EP1117768A1 - Dnazymes and methods for treating restenosis - Google Patents
Dnazymes and methods for treating restenosisInfo
- Publication number
- EP1117768A1 EP1117768A1 EP99938479A EP99938479A EP1117768A1 EP 1117768 A1 EP1117768 A1 EP 1117768A1 EP 99938479 A EP99938479 A EP 99938479A EP 99938479 A EP99938479 A EP 99938479A EP 1117768 A1 EP1117768 A1 EP 1117768A1
- Authority
- EP
- European Patent Office
- Prior art keywords
- dnazyme
- restenosis
- onset
- myc
- inhibiting
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
- C12N15/1135—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against oncogenes or tumor suppressor genes
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P9/00—Drugs for disorders of the cardiovascular system
Definitions
- This invention relates to inhibiting the onset of restenosis using DNAzymes.
- the DNAzymes accomplish this end by cleaving mRNA encoding c-myc, whose expression in vascular smooth muscle cells is required for restenosis to occur.
- Restenosis is a serious medical disorder which often occurs following angioplasty. This disorder afflicts 30%-60% of all angioplasty patients.
- Restenosis is understood to be caused, at least in part, by excessive proliferation of smooth muscle cells
- SMC's following vascular injury occurring during angioplasty.
- Several biological modulators are thought to facilitate this SMC proliferation. These modulators include platelet-derived growth factor (“PDGF”) , fibroblast growth factor (“FGF”) and insulin growth factor (“IGF”) (Ross; Banscota; Libby; Gay) .
- PDGF platelet-derived growth factor
- FGF fibroblast growth factor
- IGF insulin growth factor
- the induction of SMC proliferation by these modulators occurs via the intracellular transactivation of a number of important genes (Kindy; Gadeau) . These genes include c-myc, c-myb, c-fos and PCNA (proliferating cell nuclear antigen) , and generally are cell cycle- specific.
- the c-myc gene is over-expressed in SMC's within 30 minutes to two hours of vascular trauma, and expression declines to normal levels within 12 hours thereafter.
- angioplasty causes vascular SMC injury, which triggers excess c-myc expression beginning 30 minutes to two hours after injury, and ending 12 hours after injury.
- Radioactive implants include either radioactive implants or delivery of a radioactive composition to the site being treated. Although radiation therapy has shown some promising results, the long-term side effects of intra-coronary radiation have yet to be established. Regarding pharmacological therapy, both the anti-thrombotin and anti-proliferation approaches employed to date are generally ineffective (Bennet) .
- antisense nucleic acid technology has been one of the major tools of choice to inactivate genes whose expression causes disease and is thus undesirable.
- the anti-sense approach employs a nucleic acid molecule that is complementary to, and thereby hybridizes with, an mRNA molecule encoding an undesirable gene. Such hybridization leads to the inhibition of gene expression.
- Anti-sense technology suffers from certain drawbacks. Anti-sense hybridization results in the formation of a DNA/target mRNA heteroduplex . This heteroduplex serves as a substrate for RNAse H-mediated degradation of the target mRNA component.
- the DNA anti-sense molecule serves in a passive manner, in that it merely facilitates the required cleavage by endogenous RNAse H enzyme. This dependence on RNAse H confers limitations on the design of anti-sense molecules regarding their chemistry and ability to form stable heteroduplexes with their target mRNA' s . Anti- sense DNA molecules also suffer from problems associated with non-specific activity and, at higher concentrations, even toxicity.
- catalytic nucleic acid molecules As an alternative to anti-sense molecules, catalytic nucleic acid molecules have shown promise as therapeutic agents for suppressing gene expression, and are widely discussed in the literature (Haseloff; Breaker (1994) ; Koizumi; Otsuka; Kashani-Sabet; Raillard; and Carmi) .
- a catalytic nucleic acid molecule functions by actually cleaving its target mRNA molecule instead of merely binding to it.
- Catalytic nucleic acid molecules can only cleave a target nucleic acid sequence if that target sequence meets certain minimum requirements.
- the target sequence must be complementary to the hybridizing regions of the catalytic nucleic acid, and the target must contain a specific sequence at the site of cleavage.
- RNA molecules Catalytic RNA molecules (“ribozymes”) are well documented (Haseloff; Symonds; and Sun), and have been shown to be capable of cleaving both RNA
- Ribozymes are highly susceptible to enzymatic hydrolysis within the cells where they are intended to perform their function. This in turn limits their pharmaceutical applications.
- DNAzymes are single-stranded, and cleave both RNA (Breaker (1994); Santoro) and DNA (Carmi) .
- a general model for the DNAzyme has been proposed, and is known as the "10-23" model.
- DNAzymes following the "10-23” model also referred to simply as “10-23 DNAzymes", have a catalytic domain of 15 deoxyribonucleotides, flanked by two substrate- recognition domains of seven to nine deoxyribonucleotides each. In vitro analyses show that this type of DNAzyme can effectively cleave its substrate RNA at purine :pyrimidine junctions under physiological conditions (Santoro) .
- DNAzymes show promise as therapeutic agents. However, DNAzyme success against a disease caused by the presence of a known mRNA molecule is not predictable. This unpredictability is due, in part, to two factors. First, certain mRNA secondary structures can impede a DNAzyme' s ability to bind to and cleave its target mRNA. Second, the uptake of a DNAzyme by cells expressing the target mRNA may not be efficient enough to permit therapeutically meaningful results. For these reasons, merely knowing of a disease and its causative target mRNA sequence does not alone allow one to reasonably predict the therapeutic success of a
- This application provides a DNAzyme which specifically cleaves c-myc mRNA, comprising (a) a catalytic domain that has the nucleotide sequence GGCTAGCTACAACGA and cleaves mRNA at any purine :pyrimidine cleavage site at which it is directed, (b) a binding domain contiguous with the 5' end of the catalytic domain, and (c) another binding domain contiguous with the 3' end of the catalytic domain, wherein the binding domains are complementary to, and therefore hybridize with, the two regions immediately flanking the purine residue of the cleavage site within the c-myc mRNA, respectively, at which
- each binding domain is at least six nucleotides in length, and both binding domains have a combined total length of at least 14 nucleotides.
- This invention also provides a pharmaceutical composition for inhibiting the onset of restenosis, which comprises the instant DNAzyme and a pharmaceutically acceptable carrier suitable for topical administration.
- This invention further provides an angioplastic stent for inhibiting the onset of restenosis, which comprises an agioplastic stent operably coated with a prophylactically effective dose of the instant pharmaceutical composition.
- This invention still further provides a method for inhibiting the onset of restenosis in a subject undergoing angioplasty, which comprises topically administering a prophylactically effective dose of the instant pharmaceutical composition to the subject at around the time of the angioplasty.
- this invention provides a method for inhibiting the onset of restenosis in a subject undergoing angioplasty, which comprises topically administering the instant angioplastic stent to the subject at the time of the angioplasty.
- Figure 1 shows the structure of a "10-23" DNAzyme described in Santoro.
- the cleavage site is indicated by an asterisk between X and Y.
- the substrate-binding domains are indicated by N' s .
- Figure 2 shows c-myc RNA-cleaving DNAzyme designs.
- the cleavage site for the c-myc DNAzyme was chosen at the AUG start codon of the human c-myc mRNA (2nd exon) . Cleavage occurs between A and U as indicated.
- Figure 3 shows the optimization of DNAzyme arm-length and chemical modification.
- C-myc-cleaving DNAzymes with different arm lengths were designed based on the "10-23" model.
- the 3' -3' terminal base inversion at the 3' end is indicated by a shadow C or G (3'INV) .
- Figure 4 shows the analysis of multiple turnover kinetics.
- Panel A shows a densitometric image, obtained using a Phosphorlmager (Molecular Dynamics) , of a 16% polyacrylamide gel, showing cleavage of synthetic c-myc mRNA under multiple turnover conditions. All reactions were performed with 200 pM DNAzyme and 2 nM, 4 nM, 8 nM, 16 nM, and 32 nM of substrate mRNA (as indicated) . The incubation time for each reaction, ranging from 0-60 minutes, is indicated at the top of each lane.
- Panel B shows a plot of DNAzyme cleavage progress (nM) for each substrate concentration. These data were derived from densitometry measurements of cleaved bands shown in Panel A.
- Figure 5 shows the in vitro cleavage of c-myc mRNA.
- 1.5 kb c-myc mRNA substrate were transcribed from a pGEM vector in the presence of 32p_ ⁇ ⁇ p #
- the cleavage reaction was performed at 10 mM MgCl2, 50 mM Tris.HCl, pH 7.5, 37°C for 60 minutes.
- Figure 6 shows a stability assay of the 3 '-inverted DNAzyme in human serum.
- DNAzymes were incubated with AB-type human serum (Sigma) . Samples were collected at different time points as indicated, and labeled with 32 P. The labeled DNAzymes were analyzed on 16% PAGE gel. Typical gel patterns are shown here for unmodified (top right) and 3' inverted DNAzymes (bottom right) .
- Figure 7 shows the testing of c-myc mRNA-cleaving DNAzymes in SV-LT-SMC's.
- Growth-arrested SMC's were stimulated with 10% FBS-DME (Dulbecco's Modified Eagle Medium containing 0.5% fetal bovine serum) in the presence of 10 mM anti-c-myc mRNA DNAzyme designated Rs-6 (described below) , 10 mM control oligonucleotide (same arm sequences as Rs-6, with an inverted catalytic core sequence), or liposome alone (DOTAP; i.e. N-[l- (2, 3-dioleoyloxy) -N,N,N-trimethylammonium- methylsulfate) .
- the data are displayed as mean ⁇ SD.
- FIG 8 shows dose-response experiments for Rs-6 DNAzyme in SMC's. The experimental details are as per Figure 7. The data are expressed as a percentage of the control.
- Figure 9 shows c-myc expression in DNAzyme-treated SMC's.
- Cells were labeled with 3 ⁇ S-methionine as described in Example 7, and immunoprecipitation was performed to determine the expression level of c-myc protein in DNAzyme-treated SMC's.
- Figure 10 shows the genomic DNA sequence of the human c- myc gene (exons 1 and 2) .
- This invention is directed to inhibiting the onset of restenosis using DNAzyme technology.
- the disorder's onset triggered by physical trauma to arterial smooth muscle during angioplasty, is characterized by a several-hour period of c-myc over-expression following shortly thereafter.
- This c-myc over-expression leads to excess SMC proliferation, and inhibition of this overexpression in turn inhibits the onset of restenosis.
- This invention exploits this "window of opportunity" of c-myc over-expression by applying a c- myc mRNA-specific DNAzyme to the area of trauma around the time of angioplasty, thereby cleaving the mRNA and inhibiting restenosis onset.
- this application provides a DNAzyme which specifically cleaves c-myc mRNA, comprising (a) a catalytic domain that has the nucleotide sequence GGCTAGCTACAACGA and cleaves mRNA at any purine :pyrimidine cleavage site at which it is directed, (b) a binding domain contiguous with the 5' end of the catalytic domain, and (c) another binding domain contiguous with the 3' end of the catalytic domain, wherein the binding domains are complementary to, and therefore hybridize with, the two regions immediately flanking the purine residue of the cleavage site within the c-myc mRNA, respectively, at which DNAzyme-catalyzed cleavage is desired, and wherein each binding domain is at least six nucleotides in length, and both binding domains have a combined total length of at least 14 nucleotides.
- DNAzyme means a DNA molecule that specifically recognizes and cleaves a distinct target nucleic acid sequence, which can be either DNA or RNA.
- the instant DNAzyme cleaves RNA molecules, and is of the "10-23" model, as shown in Figure 1, named so for historical reasons. This type of DNAzyme is described in Santoro.
- the RNA target sequence requirement for the 10-23 DNAzyme is any RNA sequence consisting of
- the binding domain lengths can be of any permutation, and can be the same or different. Various permutations such as 7+7, 8+8 and 9+9 are envisioned, and are exemplified more fully in the Examples that follow. It is well established that the greater the binding domain length, the more tightly it will bind to its complementary mRNA sequence. According, in the preferred embodiment, each binding domain is nine nucleotides in length. In one embodiment, the instant DNAzyme has the sequence
- TGAGGGGCAGGCTAGCTACAACGACGTCGTGAC also referred to herein as "Rs-6" .
- a 3' -3' inversion means the covalent phosphate bonding between the 3' carbons of the terminal nucleotide and its adjacent nucleotide.
- the instant DNAzymes can contain modified nucleotides.
- Modified nucleotides include, for example, N3'-P5' phosphoramidate linkages, and peptide-nucleic acid linkages. These are well known in the art (Wagner) .
- any contiguous purine: pyrimidine nucleotide pair within the c-myc mRNA can serve as a cleavage site.
- purine :uracil is the desired purine : pyrimidine cleavage site.
- the c-myc mRNA region containing the cleavage site can be any region.
- the location within the c-myc mRNA at which DNAzyme-catalyzed cleavage is desired can be the translation initiation site, a splice recognition site, the 5' untranslated region, and the 3' untranslated region.
- the cleavage site is located at the translation initiation site.
- ⁇ c-myc mRNA means any mRNA sequence encoded by the human c-myc DNA sequence shown in Figure 10 or by any naturally occurring polymorphism thereof.
- C-myc mRNA includes both mature and immature mRNA.
- This invention also provides a pharmaceutical composition for inhibiting the onset of restenosis, which comprises the instant DNAzyme and a pharmaceutically acceptable carrier suitable for topical administration.
- topically administering the instant pharmaceutical composition can be effected or performed using any of the various methods and delivery systems known to those skilled in the art.
- the topical administration can be performed, for example, via catheter and topical injection, and via coated stent as discussed below.
- compositions for topical administration are well known in the art, as are methods for combining same with active agents to be delivered.
- the following delivery systems, which employ a number of routinely used carriers, are only representative of the many embodiments envisioned for administering the instant composition.
- Topical delivery systems include, for example, gels and solutions, and can contain excipients such as solubilizers, permeation enhancers (e.g., fatty acids, fatty acid esters, fatty alcohols and amino acids) , and hydrophilic polymers (e.g., polycarbophil and polyvinylpyrolidone) .
- the pharmaceutically acceptable carrier is a liposome or a biodegradable polymer.
- liposomes which can be used in this invention include the following: (1) CellFectin, 1:1.5 (M/M) liposome formulation of the cationic lipid N,N I ,N II ,N III -tetramethyl-N,N I ,N II ,N ⁇ - tetrapalmitylspermine and dioleoyl phosphatidyl- ethanola ine (DOPE) (GIBCO BRL) ; (2) Cytofectin GSV, 2:1 (M/M) liposome formulation of a cationic lipid and DOPE (Glen Research) ; (3) DOTAP (N- [1- (2, 3-dioleoyloxy) - N,N,N-trimethyl-ammoniummethylsulfate) (Boehringer Manheim) ; and (4) Lipofectamine, 3:1 (M/M) liposome formulation of the polycationic lipid DOSPA and the neutral lipid DOPE (GIBCO BRL) .
- DOPE
- This invention further provides an angioplastic stent for inhibiting the onset of restenosis, which comprises an agioplastic stent operably coated with a prophylactically effective dose of the instant pharmaceutical composition.
- Angioplastic stents also known by other terms such as “intravascular stents” or simply “stents”, are well known in the art. They are routinely used to prevent vascular closure due to physical anomalies such as unwanted inward growth of vascular tissue due to surgical trauma. They often have a tubular, expanding lattice-type structure appropriate for their function, and can optionally be biodegradable.
- the stent can be operably coated with the instant pharmaceutical composition using any suitable means known in the art.
- "operably coating" a stent means coating it in a way that permits the timely release of the pharmaceutical composition into the surrounding tissue to be treated once the coated stent is administered.
- Such coating methods for example, can use the polymer polypyrrole. Stents, and methods and compositions for coating same, are discussed in detail in U.S. Serial No. 60/091,217.
- the prophylactically effective dose contains between about 0.1 mg and about 1 g of the instant DNAzyme. In another embodiment, the prophylactically effective dose contains between about 1 mg and about 100 mg of the instant DNAzyme. In a further embodiment, the prophylactically effective dose contains between about 10 mg and about 50 mg of the instant DNAzyme. In yet a further embodiment, the prophylactically effective dose contains about 25 mg of the instant DNAzyme.
- This invention further provides a method for inhibiting the onset of restenosis in a subject undergoing angioplasty, which comprises topically administering a prophylactically effective dose of the instant pharmaceutical composition to the subject at around the time of the angioplasty.
- administering the instant pharmaceutical composition "at around" the time of angioplasy can be performed during the procedure, or immediately before or after the procedure. The administering can be performed according to known methods such as catheter delivery.
- “Inhibiting" the onset of restenosis means either lessening the severity of restenosis which occurs after angioplasty, or preventing the onset of restenosis entirely. In the preferred embodiment, inhibiting the onset of restenosis means preventing the onset of restenosis entirely.
- this invention provides a method for inhibiting the onset of restenosis in a subject undergoing angioplasty, which comprises topically administering the instant angioplastic stent to the subject at the time of the angioplasty.
- the efficacy of DNAzymes in vi tro was determined by measuring the rate of RNA cleavage under multiple turnover conditions. For these experiments, a range of substrate concentrations was used such that [S] ⁇ 10- fold excess over [E] which was fixed at 200 pM.
- e cl synthetic RNA substrate were pre-equilibrated separately for 10 minutes at 37°C in 50 mM Tris.HCl, pH 7.5, 10 mM MgCl2 and 0.01% SDS . At time zero, the reaction was initiated by mixing the
- the overall catalytic efficiency of each DNAzyme varies significantly between the modified and unmodified species.
- the short arm DNAzymes (7+7 bp) the inclusion of an inverted base modification produced a 3-fold decrease in the k C at/Km.
- the relative efficiency of the long (9+9 bp) arm version was enhanced 10-fold by the presence of an inverted base modification.
- the intermediate length (8+8 bp) binding arm DNAzyme was the least effected by modification, showing a 2-fold increase in the value of k C at/ K m- The effect of the 3' inverted terminal base was therefore different depending on the length of the substrate-binding arms.
- a full-length c-myc mRNA was used to further test DNAzymes' ability to cleave various forms of c-myc mRNA under simulated physiological conditions (10 mM MgCl2, pH7.5, 37°C) . Cleavage reactions were performed under 5 single turnover conditions by using 10 nM of long substrate (c-myc mRNA) and 50 nM of DNAzymes.
- Figure 5 shows that all the DNAzymes effectively cleave c-myc mRNA with a cleavage rate of 20 to 50%. As expected, the DNAzymes with longer arms cleave substrates more efficiently.
- a 3 '-inverted base modification decreases the cleavage efficiency of the 7+7 arm DNAzyme, but increases the cleavage efficiency of the 9+9 arm DNAzyme.
- Anti-c-myc DNAzyme activity was tested in vascular SV40LT (Simian Virus 40 large T antigen) smooth muscle cells (Simons). After growth arrest in 0.5% FBS-DMEM, SMC's were released from Go by addition of 10% FBS- DMEM. Cells were simultaneously exposed to DNAzyme or control oligonuceotide (i.e., the 9/9 arm DNAzyme with an inverted catalytic core sequence) delivered by
- DNAzymes The impact of DNAzymes on SMC proliferation was also assessed using two independent techniques, i.e., DNA cell-cycle analysis and the determination of mitotic index.
- DNA histograms were generated at 72 hours after serum stimulation. After this 72-hour interval, 74% of unstimulated cells remained in Go/Gi, as compared with only 65% of stimulated cells. However, with the addition of the DNAzyme Rs-6, the proportion of stimulated cells remaining in Go/Gi phase increased to 71%. In contrast, the inactivated DNAzyme control (Rs-8) had no effect on the SMC cycle.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- Biomedical Technology (AREA)
- Zoology (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- General Health & Medical Sciences (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Medicinal Chemistry (AREA)
- Public Health (AREA)
- Pharmacology & Pharmacy (AREA)
- Heart & Thoracic Surgery (AREA)
- Veterinary Medicine (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Animal Behavior & Ethology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Plant Pathology (AREA)
- Oncology (AREA)
- Cardiology (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Enzymes And Modification Thereof (AREA)
- Saccharide Compounds (AREA)
- Medicinal Preparation (AREA)
- Materials For Medical Uses (AREA)
Abstract
Description
Claims
Applications Claiming Priority (3)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US9637498P | 1998-08-13 | 1998-08-13 | |
US96374P | 1998-08-13 | ||
PCT/IB1999/001484 WO2000009672A1 (en) | 1998-08-13 | 1999-08-12 | Dnazymes and methods for treating restenosis |
Publications (2)
Publication Number | Publication Date |
---|---|
EP1117768A1 true EP1117768A1 (en) | 2001-07-25 |
EP1117768A4 EP1117768A4 (en) | 2003-09-03 |
Family
ID=22257071
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
EP99938479A Withdrawn EP1117768A4 (en) | 1998-08-13 | 1999-08-12 | Dnazymes and methods for treating restenosis |
Country Status (8)
Country | Link |
---|---|
EP (1) | EP1117768A4 (en) |
JP (1) | JP2002525037A (en) |
KR (1) | KR20010072475A (en) |
CN (1) | CN1323344A (en) |
AU (1) | AU5298499A (en) |
CA (1) | CA2340322A1 (en) |
WO (1) | WO2000009672A1 (en) |
ZA (1) | ZA200101188B (en) |
Families Citing this family (6)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
AUPQ201499A0 (en) * | 1999-08-04 | 1999-08-26 | Unisearch Limited | Treatment of inflammatory and malignant diseases |
JP2002348235A (en) * | 2001-03-23 | 2002-12-04 | Clinical Supply:Kk | Preventive against restenosis |
DE10346487A1 (en) * | 2003-10-02 | 2005-05-12 | Transmit Technologietransfer | Process for the preparation of a cell and / or tissue and / or disease phase specific drug |
US20090312399A1 (en) * | 2005-06-28 | 2009-12-17 | Johnson & Johnson Research Pty, Ltd | Guanosine-rich oligonucleotides as agents for inducing cell death in eukaryotic cells |
DK3093022T3 (en) | 2015-05-15 | 2019-11-04 | Sterna Biologicals Gmbh & Co Kg | GATA-3 INHIBITORS TO USE IN THE TREATMENT OF TH2 DRIVEN ASTMA |
KR20230137347A (en) * | 2020-12-30 | 2023-10-04 | 더 리전츠 오브 더 유니버시티 오브 캘리포니아 | Biologically stable Exnazyme that efficiently silences gene expression in cells |
Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1991015580A1 (en) * | 1990-04-10 | 1991-10-17 | Research Development Foundation | Gene therapy for cell proliferative diseases |
WO1994015646A1 (en) * | 1993-01-07 | 1994-07-21 | Thomas Jefferson University | Antisense inhibition of c-myc to modulate the proliferation of smooth muscle cells |
WO1995031541A2 (en) * | 1994-05-18 | 1995-11-23 | Ribozyme Pharmaceuticals, Inc. | Methods and compositions for treatment of restenosis and cancer using ribozymes |
Family Cites Families (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US5807718A (en) * | 1994-12-02 | 1998-09-15 | The Scripps Research Institute | Enzymatic DNA molecules |
AU735522C (en) * | 1997-04-29 | 2005-04-07 | Scripps Research Institute, The | Enzymatic dna molecules |
ATE431852T1 (en) * | 1998-03-27 | 2009-06-15 | Johnson & Johnson Res Pty Ltd | DIAGNOSTIC METHODS BASED ON CATALYTIC NUCLEIC ACIDS |
-
1999
- 1999-08-12 AU AU52984/99A patent/AU5298499A/en not_active Abandoned
- 1999-08-12 CN CN99811966A patent/CN1323344A/en active Pending
- 1999-08-12 JP JP2000565109A patent/JP2002525037A/en active Pending
- 1999-08-12 KR KR1020017001893A patent/KR20010072475A/en not_active Application Discontinuation
- 1999-08-12 WO PCT/IB1999/001484 patent/WO2000009672A1/en not_active Application Discontinuation
- 1999-08-12 CA CA002340322A patent/CA2340322A1/en not_active Abandoned
- 1999-08-12 EP EP99938479A patent/EP1117768A4/en not_active Withdrawn
-
2001
- 2001-02-12 ZA ZA200101188A patent/ZA200101188B/en unknown
Patent Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1991015580A1 (en) * | 1990-04-10 | 1991-10-17 | Research Development Foundation | Gene therapy for cell proliferative diseases |
WO1994015646A1 (en) * | 1993-01-07 | 1994-07-21 | Thomas Jefferson University | Antisense inhibition of c-myc to modulate the proliferation of smooth muscle cells |
WO1995031541A2 (en) * | 1994-05-18 | 1995-11-23 | Ribozyme Pharmaceuticals, Inc. | Methods and compositions for treatment of restenosis and cancer using ribozymes |
Non-Patent Citations (3)
Title |
---|
BREAKER R R: "DNA ENZYMES" NATURE BIOTECHNOLOGY, NATURE PUBLISHING, US, vol. 15, May 1997 (1997-05), pages 427-431, XP002912052 ISSN: 1087-0156 * |
FINKEL T AND EPSTEIN S E: "Gene therapy for vascular disease" FASEB JOURNAL, FED. OF AMERICAN SOC. FOR EXPERIMENTAL BIOLOGY, BETHESDA, MD, US, vol. 9, 1 July 1995 (1995-07-01), pages 843-851, XP002088122 ISSN: 0892-6638 * |
See also references of WO0009672A1 * |
Also Published As
Publication number | Publication date |
---|---|
CA2340322A1 (en) | 2000-02-24 |
WO2000009672A1 (en) | 2000-02-24 |
ZA200101188B (en) | 2002-05-13 |
EP1117768A4 (en) | 2003-09-03 |
CN1323344A (en) | 2001-11-21 |
AU5298499A (en) | 2000-03-06 |
JP2002525037A (en) | 2002-08-13 |
KR20010072475A (en) | 2001-07-31 |
WO2000009672A9 (en) | 2000-05-18 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US5646042A (en) | C-myb targeted ribozymes | |
US7662948B2 (en) | Antisense oligonucleotides against VR1 | |
EP1251170A2 (en) | Method and reagent for treatment of NF-kappaB dependent animal diseases | |
US20090197336A1 (en) | Suppression of polymorphic alleles | |
US6103890A (en) | Enzymatic nucleic acids that cleave C-fos | |
US8008471B2 (en) | Nucleic acids for inhibiting hairless protein expression and methods of use thereof | |
WO1998032846A9 (en) | Enzymatic nucleic acid treatment of diseases or conditions related to levels of c-fos | |
AU3974001A (en) | Method and reagent for the inhibition of checkpoint kinase-1 (chk 1) enzyme | |
US5714383A (en) | Method and reagent for treating chronic myelogenous leukemia | |
EP1117768A1 (en) | Dnazymes and methods for treating restenosis | |
US6770753B2 (en) | Phosphorothioate antisense heparanase oligonucleotides | |
US20040072783A1 (en) | Nucleozymes with endonuclease activity | |
AU3497701A (en) | Nucleozymes with endonuclease activity | |
JP2002526072A (en) | Hairpin hybridizer molecule for regulation of gene expression | |
US6238917B1 (en) | Asymmetric hammerhead ribozymes | |
US20030064946A1 (en) | Method and reagent for the inhibition of calcium activated chloride channel-1 (CLCA-1) | |
WO2002011674A2 (en) | Method and reagent for the inhibition of calcium activated chloride channel-1 (clca-1) | |
Phylactou et al. | Utilization of properties of natural catalytic RNA to design and synthesize functional ribozymes | |
AU3918899A (en) | Methods and compositions for treatment of restenosis and cancer using ribozymes | |
AU6879501A (en) | Methods and compositions for treatment of restenosis and cancer using ribozymes | |
AU5661700A (en) | Method and reagent for treatment of animal diseases | |
AU2005242129A1 (en) | Catalytic molecules |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
17P | Request for examination filed |
Effective date: 20010312 |
|
AK | Designated contracting states |
Kind code of ref document: A1 Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE |
|
AX | Request for extension of the european patent |
Free format text: AL;LT;LV;MK;RO;SI |
|
RIN1 | Information on inventor provided before grant (corrected) |
Inventor name: CAIRNS, MURRAY, J. Inventor name: SUN, LUN-QUAN |
|
A4 | Supplementary search report drawn up and despatched |
Effective date: 20030722 |
|
RIC1 | Information provided on ipc code assigned before grant |
Ipc: 7C 12N 15/11 B Ipc: 7C 12Q 1/68 B Ipc: 7A 61K 38/46 B Ipc: 7C 12N 9/16 A |
|
17Q | First examination report despatched |
Effective date: 20031210 |
|
STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN |
|
18D | Application deemed to be withdrawn |
Effective date: 20040421 |
|
REG | Reference to a national code |
Ref country code: HK Ref legal event code: WD Ref document number: 1036305 Country of ref document: HK |