EP1114157A2

EP1114157A2 - Regulatory protein from human keratinocytes

Info

Publication number: EP1114157A2
Application number: EP99969420A
Authority: EP
Inventors: Michael Kramer; Michael Bechtel; Jeanette Reinartz; Birgit Schäfer; Reinhard Wallich
Original assignee: Individual
Current assignee: Individual
Priority date: 1998-09-19
Filing date: 1999-09-06
Publication date: 2001-07-11
Also published as: AU1149100A; JP2002526060A; DE19981873D2; WO2000017232A3; CA2342957A1; DE19842863A1; WO2000017232A2

Abstract

The invention relates to an isolated polypeptide which is equivalent to or similar (i.e., equivalent in function and effect) to a protein which is naturally occurring in human keratinocytes and which is increasingly expressed in the activated state of the keratinocytes. The invention also relates to an isolated nucleic acid encoding such a polypeptide or protein typical of human keratinocytes, as well as to the use of said polypeptide and said nucleic acid for the purpose of assays, particularly for diagnostic purposes, and/or for therapeutic purposes, or to the use of reagents, particularly of recombinant vector molecules and antibodies directed against such molecules. The inventive protein has an amino acid sequence of SEQ ID NO:2 or SEQ ID NO:3 of the sequence listing or an allele or derivative of said amino acid sequence derivedy amino acid substitution, deletion, insertion or inversion. The inventive nucleic acid has a nucleotide sequence as depicted in SEQ ID NO:1 or SEQ ID NO:4 of the sequence listing or a nucleotide sequence complementary thereto or a partial sequence of one of these nucleotide sequences or a nucleotide sequence which fully or partially hybridizes to any of the above-mentioned nucleotide sequences.

Description

Regulatory protein from human keratinocytes

Description

The invention relates to an isolated polypeptide which is similar to or similar to a protein which occurs naturally in human keratinocytes and which is expressed more strongly in the activated state of the keratinocytes. The protein also relates to an isolated nucleic acid which is such a polypeptide which is typical of human keratinocytes or protein encoded, and the use of this polypeptide and this nucleic acid for detecting, in particular diagnostic, and / or for therapeutic purposes or the use of reagents, in particular recombinant vector molecules and antibodies, against such molecules

According to the current state of the art, drugs with a broad spectrum of activity, such as locally or systemically administered glucocorticoids, vitamin A, are used in dermatotherapy to influence epidermal disorders such as the autoimmune dermatoses "Pemphigus vulgaris" and "Bulloses Pemphigoid" Acid derivatives, antimetabolites and cytostatics, or it is treated with more or less unspecific measures such as "dye therapy" or "light therapy". However, the known active substances or measures all have the disadvantage that they are not very specific and therefore naturally cause numerous side effects

The provision of more specific active ingredients has so far failed due to the fundamental problem that has existed for a long time in dermatology, that the number of cellular target molecules (target structures, targets), which act as a point of attack for a (specific) influence on the cellular metabolism - especially under medical or also cosmetic Viewpoints - could serve in epidermal keratinocytes is narrowly limited The object of the present invention is therefore to provide new target structures in epidermal keratinocytes which can serve as a point of attack for diagnostics, therapeutics, cosmetics or in general for influencing the cellular metabolism

One solution to this problem is to provide a protein of the type mentioned at the outset, which upregulates activated keratinocytes, ie is expressed or produced more and is kept at a higher concentration level, and that either in the sequence listing SEQ ID NO: 2 or in the sequence listing SEQ ED NO: 3 amino acid sequence shown or an allele or derivative formed by amino acid substitution, deletion, insertion, or inversion from one of these two amino acid sequences. The polypeptide with the amino acid sequence according to SEQ ID NO: 2 or SEQ ID NO: 3 is shown in hereinafter also referred to as protein pKe # 122

A further solution to this problem consists in the provision of an isolated nucleic acid which encodes a protein which is similar to or similar to a protein which occurs naturally in human keratinocytes and which is expressed more intensely in the activated state of the keratinocytes, and which is either that described in the sequence listing SEQ ID NO: 1 or the nucleotide sequence shown in the sequence listing SEQ ID NO: 4 or a nucleotide sequence complementary to one of these two or a partial sequence of one of these two shown or complementary nucleotide sequences or a nucleotide sequence hybridizing wholly or partially with one of the aforementioned nucleotide sequences, with these two sequence listing instead of "T" can also stand for "TJ". This group of nucleic acids or nucleotide sequences according to the invention also includes, in particular, splice variants and sense or antisense oligonucleotides which correspond to those in the sequence listing SEQ ID NO: 1 or with hybridize the nucleotide sequence shown in the sequence listing SEQ ID NO: 4, preferably identical to or complementary to at least one of these two The invention consequently also includes proteins or polypeptides of the type mentioned at the outset, which have an amino acid sequence which results from such a splice variant, in particular from the splice variant of an mRNA which corresponds to that in the sequence listing SEQ ID NO: 1 or in the sequence listing SEQ ID NO: 4 indicated nucleotide sequence is identical or complementary to it

The sense or antisense oligonucleotides according to the invention comprise at least 6, preferably 8 to 25 nucleotides

The term “hybridized” refers to the hybridization methods known in the prior art under customary, in particular under highly stringent hybridization conditions, the person skilled in the art chooses the specific hybridization parameters based on the nucleotide sequence used and his general specialist knowledge (see Current Protocols in Molecular Biology, Vol 1, 1997, John Wiley & Sons Ine, Suppl 37, Chaρter 4 9 14)

The nucleic acid (s) according to the invention can be obtained both from a natural source and also synthetically or semi-synthetically. In practice, their implementation as cDNA has proven particularly effective

The polypeptide which has the amino acid sequence according to SEQ ID NO: 2 or SEQ ID NO: 3 and which is encoded by the nucleic acid shown in the sequence listing SEQ ID NO: 1 or in the sequence listing SEQ ID NO: 4, and which is hereinafter referred to as protein pKe # 122, is upregulated in human epidermal keratinocytes, namely expressed more (produced) and kept at a concentration level that is significantly higher than in the initial state when these cells are in the "activated" state, ie in the state of proliferation and / or among other things Migration, eg after an accident-related skin injury or in the autoimmunologically triggered bullose dermatoses "Pemphigus vulgaris" (triggered by autoantibodies against desmosomes) and "Bulloses pemphigoid" (triggered by autoantibodies against hemidesmosomes) The activated state of Human epidermal keratinocytes are also expressed in an increased expression of the known activation markers uPA (urokinase-type plasminogen activator) and uPA-R (receptor for urokinase-type plasminogen activator) compared to the resting state (initial state) and can be detected qualitatively and quantitatively using these markers ( See Schafer BM, Reinartz J, Bechtel MJ, Inndorf S, Lang E, and Kramer MD, 1996 Dispase mediated basal detachment of cultured keratinocytes induces urok nase-type plasminogen acüvator (uPA) and its receptor (uPA-R, CD87), Exp CellRes 228, S 246-253)

The pKe # 122 protein has a serine / threonine kinase motif, several (four) tyrosine kinase phosphorylation motifs and a kinase domain with an ATP binding site. It is obviously involved in signaling processes, is very likely to have a serine / threonine kinase function and is active a presumed role in the formation of cell-cell and / or cell-matrix connections and / or of desmosomes and / or of hemidesmosomes

It is known in the prior art that serine / threonine kinases in keratinocytes influence the function of cell-cell and cell-matrix contacts. S Blum and co-authors have shown that the localization of certain cell contact molecules of the zonula adhaerens by activation or inactivation of the serine / threonine kinase of the "protein kinase C (PKC)" type can be influenced (see Blum S, Ness W, Petrow W, Achenbach F, 1994 Localization of protein kinase C in primary cultures of human keratinocytes in relation to cell contact proteins. Cell Sig 6 157-165) and M Serres and coauthors have shown that the treatment of keratinocytes in cell culture (HaCaT cells) with the serine / threonine phosphatase inhibitors okadaic acid, calyculin and Pefabloc ™ on the one hand leads to a loss of cell -Line compounds and on the other hand leads to increased serine / threonine phosphorylation of the linker protein β-catenin involved in cell adhesion (cf. Serres M, Grangeasse C, Haft ek M, Durocher Y, Duclos B, Schmitt D, 1997 Hyperphosphorylation of ß- Catenin on serine-threonine residues and loss of cell-cell-contacts induced by calyculin A and okadaic acid in human epidermal cells. Exp. Cell. Res. 231 163-172) This in- In vitro findings were confirmed on epidermal keratinocytes from explanted human skin. After application of okadaic acid (2 μM, 24 hours) there was a clear disruption of epidermal cell / cell connections with acantholysis on neither PKC activators (such as bryostatin-1 or TPA = PMA) = Phorbol myristate acetate) and PKC inhibitors (sphingosine, staurosporine, chelerythrine, H7 = 1- (5-isoquinolinylsulfonyl) -2-methylpiperazine) or inhibitors or activators of protein kinase A (PKA), nor tyrosine kinase and phosphatase Inhibitors or less specific phosphatase inhibitors had such an effect on the cells

Serine / threonine kinases also play an important role in the formation of hemidesmosomes (cf. Mainiero F, Pepe A, Wary KK, Spinardi L, Mohammadi M, Schlessinger J Giancotti FG, 1995 Signal transduction by the alpha6beta4 integrm: distinct beta4 subunit sites mediale recruitment of Shc / Grb2 and association with the cytoskeleton of hemidesmosomes.EMBO J 14 4470-4481)

With the isolated provision of the protein pKe # 122, namely with the description of nucleotide sequences which encode this protein and with the specification (of one) of its amino acid sequence (s), it is possible - and of course also - the metabolism of physiologically active or activated keratinocytes from other cells expressing the protein pKe # 122 - to be influenced in a targeted manner, in particular for purposes of medical and cosmetic therapy

The invention further relates to recombinant DNA vector molecules which comprise a nucleic acid according to the invention and which have the ability to express in a prokaryotic a protein which occurs in human keratinocytes and is expressed in the activated state of the keratinocytes, in particular the pKe # 122 protein or eukaryotic cell. The DNA vector molecules are preferably the plasmid pUEX-1 and / or the plasmid pGEX-2T and / or the plasmid pBK-CMV and / or the plasmid pHR 2 (a derivative of Bluescript KS [Stratagene, Heidelberg], contains the human keratin 14 promoter), since these vectors have proven to be very suitable in practice Particularly suitable eukaryotic cells are cells from cell cultures, for example COS cells, but the cell in question can equally well be part of a living organism, for example a transgenic mouse

The invention therefore also encompasses transformed host cells which contain a nucleic acid according to the invention which is coupled to an activatable promoter which is contained in these cells naturally or as a result of recombination and which (as a result) has the ability to express a keratinocyte in human protein that occurs and is increasingly expressed in the activated state of the keratinocytes, in particular the protein pKe # 122

The invention further relates to the use of a nucleic acid according to the invention or a vector molecule according to the invention for the production of transgenic mammals, in particular mice or rats

The transfectants according to the invention open up the possibility for research and development work with regard to a further elucidation of the changes in cell morphology induced by the protein pKe # 122 and cellular basic functions such as proliferation, adhesion, migration and differentiation, in particular with a view to answering the questions Question whether the protein pKe # 122 itself has a "pathogenic" activity

The present invention also relates to a reagent for the indirect detection of a protein which occurs in human keratinocytes and which is expressed more strongly in the activated state of the keratinocytes, in particular the protein pKe # 122, this reagent being characterized in that it comprises at least one nucleic acid according to the invention. For indirect detection "in this context means that the mRNA encoding the protein is actually detected directly - and thus the protein only indirectly (by means of this mRNA) The protein pKe # 122 and the polypeptides related to it, that is to say with the amino acid sequence shown in the sequence listing SEQ ID NO: 2 or in the sequence listing SEQ ID NO: 3, namely the polypeptides which are obtained by substitution, deletion, insertion and / or inversion of a these amino acid sequences can be derived according to SEQ ID NO: 2 or SEQ ID NO: 3, or which have an amino acid sequence which results from a splice variant of an mRNA which corresponds to the nucleotide sequence according to the sequence listing SEQ ID NO: 1 or to the nucleotide sequence according to the sequence listing SEQ ID NO: 4 or with a partial sequence of these nucleotide sequences is identical or complementary to it, or at least hybridized, offer diverse application possibilities in the field of dermatological research and development. In particular, antibodies against these polypeptides or proteins can be produced, which with appropriate modification can then either be used as diagnostics or as therapeutic agents or al s cosmetics ("cosmeceuticals") can be used

The invention consequently also includes the use of such a protein or polypeptide for the production of an (monoclonal, polyclonal or recombinant) antibody against this polypeptide, said antibody itself and also its use for the diagnostic and / or therapeutic treatment of dermatological diseases, for cosmetic purposes Treatment of the epidermis and for the diagnostic, therapeutic and / or cosmetic treatment of other tissues or organs expressing the protein pKe # 122

According to recent scientific knowledge, sense and / or antisense oligonucleotides are also suitable as active ingredients for pharmacotherapy (cf. G Hartmann et al 1998 antisense oligonucleotides, Deutsches Arzteblatt 95, issue 24, C1 115-C1119) - and moreover as active ingredients a fundamentally new mode of action in pharmacotherapy

The present invention therefore also relates to the use of sense or antisense oligonucleotides according to the invention for diagnostic and / or therapeutic purposes Treatment, in particular of dermatological diseases, or for cosmetic treatment, in particular of the epidermis

Last but not least, a technically and economically important possibility of using a polypeptide according to the invention or a nucleic acid according to the invention is that with the aid of such a molecule, a very large number of available substances can be selected from a very large number of available substances in a screening process, which are specific to the nucleic acid in question or that Binding the relevant polypeptide These substances can then serve as the starting material (lead structure) for the development of pharmacologically usable substances and thus offer the prerequisites for the development of alternative pharmaceuticals for diagnosis and therapy, in particular the dermatological diseases mentioned at the beginning

In view of this, the invention also relates to the use of a polypeptide according to the invention or a nucleic acid according to the invention for the identification of pharmacologically usable substances which bind to the polypeptide or the nucleic acid and thereby influence its or its function and / or expression, in particular have an inhibiting or activating effect

The invention is explained in more detail below with reference to manufacturing and application examples

Example 1: Production of the protein pKe # 122

A) Obtaining or producing a polynucleotide. encoding the protein pKe # 122 Human epidermal keratinocytes of a cell culture or a cell culture model served as the polynucleotide source, which is described in the publication by Schafer BM, Reinartz J, Bechtel MJ, Inndorf S, Lang E, and Kramer MD, 1996 dispase mediated basal detachment of cultured keratinocytes induces urokinase-type plasminogen activator (uPA) and its receptor (uPA-R, CD87), Exp. Cell Res 228, S 246-253, is described in detail. The content of this publication is hereby expressly incorporated by reference this cell culture model is characterized in that it allows keratinocytes to be destroyed by enzymatic destruction of the cell / matrix contacts, ie by means of a dispase-induced detachment of the keratinocytes from the culture matrix, from the resting [uPA ^~ 7uPA-R ^~ ] to the activated [uPA ⁺ / uPA-R ⁺ ] state. The induction of the activated state is reversible the (renewed) The formation of a confluent (= maximally densely grown), multilayered cell structure made of differentiated keratinocytes leads to the down regulation of uPA and uPA-R, i.e. to the throttling of production and adjustment to a lower concentration level (see the publication by Schafer BM, Stark HJ, Fusenig NE , Rodd RF, Kramer MD, 1996 Differential expression of urokinase-type plasminogen activator (uPA), its receptor (uPA-R), and mhibitor type-2 (PAI-2) during differentiation of keratinocytes in an organotypic coculture system, Exp Cell Res 220 415-423)

The cells of this cell culture or cell culture model are also referred to below as NHEK (= "normal human epidermal keratinocytes")

The following measures were carried out to provide the cell culture or the cell culture model: Human epidermal keratinocytes obtained by skin biopsy were trypsinized overnight at 4 ° C. and then using the feeder-layer technique of JG Rheinwald and H Green (1975, Cell 6, 331 -334) in Petri dishes or 175 cm ² culture bottles for a period of 8 days in Dulbecco's modified Eagle's Medium (DMEM) with a content of 10% (vol / nol) fetal calf serum (FCS) and additions of adenine hemisulfate, insulin, transferrin, triiodothyronine , Hydrocortisone, forskolin, epidermal growth factor (EGF) and antibiotics (penicillin, streptomycin and gentamycin) cultivated under differentiation conditions, namely elevated calcium levels (37 ° C, 7% CO ₂ ). The cultivation was thus carried out in accordance with conventional conditions known in the art Under these conditions, keratinocytes form confluent two- to three-layer so-called "epidermal equivalents" or he keratinocyte "sheets"

These epidermal equivalents or keratinocyte sheets were removed from the culture matrix by treatment with Dispase II (2.4 mg / ml in DMEM without FCS) for 30 minutes detached, washed twice in DMEM and then incubated for 4 or 8 hours in complete, conditioned DMEM. The incubation in conditioned DMEM was carried out to exclude the influence of fresh FCS. During the incubation, the expression of the known was upregulated in these floating keratinocyte sheets Activation markers uPA and uPA-R as well as the protein pKe # 122 described here for the first time. The uPA / uPA-R upregulation was detectable from the incubated using known techniques such as enzyme-linked immunosorbent assay (ELISA), in-situ hybridization and immunofluorescence Cells were extracted using the guanidinium-thiocyanate-phenol-chloroform extraction method known in the prior art (cf. Chromczynski P and Sacchi N, 1986 single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction Anal Biochem 162 156-159) the entire RNA obtained ("RNA-Clean" kit from AGS from Heidelberg) From the total -RNA, the mRNA was isolated by binding to poly-T-coated spheres. This mRNA served as the starting material for the next process section of subtraction cloning

For use in control experiments or for comparative preparations, mRNA was isolated from adherent keratinocyte sheets according to the same procedure as described above, except for the difference that for the duration of the dispase treatment, a dispase inhibitor, for example phosphoramidon (100 μg / ml), was used in addition to the dispase. was applied

According to the principle of subtraction cloning, a gene bank was created which preferably contained cDNA of the dyshasions-induced genes, ie those genes which were increasingly expressed in these (or their cells) after detachment of the keratinocyte sheets. For this purpose, the mRNA obtained from the cells of the adherent keratinocyte sheets was generated again bound to poly-T-coated spheres, rewritten thereon into single-stranded cDNA and then hybridized against the mRNA of detached, ie non-adherent, keratinocyte sheets. Those mRNA molecules which only express in the non-adherent state, ie after dyshasion were and as a result found no hybridization partner remained in the supernatant. They were rewritten into cDNA and chlorinated into the cloning vector pUEX-1

The resulting gene library was then subjected to a Southern blot method with [ ³² P] -labeled cDNA-adherent and non-adherent keratinocyte sheets for the purpose of checking. That cDNA or rather the host cell clones containing it - here the E coli strain MC 1061 - which after dyshasion one showed clear upregulation, were then cultivated overnight at 30 ° C. under normal culture conditions or increased. The plasmid DNA (pUEXl cDNA) was excised from these E coli clones, and the cDNA fragments cut out from the pUEXl vector were analyzed by random -priming [ ³² P] -labeled The labeled cDNA was used as a probe in Northern blots with RNA from adherent and non-adherent keratinocyte sheets. The clones which contained cDNA, when used as a probe in the Northern blot method, had little or no signal with the RNA adherent keratinocytes, on the other hand a clear signal with RNA non-adherent kerat inocyte sheets were selected for the subsequent process step of the sequencing

When the clones in question were sequenced by means of “non-radioactive cycle sequencing”, which is a modification of the Sanger sequencing method and has meanwhile become a method known in the art, the gene with the nucleotide sequence according to SEQ ID NO: 1 and SEQ ID NO: 4 found. This gene and the associated protein were given the name pKe # 122. Further studies of the pKe # 122-specific mRNA belonging to the pKe # 122 gene (from detached, ie non-adherent keratinocyte sheets) provided the information that these mRNA has a size of about 4.8 kb and shows an upregulation after dispase-induced detachment. FIG. 1 shows the result of a Northern blot that was performed with mRNA from keratinocyte sheets (a) immediately after or (b) four hours after dispase-induced detachment and [ ³² P] -labeled pKe # 122 cDNA was carried out. This result contains the statement that immediately after detachment little pKe # 122 mRNA was present or at least detectable, however, four hours later large quantities were present (a broader, more color-intensive band), namely in the molecular weight zone of approximately 4.8 kb

The nucleotide sequence of the gene pKe # 122 contains a stop codon at the 3 'end at position 2373-2375 according to SEQ ID NO: 1 and accordingly at position 2472-2474 according to SEQ ID NO: 4, which specifies the putative location of the transcription end and the like exactly 28 nucleic acids before the poly-A site follows a sequence very similar to the so-called "polyadenylation site" (AATAAA), namely AATAA

For the overall structure of the pKe # 122 gene or generalized polynucleotide which codes for the protein pKe # 122, this means that this gene or polynucleotide has the nucleotide sequence shown in the sequence listing SEQ IN NO: 1 or the sequence listing SEQ IN NO: 4 or has a partial sequence of one of these two nucleotide sequences or comprises or consists of a nucleotide sequence that is complementary to one of the nucleotide sequences shown or one of its partial sequences, or that this gene or polynucleotide is wholly or partly identical to that described in the sequence listing SEQ ID NO: 1 or im Sequence listing SEQ ID NO: 4 hybridized with a partial sequence of one of these two nucleotide sequences or with a sequence complementary to these shown nucleotide sequences or their partial sequences, wherein in the sequence listing SEQ ID NO: 1 and SEQ ID NO: 4 instead of "T" can also be a "U", and that from this gene b An mRNA is read between the polynucleotide which corresponds to a cDNA of approximately 4.8 kb or is homologous

B) Derivation of the amino acid sequence and characterization of the protein pKe # 122 using the polynucleotide (pKe # 122 gene) coding for it. Using the genetic code, a computer-aided procedure (program HUSAR = Heidelberg Unix Sequence Analysis Resources, Version 40, German Cancer Research Center Heidelberg, 1997) according to the nucleotide sequence Sequence listing SEQ ID NO: 1 and SEQ ID NO: 4 each derived an amino acid sequence which is shown in sequence listing SEQ ID NO: 2 and SEQ ID NO: 3 respectively. The structural analysis of these amino acid sequences according to sequence listing SEQ ID NO: 2 and SEQ ID NO : 3 with this program provided the following information, which is valid for both amino acid sequences

the amino acid sequence from positions 40 to 63 (LGKGNFAWKLARHRVTK TQVAIK) according to SEQ ID NO: 2 and accordingly from positions 73 to 96 according to SEQ ID NO: 3 corresponds to known protein kinase motifs with an ATP binding site,

the amino acid sequence from positions 152 to 164 (IVHRDLKTENLLL) according to SEQ ID NO: 2 and accordingly from positions 185 to 197 according to SEQ ID NO: 3 corresponds to known serine / threonine protein kinase motifs,

the amino acid sequences from positions 238 to 240 (TLR), from positions 475 to 477 (TGR), from positions 485 to 487 (STR) and from positions 600 to 603 (TTR) according to SEQ D3 NO: 2 and from positions 271 to 273 (TLR), from positions 508 to 510 (TGR), from positions 518 to 520 (STR) and from positions 633 to 635 (TTR) according to SEQ D3 NO: 3 correspond to known phosphorylation sites for protein kinase C,

the amino acid sequence from positions 138 to 156 (WQILSAVEYCHDHHIVHRD) according to SEQ ID NO: 2 and accordingly from positions 171 to 189 according to SEQ ID NO: 3 represents the pKe # 122-l peptide against which the anti-peptide antibody " Anti- pKe # 122-1 "was produced in the rabbit (see Example 2),

the amino acid sequence from positions 481 to 499 (LAEVSTRLSPLTAPCINNS) according to SEQ ID NO: 2 and accordingly from positions 514 to 532 according to SEQ ID NO: 3 represents the pKe # 122-2 peptide against which the anti-peptide antibody " Anti-pKe # 122-2 "was produced in the rabbit (see Example 2),

the amino acid sequence from position 339-352 (NHFAAIYYLLLERL) according to SEQ ID NO: 2 and accordingly from position 372-385 according to SEQ ID NO: 3 represents the pKe # 122-3 peptide against which the anti-peptide antibody " Anti-pKe # 122-3 "was produced in the rabbit (see Example 2),

the amino acid sequence from positions 614-625 (GLARQVCQVPAS) according to SEQ ID NO: 2 and accordingly from positions 647-658 according to SEQ ID NO: 3 represents the pKe # 122-4 peptide against which the anti-peptide antibody "anti-pKe # 122-4" was produced in rabbits (see Example 2)

These structural data of the protein pKe # 122 are shown schematically in FIG. 2 (for SEQ ID NO: 2) and in FIG. 14 (for SEQ ID NO: 3). FIGS. 2A and 14A show the protein kinase motif with ATP binding sites, the serine / threonine protein kinase motif and the four phosphorylation sites for protein kinase C, and Figures 2B and 14B show the sequence segments against which anti-peptide antibodies were raised in rabbits

Example 2: Use of the amino acid sequence of the protein pKe # 122 for the production of polyclonal anti-peptide antibodies

By means of computer-aided antigenicity analysis using the computer program mentioned in Example 1, areas from the amino acid sequence according to SEQ ID NO: 2 were selected which appeared suitable for the production of polyclonal anti-peptide antibodies. These areas were made according to the known “multiple antigenic peptide” method (see Posnett DN, Tarn JP, 1989: Multiple antigenic peptide method for producing antipeptide site-specific antibodies. Methods-Enzymol 1998, 178 739-746) in the form of separate peptides (pKe # 122-l to -4, see Fig. 2) synthesized with a molecular weight of approx. 10-15 kD These peptides were used without the addition of a carrier substance for the adjuvant-assisted immunization of rabbits. The details of this peptide production process and this immunization process are generally known in the prior art. The pre- and post-immune sera were synthesized using the generally known enzyme -Linked immunosorbent assay (ELISA) for reactivity with each Peptides and comparative peptides used for the immunization were tested. A clear immunization against the peptides pKe # 122-1, -122-2 and -122-4 was detectable. To purify the polyclonal antibodies, the postimmune sera were first subjected to an ammonium sulfate precipitation and thereby the IgG fraction Enriched with this enriched IgG fraction Immunoaffinity chromatography performed For this purpose, the four peptides pKe # 122-1 to -4 used for immunization were immobilized on Sepharose 4B and these peptide-Sepharose-4B conjugates were used in immunoaffinity chromatography. Three largely pure anti-peptide IgG fractions resulted, namely anti-peptide pKe # 122-1, anti-peptide pKe # 122-2 and anti-peptide pKe # 122-4 These three affinity-purified antibody fractions showed a clear immune reaction with the corresponding antigen peptide. Table 1 shows these results

With the immune serum against the peptide pKe # 122-1, the polyclonal antibody anti-pKe # 122-1, cell lysates of the keratinocyte lime HaCaT and the keratinocyte sheets were detached 8 hours after detachment with Dispase (= non-adherent keratinocyte sheets) using the Western emblot method the expression of the protein pKe # 122 was tested. A band with a molecular weight of approx. 70-85 kD was detected both in the HaCaT cells and in the cells of the detached (non-adherent) keratinocyte sheets. The Western blot belonging to the experiment is shown in Example 3B ( 2) described in detail and shown in FIG. 3. It shows a protein of the size approximately 70-85 kD both in HaCaT cells and in the non-adherent keratinocyte sheets

The polyclonal anti-peptide antibody pKe # 122-1 was also tested with the recombinant ca 100 kD GST-pKe # 122 fusion protein (fraction 85 in FIG. 10 B) described here in Example 5 using the immunoblot method. The polyclonal anti-peptide - Antibody pKe # 122-1 reacted with the fusion protein This positive reaction was confirmed by comparison with control experiments in which an anti-GST antibody or normal rabbit IgG was used instead of the anti-peptide antibody pKe # 122-1 The results are shown in Table 1 and in FIG. 4. Lane "a" in FIG. 4 shows the control batch with goat normal IgG, lane "b" in FIG. 4 shows the batch with goat anti-GST IgG, lane " c "in FIG. 4 shows the approach with rabbit normal IgG and lane" d "in FIG. 4 shows the approach with rabbit anti-pKe # 122-1 Example 3: Use of the protein pKe # 122 or against the protein or against the mRNA of the pKe # 122-directed reagents for the detection of the activated state of human epidermal keratinocytes

A Keratinocytes used

HaCaT cells and human epidermal keratinocytes of the cell culture or of the cell culture model (NHEK), which are described in detail in the publication BM Schafer and coauthors (loc. Cit.) And briefly summarized here in Example 1 (A), served as test cells or target cells (= target cells) The content of this publication is expressly referred to here as well. Skin biopsies were also examined for the expression of the pKe # 122 protein

B) Detection methods based on the use of antibodies directed against the protein pKe # 122

1. Immunohistology

With the help of a cryotome, 5 μm thick frozen sections of tissue from skin biopsies of clinically normal normal skin and clinically conspicuous, lasional skin due to the diseases Pemphigus vulgaris, Bulloses Pepmphigoid and Psoriasis vulgaris are made.These are dried at room temperature and fixed in 100% acetone (instead of Acetone can also be used as well as 100% methanol, 100% ethanol or 4% paraformaldehyde). The sections are then treated in accordance with so-called "blocking methods" known in the art to block non-specific binding sites for the antibody. In the present example case, two blocking steps were carried out (1) blocking with avidin / biotin and (2) blocking with normal serum In the first blocking step, the avidin / biotin blocking was carried out using the avidin-biotin blocking kit from Vector-Laboratories according to the manufacturer's instructions, ie it was carried out at room temperature Incubated for 15 minutes with the avidin ready solution and then for 15 minutes with the biotin ready solution 10% by volume of normal serum in PBS (normal serum of the species from which the second antibody originates, here goat normal serum, PBS = phosphate buffered saline = phosphate-buffered saline solution, pH 7.2-7.4) for 15 minutes at room temperature incubated

Following the blocking, the sections are incubated in PBS containing 5 μg / ml anti-peptide pKe # 122-1 for 1 hour at room temperature. To remove the unbound antibody, the sections are then incubated in PBS containing 0.2 % (Weight / volume) of bovine serum albumin. This is followed by incubation with an antibody from goat, for example biotin-labeled and directed against rabbit IgG (1,500 diluted in PBS / 0.2% BSA, 30 minutes at room temperature) a further washing step and the application of a streptavidin labeled with the fluorescent dye Cy3 (1 1 000 diluted in PB S / 0.2% BSA). Instead of Cy3, another fluorescent dye can also be used to label the streptavidin, eg FITC after a last washing step the sections are covered with mounting medium, for example Elvanol or Histogel, and examined and evaluated in a fluorescence microscope. The results of such a procedure are carried out in FIG The anti-pKe # 122-1 IgG antibody stains keratinocytes on normal skin sections in the area of the epidermal basement membrane zone (FIG. 5 A). When staining biopsies of lasional skin due to the diseases Pemphigus vulgaris (FIG. 5 B), bullous pemphigoid (FIG. 5 C) or psoriasis vulgaris (FIG. 5 D), there is a strikingly strong staining in epidermal keratinocytes, particularly in the area of epidermal lesions. Accordingly, there has been increased expression and an obvious upregulation of the protein pKe # 122

2. Immuno-blot ("Western blot") and dot blot

FIG. 3 shows the detection of the pKe # 122 protein by means of the Westemblot method using anti-pKe # 122-1. Cell lysates of the keratinocyte line HaCaT (samples "HaCaT") and of keratinocyte sheets 8 hours after Dispas treatment ( Samples "NHEK 8h") electrophoretically separated in an SDS polyacrylamide gel. The proteins were analyzed using a standard method Blotted nitrocellulose membrane To block unspecific binding sites, an incubation with 5% by weight milk powder / TBS buffer was carried out. The (protein) strips with the designation "anti- 122-1" were then added in 3% milk powder / TBS buffer with the addition of anti-pKe # 122-1 antibodies (1 μg / ml) and the (protein) strips labeled “rblgG” in 3% milk powder / TBS buffer with the addition of rabbit normal IgG (1 μg / ml ) incubated at 4 ° C for approx. 18 hours (overnight). The nitrocellulose membrane was then washed with TBS / Tween and TBS buffer and with an enzyme-labeled anti-rabbit IgG antibody in 3% milk powder / TBS - Buffer incubated After washing again with TBS / Tween and TBS, the bound antibodies were made visible with a peroxidase-specific luminescent substrate (here, for example, the ECL system from Amersham-Buchler) and also represented by autoradiography. An alternative label with chromogenic substrate was also shown aten is well possible The cell lysates can also be blotted directly onto a nitrocellulose membrane without prior electrophoretic separation and further treated as described above

3. Enzyme-linked immunosorbent assay (ELISA)

Microtiter plates are coated with recombinant pKe # 122 / GST fusion protein in different concentrations (10-0 ng / ml). Unspecific binding sites are blocked by treatment with 0.1% by weight gelatin in PBS (PB S / gelatin). Then the coated wells are blocked incubated with anti-pKe # 122-1 IgG (1 μg / ml) for 1 hour at room temperature (see FIG. 6 A, closed circles) The control mixture is carried out with rabbit normal IgG in the same concentrations (see FIG. 6 A, open circles) After a washing step with 0.05% by volume Tween-20 in PBS (PBS / Tween), incubation is carried out with peroxidase-labeled goat anti-rabbit IgG (1 10,000 in PBS / Tween). After a further washing step to remove unbound enzyme-labeled Antibody is added to the colorless peroxidase substrate ortho-phenylenediamine, which is converted into a colored product by the peroxidase. Instead of ortho-phenylenediamine there are also other peroxidase substrates with color cover can be used The quantification of color formation and thus the bound antibody is carried out by absorption measurement in a microtiter plate photometer at 490 against 405 nm (ordinate). The result of such an experiment is shown in FIG. 6.A. It shows that the color concentration of the amount of the pKe # 122 fusion protein bound to the plate It is proportional from this that when samples of known antigen concentrations, so-called standards, are used, it is possible to quantify an unknown amount of antigen by comparison

For the quantification of the pKe # 122 protein in complex solutions, the implementation of a sandwich ELISA (FIG. 6 B) is preferred. For this purpose, a microtiter plate with an antibody directed against pKe # 122 (eg rabbit anti-pKe # 122 / GST fusion protein, 1 μg / Nertiefüng) Then the remaining unspecific binding sites of the microtiter plate are blocked with PB S / gelatin. Then the microtiter plate is mixed with different concentrations of the pKe # 122 / GST protein (10 - 0 ng / ml). After a washing step the plate is incubated with PBS / Tween with a second peroxidase-labeled anti-pKe # 122 antibody (eg peroxidase-labeled rabbit anti-pKe # 122-1 (peptide) antibody) (for example, one hour under rubble at room temperature) "Peroxidase" here stands for practically any labeling of the antibody, for example with enzymes, fluorescent molecules or luminescent molecules Removal of unbound enzyme-labeled antibodies, the colorless peroxidase substrate ortho-phenylenediamine is added, which is converted into a colored product by the peroxidase activity. The color formation is quantified by absorption measurement in a microtiter plate photometer at 490 against 405 nm (ordinate). The result of such an experiment is shown in Fig. 6.B. It shows that the color concentration is proportional to the amount of pKe # 122 bound to the plate. This test method therefore makes it possible to quantify the unknown amount of pKe # 122 in a sample. The substance ortho- Phenylenediamine representative of any peroxidase substrate that demonstrably changes color due to the peroxidase activity Instead of the polyclonal antibody "anti-pKe # 122-1" used here as an example, monoclonal antibodies which are directed against the protein pKe # 122 can also be used, both in a simple ELISA (= enzyme linked immunosorbent assay) and in Sandwich ELISA.

Example 4: Detection of pKe # 122-specific mRNA in cells by means of a reverse polymerase chain reaction

The polymerase chain reaction (PCR) was used to detect pKe # 122-specific RNA in cells of keratinocyte sheets (NHEK) after treatment with dispase and in HaCaT cells. For this purpose, RNA from cells of keratinocyte sheets (NHEK) after treatment with dispase and different longer incubation times and from HaCaT cells was detected each isolated using standard methods (guanidinium-thiocyanate-phenol-chloroform extraction method, see also Example 1A) and rewritten into cDNA according to standard methods. This cDNA was subjected to a PCR in which a partial fragment of <350 kb was amplified from the pKe # 122-specific cDNA A combination of the primers "pKe # 122-forward 3" (tgagcaggcgctgggtatcatgcag) and "pKe # 122-reverse 2" (tcaccgggaacaagaagggccacct) was used as the primer pair. 10 ng of cDNA with 10 μM primer each were used together with a mixture of heat-stable DNA polymerase, ATP, TTP, GTP, CTP and polymerase buffer (cf. e.g. Current protocols in Molecular Biology, Vol. 1, 1997, John Wiley & Sons Ine , Suppl. 37, Chapter 15), here in the example in the form of the ready-to-use "PCR master mix" from Clontech. In addition, the following control examinations were carried out: 1 the approach described above with the plasmid pUEX-l / pKe # 122 instead of the cDNA, 2 the kit-internal positive control, 3. the reaction approach described above without addition of cDNA (negative control 1), 4. the Approach described above with cDNA from cells of keratinocyte sheets (NHEK) 2 hours after dispase treatment, without addition of primer (negative control 2). The reaction products of the PCR reaction were separated electrophoretically in the agarose gel. 7 shows the result of this separation. Lane 1 = molecular weight marker, lane 2 = NHEK T0, lane 3 = NHEK T2, Lane 4 = NHEK T4, Lane 5 = NHEK T8, Lane 6 = HaCaT, Lane 7 = free, Lane 8 = positive control (pUEX-1; with pKe # 122 as insert), Lane 9 = negative control (approach with cDNA without primer) , Lane 10 = kit-specific positive control for checking the functionality of the PCR, lane 11 = negative control (approach with primer without cDNA), lane 12 = molecular weight marker. A PCR product of the expected size of 350 kb was detected in lanes 3, 4, 5, 6 and 8, that is to say: pKe # 122-specific mRNA was found in cells of keratinocyte sheets at time 2 (T2), 4 (T4 ) and 8 (T8) hours after dispase-induced detachment and also in HaCaT cells.

This technique enables the detection of pKe # 122 expression even in cases in which the detection of pKe # 122 protein is not possible due to the expression level being too low using immunohistological methods, the ELISA, dot blot or western emblot method.

Example 5: Production of vector molecules with the ability to express the protein pKe # 122 in prokaryotic or eukaryotic cells

Two ways were used to produce or express the recombinant pKe # 122 protein. On the one hand, two pKe # 122-gluthathione-S-transferase (GST) fusion proteins, ρKe # 122 / GST-I and pKe # 122 / GST-II, (vector pGEX; see FIG. 8) were used for the purpose of expression in Bacteria (E. coli DH5α) are produced. On the other hand, a pKe # 122-FL AG fusion protein (vector pBK-CMV; see FIG. 9) was produced for the purpose of expression in eukaryotic cells (cos cells).

The pKe # 122-gluthathione-S-transferase (GST) fusion proteins were expressed in E. coli (DH5α) by LPTG induction. After the induction, the bacterial lysate was examined in a western emblot with anti-GST antibodies, in comparison to pKe # 122-gluthathione-S-transferase (GST) vector-bearing, non-induced bacterial lysate and to lysate of bacteria that exclusively GST expressed. The product of this western emblot is shown in Fig. 10.A: Lane (a) shows the control transfectant (GST without insert) before LPTG induction, lane (b) shows the control transfectant (GST without insert) after LPTG induction , Lane (c) shows pKe # 122 / GST-I before LPTG induction, lane (d) shows pKe # 122 / GST-I after LPTG induction, lane (e) shows ρKe # 122 / GST-II before LPTG- Induction, and lane (f) shows pKe # 122 / GST-II after LPTG induction.

As can be seen in the figure, a mixture of differently large GST-positive bands was detectable and only after LPTG induction. The highest molecular band had a molecular weight of approx. 100 kD (fraction 85), the lowest molecular band of approx. 26 kD, which corresponds to the molecular weight of the pure GST protein. The data mentioned indicate that the recombinant pKe # 122-GST fusion protein is degraded in E. coli. The expressed fusion proteins (lane d) were present as insoluble protein aggregates in the so-called "inclusion bodies", which is why purification was carried out using prep cell. The fractions of this PrepCell purification were then separated by means of standard methods and analyzed by means of the immunoblot method with anti-GST antibodies already described above. The product of this purification process is shown in Fig. 10B. Purification resulted in a mixture of different sized GST fusion proteins. The strongest gang, i.e. the majority of the GST fusion proteins had an apparent molecular weight marker of 65 kD. This allows the conclusion that the 65 kD pKe # 122-GST fusion protein consists of the GST protein and an approximately 40 kD fragment of the protein pKe # 122. The 65 kD pKe # 122 / GST fusion protein was used to produce a polyclonal antiserum in rabbits. The antibodies were prepared and characterized as described in Example 2 for the anti-peptide antibodies

The highest molecular band had an apparent molecular weight of approx. 100 kD (see Fig. 10 B, fraction 85). This allows the conclusion that the 100 kD pKe # 122-GST fusion protein consists of the GST protein and an approximately 70-75 kD fragment of the Protein pKe # 122 exists (see also FIG. 4 and the associated description in Example 2)

In the eukaryotic system, the pBK-CMV-pKe # 122 vector (FIG. 9) was transformed into so-called Cos cells, ie into cells of the Cos cell line which is generally known in the prior art. The Cos cells were removed by treatment with DEAE by standard methods -Dextran / chloroquine brought to take up the plasmid DNA. The transformed cells were then incubated for two days under standard conditions (37 ° C. and 7% CO ₂ ). The Cos cells were lysed and analyzed in the immuno-blot method using an antibody against the FLAG epitope or the anti-peptide antibody anti-pKe # 122-1 IgG. FIG. 11 shows the product of the immunoblot Lane a shows the non-transfected Cos cells, lane b shows a FLAG control protein and lane c shows pKe # 122-FLAG vector construct transfected Cos cells. Lane c has a band with an approximate molecular weight of 80 kD, which was stained by the anti-FLAG antibody. Lane b shows a FLAG-labeled control protein which is functional itat the anti-FLAG antibody demonstrated

Example 6: Influence of Keratinocytes by pKe # 122-Specific Antisense Oligonucleotides

Antisense nucleotides are taken up by cells, including keratinocytes (cf. G Hartmann et al 1998 antisense oligonucleotides, Deutsches Arzteblatt 95, issue 24, C1 115-C1119) and bind to the mRNA present in the cell and inhibit its translation and thus its translation Expression (cf. Y -S Lee, et al 1997 Definition by specific antisense oligonucleotides of a role for protemkinase Ca in expression of differentiation markers in normal and neoplastic mouse epidermal keratinocytes, Molecular Carcinogenesis 18, pp 44-53) Suitable antisense oligonucleotides were identified the pKe # 122-specific nucleotide sequence (SEQ ID NO: 1 or SEQ ID NO: 4) was prepared. They were adjusted to a concentration of 100 μM with a suitable buffer medium (so-called “oligo buffer”). HaCaT cells were at 37 ° C. and 7% CO ₂ cultivated to a confluency of 70-80% The cells were trypsinized (10 minutes 0.2% EDTA, 5-10 minutes 0.1% trypsin) and adjusted to a concentration of 25,000 cells / ml. 100 μl of cell suspension (corresponding to 2,500 cells) were pipetted into each well of a 96-well plate The cells were incubated for 1 hour, followed by the addition of the antisense oligonucleotide (2 μl of a 100 μM solution) and a further incubation of 24-48 hours. Cell batches were used as a negative control, to which oligonucleotide with the same base distribution but a randomly selected sequence were added

The cells treated in this way were examined with the aid of a microscope with regard to phenotypic changes in the cells. The result of the microscopic analysis is shown in FIG. 12 and FIG. 13. FIG. 12 a shows subconfluent HaCaT cultures which contain pKe # 122-specific antisense oligonucleotides 12 b shows subconfluent HaCaT cultures which have been treated with control oligonucleotides, FIG. 13 a shows confluent HaCaT cultures which have been treated with pKe # 122-specific antisense oligonucleotides, FIG. 13 b shows confluent HaCaT cultures which have been treated with control oligonucleotides, and FIG. 13 c shows a detail from FIG. 13 a

The microscopic examination results demonstrate that, in comparison to control oligonucleotides, the number of cells in the cultures treated with the specific antisense oligonucleotide is significantly reduced. This suggests a decrease in cellular proliferation caused by the antisense oligonucleotide in the HaCaT cultures treated with antisense oligonucleotides, greatly enlarged cells which were not found in the cultures treated with control oligonucleotides. These large cells correspond in their morphology to differentiated keratinocytes. The finding suggests that pKe # 122- specific antisense oligonucleotides treated cells have an increased tendency to differentiate

In summary, treatment with pKe # 122-specific oligonucleotides leads to a significant influence on proliferation and differentiation

Claims

Expectations

An isolated polypeptide which is similar or similar to a protein which occurs naturally in human keratinocytes and which is increasingly expressed in the activated state of the keratinocytes, and which has the amino acid sequence shown in the sequence listing SEQ LD NO 2 or the sequence listing SEQ ID NO 3 or a amino acid substitution or deletion , insertion, or inversion of an allele or derivative formed from one of these two amino acid sequences

Isolated nucleic acid which encodes a protein which is similar or similar to a protein which occurs naturally in human keratinocytes and which is expressed more intensely in the activated state of the keratinocytes, which is either the nucleotide sequence shown in the sequence listing SEQ LD NO 1 or the sequence listing SEQ ID NO 4 or the one of these two complementary nucleotide sequences or a partial sequence of one of these two illustrated or complementary nucleotide sequences or a nucleotide sequence hybridizing wholly or partially with one of these aforementioned nucleotide sequences

Isolated nucleic acid according to claim 2, characterized in that this nucleic acid is obtained from a natural, synthetic or semi-synthetic source Isolated nucleic acid according to claim 2 or 3, characterized in that this nucleic acid is a cDNA

Isolated nucleic acid according to one of claims 2 or 3, characterized in that this nucleic acid is a sense or antisense oligonucleotide which comprises at least 6, preferably 8 to 25 nucleotides and with which in the sequence listing SEQ ID NO 1 or in the sequence listing SEQ LD NO 4 hybridized nucleotide sequence or partial sequences thereof

Isolated nucleic acid according to one of claims 2 or 3, characterized in that this nucleic acid is a splice variant which hybridizes with the nucleotide sequence shown in the sequence listing SEQ LD NO 1 or in the sequence listing SEQ LD NO 4

Isolated polypeptide, characterized in that it has an amino acid sequence which results from a splice variant of an mRNA which is either the nucleotide sequence shown in the sequence listing SEQ ID NO 1 or the sequence listing SEQ ID NO 4 or that which is complementary to either of these two or has a partial sequence of one of these two illustrated or complementary nucleotide sequences or a nucleotide sequence which hybridizes wholly or partially with one of these aforementioned nucleotide sequences Recombinant DNA vector molecule that contains a nucleic acid according to one of the

Claims 2 to 6, and which has the ability to express in a prokaryotic or eukaryotic cell a protein which occurs in human keratinocytes and which is expressed more strongly in activated keratinocytes, in particular the protein pKe # 122

Recombinant DNA vector molecule according to claim 8, characterized in that the vector molecule is the plasmid pUEX-1 or pGEX-2T or pBK-CMV or pHR 2

A transformed host cell which contains a nucleic acid according to any one of claims 2 to 6 which is coupled to an activatable promoter which is naturally contained in the host cell or as a result of recombination, and which has the ability to express a gene which is present in and activated in human keratinocytes Keratinocytes have increased expressed protein, in particular the protein ρKe # 122

Transformed host cell according to claim 10, characterized in that the promoter is the cytokeratin 14 promoter and the host cell is a keratinocyte, or in that the promoter is the CMV promoter and the host cell is a Cos cell

Use of a nucleic acid according to claim 2 or a vector molecule according to claim 8 for the production of transgenic mammals, especially mice or rats Use of a polypeptide according to claim 1 or claim 7 for the production of an antibody against this polypeptide and / or related proteins

Use according to Claim 13, characterized in that the antibody is used for the diagnostic and / or therapeutic treatment of, in particular, dermatological diseases or for the cosmetic treatment of, in particular, the epidermis

Antibody that specifically reacts with a polypeptide according to Anspmch 1 or Anspmch 7

Use of an antibody according to Anspmch 15 for the diagnostic and / or therapeutic treatment of dermatological diseases or for the cosmetic treatment of the epidermis.

Reagent for the indirect detection of a protein which occurs in human keratinocytes and which is increasingly expressed in activated keratinocytes, in particular the protein pKe # 122, characterized in that the reagent comprises at least one nucleic acid according to one of claims 2 to 6 or a polypeptide according to claim 1 or claim 7

Use of a sense or antisense oligonucleotide according to Claim 5 for the diagnostic and / or therapeutic treatment of, in particular, dermatological diseases or for the cosmetic treatment of, in particular, the epidermis

9. Use of a polypeptide according to claim 1 or claim 7 or one

Nucleic acid according to Claim 2 for the identification of medicinally, cosmetically or pharmacologically usable substances which bind to the polypeptide or the nucleic acid and thereby influence its function and / or expression, in particular act as inhibitors or activators.