagonists of TRI 2, include, but not limited to, the following Gram-Negative and Gram-positive bacterial families and fungi: Actinomycetales (e.g., Corynebacterium, Mycobacterium, Norcardia), Aspergillosis, Bacillaceae (e.g., Anthrax, Clostridium), Bacteroidaceae, Blastomycosis, Bordetella, Borrelia, Brucellosis, Candidiasis, Campylobacter, Coccidioidomycosis, Cryptococcosis, Dermatocycoses, Enterobacteriaceae (Klebsiella, Salmonella, Serratia, Yersinia), Erysipelothrix, Helicobacter, Legionellosis, Leptospirosis, Listeria, My
• bacterial or fungal families can cause the following diseases or symptoms, including, but not limited to: bacteremia, endocarditis, eye infections (conjunctivitis, tuberculosis, uveitis), gingivitis, opportunistic infections (e.g., AIDS related infections), paronychia, prosthesis-related infections, Reiter's Disease, respiratory tract infections, such as Whooping Cough or Empyema, sepsis, Lyme Disease, Cat-Scratch Disease, Dysentery, Paratyphoid Fever, food poisoning, Typhoid, pneumonia, Gonorrhea, meningitis, Chlamydia, Syphilis, Diphtheria, Leprosy, Paratuberculosis, Tuberculosis, Lupus, Botulism, gangrene, tetanus, impetigo, Rheumatic Fever, Scarlet Fever, sexually transmitted diseases, skin diseases (e.g., cellu
• parasitic agents causing disease or symptoms that can be treated or detected by TR12 polynucleotides or polypeptides, or agonists or antagonists of TR12 include, but not limited to, the following families: Amebiasis, Babesiosis, Coccidiosis, Cryptosporidiosis, Dientamoebiasis, Dourine, Ectoparasitic, Giardiasis, Helminthiasis, Leishmaniasis, Theileriasis, Toxoplasmosis, Trypanosomiasis, and Trichomonas.
• TRI 2 polynucleotides or polypeptides, or agonists or antagonists of TRI 2 can be used to treat or detect any of these symptoms or diseases.
• treatment using TR12 polynucleotides or polypeptides, or agonists or antagonists of TR12 could either be by administering an effective amount of TR12 polypeptide to the patient, or by removing cells from the patient, supplying the cells with TRI 2 polynucleotide, and returning the engineered cells to the patient (ex vivo therapy).
• the TRI 2 polypeptide or polynucleotide can be used as an antigen in a vaccine to raise an immune response against infectious disease.
• TRI 2 polynucleotides or polypeptides, or agonists or antagonists of TRI 2 can be used to differentiate, proliferate, and attract cells, leading to the regeneration of tissues.
• the regeneration of tissues could be used to repair, replace, or protect tissue damaged by congenital defects, trauma (wounds, burns, incisions, or ulcers), age, disease (e.g. osteoporosis, osteocarthritis, periodontal disease, liver failure), surgery, including cosmetic plastic surgery, fibrosis, reperfusion injury, or systemic cytokine damage.
• Tissues that could be regenerated using the present invention include organs (e.g., pancreas, liver, intestine, kidney, skin, endothelium), muscle (smooth, skeletal or cardiac), vasculature (including vascular and lymphatics), nervous, hematopoietic, and skeletal (bone, cartilage, tendon, and ligament) tissue.
• organs e.g., pancreas, liver, intestine, kidney, skin, endothelium
• muscle smooth, skeletal or cardiac
• vasculature including vascular and lymphatics
• nervous hematopoietic
• hematopoietic skeletal
• skeletal bone, cartilage, tendon, and ligament
• TRI 2 polynucleotides or polypeptides, or agonists or antagonists of TR12 may increase regeneration of tissues difficult to heal. For example, increased tendon/ligament regeneration would quicken recovery time after damage.
• TR12 polynucleotides or polypeptides, or agonists or antagonists of TRI 2, of the present invention could also be used prophylactically in an effort to avoid damage.
• Specific diseases that could be treated include of tendinitis, ca ⁇ al tunnel syndrome, and other tendon or ligament defects.
• a further example of tissue regeneration of non-healing wounds includes pressure ulcers, ulcers associated with vascular insufficiency, surgical, and traumatic wounds.
• nerve and brain tissue could also be regenerated by using TRI 2 polynucleotides or polypeptides, or agonists or antagonists of TRI 2, to proliferate and differentiate nerve cells.
• Diseases that could be treated using this method include central and peripheral nervous system diseases, neuropathies, or mechanical and traumatic disorders (e.g., spinal cord disorders, head trauma, cerebrovascular disease, and stoke).
• diseases associated with peripheral nerve injuries could all be treated using the TRI 2 polynucleotides or polypeptides, or agonists or antagonists of TR12.
• TR12 polynucleotides or polypeptides, or agonists or antagonists of TR12 may have chemotaxis activity.
• a chemotaxic molecule attracts or mobilizes cells (e.g., monocytes, fibroblasts, neutrophils, T-cells, mast cells, eosinophils, epithelial and/or endothelial cells) to a particular site in the body, such as inflammation, infection, or site of hype ⁇ roliferation.
• the mobilized cells can then fight off and/or heal the particular trauma or abnormality.
• TR12 polynucleotides or polypeptides, or agonists or antagonists of TR12 may increase chemotaxic activity of particular cells. These chemotactic molecules can then be used to treat inflammation, infection, hype ⁇ roliferative disorders, or any immune system disorder by increasing the number of cells targeted to a particular location in the body. For example, chemotaxic molecules can be used to treat wounds and other trauma to tissues by attracting immune cells to the injured location. As a chemotactic molecule, TRI 2 could also attract fibroblasts, which can be used to treat wounds. It is also contemplated that TRI 2 polynucleotides or polypeptides, or agonists or antagonists of TRI 2, may inhibit chemotactic activity. These molecules could also be used to treat disorders. Thus, TR12 polynucleotides or polypeptides, or agonists or antagonists of TR12, could be used as an inhibitor of chemotaxis.
• TRI 2 polypeptides may be used to screen for molecules that bind to TRI 2 or for molecules to which TRI 2 binds.
• the binding of TRI 2 and the molecule may activate (agonist), increase, inhibit (antagonist), or decrease activity of the TR12 or the molecule bound.
• Examples of such molecules include antibodies, oligonucleotides, proteins (e.g., TNF ligands), or small molecules.
• TNF, TNF-related or TNF-like molecules that may bind the compositions of the invention include, but are not limited to, soluble forms of TNF-alpha, lymphotoxin-alpha (LT-alpha, also known as TNF-beta), LT-beta (found in complex heterotrimer LT-alpha2-beta), OPGL, FasL, CD27L, CD30L, CD40L, 4-1BBL, DcR3, OX40L, TNF-gamma (International Publication No. WO 96/14328), ATM-I (International Publication No. WO 97/33899), endokine-alpha (International Publication No.
• WO 98/07880 OPG, and Neutrokine-alpha
• International Publication No. WO 98/18921, OX40, and nerve growth factor (NGF) and soluble forms of Fas, CD30, CD27, CD40 and 4-IBB
• TR2 International Publication No. WO 96/34095
• DR3 International Publication No. WO 97/33904
• DR4 International Publication No. WO 98/32856
• TR5 International Publication No. WO 98/30693
• TR6 International Publication No. WO 98/30694
• TR7 International Publication No. WO 98/41629
• TRANK TR9
• TR12 International Publication No. WO 98/56892
• TR12 International Publication No. WO 98/54202
• 312C2 International Publication No. WO 98/06842
• TR12 and soluble forms CD154, CD70, and CD153.
• the molecule is closely related to the natural ligand of TRI 2, e.g., a fragment of the ligand, or a natural substrate, a ligand, a stmctural or functional mimetic.
• the molecule can be closely related to the natural ligand to which TR12 binds, or at least, a fragment of the ligand capable of being bound by TR12 (e.g. , active site). In either case, the molecule can be rationally designed using known techniques.
• the screening for these molecules involves producing appropriate cells which express TRI 2, either as a secreted protein or on the cell membrane.
• Preferred cells include cells from mammals, yeast, Drosophila, or E. coli.
• Cells expressing TR12(or cell membrane containing the expressed polypeptide) are then preferably contacted with a test compound potentially containing the molecule to observe binding, stimulation, or inhibition of activity of either TRI 2 or the molecule.
• the assay may simply test binding of a candidate compound to TRI 2, wherein binding is detected by a label, or in an assay involving competition with a labeled competitor. Further, the assay may test whether the candidate compound results in a signal generated by binding to TRI 2.
• the assay can be carried out using cell-free preparations, polypeptide/molecule affixed to a solid support, chemical libraries, or natural product mixtures.
• the assay may also simply comprise the steps of mixing a candidate compound with a solution containing TRI 2, measuring TR12/molecule activity or binding, and comparing the TR12/molecule activity or binding to a standard.
• an ⁇ LISA assay can measure TRI 2 level or activity in a sample (e.g., biological sample) using a monoclonal or polyclonal antibody.
• the antibody can measure TR12 level or activity by either binding, directly or indirectly, to TR12 or by competing with TRI 2 for a substrate.
• the TNF ligand to which TRI 2 binds can be identified by numerous methods known to those of skill in the art,- for example, ligand panning and
• the present invention also provides a screening method for identifying compounds capable of enhancing or inhibiting a cellular response induced by TRI 2 polypeptides, which involves contacting cells which express TRI 2 polypeptides with the candidate compound, assaying a cellular response, and comparing the cellular response to a standard cellular response, the standard being assayed when contact is made in absence of the candidate compound; whereby, an increased cellular response over the standard indicates that the compound is an agonist and a decreased cellular response over the standard indicates that the compound is an antagonist.
• a screening assay for agonists and antagonists involves determining the effect a candidate compound has on the binding of ligands to TR12 polypeptides.
• the method involves contacting TR12 polypeptides with a ligand polypeptide and a candidate compound and determining whether ligand binding to the TRI 2 polypeptide is increased or decreased due to the presence of the candidate compound.
• TR12/molecule can discover agents which may inhibit or enhance the production of TR12 from suitably manipulated cells or tissues.
• the invention includes a method of identifying compounds which bind to TRI 2 comprising the steps of: (a) incubating a candidate binding compound with TR12; and (b) determining if binding has occurred. Moreover, the invention includes a method of identifying agonists/antagonists comprising the steps of: (a) incubating a candidate compound with TR12, (b) assaying a biological activity , and (b) determining if a biological activity of TRI 2 has been altered.
• antagonists according to the present invention are nucleic acids corresponding to the sequences contained in SEQ ID NOT, or the complementary strand thereof, and/or to nucleotide sequences contained in the plasmid deposited in ATCC Deposit No. 203365.
• antisense sequence is generated internally by the organism, in another embodiment, the antisense sequence is separately administered (see, for example, O'Connor, J., Neurochem. 56:560 (1991). Oligodeoxynucleotides as Anitsense Inhibitors of Gene Expression, CRC Press, Boca Raton, FL (1988).
• Antisense technology can be -used to control gene expression through antisense DNA or RNA, or through triple-helix formation.
• Antisense techniques are discussed for example, in Okano, J., Neurochem. 56:560 (1991); Oligodeoxynucleotides as Antisense Inhibitors of Gene Expression, CRC Press, Boca Raton, FL (1988). Triple helix formation is discussed in, for instance, Lee et al., Nucleic Acids Research 10-1573 (1979); Cooney et al., Science 241:456 (1988); and Dervan et al., Science 251:1300 (1991). The methods are based on binding of a polynucleotide to a complementary DNA or RNA.
• the 5' coding portion of a polynucleotide that encodes the mature polypeptide of the present invention may be used to design an antisense RNA oligonucleotide of from about 10 to 40 base pairs in length.
• a DNA oligonucleotide is designed to be complementary to a region of the gene involved in transcription thereby preventing transcription and the production of the receptor.
• the antisense RNA oligonucleotide hybridizes to the mRNA in vivo and blocks translation of the mRNA molecule into receptor polypeptide.
• the TRI 2 antisense nucleic acid of the invention is produced intracellularly by transcription from an exogenous sequence.
• a vector or a portion thereof is transcribed, producing an antisense nucleic acid (RNA) of the invention.
• RNA antisense nucleic acid
• Such a vector would contain a sequence encoding the TRI 2 antisense nucleic acid.
• Such a vector can remain episomal or become chromosomally integrated, as long as it can be transcribed to produce the desired antisense RNA.
• Such vectors can be constmcted by recombinant DNA technology methods standard in the art.
• Vectors can be plasmid, viral, or others know in the art, used for replication and expression in vertebrate cells.
• Expression of the sequence encoding TRI 2, or fragments thereof can be by any promoter known in the art to act in vertebrate, preferably human cells.
• Such promoters can be inducible or constitutive.
• Such promoters include, but are not limited to, the SV40 early promoter region (Bernoist and Chambon, Nature 29:304-310 (1981), the promoter contained in the 3' long terminal repeat of Rous sarcoma virus (Yamamoto et al, Cell 22:787-797 (1980), the he ⁇ es thymidine promoter (Wagner et al., Proc. Natl. Acad. Sci. U.S.A. 78: 1441-1445 (1981), the regulatory sequences of the metallothionein gene (Brinster, et al., Nature 296:39-42 (1982)), etc.
• the antisense nucleic acids of the invention comprise a sequence complementary to at least a portion of an RNA transcript of a TRI 2 gene.
• absolute complementarity although preferred, is not required.
• a sequence "complementary to at least a portion of an RNA,” referred to herein, means a sequence having sufficient complementarity to be able to hybridize with the RNA, forming a stable duplex; in the case of double stranded TRI 2 antisense nucleic acids, a single strand of the duplex DNA may thus be tested, or triplex formation may be assayed.
• the ability to hybridize will depend on both the degree of complementarity and the length of the antisense nucleic acid Generally, the larger the hybridizing nucleic acid, the more base mismatches with a TRI 2 RNA it may contain and still form a stable duplex (or triplex as the case may be).
• One skilled in the art can ascertain a tolerable degree of mismatch by use of standard procedures to determine the melting point of the hybridized complex. Oligonucleotides that are complementary to the 5' end of the message, e.g., the 5' untranslated sequence up to and including the AUG initiation codon, should work most efficiently at inhibiting translation.
• oligonucleotides complementary to either the 5'- or 3'- non- translated, non-coding regions of TRI 2 shown in Figures 1A-C could be used in an antisense approach to inhibit translation of endogenous TRI 2 mRNA.
• Oligonucleotides complementary to the 5' untranslated region of the mRNA should include the complement of the AUG start codon.
• Antisense oligonucleotides complementary to mRNA coding regions are less efficient inhibitors of translation but could be used in accordance with the invention.
• antisense nucleic acids should be at least six nucleotides in length, and are preferably oligonucleotides ranging from 6 to about 50 nucleotides in length. In specific aspects the oligonucleotide is at least 10 nucleotides, at least 17 nucleotides, at least 25 nucleotides or at least 50 nucleotides.
• the polynucleotides of the invention can be DNA or RNA or chimeric mixtures or derivatives or modified versions thereof, single-stranded or double-stranded.
• the oligonucleotide can be modified at the base moiety, sugar moiety, or phosphate backbone, for example, to improve stability of the molecule, hybridization, etc.
• the oligonucleotide may include other appended groups such as peptides (e.g., for targeting host cell receptors in vivo), or agents facilitating transport across the cell membrane (see, e.g., Letsinger et al, Proc. Natl. Acad. Sci. U.S.A. 86:6553-6556 (1989); Lemaitre et al., Proc. Natl. Acad. Sci. 84:648-652 (1987); PCT Publication No.
• oligonucleotide may be conjugated to another molecule, e.g., a peptide, hybridization triggered cross-linking agent, transport agent, hybridization-triggered cleavage agent, etc.
• the antisense oligonucleotide may comprise at least one modified base moiety which is selected from the group including, but not limited to, 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xantine, 4-acetylcytosine, 5-(carboxyhydroxylmethyl) uracil, 5-carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylaminomethyluracil, dihydrouracil, beta-D-galactosylqueosine, inosine, N6-isopentenyladenine, 1-methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-adenine, 7-methylguanine, 5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, beta-D-mannosylque
• the antisense oligonucleotide may also comprise at least one modified sugar moiety selected from the group including, but not limited to, arabinose, 2-fluoroarabinose, xylulose, and hexose.
• the antisense oligonucleotide comprises at least one modified phosphate backbone selected from the group including, but not limited to, a phosphorothioate, a phosphorodithioate, a phosphoramidothioate, a phosphoramidate, a phosphordiamidate, a methylphosphonate, an alkyl phosphotriester, and a formacetal or analog thereof.
• the antisense oligonucleotide is an a-anomeric oligonucleotide.
• An a-anomeric oligonucleotide forms specific double-stranded hybrids with complementary RNA in which, contrary to the usual b-units, the strands mn parallel to each other (Gautier et al., Nucl. Acids Res. 15:6625-6641 (1987)).
• the oligonucleotide is a 2'-0-methylribonucleotide (Inoue et al., Nucl. Acids Res. 15:6131- 6148 (1987)), or a chimeric RNA-DNA analogue (Inoue et al., FEBS Lett. 215:327- 330 (1987)).
• Polynucleotides of the invention may be synthesized by standard methods known in the art, e.g. by use of an automated DNA synthesizer (such as are commercially available from Biosearch, Applied Biosystems, etc.).
• an automated DNA synthesizer such as are commercially available from Biosearch, Applied Biosystems, etc.
• phosphorothioate oligonucleotides may be synthesized by the method of Stein et al. (Nucl. Acids Res. 16:3209 (1988))
• methylphosphonate oligonucleotides can be prepared by use of controlled pore glass polymer supports (Sarin et al., Proc. Natl. Acad. Sci. U.S.A. 85:7448-7451 (1988)), etc.
• antisense nucleotides complementary to the TRI 2 coding region sequence could be used, those complementary to the transcribed untranslated region are most preferred.
• Potential antagonists according to the invention also include catalytic RNA, or a ribozyme (See, e.g., PCT International Publication WO 90/11364, Sarver et al, Science 247:1222-1225 (1990). While ribozymes that cleave mRNA at site specific recognition sequences can be used to destroy TRI 2 mRNAs, the use of hammerhead ribozymes is preferred. Hammerhead ribozymes cleave mRNAs at locations dictated by flanking regions that form complementary base pairs with the target mRNA. The sole requirement is that the target mRNA have the following sequence of two bases: 5'-UG- 3'.
• hammerhead ribozymes The constmction and production of hammerhead ribozymes is well known in the art and is described more fully in Haseloff and Gerlach, Nature 334:585-591 (1988).
• the ribozyme is engineered so that the cleavage recognition site is located near the 5' end of the TRI 2 mRNA; i.e., to increase efficiency and minimize the intracellular accumulation of non-functional mRNA transcripts.
• the ribozymes of the invention can be composed of modified oligonucleotides (e.g.
• DNA constmcts encoding the ribozyme may be introduced into the cell in the same manner as described above for the introduction of antisense encoding DNA.
• a preferred method of delivery involves using a DNA constmct "encoding" the ribozyme under the control of a strong constitutive promoter, such as, for example, pol III or pol II promoter, so that transfected cells will produce sufficient quantities of the ribozyme to destroy endogenous TR12 messages and inhibit translation. Since ribozymes unlike antisense molecules, are catalytic, a lower intracellular concentration is required for efficiency.
• the antagonist/agonist may be employed to treat the diseases described herein.
• hosts also referred to herein as patients or individuals.
• hosts include, but are not limited to, human, murine, rabbit, goat, guinea pig, camel, horse, mouse, rat, hamster, pig, micro-pig, chicken, goat, cow, sheep, dog, cat, non-human primate, and human.
• the host is a mouse, rabbit, goat, guinea pig, chicken, rat, hamster, pig, sheep, dog or cat.
• the host is a mammal.
• the host is a human.
• pCMVSport3 contains an ampicillin resistance gene and may be transformed into E. coli strain DH10B, available from Life Technologies. (See, for instance, Gruber et al., Focus 15:59 (1993).)
• TRI 2 Two approaches can be used to isolate TRI 2 from the deposited sample.
• the deposited clone is transformed into a suitable host (such as XL-1 Blue (Stratagene)) using techniques known to those of skill in the art, such as those provided by the vector supplier or in related publications or patents.
• the transformants are plated on 1.5% agar plates (containing the appropriate selection agent, e.g., ampicillin) to a density of about 150 transformants (colonies) per plate.
• a single colony is then used to generate DNA using nucleic acid isolation techniques well known to those skilled in the art. (e.g., Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd Edit., (1989), Cold Spring Harbor Laboratory Press.)
• two primers of 17-20 nucleotides derived from both ends of the SEQ ID NOT are synthesized and used to amplify the TRI 2 cDNA using the deposited cDNA plasmid as a template.
• the polymerase chain reaction is carried out under routine conditions, for instance, in 25 ul of reaction mixture with 0.5 ug of the above cDNA template.
• a convenient reaction mixture is 1.5-5 mM MgCl,, 0.01% (w/v) gelatin, 20 uM each of dATP, dCTP, dGTP, dTTP, 25 pmol of each primer and 0.25 Unit of Taq polymerase.
• Thirty five cycles of PCR (denaturation at 94 degree C for 1 min; annealing at 55 degree C for 1 min; elongation at 72 degree C for 1 min) are performed with a Perkin-Elmer Cetus automated thermal cycler.
• the amplified product is analyzed by agarose gel electrophoresis and the DNA band with expected molecular weight is excised and purified.
• the PCR product is verified to be the selected sequence by subcloning and sequencing the DNA product.
• RNA oligonucleotide is ligated to the 5' ends of a population of RNA presumably containing full-length gene RNA transcripts.
• a primer set containing a primer specific to the ligated RNA oligonucleotide and a primer specific to a known sequence of the TRI 2 gene of interest is used to PCR amplify the 5' portion of the TRI 2 full-length gene. This amplified product may then be sequenced and used to generate the full length gene.
• RNA isolation can then be treated with phosphatase if necessary to eliminate 5' phosphate groups on degraded or damaged RNA which may interfere with the later RNA ligase step.
• the phosphatase should then be inactivated and the RNA treated with tobacco acid pyrophosphatase in order to remove the cap structure present at the 5' ends of messenger RNAs. This reaction leaves a 5' phosphate group at the 5' end of the cap cleaved RNA which can then be ligated to an RNA oligonucleotide using T4 RNA ligase.
• This modified RNA preparation is used as a template for first strand cDNA synthesis using a gene specific oligonucleotide.
• the first strand synthesis reaction is used as a template for PCR amplification of the desired 5' end using a primer specific to the ligated RNA oligonucleotide and a primer specific to the known sequence of the gene of interest.
• the resultant product is then sequenced and analyzed to confirm that the 5' end sequence belongs to the TRI 2 gene.
• a human genomic PI library (Genomic Systems, Inc.) is screened by PCR using primers selected for the cDNA sequence corresponding to SEQ ID NOT, according to the method described in Example 1. (See also, Sambrook.)
• Example 3 Tissue Distribution of TR12 Polypeptides _ Tissue distribution of mRNA expression of TRI 2 is determined using protocols for Northern blot analysis, described by, among others, Sambrook et al.
• a TRI 2 probe produced by the method described in Example 1 is labeled with P 32 using the rediprimeTM DNA labeling system (Amersham Life Science), according to manufacturer's instmctions. After labeling, the probe is purified using CHROMA SPIN-100TM column (Clontech Laboratories, Inc.), according to manufacturer's protocol number PT 1200-1. The purified labeled probe is then used to examine various human tissues for mRNA expression.
• MTN Multiple Tissue Northern
• H human tissues
• IM human immune system tissues
• An oligonucleotide primer set is designed according to the sequence at the 5 ' end of SEQ ID NOT. This primer preferably spans about 100 nucleotides. This primer set is then used in a polymerase chain reaction under the following set of conditions : 30 seconds, 95 degree C; 1 minute, 56 degree C; 1 minute, 70 degree C. This cycle is repeated 32 times followed by one 5 minute cycle at 70 degree C. Human, mouse, and hamster DNA is used as template in addition to a somatic cell hybrid panel containing individual chromosomes or chromosome fragments (Bios, Inc). The reactions is analyzed on either 8% polyacrylamide gels or 3.5 % agarose gels. Chromosome mapping is determined by the presence of an approximately 100 bp PCR fragment in the particular somatic cell hybrid.
• TRI 2 polynucleotide encoding a TRI 2 polypeptide invention is amplified using PCR oligonucleotide primers corresponding to the 5' and 3' ends of the DNA sequence, as outlined in Example 1, to synthesize insertion fragments.
• the primers used to amplify the cDNA insert should preferably contain restriction sites, such as BamHI and Xbal, at the 5' end of the primers in order to clone the amplified product into the expression vector.
• restriction sites such as BamHI and Xbal correspond to the restriction enzyme sites on the bacterial expression vector pQE-9. (Qiagen, Inc., Chatsworth,
• This plasmid vector encodes antibiotic resistance (Amp r ), a bacterial origin of replication (ori), an IPTG-regulatable promoter/operator (P/O), a ribosome binding site (RBS), a 6-histidine tag (6-His), and restriction enzyme cloning sites.
• the pQE-9 vector is digested with BamHI and Xbal and the amplified fragment is ligated into the pQE-9 vector maintaining the reading frame initiated at the bacterial RBS.
• the ligation mixture is then used to transform the E. coli strain M15/rep4
• IPTG Isopropyl-B-D-thiogalacto pyranoside
• IPTG induces by inactivating the lad repressor, clearing the P/O leading to increased gene expression.
• Ni-NTA nickel-nitrilo-tri-acetic acid
• the supernatant is loaded onto the column in 6 M guanidine-HCl, pH 8 , the column is first washed with 10 volumes of 6 M guanidine-HCl, pH 8, then washed with 10 volumes of 6 M guanidine-HCl pH 6, and finally the polypeptide is eluted with 6 M guanidine-HCl, pH 5.
• the purified TRI 2 protein is then renatured by dialyzing it against phosphate- buffered saline (PBS) or 50 mM Na-acetate, pH 6 buffer plus 200 mM NaCl.
• PBS phosphate- buffered saline
• the TRI 2 protein can be successfully refolded while immobilized on the Ni-NTA column.
• the recommended conditions are as follows: renature using a linear 6M-1M urea gradient in 500 mM NaCl, 20% glycerol, 20 mM Tris/HCl pH 7.4, containing protease inhibitors.
• the renaturation should be performed over a period of 1.5 hours or more.
• the proteins are eluted by the addition of 250 mM immidazole. Immidazole is removed by a final dialyzing step against PBS or 50 mM sodium acetate pH 6 buffer plus 200 mM NaCl.
• the purified TRI 2 protein is stored at 4 degree C
• the present invention further includes an expression vector comprising phage operator and promoter elements operatively linked to a TR12 polynucleotide, called pHE4a.
• This vector contains: 1) a neomycinphosphotransferase gene as a selection marker, 2) an E. coli origin of replication, 3) a T5 phage promoter sequence, 4) two lac operator sequences, 5) a Shine-Delgarno sequence, and 6) the lactose operon repressor gene (laclq).
• the origin of replication (oriC) is derived from pUC19 (LTI, Gaithersburg, MD). The promoter sequence and operator sequences are made synthetically.
• DNA can be inserted into the pHEa by restricting the vector with Ndel and Xbal, BamHI, Xhol, or Asp718, mnning the restricted product on a gel, and isolating the larger fragment (the stuffer fragment should be about 310 base pairs).
• the DNA insert is generated according to the PCR protocol described in Example 1, using PCR primers having restriction sites for Ndel (5' primer) and Xbal, BamHI, Xhol, or Asp718 (3' primer).
• the PCR insert is gel purified and restricted with compatible enzymes.
• the insert and vector are ligated according to standard protocols.
• the 5' primer is sequence 5 '
• CGCCATATGACAACCCTTTGGCAGTGCCCAC 3' (SEQ ID NO: 10) containing the Nde I restriction site followed a number of nucleotides of the amino terminal coding sequence of the soluble portion of the TRI 2 sequence in SEQ ID NOT.
• the point in the protein coding sequence where the 5' primer begins may be varied to amplify a DNA segment encoding any desired portion of the complete TRI 2 protein shorter or longer than the soluble portion of the protein.
• the 3' primer has the sequence
• primers used to clone full length TRI 2 into pCDNA3 include: GCGAGATCTGCCATCATGAAGCCAAGTCTGCTGTG (SEQ ID NO: 12) and GCGTCTAGACTCTGATGATACAGAGAATC (SEQ ID NO: 13).
• the engineered vector could easily be substituted in the above protocol to express protein in a bacterial system.
• Example 6 Purification of TR12 Polypeptide from an Inclusion Body
• the cell culture Upon completion of the production phase of the E. coli fermentation, the cell culture is cooled to 4-10 degree C and the cells harvested by continuous centrifugation at 15,000 ⁇ m (Heraeus Sepatech). On the basis of the expected yield of protein per unit weight of cell paste and the amount of purified protein required, an appropriate amount of cell paste, by weight, is suspended in a buffer solution containing 100 mM
• Tris 50 mM EDTA, pH 7.4.
• the cells are dispersed to a homogeneous suspension using a high shear mixer.
• the cells are then lysed by passing the solution through a microfluidizer
• the resulting washed inclusion bodies are solubilized with 1.5 M guanidine hydrochloride (GuHCl) for 2-4 hours. After 7000 xg centrifugation for 15 min., the pellet is discarded and the polypeptide containing supernatant is incubated at 4 degree C overnight to allow further GuHCl extraction.
• guanidine hydrochloride (GuHCl)
• the GuHCl solubilized protein is refolded by quickly mixing the GuHCl extract with 20 volumes of buffer containing 50 mM sodium, pH 4.5, 150 mM NaCl, 2 mM EDTA by vigorous stirring.
• the refolded diluted protein solution is kept at 4 degree C without mixing for 12 hours prior to further purification steps.
• a cation exchange resin e.g., Poros HS-50, Perseptive
• the column is washed with 40 mM sodium acetate, pH 6.0 and eluted with 250 mM, 500 mM, 1000 mM, and 1500 mM NaCl in the same buffer, in a stepwise manner.
• the absorbance at 280 nm of the effluent is continuously monitored.
• Fractions are collected and further analyzed by SDS-PAGE. Fractions containing the TRI 2 polypeptide are then pooled and mixed with 4 volumes of water. The diluted sample is then loaded onto a previously prepared set of tandem columns of strong anion (Poros HQ-50, Perseptive Biosystems) and weak anion (Poros CM-20, Perseptive Biosystems) exchange resins. The columns are equilibrated with 40 mM sodium acetate, pH 6.0. Both columns are washed with 40 mM sodium acetate, pH 6.0, 200 mM NaCl.
• CM-20 column is then eluted using a 10 column volume linear gradient ranging from 0.2 M NaCl, 50 mM sodium acetate, pH 6.0 to 1.0 M NaCl, 50 mM sodium acetate, pH 6.5. Fractions are collected under constant A 280 monitoring of the effluent. Fractions containing the polypeptide (determined, for instance, by 16% SDS-PAGE) are then pooled.
• the resultant TRI 2 polypeptide should exhibit greater than 95% purity after the above refolding and purification steps. No major contaminant bands should be observed from Commassie blue stained 16% SDS-PAGE gel when 5 ug of purified protein is loaded.
• the purified TRI 2 protein can also be tested for endotoxin/LPS contamination, and typically the LPS content is less than 0.1 ng/ml according to LAL assays.
• the plasmid shuttle vector pA2 is used to insert TRI 2 polynucleotide into a baculovims to express TR12.
• This expression vector contains the strong polyhedrin promoter of the Autographa califomica nuclear polyhedrosis virus (AcMNPV) followed by convenient restriction sites such as BamHI, Xba I and Asp718.
• the polyadenylation site of the simian vims 40 (“SV40") is used for efficient polyadenylation.
• the plasmid contains the beta-galactosidase gene from E.
• plasmin under control of a weak Drosophila promoter in the same orientation, followed by the polyadenylation signal of the polyhedrin gene.
• the inserted genes are flanked on both sides by viral sequences for cell-mediated homologous recombination with wild-type viral DNA to generate a viable vims that express the cloned TRI 2 polynucleotide.
• baculovims vectors can be used in place of the vector above, such as pAc373, pVL941, and pAcIMl, as one skilled in the art would readily appreciate, as long as the constmct provides appropriately located signals for transcription, translation, secretion and the like, including a signal peptide and an in-frame AUG as required.
• Such vectors are described, for instance, in Luckow et al., Virology 170:31- 39 (1989).
• the TRI 2 cDNA sequence contained in the deposited clone, including the AUG initiation codon and any naturally associated leader sequence is amplified using the PCR protocol described in Example 1.
• the pA2 vector does not need a second signal peptide.
• the vector can be modified (pA2 GP) to include a baculovims leader sequence, using the standard methods described in Summers et al., "A Manual of Methods for Baculovims Vectors and Insect Cell Culture Procedures," Texas Agricultural Experimental Station Bulletin No. 1555 (1987).
• the cDNA sequence in the deposited plasmid encoding the full length TRI 2 protein, including the AUG initiation codon and the naturally associated leader sequence shown in SEQ ID NOT, is amplified using PCR oligonucleotide primers corresponding to the 5' and 3' sequences of the gene.
• the 5 ' primer has the sequence 5' GCGAGATCTGCCATCATGAAGCCAAGTCTGCTGTG 3' (SEQ ID NO: 14) containing the Bgl II restriction enzyme site, an efficient signal for initiation of translation in eukaryotic cells (Kozak, M., J. Mol. Biol.
• the 3 ' primer has the sequence 5' GCGTCTAGACTCTGATGATACAGAGAATC 3' (SEQ ID NO: 15) containing the Xba I restriction site followed by a number of nucleotides complementary to the 3' noncoding sequence in Figures lA-lC.
• the cDNA sequence encoding the extracellular or soluble portion of TR12 protein in the deposited clone is amplified using PCR oligonucleotide primers corresponding to the 5' and 3' sequences of the gene.
• the 5' primer has the sequence 5' GCGAGATCTGCCATCATGAAGCCAAGTCTGCTGTG 3' (SEQ ID NO: 16) containing the Bgl II restriction enzyme site, an efficient signal for initiation of translation in eukaryotic cells (Kozak, M., J. Mol. Biol. 196:947-950 (1987)), followed by a number of nucleotides of the sequence of the complete TRI 2 protein shown in Figures 1A-1C, beginning with the AUG initiation codon.
• the 3' primer has the sequence 5' GCGTCTAGATTACGCGTACTGGGCGGCTGTC 3' (SEQ ID NO: 17) containing the Xba I restriction site followed by a number of nucleotides complementary to the 3' noncoding sequence in Figures 1A-1C, and a stop codon inserted at nucleotide position 717-735.
• the amplified fragment is isolated from a 1 % agarose gel using a commercially available kit ("Geneclean,” BIO 101 Inc., La Jolla, Ca.). The fragment then is digested with appropriate restriction enzymes and again purified on a 1% agarose gel.
• the plasmid is digested with the corresponding restriction enzymes and optionally, can be dephosphorylated using calf intestinal phosphatase, using routine procedures known in the art.
• the DNA is then isolated from a 1 % agarose gel using a commercially available kit ("Geneclean" BIO 101 Inc., La Jolla, Ca.).
• the fragment and the dephosphorylated plasmid are ligated together with T4 DNA ligase.
• E. coli HB101 or other suitable E. coli hosts such as XL-1 Blue (Stratagene Cloning Systems, La Jolla, CA) cells are transformed with the ligation mixture and spread on culture plates.
• Bacteria containing the plasmid are identified by digesting DNA from individual colonies and analyzing the digestion product by gel electrophoresis. The sequence of the cloned fragment is confirmed by DNA sequencing.
• a plasmid containing the polynucleotide Five ug of a plasmid containing the polynucleotide is co-transfected with 1.0 ug of a commercially available linearized baculovims DNA ("BaculoGoldTM baculovims DNA", Pharmingen, San Diego, CA), using the lipofection method described by Feigner et al., Proc. Natl. Acad. Sci. USA 84:7413-7417 (1987).
• BaculoGoldTM vims DNA and 5 ug of the plasmid are mixed in a sterile well of a microtiter plate containing 50 ul of semm-free Grace's medium (Life Technologies Inc., Gaithersburg, MD).
• plaque assay After four days the supernatant is collected and a plaque assay is performed, as described by Summers and Smith, supra.
• An agarose gel with "Blue Gal” (Life Technologies Inc., Gaithersburg) is used to allow easy identification and isolation of gal-expressing clones, which produce blue-stained plaques.
• a detailed description of a "plaque assay” of this type can also be found in the user's guide for insect cell culture and baculovirology distributed by Life Technologies Inc., Gaithersburg, page 9-10.
• blue stained plaques are picked with the tip of a micropipettor (e.g., Eppendorf).
• the agar containing the recombinant viruses is then resuspended in a microcentrifuge tube containing 200 ul of Grace's medium and the suspension containing the recombinant baculovims is used to infect Sf9 cells seeded in 35 mm dishes. Four days later the supernatants of these culture dishes are harvested and then they are stored at 4 degree C. To verify the expression of the polypeptide, Sf9 cells are grown in Grace's medium supplemented with 10% heat-inactivated FBS. The cells are infected with the recombinant baculovims containing the polynucleotide at a multiplicity of infection ("MOI") of about 2.
• MOI multiplicity of infection
• radiolabeled proteins are desired, 6 hours later the medium is removed and is replaced with SF900 II medium minus methionine and cysteine (available from Life Technologies Inc., Rockville, MD). After 42 hours, 5 uCi of 35 S- methionine and 5 uCi 35 S-cysteine (available from Amersham) are added. The cells are further incubated for 16 hours and then are harvested by centrifugation. The proteins in the supernatant as well as the intracellular proteins are analyzed by SDS-PAGE followed by autoradiography (if radiolabeled).
• Microsequencing of the amino acid sequence of the amino terminus of purified protein may be used to determine the amino terminal sequence of the produced TRI 2 protein.
• TR12 polypeptide can be expressed in a mammalian cell.
• a typical mammalian expression vector contains a promoter element, which mediates the initiation of transcription of mRNA, a protein coding sequence, and signals required for the termination of transcription and polyadenylation of the transcript. Additional elements include enhancers, Kozak sequences and intervening sequences flanked by donor and acceptor sites for RNA splicing. Highly efficient transcription is achieved with the early and late promoters from SV40, the long terminal repeats (LTRs) from SV40, the long terminal repeats (LTRs) from SV40.
• LTRs long terminal repeats
• Retrovimses e.g., RSV, HTLVI, HIVI and the early promoter of the cytomegalovirus
• CMV CMV
• cellular elements can also be used (e.g., the human actin promoter).
• Suitable expression vectors for use in practicing the present invention include, for example, vectors such as pSVL and pMSG (Pharmacia, Uppsala, Sweden), pRSVcat (ATCC 37152), pSV2DHFR (ATCC 37146), pBC12MI (ATCC 67109), pCMVSport 2.0, and pCMVSport 3.0.
• Mammalian host cells that could be used include, human Hela, 293, H9 and Jurkat cells, mouse NIH3T3 and C127 cells, Cos 1 , Cos 7 and CV1, quail QC1-3 cells, mouse L cells and Chinese hamster ovary (CHO) cells.
• TRI 2 polypeptide can be expressed in stable cell lines containing the TRI 2 polynucleotide integrated into a chromosome.
• the co-transfection with a selectable marker such as DHFR, gpt, neomycin, hygromycin allows the identification and isolation of the transfected cells.
• the transfected TRI 2 gene can also be amplified to express large amounts of the encoded protein.
• the DHFR (dihydrofolate reductase) marker is useful in developing cell lines that carry several hundred or even several thousand copies of the gene of interest. (See, e.g., Alt et al., J. Biol. Chem. 253:13-57-1370 (1978); Hamlin and Ma, Biochem. et Biophys. Acta, 1097: 107-143 (1990); Page and Sydenham, Biotechnology 9:64-68 (1991).) Another useful selection marker is the enzyme glutamine synthase (GS) (Mu ⁇ hy et al., Biochem J.
• LTR strong promoter
• CMV-enhancer a fragment of the CMV-enhancer
• Multiple cloning sites e.g., with the restriction enzyme cleavage sites BamHI, Xbal and Asp718, facilitate the cloning of TRI 2.
• the vectors also contain the 3' intron, the polyadenylation and termination signal of the rat preproinsulin gene, and the mouse DHFR gene under control of the SV40 early promoter.
• the plasmid pC4 is digested Bgl II and Xba I and then dephosphorylated using calf intestinal phosphates by procedures known in the art. The vector is then isolated from a 1% agarose gel.
• the cDNA sequence encoding the full length TRI 2 protein in the deposited clone is amplified using PCR oligonucleotide primers corresponding to the 5' and 3 ' sequences of the gene.
• the 5' primer has the sequence 5' GCGAGATCTGCCATCATGAAGCCAAGTCTGCTGTG 3' (SEQ ID NO: 18) containing the Bgl II restriction enzyme site, an efficient signal for initiation of translation in eukaryotic cells (Kozak, M., J. Mol. Biol 196:947-950 (1987)), followed by a number of nucleotides of the sequence of the complete TRI 2 protein shown in Figures 1A-1C, beginning with the AUG initiation codon.
• the 3' primer has the sequence 5' GCGTCTAGACTCTGATGATACAGAGAATC 3' (SEQ ID NO: 19) containing the Xba I restriction site followed by a number of nucleotides complementary to the 3' noncoding sequence in Figures lA-lC.
• the cDNA sequence encoding the extracellular or soluble portion of TRI 2 protein in the deposited clone is amplified using PCR oligonucleotide primers corresponding to the 5' and 3' sequences of the gene.
• the 5' primer has the sequence 5' GCGAGATCTGCCATCATGAAGCCAAGTCTGCTGTG 3' (SEQ ID NO:20) containing the Bgl II restriction enzyme site, an efficient signal for initiation of translation in eukaryotic cells (Kozak, M., J. Mol Biol. 196:947-950 (1987)), followed by a number of nucleotides of the sequence of the complete TRI 2 protein shown in Figures 1A-1C, beginning with the AUG initiation codon.
• the 3' primer has the sequence 5' GCGTCTAGATTACGCGTACTGGGCGGCTGTC 3'
• the vector does not need a second signal peptide.
• the vector can be modified to include a heterologous signal sequence in an effort to secrete the protein from the cell. (See, e.g., WO 96/34891.)
• the amplified fragment is then digested with the Bgl II and Xba I, purified on a 1% agarose gel using a commercially available kit ("Geneclean," BIO 101 Inc., La Jolla, Ca.).
• the isolated fragment and the dephosphorylated vector are then ligated with T4 DNA ligase.
• E. coli HB101 or XL-1 Blue cells are then transformed and bacteria are identified that contain the fragment inserted into plasmid pC4 using, for instance, restriction enzyme analysis.
• Chinese hamster ovary cells lacking an active DHFR gene is used for transfection.
• Five ⁇ g of the expression plasmid pC4 is cotransfected with 0.5 ug of the plasmid pSVneo using lipofectin (Feigner et al., supra).
• the plasmid pSV2-neo contains a dominant selectable marker, the neo gene from Tn5 encoding an enzyme that confers resistance to a group of antibiotics including G418.
• the cells are seeded in alpha minus MEM supplemented with 1 mg/ml G418.
• the cells are trypsinized and seeded in hybridoma cloning plates (Greiner, Germany) in alpha minus MEM supplemented with 10, 25, or 50 ng/ml of metothrexate plus 1 mg/ml G418. After about 10-14 days single clones are trypsinized and then seeded in 6-well petri dishes or 10 ml flasks using different concentrations of methotrexate (50 nM, 100 nM, 200 nM, 400 nM, 800 nM).
• methotrexate 50 nM, 100 nM, 200 nM, 400 nM, 800 nM.
• oligonucleotide primers of about 15-25 nucleotides are derived from the desired 5' and 3' positions of a polynucleotide of SEQ ID NOT. The 5' and 3' positions of the primers are determined based on the desired TRI 2 polynucleotide fragment. An initiation and stop codon are added to the 5' and 3' primers respectively, if necessary, to express the TR12 polypeptide fragment encoded by the polynucleotide fragment.
• Preferred TRI 2 polynucleotide fragments are those encoding the N-terminal and C-terminal deletion mutants disclosed above in the "Polynucleotide and Polypeptide Fragments" section of the Specification.
• Additional nucleotides containing restriction sites to facilitate cloning of the TRI 2 polynucleotide fragment in a desired vector may also be added to the 5' and 3 ' primer sequences.
• the TR12 polynucleotide fragment is amplified from genomic DNA or from the deposited cDNA clone using the appropriate PCR oligonucleotide primers and conditions discussed herein or known in the art.
• the TRI 2 polypeptide fragments encoded by the TRI 2 polynucleotide fragments of the present invention may be expressed and purified in the same general manner as the full length polypeptides, although routine modifications may be necessary due to the differences in chemical and physical properties between a particular fragment and full length polypeptide.
• the polynucleotide encoding the TR12 polypeptide fragment Gly-35 to Pro-276 is amplified and cloned as follows: A 5' primer is generated comprising a restriction enzyme site followed by an initiation codon in frame with the polynucleotide sequence encoding the N-terminal portion of the polypeptide fragment beginning with Gly-35. A complementary 3' primer is generated comprising a restriction enzyme site followed by a stop codon in frame with the polynucleotide sequence encoding C-terminal portion of the TRI 2 polypeptide fragment ending with Pro-276.
• the amplified polynucleotide fragment and the expression vector are digested with restriction enzymes which recognize the sites in the primers.
• the digested polynucleotides are then ligated together.
• the TRI 2 polynucleotide fragment is inserted into the restricted expression vector, preferably in a manner which places the TRI 2 polypeptide fragment coding region downstream from the promoter.
• the ligation mixture is transformed into competent E. coli cells using standard procedures and as described in the Examples herein. Plasmid DNA is isolated from resistant colonies and the identity of the cloned DNA confirmed by restriction analysis, PCR and DNA sequencing.
• Example 10 Protein Fusions of TR12 TR12 polypeptides are preferably fused to other proteins. These fusion proteins can be used for a variety of applications. For example, fusion of TR12 polypeptides to His-tag, HA-tag, protein A, IgG domains, and maltose binding protein facilitates purification. (See Example 5; see also EP A 394,827; Traunecker, et al., Nature 331:84-86 (1988).) Similarly, fusion to IgG-1, IgG-3, and albumin increases the halflife time in vivo.
• Nuclear localization signals fused to TR12 polypeptides can target the protein to a specific subcellular localization, while covalent heterodimer or homodimers can increase or decrease the activity of a fusion protein. Fusion proteins can also create chimeric molecules having more than one function. Finally, fusion proteins can increase solubility and/or stability of the fused protein compared to the non-fused protein. All of the types of fusion proteins described above can be made by modifying the following protocol, which outlines the fusion of a polypeptide to an IgG molecule, or the protocol described in Example 5.
• the human Fc portion of the IgG molecule can be PCR amplified, using primers that span the 5' and 3' ends of the sequence described below. These primers also should have convenient restriction enzyme sites that will facilitate cloning into an expression vector, preferably a mammalian expression vector.
• the deposited clone is amplified using PCR oligonucleotide primers corresponding to the 5' and 3 ' sequences of the gene.
• the 5' primer has the sequence 5' GCGAGATCTGCCATC ATGAAGCCAAGTCTGCTGTG 3' (SEQ ID NO:22) containing the Bgl II restriction enzyme site, followed by a number of nucleotides of the sequence of the complete TRI 2 protein shown in Figures 1 A-C.
• the 3' primer has the sequence 5 ' GCGTCTAGACGCGTACTGGGCGGCTGTC 3' (SEQ ID NO:23) containing the Xba I restriction site followed by a number of nucleotides complementary to the 3 ' noncoding sequence in Figures lA-C.
• the human Fc portion can be ligated into the BamHI cloning site. Note that the 3' BamHI site should be destroyed.
• the vector containing the human Fc portion is re-restricted with BamHI, linearizing the vector, and TRI 2 polynucleotide, isolated by the PCR protocol described in Example 1, is ligated into this BamHI site. Note that the polynucleotide is cloned without a stop codon, otherwise a fusion protein will not be produced.
• the naturally occurring signal sequence is used to produce the secreted protein, pC4 does not need a second signal peptide.
• the vector can be modified to include a heterologous signal sequence. (See, e.g., WO 96/34891.)
• the antibodies of the present invention can be prepared by a variety of methods.
• cells expressing TR12 is administered to an animal to induce the production of sera containing polyclonal antibodies.
• a preparation of TRI 2 protein is prepared and purified to render it substantially free of natural contaminants. Such a preparation is then introduced into an animal in order to produce polyclonal antisera of greater specific activity.
• the antibodies of the present invention are monoclonal antibodies (or protein binding fragments thereof).
• Such monoclonal antibodies can be prepared using hybridoma technology. (Kohler et al., Nature 256:495 (1975); Kohler et al., Eur. J. Immunol. 6:511 (1976); Kohler et al., Eur. J . Immunol. 6:292 (1976); Hammerling et al., in: Monoclonal Antibodies and T-Cell Hybridomas, Elsevier, N.Y., pp.
• such procedures involve immunizing an animal (preferably a mouse) with TRI 2 polypeptide or, more preferably, with a secreted TR12 polypeptide-expressing cell.
• TRI 2 polypeptide or, more preferably, with a secreted TR12 polypeptide-expressing cell.
• Such cells may be cultured in any suitable tissue culture medium; however, it is preferable to culture cells in Earle's modified Eagle's medium supplemented with 10% fetal bovine semm (inactivated at about 56 degree C), and supplemented with about 10 g/1 of nonessential amino acids, about 1,000 U/ml of penicillin, and about 100 ug/ml of streptomycin.
• the splenocytes of such mice are extracted and fused with a suitable myeloma cell line.
• a suitable myeloma cell line may be employed in accordance with the present invention; however, it is preferable to employ the parent myeloma cell line (SP2O), available from the ATCC.
• SP2O parent myeloma cell line
• the resulting hybridoma cells are selectively maintained in HAT medium, and then cloned by limiting dilution as described by Wands et al. (Gastroenterology 80:225-232 (1981).)
• the hybridoma cells obtained through such a selection are then assayed to identify clones which secrete antibodies capable of binding the TRI 2 polypeptide.
• additional antibodies capable of binding to TRI 2 polypeptide can be produced in a two-step procedure using anti-idiotypic antibodies.
• a method makes use of the fact that antibodies are themselves antigens, and therefore, it is possible to obtain an antibody which binds to a second antibody.
• protein specific antibodies are used to immunize an animal, preferably a mouse.
• the splenocytes of such an animal are then used to produce hybridoma cells, and the hybridoma cells are screened to identify clones which produce an antibody whose ability to bind to the TR12 protein-specific antibody can be blocked byTR12.
• Such antibodies comprise anti-idiotypic antibodies to the TRI 2 protein-specific antibody and can be used to immunize an animal to induce formation of further TRI 2 protein-specific antibodies.
• Fab and F(ab')2 and other fragments of the antibodies of the present invention may be used according to the methods disclosed herein.
• Such fragments are typically produced by proteolytic cleavage, using enzymes such as papain (to produce Fab fragments) or pepsin (to produce F(ab')2 fragments).
• enzymes such as papain (to produce Fab fragments) or pepsin (to produce F(ab')2 fragments).
• secreted TRI 2 protein-binding fragments can be produced through the application of recombinant DNA technology or through synthetic chemistry.
• chimeric monoclonal antibodies For in vivo use of antibodies in humans, it may be preferable to use "humanized" chimeric monoclonal antibodies. Such antibodies can be produced using genetic constmcts derived from hybridoma cells producing the monoclonal antibodies described above. Methods for producing chimeric antibodies are known in the art. (See, for review, Morrison, Science 229:1202 (1985); Oi et al., BioTechniques 4:214 (1986); Cabilly et al., U.S. Patent No.
• V-genes isolated from human PBLs are constmcted into a large library of antibody fragments which contain reactivities against TRI 2 to which the donor may or may not have been exposed (see e.g., U.S. Patent No. 5,885,793 inco ⁇ orated herein in its entirety by reference).
• a library of scFvs is constmcted from the RNA of human PBLs as described in WO92/01047. To rescue phage displaying antibody fragments, approximately 10 9 E.
• coli harbouring the phagemid are used to inoculate 50 ml of 2xTY containing 1% glucose and 100 ug/ml of ampicillin (2xTY-AMP-GLU) and grown to an O.D. of 0.8 with shaking.
• Five ml of this culture is used to innoculate 50 ml of 2xTY-AMP-GLU, 2 x 10 8 TU of delta gene 3 helper (Ml 3 delta gene III, see WO92/01047) are added and the culture incubated at 37 degree C for 45 minutes without shaking and then at 37 degree C for 45 minutes with shaking.
• the culture is centrifuged at 4000 r.p.m. for 10 min. and the pellet resuspended in 2 liters of of 2xTY containing 100 ug/ml ampicillin and 50 ug/ml kanamycin and grown overnight. Phage are prepared as described in WO92/01047.
• M13 delta gene III is prepared as follows: M13 delta gene III helper phage does not encode gene III protein, hence the phage(mid) displaying antibody fragments have a greater avidity of binding to antigen. Infectious M13 delta gene III particles are made by growing the helper phage in cells harbouring a pUC19 derivative supplying the wild type gene III protein during phage mo ⁇ hogenesis. The culture is incubated for 1 hour at 37 degree C without shaking and then for a further hour at 37 degree C with shaking.
• Cells are spun down (IEC-Centra 8, 4000 revs/min for 10 min), resuspended in 300 ml 2xTY broth containing 100 ug ampicillin/ml and 25 ug kanamycin/ml (2xTY- AMP- KAN) and grown overnight, shaking at 37° C. Phage particles are purified and concentrated from the culture medium by two PEG-precipitations (Sambrook et al., 1990), resuspended in 2 ml PBS and passed through a 0.45 um filter (Minisart NML; Sartorius) to give a final concentration of approximately 10 13 transducing units/ml (ampicillin-resistant clones).
• Immunotubes (Nunc) are coated overnight in PBS with 4 ml of either 100 ug/ml or 10 ug/ml of a polypeptide of the present invention. Tubes are blocked with 2% Marvel-PBS for 2 hours at 37 degree C and then washed 3 times in PBS. Approximately 10 13 TU of phage is applied to the tube and incubated for 30 minutes at room temperature tumbling on an over and under turntable and then left to stand for another 1.5 hours. Tubes are washed 10 times with PBS 0.1% Tween-20 and 10 times with PBS.
• Phage are eluted by adding 1 ml of 100 mM triethylamine and rotating 15 minutes on an under and over turntable after which the solution is immediately neutralized with 0.5 ml of 1.0M Tris-HCl, pH 7.4. Phage are then used to infect 10 ml of mid-log E. coli TGI by incubating eluted phage with bacteria for 30 minutes at 37 degree C. The E. coli are then plated on TYE plates containing 1% glucose and 100 ug/ml ampicillin. The resulting bacterial library is then rescued with delta gene 3 helper phage as described above to prepare phage for a subsequent round of selection.
• Binders Eluted phage from the 3rd and 4th rounds of selection are used to infect E. coli HB 2151 and soluble scFv is produced (Marks, et al., 1991) from single colonies for assay.
• ELISAs are performed with microtitre plates coated with either 10 pg/ml of the polypeptide of the present invention in 50 mM bicarbonate pH 9.6. Clones positive in ELISA are further characterized by PCR finge ⁇ rinting (see e.g., WO92/01047) and then by sequencing.
• Example 1 2 Production Of TR12 Protein For High-Throughput Screening Assays
• the following protocol produces a supernatant containing soluble TRI 2 polypeptide, constmcted by the methods in the previous examples. This supernatant can then be used in the Screening Assays described in Examples 14-21.
• dilute Poly-D-Lysine (644 587 Boehringer-Mannheim) stock solution (lmg/ml in PBS) 1:20 in PBS (w/o calcium or magnesium 17-516F Biowhittaker) for a working solution of 50ug/ml.
• PBS w/o calcium or magnesium 17-516F Biowhittaker
• the PBS should remain in the well until just prior to plating the cells and plates may be poly-lysine coated in advance for up to two weeks. Plate 293T cells (do not carry cells past P+20) at 2 x 10 ⁇ cells/well in .5ml
• DMEM Dulbecco's Modified Eagle Medium
• FBS FBS(14-503F Biowhittaker)/ lx Penstrep(17-602E Biowhittaker). Let the cells grow overnight.
• the transfection should be performed by tag-teaming the following tasks.
• tags on time is cut in half, and the cells do not spend too much time on PBS.
• person A aspirates off the media from four 24-well plates of cells, and then person B rinses each well with .5-lml PBS.
• Person A then aspirates off PBS rinse, and person B, using al2-channel pipetter with tips on every other channel, adds the 200ul of DNA/Lipofectamine/Optimem I complex to the odd wells first, then to the even wells, to each row on the 24-well plates. Incubate at 37 degree C for 6 hours.
• Lysine HCL 32.34 mg/ml of L-Methionine; 68.48 mg/ml of L-Phenylalainine; 40.0 mg/ml of L-Proline; 26.25 mg/ml of L-Serine; 101.05 mg/ml of L-Threonine; 19.22 mg/ml of L-Tryptophan; 91.79 mg/ml of L-Tryrosine-2Na-2H2 ⁇ ; and 99.65 mg/ml of
• the transfection reaction is terminated, preferably by tag-teaming, at the end of the incubation period.
• Person A aspirates off the transfection media, while person B adds 1.5ml appropriate media to each well.
• Incubate at 37 degree C for 45 or 72 hours depending on the media used: 1%BSA for 45 hours or CHO-5 for 72 hours.
• the activity when activity is obtained in any of the assays described below using a supernatant, the activity originates from either the TRI 2 polypeptide directly (e.g., as a secreted protein) or by TRI 2 inducing expression of other proteins, which are then secreted into the supernatant.
• the invention further provides a method of identifying the protein in the supernatant characterized by an activity in a particular assay.
• Jaks-STATs pathway One signal transduction pathway involved in the differentiation and proliferation of cells is called the Jaks-STATs pathway. Activated proteins in the Jaks-STATs pathway bind to gamma activation site "GAS” elements or interferon-sensitive responsive element ("ISRE"), located in the promoter of many genes. The binding of a protein to these elements alter the expression of the associated gene.
• GAS gamma activation site
• ISRE interferon-sensitive responsive element
• GAS and ISRE elements are recognized by a class of transcription factors called Signal Transducers and Activators of Transcription, or "STATs.”
• STATs Signal Transducers and Activators of Transcription
• Statl and Stat3 are present in many cell types, as is Stat2 (as response to IFN-alpha is widespread).
• Stat4 is more restricted and is not in many cell types though it has been found in T helper class I, cells after treatment with IL-12.
• Stat5 was originally called mammary growth factor, but has been found at higher concentrations in other cells including myeloid cells. It can be activated in tissue culture cells by many cytokines.
• the STATs are activated to translocate from the cytoplasm to the nucleus upon tyrosine phosphorylation by a set of kinases known as the Janus Kinase ("Jaks") family.
• Jaks represent a distinct family of soluble tyrosine kinases and include Tyk2, Jakl, Jak2, and Jak3. These kinases display significant sequence similarity and are generally catalytically inactive in resting cells.
• the Jaks are activated by a wide range of receptors summarized in the Table below. (Adapted from review by Schidler and Darnell, Ann. Rev. Biochem.
• a cytokine receptor family capable of activating Jaks, is divided into two groups: (a) Class 1 includes receptors for IL-2, IL-3, IL-4, IL-6, IL-7, IL-9, IL-11, IL- 12, IL-15, Epo, PRL, GH, G-CSF, GM-CSF, LIF, CNTF, and thrombopoietin; and (b) Class 2 includes IFN-a, IFN-g, and IL-10.
• the Class 1 receptors share a conserved cysteine motif (a set of four conserved cysteines and one tryptophan) and a WSXWS motif (a membrane proxial region encoding T ⁇ -Ser-Xxx-T ⁇ -Ser (SEQ ID NO:47)).
• Jaks are activated, which in turn activate STATs, which then translocate and bind to GAS elements. This entire process is encompassed in the Jaks-STATs signal transduction pathway.
• activation of the Jaks-STATs pathway can be used to indicate proteins involved in the proliferation and differentiation of cells.
• growth factors and cytokines are known to activate the Jaks-STATs pathway. (See Table below.)
• activators of the Jaks-STATs pathway can be identified.
• IL-2 (lymphocytes) - + - + 1,3,5 GAS
• IL-7 (lymphocytes) - + - + 5 GAS
• IL-9 (lymphocytes) - + - + 5 GAS
• IL-13 (lymphocyte) - + 7 7 6 GAS
• a PCR based strategy is employed to generate a GAS-SV40 promoter sequence.
• the 5' primer contains four tandem copies of the GAS binding site found in the IRFl promoter and previously demonstrated to bind STATs upon induction with a range of cytokines (Rothman et al., Immunity 1:457-468 (1994).), although other GAS or ISRE elements can be used instead.
• the 5' primer also contains 18bp of sequence complementary to the SV40 early promoter sequence and is flanked with an Xhol site.
• the sequence of the 5' primer is: 5':GCGCCTCGAGATTTCCCCGAAATCTAGATTTCCCCGAAATGATTTCCCCG AAATGATTTCCCCGAANTATCTGCCATCTCAATTAG:3' (SEQ ID ⁇ O:25)

Landscapes

• Health & Medical Sciences (AREA)
• Life Sciences & Earth Sciences (AREA)
• Chemical & Material Sciences (AREA)
• Organic Chemistry (AREA)
• General Health & Medical Sciences (AREA)
• Veterinary Medicine (AREA)
• Medicinal Chemistry (AREA)
• Chemical Kinetics & Catalysis (AREA)
• General Chemical & Material Sciences (AREA)
• Pharmacology & Pharmacy (AREA)
• Animal Behavior & Ethology (AREA)
• Public Health (AREA)
• Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
• Engineering & Computer Science (AREA)
• Bioinformatics & Cheminformatics (AREA)
• Oncology (AREA)
• Diabetes (AREA)
• Immunology (AREA)
• Hematology (AREA)
• Biomedical Technology (AREA)
• Gastroenterology & Hepatology (AREA)
• Cardiology (AREA)
• Tropical Medicine & Parasitology (AREA)
• Obesity (AREA)
• Communicable Diseases (AREA)
• Neurology (AREA)
• Neurosurgery (AREA)
• Pain & Pain Management (AREA)
• Rheumatology (AREA)
• Urology & Nephrology (AREA)
• Physical Education & Sports Medicine (AREA)
• Cell Biology (AREA)
• Toxicology (AREA)
• Zoology (AREA)
• Heart & Thoracic Surgery (AREA)
• Biochemistry (AREA)
• Biophysics (AREA)
• Genetics & Genomics (AREA)
• Molecular Biology (AREA)
• Proteomics, Peptides & Aminoacids (AREA)

Applications Claiming Priority (3)

Publications (2)

Family

ID=22303299

Family Applications (1)

Country Status (5)

Families Citing this family (5)

Citations (1)

• 1999
  • 1999-10-19 EP EP99952028A patent/EP1121419A4/de not_active Withdrawn
  • 1999-10-19 JP JP2000577283A patent/JP2002527104A/ja not_active Withdrawn
  • 1999-10-19 CA CA002347080A patent/CA2347080A1/en not_active Abandoned
  • 1999-10-19 WO PCT/US1999/024413 patent/WO2000023572A1/en not_active Application Discontinuation
  • 1999-10-19 AU AU64334/99A patent/AU6433499A/en not_active Abandoned

Patent Citations (1)

Non-Patent Citations (1)

Also Published As

Similar Documents

Legal Events