Classifications

• • B—PERFORMING OPERATIONS; TRANSPORTING
  • B82—NANOTECHNOLOGY
  • B82Y—SPECIFIC USES OR APPLICATIONS OF NANOSTRUCTURES; MEASUREMENT OR ANALYSIS OF NANOSTRUCTURES; MANUFACTURE OR TREATMENT OF NANOSTRUCTURES
  • B82Y15/00—Nanotechnology for interacting, sensing or actuating, e.g. quantum dots as markers in protein assays or molecular motors
• • B—PERFORMING OPERATIONS; TRANSPORTING
  • B82—NANOTECHNOLOGY
  • B82Y—SPECIFIC USES OR APPLICATIONS OF NANOSTRUCTURES; MEASUREMENT OR ANALYSIS OF NANOSTRUCTURES; MANUFACTURE OR TREATMENT OF NANOSTRUCTURES
  • B82Y30/00—Nanotechnology for materials or surface science, e.g. nanocomposites
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
  • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
  • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
  • C12Q1/6813—Hybridisation assays
  • C12Q1/6816—Hybridisation assays characterised by the detection means
  • C12Q1/6825—Nucleic acid detection involving sensors
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
  • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
  • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
  • C12Q1/6869—Methods for sequencing
  • C12Q1/6874—Methods for sequencing involving nucleic acid arrays, e.g. sequencing by hybridisation
• • G—PHYSICS
  • G01—MEASURING; TESTING
  • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
  • G01N27/00—Investigating or analysing materials by the use of electric, electrochemical, or magnetic means
  • G01N27/26—Investigating or analysing materials by the use of electric, electrochemical, or magnetic means by investigating electrochemical variables; by using electrolysis or electrophoresis
  • G01N27/28—Electrolytic cell components
  • G01N27/30—Electrodes, e.g. test electrodes; Half-cells
  • G01N27/327—Biochemical electrodes, e.g. electrical or mechanical details for in vitro measurements
  • G01N27/3275—Sensing specific biomolecules, e.g. nucleic acid strands, based on an electrode surface reaction
  • G01N27/3277—Sensing specific biomolecules, e.g. nucleic acid strands, based on an electrode surface reaction being a redox reaction, e.g. detection by cyclic voltammetry
• • G—PHYSICS
  • G01—MEASURING; TESTING
  • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
  • G01N2610/00—Assays involving self-assembled monolayers [SAMs]

Definitions

• the present invention is directed to methods and compositions for the use of self-assembled monolayers with electronically exposed termini to electronically detect nucleic acids.
• Gene probe assays currently play roles in identifying infectious organisms such as bacteria and viruses, in probing the expression of normal genes and identifying mutant genes such as oncogenes, in typing tissue for compatibility preceding tissue transplantation, in matching tissue or blood samples for forensic medicine, and for exploring homology among genes from different species.
• a gene probe assay should be sensitive, specific and easily automatable (for a review, see Nickerson, Current Opinion in Biotechnology 4:48-51 (1993)).
• the requirement for sensitivity i.e. low detection limits
• PCR polymerase chain reaction
• other amplification technologies which allow researchers to amplify exponentially a specific nucleic acid sequence before analysis (for a review, see Abramson et al., Current Opinion in Biotechnology, 4:41-47 (1993)).
• Branched DNA signal amplification relies on the synthesis of branched nucleic acids, containing a multiplicity of nucleic acid “arms” that function to increase the amount of label that can be put onto one probe This technology is generally described in U S Patent Nos
• dendnmers of nucleic acids serve to vastly increase the amount of label that can be added to a single molecule, using a similar idea but different compositions
• This technology is as described in U.S Patent No 5,175,270 and Nilsen et al , J Theor Biol 187 273 (1997), both of which are incorporated herein by reference
• compositions comprising electrodes comprising a monolayer comprising conductive oligomers, and a capture probe
• the composition further comprises a target sequence comprising a first portion that is capable of hybridizing to the capture probe, and a second portion that does not hybridize to the capture probe and comprises at least one covalently attached electron transfer moiety
• compositions comprising electrodes comprising a monolayer comprising conductive oligomers, and a capture probe
• the compositions further comprise a label probe comprising a first portion that is capable of hybridizing to a component of an assay complex, and a second portion comprising a recruitment linker that does not hybridize to a component of an assay complex and comprises at least one covalently attached electron transfer moiety
• the invention provides methods of detecting a target nucleic acid sequence in a test sample comprising attaching said target sequence to an electrode comprising a monolayer of conductive oligomers
• Label probes are directly or indirectly attached to the target sequence to form an assay complex, wherein the label probe comprises a first portion capable of hybridizing to a component of the assay complex, and a second portion comprising a recruitment linker that does not hybridize to a component of the assay complex and comprises at least one covalently attached electron transfer moiety
• the method further comprises detecting electron transfer between said ETM and said electrode
• the methods comprise attaching a target sequence to an electrode, and directly or indirectly attaching a first portion of at least one label probe containing at least one ETM to the target sequence
• the method further comprises detecting electron transfer between said ETM and said electrode
• the target sequence is attached to the electrode by (1) hybridization to a capture probe (2) by hybridizing a first portion of the target sequence to a first capture extender probe, and hybridizing a second portion of the first capture extender probe to a capture probe on the electrode, or (3) hybridizing a first portion of the target sequence to a first portion of a first capture extender probe, hybridizing a second portion of the first capture extender probe to a first portion of an capture probe on the electrode, hybridizing a second portion of the target sequence to a first portion of a second capture extender probe, and hybridizing a second portion of the second capture extender probe to a second portion of the capture probe
• the label probe is attached to the target sequence by a variety of methods, including (1) hybridizing said first portion of said label probe to a first portion of
• Kits and apparatus comprising the compositions of the method are also provided.
• Figures 1A-10 depict depict a number of different compositions of the invention, the results are shown in Example 1 and 2 Figure 1A depicts I, also referred to as P290 Figure 1 B depicts II, also referred to as P291 Figure 1C depicts III, also referred to as W31 Figure 1 D depicts IV, also referred to as N6 Figure 1 E depicts V, also referred to as P292 Figure 1 F depicts II, also referred to as C23 Figure 1G depicts VII, also referred to as C15 Figure 1 H depicts VIII, also referred to as C95 Figure 11 depicts Y63 Figure U depicts another compound of the invention Figure 1 K depicts N11 Figure 1L depicts C131, with a phosphoramidite group and a DMT protecting group Figure 1M depicts W38, also with a phosphoramidite group and a DMT protecting group Figure 1 N depicts the commercially available moiety that enables "branching" to occur, as its incorporation into a growing oligonucleotide chain results in
• Figure 2 depicts the synthetic scheme of a preferred attachment of an ETM, in this case ferrocene, to a nucleoside (in this case adenosine) via an oxo linkage to the nbose, forming the N6 compound of the invention
• Figure 3 is similar to Figure 2 except that the nucleoside is cytidine, forming the W38 compound of the invention
• Figure 4 depicts the synthetic scheme of a preferred attachment of an ETM, in this case ferrocene, to a nucleoside via the phosphate, forming the Y63 compound of the invention
• Figure 5 depicts the synthetic scheme of a tnphosphate nucleotide, in this case adenosine, with an attached ETM, in this case ferrocene, via an oxo linkage to the nbose
• Figure 6 depicts the use of an activated carboxylate for the addition of a nucleic acid functionalized with a primary amine to a pre-formed SAM
• Figure 7 depicts a schematic of the use of "universal" type gene chips, utilizing restriction endonuclease sites
• Figures 8A and 8B depicts two phosphate attachments of conductive oligomers that can be used to add the conductive oligomers at the 5' position, or any position
• Figure 9 depicts the synthesis of an insulator (C109) to the nbose of a nucleoside for attachment to an electrode
• Figure 10 depicts the synthetic scheme of ethylene glycol terminated conductive oligomers
• Figures 11 A, 11 B and 11C depict the synthesis of three different "branch" points (in this case each using adenosine as the base), to allow the addition of ETM polymers
• Figure 11 A depicts the synthesis of the N17 compound of the invention
• Figure 11 B depicts the synthesis of the W90 compound
• Figure 11C depicts the synthesis of the N38 compound
• Figure 12 depicts a schematic of the synthesis of simultaneous incorporation of multiple ETMs into a nucleic acid, using the N17 "branch" point nucleoside
• Figure 13 depicts a schematic of an alternate method of adding large numbers of ETMs simultaneously to a nucleic acid using a "branch" point phosphoramidite, in this case utilizing three branch points (although two branch points are also possible, see for example Figure 1 N) as is known in the art
• each end point can contain any number of ETMs
• Figure 14 shows a representative hairpin structure 500 is a target binding sequence, 510 is a loop sequence, 520 is a self-complementary region, 530 is substantially complementary to a detection probe, and 530 is the "sticky end", that is, a portion that does not hybridize to any other portion of the probe, that contains the ETMs
• Figures 15A, 15B and 15C depict three preferred embodiments for attaching a target sequence to the electrode
• Figure 15A depicts a target sequence 120 hybridized to a capture probe 100 linked via a attachment linker 106, which as outlined herein may be either a conductive oligomer or an insulator
• the electrode 105 comprises a monolayer of passivation agent 107, which can comprise conductive oligomers (herein depicted as 108) and/or insulators (herein depicted as 109)
• n is an integer of at least 1 , although as will be appreciated by those in the art, the system may not utilize a capture probe at all (i e n is zero), although this is generally not preferred
• the upper limit of n will depend on the length of the target sequence and the required sensitivity
• Figure 15B depicts the use of a single capture extender probe 110 with a first portion 111 that will hybridize to a first portion of the target sequence 120 and a second portion that will hybridize to the capture
• Figures 16A, 16B, 16C, 16D, 16E, 4F and 4G depict some of the embodiments of the invention All of the monolayers depicted herein show the presence of both conductive oligomers 108 and insulators 107 in roughly a 1 1 ratio, although as discussed herein, a variety of different ratios may be used, or the insulator may be completely absent.
• any one of these structures may be repeated for a particular target sequence, that is, for long target sequences, there may be multiple assay complexes formed
• any of the electrode- attachment embodiments of Figure 15 may be used in any of these systems
• Figures 16A, 16B and 16D have the target sequence 120 containing the ETMs 135, as discussed herein, these may be added enzymatically, for example during a PCR reaction using nucleotides modified with ETMs, resulting in essentially random incorporation throughout the target sequence, or added to the terminus of the target sequence
• Figure 16C depicts the use of two different capture probes 100 and 100', that hybridize to different portions of the target sequence 120 As will be appreciated by those in the art, the 5'-3' orientation of the two capture probes in this embodiment is different
• Figure 16C depicts the use of label probes 145 that hybridize directly to the target sequence 120
• Figure 16C shows the use of a label probe 145, comprising a first portion 141 that hybridizes to a portion of the target sequence 120, a second portion 142 comprising ETMs 135
• Figures 16E, 16F and 16G depict systems utilizing label probes 145 that do not hybridize directly to the target, but rather to amplifier probes that are directly (Figure 16E) or indirectly (Figures 16F and 16G) hybridized to the target sequence
• Figure 16E utilizes an amplifier probe 150 has a first portion
• a first label extender probe 160 comprising a first portion 161 that hybridizes to the target sequence 120 and a second portion 162 that hybridizes to a first portion 151 of amplifier probe 150
• a second portion 152 of the amplifier probe 150 hybridizes to a first portion 141 of the label probe 140, which also comprises a recruitment linker 142 comprising ETMs 135 Figure 16G adds a second label extender probe 170, with a first portion 171 that hybridizes to a portion of the target sequence 120 and a second portion that hybridizes to a portion of the amplifier probe
• Figure 16H depicts a system that utilizes multiple label probes The first portion 141 of the label probe
• Figures 17A, 17B, 17C, 17D and 17E depict different possible configurations of label probes and attachments of ETMs
• the recruitment linker is nucleic acid
• in Figures 17D and E is is not
• A nucleoside replacement
• B attachment to a base
• C attachment to a nbose
• D attachment to a phosphate
• E metallocene polymer (although as described herein, this can be a polymer of other ETMs as well), attached to a base, nbose or phosphate (or other backbone analogs)
• F dendnmer structure, attached via a base, nbose or phosphate (or other backbone analogs)
• G attachment via a "branching" structure, through base, nbose or phosphate (or other backbone analogs)
• H attachment of metallocene (or other ETM) polymers
• I attachment via a dendnmer structure
• J attachment using standard link
• Figure 18 depicts an improvement utilizing a stem-loop probe This can be desirable as it creates torsional strain on the surface-bound probe, which has been shown to increase binding efficiency and in some cases thermodynamic stability
• the surface bound probe comprises a capture probe 100, a first stem-loop sequence 550, a target binding sequence 560, and a second stem-loop sequence 570 that is substantially complementary to the first stem-loop sequence
• the target sequence 120 which can contain the ETMs 135 either directly or indirectly using a label probe 145, the effective concentration of the target at the surface increases
• FIGS 19A-19AA depict some of the sequences used in Example 1
• Figures 20A - 20O depict representative scans from the experiments outlined in Example 1 Unless otherwise noted, all scans were run at initial voltage -0 11 V, final voltage 0 5 V, with points taken every 10 mV, amplitude of 0 025, frequency of 10 Hz, a sample period of 1 sec, a quiet time of 2 sec
• Figure 20A has a peak potential of 0 160 V, a peak current of 1 092 X 10 8 A, and a peak A of 7 563 X 10 "10
• VA Figure 20C has a peak potential of 0 190 V, a peak current of 2 046 X 10 "7 A, and a peak area of 2 046 X 10 8
• VA Figure 20d has a peak potential of 0 190 V, a peak current of 3 552 X 10 8 A, and a peak A of 3 568 X 10 "9
• VA Figure 20E has a peak potential of 0 190 V, a peak current of 2 3762 X 10 "7 A, and
• Figure 21 depicts the ligation chain reaction (LCR) experiment of Example 13
• Figures 22A and 22B depicts the results of Example 12
• the "hybrid code” refers to the system number, + and - refer to the presence or absence of the rRNA target
• FIGS 23A, 23B, 23C, 23D, 23E and 23F depict the compositions and results of Example 13
• FIGS. 24A and 24B depict the compositions and results from Example 13
• FIGS 25A and 25B depict the set up of two of the experiments of Example 8.
• Figure 26 shows the results of a PCR experiment as outlined in Example 9 DETAILED DESCRIPTION OF THE INVENTION
• nucleic acid detection particularly in array formats, is rapidly expanding, with fluorescent based detection systems being the most common
• detection based on electron transfer see U S Pat No 5,591 ,578
• This electron transfer detection is based on the finding that electron transfer can proceed through the stacked ⁇ orbitals (the " ⁇ -way") of the heterocyc c bases of double stranded (hybridized) nucleic acid, thus allowing differentiation between single stranded and double stranded nucleic acids
• nucleic acids are made that contain covalently attached ETMs, which, upon hybridization to a complementary strand, allows electron transfer to occur between the ETMs via the " ⁇ -way", and thus resulting in detection of a target sequence
• Further improvements on the system described in PCT US97/20014, allows the attachment of nucleic acids to electrodes using conductive oligomers, i e chemical "wires", such that upon formation of double stranded nucleic acids containing ETMs, electron
• the present invention is directed to the discovery that the presence or absence of the ETMs can be directly detected using conductive oligomers, that is, the electrons from the ETMs need not travel through the stacked ⁇ orbitals in order to generate a signal Instead, the presence of ETMs on the surface of a SAM, that comprises conductive oligomers, can be directly detected
• a label probe comprising an ETM is brought to the surface, and detection of the ETM can proceed, putatively through the conductive ohgomer to the electrode
• the role of the SAM comprising the conductive oligomers is to "raise" the electronic surface of the electrode, while still providing the benefits of shielding the electrode from solution components and reducing the amount of non-specific binding to the electrodes
• the role of the nucleic acids is to provide specificity for a recruitment of ETMs to the surface, where they can be detected using conductive oligomers with electronically exposed termini
• the present invention provides methods and compositions useful in the detection of nucleic acids
• the compositions of the invention can take on a wide variety of configurations, as is generally outlined in the Figures
• preferred systems of the invention work as follows
• a target nucleic acid sequence is attached (via hybridization) to an electrode comprising a monolayer including conductive oligomers
• This attachment can be either directly to a capture probe on the surface, or indirectly, using capture extender probes
• a label probe is then added, forming an assay complex, that has a first portion that is capable of hybridizing to a component of the assay complex, and a second portion that does not hybridize to a component of the assay complex and contains at least one covalently attached ETM
• the attachment of the label probe may be direct (i e hybridization to a portion of the target sequence), or indirect (i e hybridization to an amplifier probe that hybridizes to the target sequence), with all the required nucleic acids forming an assay complex As a result
• compositions comprise an electrode comprising a monolayer
• an electrode herein is meant a composition, which, when connected to an electronic device, is able to sense a current or charge and convert it to a signal
• an electrode can be defined as a composition which can apply a potential to and/or pass electrons to or from species in the solution
• an electrode is an ETM as described herein
• Preferred electodes include, but are not limited to, certain metals and their oxides, including gold, platinum, palladium, silicon, aluminum, metal oxide electrodes including platinum oxide, titanium oxide, tin oxide, indium tin oxide, palladium oxide, silicon oxide, aluminum oxide, molybdenum oxide (Mo 2 0 6 ), tungsten oxide W0 3 ) and ruthenium oxides, and carbon (including glassy carbon electrodes graphite and carbon paste)
• Preferred electrodes include gold, silicon, carbon and metal oxide electrodes, with gold being particularly preferred
• the electrodes described herein are depicted as a flat surface, which is only one of the possible conformations of the electrode and is for schematic purposes only
• the conformation of the electrode will vary with the detection method used
• flat planar electrodes may be preferred for optical detection methods, or when arrays of nucleic acids are made, thus requiring addressable locations for both synthesis and detection
• the electrode may be in the form of a tube, with the SAMs comprising conductive oligomers and nucleic acids bound to the inner surface This allows a maximum of surface area containing the nucleic acids to be exposed to a small volume of sample
• the electrode comprises a monolayer, comprising conductive oligomers
• monolayer or “self- assembled monolayer” or “SAM” herein is meant a relatively ordered assembly of molecules spontaneously chemisorbed on a surface, in which the molecules are oriented approximately parallel to each other and roughly perpendicular to the surface Each of the molecules includes a functional group that adheres to the surface, and a portion that interacts with neighboring molecules in the monolayer to form the relatively ordered array
• a "mixed" monolayer comprises a heterogeneous monolayer, that is, where at least two different molecules make up the monolayer
• the SAM may comprise conductive oligomers alone, or a mixture of conductive oligomers and insulators As outlined herein, the efficiency of oligonucleotide hybridization may increase when the oligonucleotide is at a distance from the electrode Similarly, non-specific binding of biomolecules, including the nucleic acids, to an electrode is generally reduced when a monolayer is present Thus, a mono
• the monolayer comprises conductive oligomers
• conductive oligomer herein is meant a substantially conducting oligomer, preferably linear, some embodiments of which are referred to in the literature as “molecular wires”
• substantially conducting herein is meant that the oligomer is capable of transfe ⁇ ng electrons at 100 Hz
• the conductive oligomer has substantially overlapping ⁇ -orbitals, i e conjugated ⁇ -orbitals, as between the monomenc units of the conductive oligomer, although the conductive oligomer may also contain one or more sigma ( ⁇ ) bonds
• a conductive oligomer may be defined functionally by its ability to inject or receive electrons into or from an associated ETM
• the conductive oligomer is more conductive than the insulators as defined herein
• the conductive oligomers of the invention are to be distinguished from electroactive polymers, that themselves may donate or accept electrons
• the conductive oligomers have a conductivity, S, of from between about 10 "6 to about 10 4 ⁇ cm 1 , with from about 10 5 to about 10 3 ⁇ 1 cm 1 being preferred, with these S values being calculated for molecules ranging from about 20A to about 200A
• insulators have a conductivity S of about 10 7 ⁇ 1 cm 1 or lower, with less than about 10 8 ⁇ 'cm 1 being preferred See generally Gardner et al , Sensors and Actuators A 51 (1995) 57-66, incorporated herein by reference
• Desired characteristics of a conductive oligomer include high conductivity, sufficient solubility in organic solvents and/or water for synthesis and use of the compositions of the invention, and preferably chemical resistance to reactions that occur i) during nucleic acid synthesis (such that nucleosides containing the conductive oligomers may be added to a nucleic acid synthesizer during the synthesis of the compositions of the invention), n) during the attachment of the conductive oligomer to an electrode, or in) during hybridization assays
• conductive oligomers that will promote the formation of self-assembled monolayers are preferred
• the oligomers of the invention comprise at least two monome ⁇ c subunits, as described herein As is described more fully below, oligomers include homo- and hetero-oligomers, and include polymers
• the conductive oligomer has the structure depicted in Structure 1
• the conductive oligomer of Structure 1 may be attached to ETMs, such as electrodes, transition metal complexes, organic ETMs, and metallocenes, and to nucleic acids, or to several of these Unless otherwise noted, the conductive oligomers depicted herein will be attached at the left side to an electrode, that is, as depicted in Structure 1 , the left “Y” is connected to the electrode as described herein If the conductive oligomer is to be attached to a nucleic acid, the right "Y", if present, is attached to the nucleic acid, either directly or through the use of a linker, as is described herein
• Y is an aromatic group
• n is an integer from 1 to 50
• g is either 1 or zero
• e is an integer from zero to 10
• m is zero or 1
• B-D is a tond able 10 conjugate with neighboring bonds (herein referred to as a "conjugated'boiid" , preferably selected from acetylene, B-
• e is preferably 1
• D is preferably carbonyl, or a heteroatom moiety, wherein the heteroatom is selected from oxygen, sulfur, nitrogen, silicon or phosphorus
• suitable heteroatom moieties include, but are not limited to, -NH and -NR, wherein R is as defined herein, substituted sulfur, sulfonyl (-S0 2 -) sulfoxide (-SO-), phosphine oxide (-PO- and -RPO-), and thiophosphine (-PS- and -RPS-)
• R
• aromatic group or grammatical equivalents herein is meant an aromatic monocyclic or polycychc hydrocarbon moiety generally containing 5 to 14 carbon atoms (although larger polycychc rings structures may be made) and any carbocy c ketone or thioketone derivative thereof, wherein the carbon atom with the free valence is a member of an aromatic ring
• Aromatic groups include arylene groups and aromatic groups with more than two atoms removed
• aromatic includes heterocycle
• Heterocycle or “heteroaryl” means an aromatic group wherein 1 to 5 of the indicated carbon atoms are replaced by a heteroatom chosen from nitrogen, oxygen, sulfur, phosphorus, boron and silicon wherein the atom with the free valence is a member of an aromatic ring, and any heterocyclic ketone and thioketone derivative thereof
• heterocycle includes thienyl, furyl, pyrrolyl, pyrimidinyl, oxalyl, indolyl,
• the Y aromatic groups of the conductive oligomer may be different, i e the conductive oligomer may be a heteroo gomer That is, a conductive oligomer may comprise a oligomer of a single type of Y groups, or of multiple types of Y groups
• the aromatic group may be substituted with a substitution group, generally depicted herein as R R groups may be added as necessary to affect the packing of the conductive oligomers, i e R groups may be used to alter the association of the oligomers in the monolayer R groups may also be added to 1 ) alter the solubility of the oligomer or of compositions containing the oligomers, 2) alter the conjugation or electrochemical potential of the system, and 3) alter the charge or characteristics at the surface of the monolayer
• R groups are preferred to increase solubility when solution synthesis is done
• the R groups, and their positions are chosen to minimally effect the packing of the conductive oligomers on a surface, particularly within a monolayer, as described below
• the R groups are chosen to minimally effect the packing of the conductive oligomers on a surface, particularly within a monolayer, as described below
• only small R groups are used within the monolayer, with larger R grouDs generally above the surface of the monolayer
• attachment of methyl groups to the portion of the conductive oligomer within the monolayer to increase solubility is preferred, with attachment of longer alkoxy groups, for example, C3 to C10, is preferably done above the monolayer surface
• this generally means that attachment of ste ⁇ cally significant R groups is not done on any of the first two or three oligomer subunits, depending on the average length of the molecules making up the monolayer
• R groups include, but are not limited to, hydrogen, alkyl, alcohol, aromatic, ammo, amido, nitro, ethers, esters, aldehydes, sulfonyl, silicon moieties, halogens, sulfur containing moieties, phosphorus containing moieties, and ethylene glycols
• R is hydrogen when the position is unsubstituted It should be noted that some positions may allow two substitution groups, R and R', in which case the R and R' groups may be either the same or different
• alkyl group or grammatical equivalents herein is meant a straight or branched chain alkyl group, with straight chain alkyl groups being preferred If branched, it may be branched at one or more positions, and unless specified, at any position
• the alkyl group may range from about 1 to about 30 carbon atoms (C1 -C30), with a preferred embodiment utilizing from about 1 to about 20 carbon atoms
• alkyl group (C1 -C20), with about C1 through about C12 to about C15 being preferred, and C1 to C5 being particularly preferred, although in some embodiments the alkyl group may be much larger
• cycloalkyl groups such as C5 and C6 rings, and heterocyclic rings with nitrogen, oxygen, sulfur or phosphorus
• Alkyl also includes heteroalkyl, with heteroatoms of sulfur, oxygen, nitrogen, and silicone being preferred
• Alkyl includes substituted alkyl groups
• substituted alkyl group herein is meant an alkyl group further comprising one or more substitution moieties "R", as defined above
• nitro group herein is meant an -N0 2 group
• sulfur containing moieties herein is meant compounds containing sulfur atoms, including but not limited to, thia-, thio- and sulfo- compounds, thiols (-SH and -SR), and sulfides (-RSR-)
• phosphorus containing moieties herein is meant compounds containing phosphorus, including, but not limited to, phosphmes and phosphates
• silicon containing moieties herein is meant compounds containing silicon
• ether herein is meant an -O-R group
• Preferred ethers include alkoxy groups, with -0-(CH 2 ) 2 CH 3 and -0-(CH 2 ) 4 CH 3 being preferred
• esters herein is meant a -COOR group
• halogen herein is meant bromine, iodine, chlorine, or fluorine
• Preferred substituted alkyls are partially or fully halogenated alkyls such as CF 3 , etc
• aldehyde herein is meant -RCHO groups
• alcohol herein is meant -OH groups, and alkyl alcohols -ROH
• ethylene glycol or "(poly)ethylene glycol” herein is meant a -(0-CH 2 -CH 2 ) n - group, although each carbon atom of the ethylene group may also be singly or doubly substituted, i e -(0-CR 2 -CR 2 ) n -, with R as described above
• Ethylene glycol derivatives with other heteroatoms in place of oxygen i e -(N- CH 2 -CH 2 ) n - or -(S-CH 2 -CH 2 ) n -, or with substitution groups
• substitution groups include, but are not limited to, methyl, ethyl, propyl, alkoxy groups such as -0-(CH 2 ) 2 CH 3 and -0-(CH 2 ) 4 CH 3 and ethylene glycol and derivatives thereof.
• Preferred aromatic groups include, but are not limited to, phenyl, naphthyl, naphthalene, anthracene, phenanthroline, pyrole, pyridine, thiophene, porphyrins, and substituted derivatives of each of these, included fused ring derivatives.
• B-D is a bond linking two atoms or chemical moieties.
• B-D is a conjugated bond, containing overlapping or conjugated ⁇ -orbitals.
• B-D bonds are acetylene, alkene, amide, and substituted derivatives of these three, and azo.
• B-D bonds are acetylene, alkene and amide.
• the oligomer components attached to double bonds may be in the trans or cis -conformation, or mixtures.
• either B or O may include carbon, nitrogen or silicon.
• substitution groups are- as-defined as above for R.
• e is preferably 1 and the D moiety may be carbonyl or a heteroatom moiety as defined above.
• the terminal B-D bond may be an amide bond
• the rest of the B-D bonds may be acetylene bonds.
• amide bonds when amide bonds are present, as few amide bonds as possible are preferable, but in some embodiments all the B-D bonds are amide bonds.
• B-D bond may be present in the conductive oligomer within a monolayer as described below, and another type above the monolayer level, for example to give greater flexibility for nucleic acid hybridization when the nucleic acid is attached via a conductive oligomer.
• n is an integer from 1 to 50, although longer oligomers may also be used (see for example Schumm et al., Angew. Chem. Int. Ed. Engl. 1994 33(13):1360).
• the hybridization should occur at a distance from the surface, i e the kinetics of hybridization increase as a function of the distance from the surface, particularly for long oligonucleotides of 200 to 300 basepairs
• the length of the conductive oligomer is such that the closest nucleotide of the nucleic acid is positioned from about 6A to about 100A (although distances of up to 500A may be used) from the electrode surface, with from about 15A to about 60A being preferred and from about 25A to about 60A also being preferred
• n will depend on the size of the aromatic group, but generally will be from about 1 to about 20, with from about 2 to about 15 being preferred and from about 3 to about 10 being especially preferred
• m is either 0 or 1 That is, when m is 0, the conductive oligomer may terminate in the B-D bond or D moiety, i e the D atom is attached to the nucleic acid either directly or via a linker
• the conductive oligomer may terminate in the B-D bond or D moiety, i e the D atom is attached to the nucleic acid either directly or via a linker
• the conductive oligomer may terminate in the B-D bond or D moiety, i e the D atom is attached to the nucleic acid either directly or via a linker
• the D atom may be the nitrogen atom of the ammo-modified nbose
• the conductive oligomer may terminate in Y, an aromatic group, i e the aromatic group is attached to the nucleic acid or linker
• conductive oligomers falling within the Structure 1 and Structure 8 formulas, as well as other conductive oligomers, as are generally known in the art, including for example, compounds comprising fused aromatic rings or Teflon®-l ⁇ ke oligomers, such as -(CF 2 ) n -, -(CHF) n - and -(CFR) n - See for example, Schumm et al , Angew Chem Intl Ed Engl 33 1361 (1994), Grosshenny et al , Platinum Metals Rev 40(1 ) 26-35 (1996), Tour, Chem Rev 96 537-553 (1996), Hsung et al ,
• Structure 2 is Structure 1 when g is 1 Preferred embodiments of Structure 2 include e is zero, Y is pyrole or substituted pyrole, e is zero, Y is thiophene or substituted thiophene, e is zero, Y is furan or substituted furan, e is zero, Y is phenyl or substituted phenyl, e is zero, Y is pyridme or substituted pyridme, e is 1 , B-D is acetylene and Y is phenyl or substituted phenyl (see Structure 4 below) A preferred embodiment of Structure 2 is also when e is one, depicted as Structure 3 below
• Preferred embodiments of Structure 3 are Y is phenyl or substituted phenyl and B-D is azo, Y is phenyl or substituted phenyl and B-D is acetylene, Y is phenyl or substituted phenyl and B-D is alkene, Y is pyridme or substituted pyridme and B-D is acetylene, Y is thiophene or substituted thiophene and B-D is acetylene, Y is furan or substituted furan and B-D is acetylene, Y is thiophene or furan (or substituted thiophene or furan) and B-D are alternating alkene and acetylene bonds
• any Structure 3 oligomers may be substituted with any of the other structures depicted herein, i e Structure 1 or 8 oligomer, or other conducting oligomer, and the use of such Structure 3 depiction is not meant to limit the scope of the invention
• Structure 4 includes n is two, m is one, and R is hydrogen, n is three, m is zero, and R is hydrogen, and the use of R groups to increase solubility Structure ⁇
• the conductive oligomers are pseudopeptide oligomers
• the amide bond in Structure 5 is depicted with the carbonyl to the left, i e -
• Structure 5 the reverse may also be used, i e -NHCO-
• Particularly preferred embodiments of Structure 5 include n is two, m is one, and R is hydrogen, n is three, m is zero, and R is hydrogen (in this embodiment, the terminal nitrogen (the D atom) may be the nitrogen of the ammo-modified nbose), and the use of R groups to increase solubility Structure 6
• Preferred embodiments of Structure 6 include the first n is two, second n is one, m is zero, and all R groups are hydrogen, or the use of R groups to increase solubility.
• Preferred embodiments of Structure 7 include: the first n is three, the second n is from 1-3, with m being either 0 or 1 , and the use of R groups to increase solubility.
• the conductive oligomer has the structure depicted in Structure 8:
• C are carbon atoms
• n is an integer from 1 to 50
• m is 0 or 1
• J is a heteroatom selected from the group consisting of oxygen, nitrogen, silicon, phosphorus, sulfur, carbonyl or sulfoxide
• the G bond of each subunit may be the same or different than the G bonds of other subunits; that is, alternating oligomers of alkene and acetylene bonds could be used, etc.
• G is an alkane bond
• the number of alkane bonds in the oligomer should be kept to a minimum, with about six or less sigma bonds per conductive oligomer being preferred.
• Alkene bonds are preferred, and are generally depicted herein, although alkane and acetylene bonds may be substituted in any structure or embodiment described herein as will be appreciated by those in the art.
• m 0 then at least one of the G bonds is not an alkane bond.
• the m of Structure 8 is zero In a particularly preferred embodiment, m is zero and G is an alkene bond, as is depicted in Structure 9
• alkene oligomer of structure 9, and others depicted herein, are generally depicted in the preferred trans configuration, although oligomers of as or mixtures of trans and cis may also be used As above, R groups may be added to alter the packing of the compositions on an electrode, the hydrophilicity or hydrophobicity of the oligomer, and the flexibility, i e the rotational, torsional or longitudinal flexibility of the oligomer n is as defined above
• R is hydrogen, although R may be also alkyl groups and polyethylene glycols or derivatives
• the conductive oligomer may be a mixture of different types of oligomers, for example of structures 1 and 8
• the terminus of at least some of the conductive oligomers in the monolayer are electronically exposed
• electroconductive oligomers may or may not have terminal groups
• there is no additional terminal group and the conductive oligomer terminates with one of the groups depicted in Structures 1 to 9, for example, a B-
• a terminal group is added, sometimes depicted herein as "Q"
• a terminal group may be used for several reasons, for example, to contribute to the electronic availability of the conductive oligomer for detection of ETMs, or to alter the surface of the SAM for other reasons, for example to prevent non-specific binding
• Preferred terminal groups include -NH 2 , -OH, - COOH, and alkyl groups such as -CH 3 , and (poly)alkylox ⁇ des such as (poly)ethylene glycol, with - OCH 2 CH 2 OH, -(OCH 2 CH 2 0) 2 H, -(OCH 2 CH 2 0) 3 H, and -(OCH 2 CH 2 0) 4 H being preferred
• the monolayer may comprise different conductive oligomer species, although preferably the different species are chosen such that a reasonably uniform SAM can be formed.
• the monolayer may comprise different conductive oligomer species, although preferably the different species are chosen such that a reasonably uniform SAM can be formed.
• nucleic acids are covalently attached to the electrode using conductive oligomers
• preferred embodiments utilize conductive oligomers that terminate below the surface of the rest of the monolayer, i.e. below the insulator layer, if used, or below some fraction of the other conductive oligomers.
• the use of different conductive oligomers may be done to facilitate monolayer formation, or to make monolayers with altered properties.
• the monolayer may further comprise insulator moieties.
• insulator herein is meant a substantially nonconducting oligomer, preferably linear.
• substantially nonconducting herein is meant that the insulator will not transfer electrons at 100 Hz. The rate of electron transfer through the insulator is preferrably slower than the rate through the conductive oligomers described herein.
• trie insulators have a conductivity, S, of about 10 "7 ⁇ "1 c ⁇ r 1 or lower, with less tharrabout 10 "8 ⁇ 'cm ' 1 being preferred. See- generally Gardner et ai., supra.
• insulators are alkyl or heteroalkyl oligomers or moieties with sigma bonds, although any particular insulator molecule may contain aromatic groups or one or more conjugated bonds.
• heteroalkyl herein is meant an alkyl group that has at least one heteroatom, i.e. nitrogen, oxygen, sulfur, phosphorus, silicon or boron included in the chain.
• the insulator may be quite similar to a conductive oligomer with the addition of one or more heteroatoms or bonds that serve to inhibit or slow, preferably substantially, electron transfer.
• Suitable insulators include, but are not limited to, -(CH 2 ) n -, -(CRH) n -, and - (CR 2 ) n -, ethylene glycol or derivatives using other heteroatoms in place of oxygen, i.e. nitrogen or sulfur (sulfur derivatives are not preferred when the electrode is gold).
• the insulators may be substituted with R groups as defined herein to alter the packing of the moieties or conductive oligomers on an electrode, the hydrophilicity or hydrophobicity of the insulator, and the flexibility, i e the rotational, torsional or longitudinal flexibility of the insulator
• R groups as defined herein to alter the packing of the moieties or conductive oligomers on an electrode, the hydrophilicity or hydrophobicity of the insulator, and the flexibility, i e the rotational, torsional or longitudinal flexibility of the insulator
• branched alkyl groups may be used
• the insulators may contain terminal groups, as outlined above, particularly to influence the surface of the monolayer
• the length of the species making up the monolayer will vary as needed As outlined above, it appears that hybridization is more efficient at a distance from the surface
• the species to which nucleic acids are attached (as outlined below, these can be either insulators or conductive oligomers) may be basically the same length as the monolayer forming species or longer than them, resulting in the nucleic acids being more accessible to the solvent for hybridization
• the conductive oligomers to which the nucleic acids are attached may be shorter than the monolayer
• the actual combinations and ratios of the different species making up the monolayer can vary widely Generally, three component systems are preferred, with the first species comprising a nucleic acid containing species (i e a capture probe, that can be attached to the electrode via either an insulator or a conductive oligomer, as is more fully described below)
• the second species are the conductive oligomers
• the third species are insulators
• the first species can comprise from about 90% to about 1 %, with from about 20% to about 40% being preferred, and from about 30% to about 40% being especially preferred for short oligonucleotide targets and from about 10% to about 20% preferred for longer targets
• the second species can comprise from about 1 % to about 90%, with from about 20% to about 90% being preferred, and from about 40% to about 60% being especially preferred
• the third species can comprise from about 1 % to about 90% with from about 20% to about 40% being preferred, and from about 15% to about 30% being especially preferred Preferred ratios of first second.third species are 2 2 1 for short targets
• first and second species are used, comprising the first and second species
• the first species can comprise from about 90% to about 1 %, with from about 1% to about 40% being preferred, and from about 10% to about 40% being especially preferred
• the second species can comprise from about 1% to about 90%, with from about 10% to about 60% being preferred, and from about 20% to about 40% being especially preferred
• the attachment linkers with covalently attached nucleosides or nucleic acids as depicted herein are covalently attached to an electrode
• one end or terminus of the attachment linker is attached to the nucleoside or nucleic acid, and the other is attached to an electrode
• the attachment linker may be attached at two sites to the electrode, as is generally depicted in Structures 11-13 Generally, some type of linker is used, as depicted below as "A" in Structure 10, where "X" is the conductive oligomer, "I" is
• A is a linker or atom
• A is a linker or atom
• A may be a sulfur moiety when a gold electrode is used
• A when metal oxide electrodes are used, A may be a silicon (silane) moiety attached to the oxygen of the oxide (see for example Chen et al , Langmuir 10 3332-3337 (1994), Lenhard et al , J Electroanal Chem 78 195-201 (1977), both of which are expressly incorporated by reference)
• A When carbon based electrodes are used, A may be an ammo moiety (preferably a primary amine, see for example Deinhammer et al , Langmuir 10 1306-1313 (1994))
• preferred A moieties include, but are not limited to, silane moieties, sulfur moieties (including alkyl sulfur moieties), and ammo moieties
• epoxide type linkages with redox polymers such as are known in the art are not used
• the insulators and conductive oligomers may be attached to the electrode with more than one "A" moiety, the "A" moieties may be the same or different
• the electrode is a gold electrode
• "A" is a sulfur atom or moiety
• multiple sulfur atoms may be used to attach the conductive oligomer to the electrode, such as is generally depicted below in Structures 11 , 12 and 13
• other such structures can be made In Structures 11 , 12 and 13, the A moiety is just a sulfur atom, but substituted sulfur moieties may also be used Structure 11
• a conductive oligomer terminating in a single carbon atom with three sulfur moities attached to the electrode may also comprise a "Q" terminal group
• the electrode is a gold electrode, and attachment is via a sulfur linkage as is well known in the art, i e the A moiety is a sulfur atom or moiety Although the exact characteristics of the gold-sulfur attachment are not known, this linkage is considered covalent for the purposes of this invention
• a representative structure is depicted in Structure 14, using the Structure 3 conductive oligomer, although as for all the structures depicted herein, any of the conductive oligomers, or combinations of conductive oligomers, may be used Similarly, any of the conductive oligomers or insulators may also comprise terminal groups as described herein Structure 14 depicts the "A" linker as comprising just a sulfur atom, although additional atoms may be present (i e linkers from the sulfur to the conductive oligomer or substitution groups) In addition, Structure 14 shows the sulfur atom attached to the Y aromatic group, but as will be appreciated by those in the art, it may be attached to the B-D group (i e an acety
• the electrode is a carbon electrode, i e a glassy carbon electrode, and attachment is via a nitrogen of an amine group
• a representative structure is depicted in Structure 15 Again, additional atoms may be present, i e Z type linkers and/or terminal groups
• the oxygen atom is from the oxide of the metal oxide electrode
• the Si atom may also contain other atoms, i e be a silicon moiety containing substitution groups
• Other attachments for SAMs to other electrodes are known in the art, see for example Napier et al , Langmuir, 1997, for attachment to indium tin oxide electrodes, and also the chemisorption of phosphates to an indium tin oxide electrode (talk by H Holden Thorpe, CHI conference, May 4-5, 1998)
• the electrode comprising the monolayer including conductive oligomers further comprises a nucleic acid capture probe
• nucleic acid or "oligonucleotide” or grammatical equivalents herein means at least two nucleotides covalently linked together
• a nucleic acid of the present invention will generally contain phosphodiester bonds, although in some cases, as outlined below, nucleic acid analogs are included that may have alternate backbones, comprising, for example, phosphoramide (Beaucage et al , Tetrahedron 49(10) 1925 (1993) and references therein, Letsmger, J Org Chem 35 3800 (1970), Spnnzl et al , Eur J Biochem 81 579 (1977), Letsmger et al , Nucl Acids Res 14 3487 (1986), Sawai et al, Chem Lett 805 (1984), Letsmger et al , J Am Chem Soc 110 4470 (1988), and Pau
• nucleic acid analogs may find use in the present invention
• mixtures of naturally occurring nucleic acids and analogs can be made, for example, at the site of conductive oligomer or ETM attachment, an analog structure may be used
• PNA peptide nucleic acids
• PNA backbones are substantially non-ionic under neutral conditions, in contrast to the highly charged phosphodiester backbone of naturally occurring nucleic acids
• Tm melting temperature
• RNA typically exhibit a 2-4°C drop in Tm for an internal mismatch Wth the non-ionic PNA backbone, the drop is closer to 7-9°C
• salt concentration is particularly advantageous in the systems of the present invention, as a reduced salt hybridization solution has a lower Faradaic current than a physiological salt solution (in the range of 150 mM)
• the nucleic acids may be single stranded or double stranded, as specified, or contain portions of both double stranded or single stranded sequence
• the nucleic acid may be DNA, both genomic and cDNA, RNA or a hybrid, where the nucleic acid contains any combination of deoxy ⁇ bo- and nbo- nucleotides, and any combination of bases, including uracil, adenine, thymme, cytosme, guanme, inosme, xathanme hypoxathan e, isocytosine, isoguanme, etc
• a preferred embodiment utilizes isocytosine and isoguanme in nucleic acids designed to be complementary to other probes, rather than target sequences, as this reduces non-specific hybridization, as is generally described in U S
• nucleoside includes nucleotides as well as nucleoside and nucleotide analogs, and modified nucleosides such as ammo modified nucleosides
• nucleoside includes non-naturally occunng analog structures
• nucleoside includes non-naturally occunng analog structures
• the capture probe nucleic acid is covalently attached to the electrode This attachment can be via a conductive oligomer or via an insulator
• capture probe or “anchor probe” herein is meant a component of an assay complex as defined herein that allows the attachment of a target sequence to the electrode, for the purposes of detection
• attachment of the target sequence to the capture probe may be direct (i e the target sequence hybridizes to the capture probe) or indirect (one or more capture extender probes are used)
• covalently attached herein is meant that two moieties are attached by at least one bond, including sigma bonds, pi bonds and coordination bonds
• the capture probes may have botf ' i nucleic and non- nucleic acid portions
• flexible linkers such as alkyl groups, including polyethylene glycol linkers, may be used to get the nucleic acid portion of the capture probe off the electrode surface This may be particularly useful when the target sequences are large, for example
• the capture probe nucleic acid is covalently attached to the electrode, via an "attachment linker", that can be either a conductive oligomer or via an insulator
• an attachment linker that can be either a conductive oligomer or via an insulator
• one end of the attachment linker is attached to a nucleic acid, and the other end (although as will be appreciated by those in the art, it need not be the exact terminus for either) is attached to the electrode
• any of structures depicted herein may further comprise a nucleic acid effectively as a terminal group
• the present invention provides compositions comprising nucleic acids covalently attached to electrodes as is generally depicted below in Structure 17 Structure 17
• F is a linkage that allows the covalent attachment of the electrode and the conductive oligomer or insulator, including bonds, atoms or linkers such as is described herein, for example as "A", defined below
• F 2 is a linkage that allows the covalent attachment of the conductive oligomer or insulator to the nucleic acid, and may be a bond, an atom or a linkage as is herein described
• F 2 may be part of the conductive oligomer, part of the insulator, part of the nucleic acid, or exogeneous to both, for example, as defined herein for "Z"
• the capture probe nucleic acid is covalently attached to the electrode via a conductive oligomer
• the covalent attachment of the nucleic acid and the conductive oligomer may be accomplished in several ways In a preferred embodiment, the attachment is via attachment to the base of the nucleoside, via attachment to the backbone of the nucleic acid (either the nbose, the phosphate, or to an analogous group of a nucleic acid analog backbone), or via a transition metal ligand, as described below.
• the techniques outlined below are generally described for naturally occunng nucleic acids, although as will be appreciated by those in the art, similar techniques may be used with nucleic acid analogs
• the conductive oligomer is attached to the base of a nucleoside of the nucleic acid This may be done in several ways, depending on the oligomer, as is described below In one embodiment, the oligomer is attached to a terminal nucleoside, i e either the 3' or 5' nucleoside of the nucleic acid Alternatively, the conductive oligomer is attached to an internal nucleoside
• attachment is to the 5 or 6 position of py ⁇ midines such as undine, cytosme and thymme
• the linkage is preferably via the 8 position
• Attachment to non-standard bases is preferably done at the comparable positions
• the attachment is direct, that is, there are no intervening atoms between the conductive oligomer and the base
• conductive oligomers with terminal acetylene bonds are attached directly to the base Structure 18 is an example of this linkage, using a Structure 3 conductive oligomer and undine as the base, although other bases and conductive oligomers can be used as will be appreciated by those in the art
• the pentose structures depicted herein may have hydrogen, hydroxy, phosphates or other groups such as ammo groups attached
• the pentose and nucleoside structures depicted herein are depicted non-conventionally, as mirror images of the normal rendering
• the pentose and nucleoside structures may also contain additional groups, such as protecting groups, at any position, for example as needed during synthesis
• the base may contain additional modifications as needed, i e the carbonyl or amine groups may be altered or protected, for example as is depicted in Figure 18A of PCT US97/20014 This may be required to prevent significant dimerization of conductive oligomers instead of coupling to the lodinatmg base
• changing the components of the palladium reaction may be desirable also R groups may be preferred on longer conductive oligomers to increase solubility
• the attachment is any number of different Z linkers, including amide and amine linkages, as is generally depicted in Structure 19 using undine as the base and a Structure 3 oligomer
• Z is a linker
• Z is a short linker of about 1 to about 10 atoms, with from 1 to 5 atoms being preferred, that may or may not contain alkene, alkynyl, amine, amide, azo, imine, etc , bonds
• Linkers are known in the art, for example, homo-or hetero-bifunctional linkers as are well known (see 1994 Pierce Chemical Company catalog, technical section on cross-linkers, pages 155-200, incorporated herein by reference)
• Preferred Z linkers include, but are not limited to, alkyl groups (including substituted alkyl groups and alkyl groups containing heteroatom moieties), with short alkyl groups, esters, amide, amine, epoxy groups and ethylene glycol and derivatives being preferred, with propyl, acetylene, and C 2 alkene being especially preferred Z may also be a sulfone group, forming sulfonamide linkages as discussed below
• the attachment of the nucleic acid and the conductive oligomer is done via attachment to the backbone of the nucleic acid This may be done in a number of ways, including attachment to a nbose of the ⁇ bose-phosphate backbone, or to the phosphate of the backbone, or other groups of analogous backbones
• the site of attachment in this embodiment may be to a 3' or 5' terminal nucleotide, or to an internal nucleotide, as is more fully described below
• the conductive oligomer is attached to the nbose of the nbose-phosphate backbone This may be done in several ways As is known in the art, nucleosides that are modified at either the 2' or 3' position of the nbose with ammo groups, sulfur groups, silicone groups, phosphorus groups, or oxo groups can be made (Imazawa et al , J Org Chem , 44 2039 (1979), Hobbs et al , J Org Chem 42(4) 714 (1977), Verheyden et al , J Orrg Chem 36(2) 250 (1971 ), McGee et al , J Org Chem 61 781-785 (1996), Mikhailopulo et al , Liebigs Ann Chem 513-519 (1993), McGee et al , Nucleosides & Nucieotides 14(6) 323 (1995), ail of which are incorporated by reference) These modified
• a preferred embodiment utilizes ammo-modified nucleosides These ammo-modified ⁇ boses can then be used to form either amide or amine linkages to the conductive oligomers
• the ammo group is attached directly to the nbose, although as will be appreciated by those in the art, short linkers such as those described herein for "Z" may be present between the ammo group and the nbose
• an amide linkage is used for attachment to the nbose
• m is zero and thus the conductive oligomer terminates in the amide bond
• the nitrogen of the ammo group of the ammo-modified nbose is the "D" atom of the conductive oligomer
• Structure 20 has the terminal bond fixed as an amide bond
• a heteroatom linkage is used, i e oxo, amine, sulfur, etc
• a preferred embodiment utilizes an amine linkage
• the nitrogen of the ammo-modified nbose may be the "D" atom of the conductive oligomer when the Structure 3 conductive oligomer is used
• Structures 21 and 22 depict nucleosides with the Structures 3 and 9 conductive oligomers, respectively, using the nitrogen as the heteroatom, athough other heteroatoms can be used
• both m and t are not zero
• a preferred Z here is a methylene group, or other aliphatic alkyl linkers One, two or three carbons in this position are particularly useful for synthetic reasons, see PCT US97/20014
• Suitable linkers include methylene and ethylene
• the conductive oligomer is covalently attached to the nucleic acid via the phosphate of the nbose-phosphate backbone (or analog) of a nucleic acid
• the attachment is direct, utilizes a linker or via an amide bond
• Structure 23 depicts a direct linkage
• Structure 24 depicts linkage via an amide bond (both utilize the Structure 3 conductive oligomer, although Structure 8 conductive oligomers are also possible)
• Structures 23 and 24 depict the conductive oligomer in the 3' position, although the 5' position is also possible
• both Structures 23 and 24 depict naturally occurring phosphodiester bonds, although as those in the art will appreciate, non-standard analogs of phosphodiester bonds may also be used
• Structure 24 depicts a preferred embodiment, wherein the terminal B-D bond is an amide bond, the terminal Y is not present, and Z is a linker, as defined herein
• the conductive oligomer is covalently attached to the nucleic acid via a transition metal ligand
• the conductive oligomer is covalently attached to a ligand which provides one or more of the coordination atoms for a transition metal
• the ligand to which the conductive oligomer is attached also has the nucleic acid attached, as is generally depicted below in Structure 25
• the con ⁇ uctive oligomer is attached to one ligand
• the nucleic acid is attached to another ligand, as is generally depicted below in Structure 26
• the conductive oligomer is covalently attached to the nucleic acid
• Both of these structures depict Structure 3 conductive oligomers, although other oligomers may be utilized Structures 25 and 26 depict two representative structures
• M is a metal atom, with transition metals being preferred Suitable transition metals for use in the invention include, but are not limited to, cadmium (Cd), copper (Cu), cobalt (Co), palladium (Pd), zinc (Zn), iron (Fe), ruthenium (Ru), rhodium (Rh), osmium (Os), rhenium (Re), platinium (Pt), scandium (Sc), titanium (Ti), Vanadium (V), chromium (Cr), manganese (Mn), nickel (Ni), Molybdenum (Mo), technetium (Tc), tungsten (W), and indium (Ir) That is, the first series of transition metals, the platinum metals (Ru, Rh, Pd, Os, Ir and Pt), along with Fe, Re, W, Mo and Tc, are preferred Particularly preferred are ruthenium, rhenium, osmium, platinium, cobalt
• L are the co-ligands, that provide the coordination atoms for the binding of the metal ion
• the number and nature of the co-hgands will depend on the coordination number of the metal ion
• Mono-, di- or polydentate co-ligands may be used at any position
• r may range from zero (when all coordination atoms are provided by the other two ligands) to four, when all the co-hgands are monodentate
• r will be from 0 to 8, depending on the coordination number of the metal ion and the choice of the other ligands
• the metal ion has a coordination number of six and both the ligand attached to the conductive oligomer and the ligand attached to the nucleic acid are at least bidentate, that is, r is preferably zero one (i e the remaining co-hgand is bidentate) or two (two monodentate co-ligands are used)
• Suitable ligands can be the same or different Suitable ligands fall into two categories ligands which use nitrogen, oxygen, sulfur, carbon or phosphorus atoms (depending on the metal ion) as the coordination atoms (generally referred to in the literature as sigma ( ⁇ ) donors) and organometalhc ligands such as metallocene ligands (generally referred to in the literature as pi ( ⁇ ) donors, and depicted herein as L Suitable nitrogen donating ligands are well known in the art and include, but are not limited to, NH 2 , NHR, NRR', pyridme, pyrazme, isonicotinamide, imidazole, bipyndine and substituted derivatives of bipyndine, terpy ⁇ dme and substituted derivatives, phenanthrolmes, particularly 1 ,10-phenanthrol ⁇ ne (abbreviated phen) and substituted derivatives of phen
• Suitable sigma donating ligands using carbon, oxygen, sulfur and phosphorus are known in the art
• suitable sigma carbon donors are found in Cotton and Wilkenson, Advanced Organic
• oxygen ligands include crown ethers, water and others known in the art Phosphmes and substituted phosphmes are also suitable, see page 38 of Cotton and Wilkenson
• oxygen, sulfur, phosphorus and nitrogen-donating ligands are attached in such a manner as to allow the heteroatoms to serve as coordination atoms
• organometallic ligands are used In addition to purely organic compounds for use as redox moieties, and various transition metal coordination complexes with ⁇ -bonded organic ligand with donor atoms as heterocyclic or exocyc c substituents, there is available a wide variety of transition metal organometallic compounds with ⁇ -bonded organic ligands (see Advanced Inorganic Chemistry, 5th Ed , Cotton & Wilkinson, John Wiley & Sons, 1988, chapter 26, Organometallics, A Concise Introduction, Elschenbroich et al , 2nd Ed , 1992, VCH, and Comprehensive Organometallic Chemistry II, A Review of the Literature 1982-1994, Abel et al Ed , Vol 7, chapters 7, 8, 10 & 11 , Pergamon Press, hereby expressly incorporated by reference)
• Such organometallic ligands include cyclic aromatic compounds such as the cyclopentadienide ion [C 5 H 5 (-1 )] and various organometall
• the ligand is generally attached via one of the carbon atoms of the organometallic ligand, although attachment may be via other atoms for heterocychc ligands
• Preferred organometallic ligands include metallocene ligands, including substituted derivatives and the metalloceneophanes (see page 1174 of Cotton and Wilkenson, supra)
• derivatives of metallocene ligands such as methylcyclopentadienyl, with multiple methyl groups being preferred, such as pentamethylcyclopentadienyl, can be used to increase the stability of the metallocene
• only one of the two metallocene ligands of a metallocene are derivatized
• any combination of ligands may be used Preferred combinations include a) all ligands are nitrogen donating ligands, b) all ligands are organometallic ligands, and c) the ligand at the terminus of the conductive oligomer is a metallocene ligand and the ligand provided by the nucleic acid is a nitrogen donating ligand, with the other ligands, if needed, are either nitrogen donating ligands or metallocene ligands, or a mixture
• These combinations are depicted in representative structures using the conductive oligomer of Structure 3 are depicted in Structures 27 (using phenanthrolme and ammo as representative ligands), 28 (using ferrocene as the metal-hgand combination) and 29 (using cyclopentadienyl and ammo as representative ligands)
• the ligands used in the invention show altered fluoroscent properties depending on the redox state of the chelated metal ion As described below, this thus serves as an additional mode of detection of electron transfer between the ETM and the electrode
• the ligand attached to the nucleic acid is an ammo group attached to the 2' or 3' position of a nbose of the nbose-phosphate backbone
• This ligand may contain a multiplicity of ammo groups so as to form a polydentate ligand which binds the metal ion
• Other preferred ligands include cyclopentadiene and phenanthrol e
• metal ions to connect the nucleic acids can serve as an internal control or calibration of the system, to evaluate the number of available nucleic acids on the surface
• metal ions are used to connect the nucleic acids to the conductive oligomers, it is generally desirable to have this metal ion complex have a different redox potential than that of the ETMs used in the rest of the system, as described below This is generally true so as to be able to distinguish the presence of the capture probe from the presence of the target sequence This may be useful for identification, calibration and/or quantification
• the amount of capture probe on an electrode may be compared to the amount of hybridized double stranded nucleic acid to quantify the amount of target sequence in a sample This is quite significant to serve as an internal control of the sensor or system This allows a measurement either prior to the addition of target or after, on the same molecules that will be used for detection, rather than rely on a similar but different control system
• the actual molecules that will be used for the detection can be used to be used for the detection.
• the capture probe nucleic acids are covalently attached to the electrode via an insulator
• insulators such as alkyl groups
• the attachment of nucleic acids to insulators such as alkyl groups is well known, and can be done to the base or the backbone, including the nbose or phosphate for backbones containing these moieties, or to alternate backbones for nucleic acid analogs
• different capture probes, or one capture probes with a multiplicity of different capture extender probes can be used
• the present invention provides electrodes comprising monolayers comprising conductive oligomers and capture probes, useful in nucleic acid detection systems
• the compositions further comprise a label probe
• the label probe is nucleic acid, generally single stranded, although as more fully outlined below, it may contain double-stranded portions
• the label probe comprises a first portion that is capable of hybridizing to a component of the assay complex, defined below, and a second portion that does not hybridize to a component of an assay complex and comprises at least one covalently attached ETM
• ETMs label probes with covalently attached ETMs
• ETMs electron donor moiety
• electron acceptor moiety or grammatical equivalents herein refers to molecules capable of electron transfer under certain conditions It is to be understood that electron donor and acceptor capabilities are relative, that is, a molecule which can lose an electron under certain experimental conditions will be able to accept an electron under different experimental conditions It is to be understood that the number of possible electron donor moieties and electron acceptor moieties is very large, and that one skilled in the art of electron transfer compounds will be able to utilize a number of compounds in the present invention
• Preferred ETMs include, but are not limited to, transition metal complexes, organic ETMs, and electrodes
• the ETMs are transition metal complexes
• Transition metals are those whose atoms have a partial or complete d shell of electrons Suitable transition metals for use in the invention are listed above
• transition metals are complexed with a variety of ligands, L, defined above, to form suitable transition metal complexes, as is well known in the art
• organic electron donors and acceptors may be covalently attached to the nucleic acid for use in the invention
• organic molecules include, but are not limited to, nboflavin, xanthene dyes, azine dyes, acndine orange, diazapyrenium dichlonde (DAP 2+ ), methylviologen, ethidium bromide, quinones such as N,N'- d ⁇ methylanthra(2,1 ,9-def6,5,10-d'eOd ⁇ soqu ⁇ nol ⁇ ne dichlonde (ADIQ + ), porphy ⁇ ns ([meso-tetrak ⁇ s(N- methyl-x-pyr ⁇ d ⁇ n ⁇ um)porphyr ⁇ n tetrachlo ⁇ de], varlamme blue B hydrochlo ⁇ de, Bmdschedler's green, 2,6-d ⁇ chloro ⁇ ndophenol, 2,6-d ⁇ bromophenohnd
• the electron donors and acceptors are redox proteins as are known in the art However, redox proteins in many embodiments are not preferred
• ETMs are metallocenes, with ferrocene being particularly preferred
• a plurality of ETMs are used as is shown in the examples, the use of multiple ETMs provides signal amplification and thus allows more sensitive detection limits As discussed below, while the use of multiple ETMs on nucleic acids that hybridize to complementary strands can cause decreases in T m s of the hybridization complexes depending on the number, site of attachment and spacing between the multiple ETMs, this is not a factor when the ETMs are on the recruitment linker, since this does not hybridize to a complementary sequence Accordingly, pluralities of ETMs are preferred, with at least about 2 ETMs per recruitment linker being preferred, and at least about 10 being particularly preferred, and at least about 20 to 50 being especially preferred In some instances, very large numbers of ETMs (100 to 1000) can be used
• the portion of the label probe (or target, in some embodiments) that comprises the ETMs can be nucleic acid, or it can be a non-nucleic acid linker that links the first hybndizable portion of the label probe to the ETMs That is, since this portion of the label probe is not required for hybridization, it need not be nucleic acid, although this may be done for ease of synthesis
• the recruitment linker may comprise double-stranded portions
• the recruitment linker is nucleic acid (including analogs), and attachment of the ETMs can be via (1 ) a base, (2) the backbone, including the nbose, the phosphate, or comparable structures in nucleic acid analogs, (3) nucleoside replacement,
• the recruitment linker is a nucleic acid, and comprises covalently attached ETMs
• the ETMs may be attached to nucleosides within the nucleic acid in a variety of positions
• Preferred embodiments include, but are not limited to, (1) attachment to the base of the nucleoside, (2) attachment of the ETM as a base replacement, (3) attachment to the backbone of the nucleic acid, including either to a nbose of the ⁇ bose-phosphate backbone or to a phosphate moiety, or to analogous structures in nucleic acid analogs, and (4) attachment via metallocene polymers, with the latter being preferred
• the recruitment linker is nucleic acid
• secondary label probes that have a first portion that will hybridize to a portion of the primary label probes and a second portion comprising a recruitment linker as is defined herein This is generally depicted in Figure 16H, this is similar to the use of an amplifier probe, except that both the primary and the secondary label probes comprise ETMs
• the ETM is attached to the base of a nucleoside as is generally outlined above for attachment of the conductive oligomer Attachment can be to an internal nucleoside or a terminal nucleoside
• the covalent attachment to the base will depend in part on the ETM chosen, but in general is similar to the attachment of conductive oligomers to bases, as outlined above Attachment may generally be done to any position of the base
• the ETM is a transition metal complex, and thus attachment of a suitable metal ligand to the base leads to the covalent attachment of the
• the C4 attached ammo group of cytosine, the C6 attached ammo group of adenine, or the C2 attached ammo group of guanme may be used as a transition metal ligand
• Structure 30 depicts a representative structure in the presence of the metal ion and any other necessary ligands, Structure 30 depicts undine, although as for all the structures herein, any other base may also be used Structure 30
• L a is a ligand, which may include nitrogen, oxygen, sulfur or phosphorus donating ligands or organometallic ligands such as metallocene ligands
• Suitable L a ligands include, but not limited to, phenanthroline, imidazole, bpy and terpy L r and M are as defined above
• a linker (“Z") may be included between the nucleoside and the ETM
• the linkage may be done using a linker, which may utilize an amide linkage (see generally Telser et al J Am Chem Soc 111 7221-7226 (1989), Telser et al , J Am Chem Soc 111 7226-7232 (1989), both of which are expressly incorporated by reference)
• a linker which may utilize an amide linkage (see generally Telser et al J Am Chem Soc 111 7221-7226 (1989), Telser et al , J Am Chem Soc 111 7226-7232 (1989), both of which are expressly incorporated by reference)
• L is a ligand as defined above, with L r and M as defined above as well
• L is ammo, phen, byp and terpy
• the ETM attached to a nucleoside is a metallocene, i e thel and L r of
• Structure 31 are both metallocene ligands, L m , as described above Structure 32 depicts a preferred embodiment wherein the metallocene is ferrocene, and the base is undine, although other bases may be used Structure 32
• Preferred metallocenes include ferrocene, cobaltocene and osmiumocene
• the ETM is attached to a nbose at any position of the nbose-phosphate backbone of the nucleic acid, i e either the 5' or 3' terminus or any internal nucleoside Ribose in this case can include ribose analogs
• nucleosides that are modified at either the 2' or 3' position of the ribose can be made, with nitrogen, oxygen, sulfur and phosphorus-containing modifications possible Ammo-modified and oxygen-modified ribose is preferred See generally PCT publication WO 95/15971 , incorporated herein by reference
• modification groups may be used as a transition metal ligand, or as a chemically functional moiety for attachment of other transition metal ligands and organometallic ligands, or organic electron donor moieties as will be appreciated by those in the art
• a linker such as depicted herein for "Z" may be used as well, or a linker such as depicted herein for "Z
• a metallocene serves as the ETM, and is attached via an amide bond as depicted below in Structure 33
• the examples outline the synthesis of a preferred compound when the metallocene is ferrocene Structure 33
• Z is a linker, as defined herein, with 1-16 atoms being preferred, and 2-4 atoms being particularly preferred, and t is either one or zero
• oxo linkages are used, as is generally depicted in Structure 35
• an ETM is attached to a phosphate at any position of the nbose-phosphate backbone of the nucleic acid
• phosphodiester bond analogs such as phosphoramide or phosphoramidite linkages may be incorporated into a nucleic acid, where the heteroatom (i e nitrogen) serves as a transition metal ligand (see PCT publication WO 95/15971 , incorporated by reference)
• the conductive oligomers depicted in Structures 23 and 24 may be replaced by El Ms
• the composition has the structure shown in Structure 36 Structure 36
• alkyl-based linkers can be used to create multiple branching structures comprising one or more ETMs at the terminus of each branch (although internal ETMs can be used as well) Generally, this is done by creating branch points containing multiple hydroxy groups, which optionally can then be used to add additional branch points The terminal hydroxy groups can then be used in phosphoramidite reactions to add ETMs, as is generally done below for the nucleoside replacement and metallocene polymer reactions
• the branch point can be an internal one or a terminal one, and can be a chemical branch point or a nucleoside branch point
• an ETM such as a metallocene is used as a "nucleoside replacement", serving as an ETM
• the distance between the two cyclopentadiene rings of ferrocene is similar to the orthongonal distance between two bases in a double stranded nucleic acid
• Other metallocenes in addition to ferrocene may be used, for example, air stable metallocenes such as those containing cobalt or ruthenium
• metallocene moieties may be incorporated into the backbone of a nucleic acid, as is generally depicted in Structure 37 (nucleic acid with a nbose-phosphate backbone) and Structure 38 (peptide nucleic acid backbone) Structures 37 and 38 depict ferrocene, although as will be appreciated by those in the art, other metallocenes may be used as well
• air stable metallocenes are preferred, including metallocenes utilizing ruthenium and cobalt as the metal
• Z is a linker as defined above, with generally short, alkyl groups, including heteroatoms such as oxygen being preferred Generally, what is important is the length of the linker, such that minimal perturbations of a double stranded nucleic acid is effected, as is more fully described below Thus, methylene, ethylene, ethylene giycols, propylene and butylene are all preferred, with ethylene and ethylene glycol being particularly preferred.
• each Z linker may be the same or different Structure 37 depicts a nbose-phosphate backbone, although as will be appreciated by those in the art, nucleic acid analogs may also be used, including ribose analogs and phosphate bond analogs
• ETMs in addition to metallocenes, as nucleoside replacements or in polymer embodiments, described below
• the ETM is a transition metal complex other than a metallocene, comprising one, two or three (or more) ligands
• the ligands can be functiona zed as depicted for the ferrocene to allow the addition of phosphoramidite groups
• Particularly preferred in this embodiment are complexes comprising at least two ring (for example, aryl and substituted aryl) ligands, where each of the ligands comprises functional groups for attachment via phosphoramidite chemistry
• this type of reaction creating polymers of ETMs either as a portion of the backbone of the nucleic acid or as "side groups" of the nucleic acids, to allow amplification of the signals generated herein,
• nucleic acid analogs are made, that is, the invention piovides nucieic acids having a backbone comprising at least one metallocene
• a metallocene such as ferrocene (or other ETM)
• the invention piovides nucieic acids having a backbone comprising at least one metallocene
• nucleic acids having metallocenes attached to the backbone i e via a ribose, a phosphate, etc
• two nucleic acids each made up of a traditional nucleic acid or analog may be covalently attached to each other via a metallocene
• a metallocene derivative or substituted metallocene is provided, wherein each of the two aromatic rings of the metallocene has a nucleic acid substitutent group
• it is possible to incorporate more than one metallocene into the backbone either with nucleotides in between and/or with adjacent
• nucleic acid substitutent groups it is also desirable in some instances to add additional substituent groups to one or both of the aromatic rings of the metallocene (or ETM)
• additional substituent groups to one or both of the aromatic rings of the metallocene (or ETM)
• these nucleoside replacements are generally part of probe sequences to be hybridized with a substantially complementary nucleic acid, for example a target sequence or another probe sequence
• substitutent groups to the metallocene rings to facilitate hydrogen bonding to the base or bases on the opposite strand
• substitutent groups include, but are not limited to, amide groups, amine groups, carboxy c acids, and alcohols, including substituted alcohols
• these substitutent groups can be attached via linkers as well, although in general this is not preferred
• substituent groups on an ETM may be added to alter the redox properties of the ETM
• substituent groups on an ETM may be added to alter the redox properties of the ETM
• substituent groups on the metallocene may allow two different
• the intermediate components are also provided.
• the invention provides phosphoramidite metallocenes, as generally depicted in Structure 39
• PG is a protecting group, generally suitable for use in nucleic acid synthesis, with DMT, MMT and TMT all being preferred
• the aromatic rings can either be the rings of the metallocene, or aromatic rings of ligands for transition metal complexes or other organic ETMs
• the aromatic rings may be the same or different, and may be substituted as discussed herein
• Structure 40 depicts the ferrocene derivative
• Structure 41 depicts the ferrocene peptide nucleic acid (PNA) monomer, that can be added to PNA synthesis as is known in the art and depicted within the Figures and Examples
• the PG protecting group is suitable for use in peptide nucleic acid synthesis, with MMT, boc and Fmoc being preferred
• ETM or metallocene polymers which are added to the nucleic acids, rather than as backbone replacements, as is more fully described below
• the ETMs are attached as polymers, for example as metallocene polymers, in a "branched" configuration similar to the "branched DNA” embodiments herein and as outlined in U S Patent No 5,124,246, using modified functionahzed nucleotides
• the general idea is as follows A modified phosphoramidite nucleotide is generated that can ultimately contain a free hydroxy group that can be used in the attachment of phosphoramidite ETMs such as metallocenes
• This free hydroxy group could be on the base or the backbone, such as the ribose or the phosphate (although as will be appreciated by those in the art, nucleic acid analogs containing other structures can also be used)
• the modified nucleotide is incorporated into a nucleic acid, and any hydroxy protecting groups are removed, thus leaving the free hydroxyl
• ETMs such as metallocene ETMs
• Additional phosphoramidite ETMs such as metallocenes can be added, to form "ETM polymers", including "metallocene polymers” as depicted herein, particularly for ferrocene
• it is desirable to increase the solubility of the polymers by adding a "capping" group to the terminal ETM in the polymer, for example a final phosphate group to the metallocene as is generally depicted in Figure 12
• a "capping" group to the terminal ETM in the polymer, for example a final phosphate group to the metallocene as is generally
• a preferred embodiment of this general idea is outlined in the Figures
• the 2' position of a ribose of a phosphoramidite nucleotide is first functionahzed to contain a protected hydroxy group, in this case via an oxo-hnkage, although any number of linkers can be used, as is generally described herein for Z linkers
• the protected modified nucleotide is then incorporated via standard phosphoramidite chemistry into a growing nucleic acid
• the protecting group is removed, and the free hydroxy group is used, again using standard phosphoramidite chemistry to add a phosphoramidite metallocene such as ferrocene
• a similar reaction is possible for nucleic acid analogs
• nucleic acid analogs For example, using peptide nucleic acids and the metallocene monomer shown in Structure 41, peptide nucleic acid structures containing metallocene polymers could be generated
• the present invention provides recruitment linkers of nucleic acids comprising "branches" of metallocene polymers as is generally depicted in Figures 12 and 13 Preferred embodiments also utilize metallocene polymers from one to about 50 metallocenes >n length, with from about 5 to about 20 hemg preferred and from about 5 to about 10 being especially preferred
• the recruitment linker is nucleic acid
• any combination of ETM attachments may be done
• the recruitment linker is not nucleic acid, and instead may be any sort of linker or polymer
• any linker or polymer that can be modified to contain ETMs can be used
• the polymers or linkers should be reasonably soluble and contain suitable functional groups for the addition of ETMs
• a "recruitment polymer” comprises at least two or three subunits, which are covalently attached At least some portion of the monomenc subunits contain functional groups for the covalent attachment of ETMs
• coupling moieties are used to covalently link the subunits with the ETMs
• Preferred functional groups for attachment are ammo groups, carboxy groups, oxo groups and thiol groups, with ammo groups being particularly preferred
• Suitable linkers include, but are not limited to, alkyl linkers (including heteroalkyl (including (poly)ethylene glycol-type structures), substituted alkyl, aryalkyl linkers, etc As above for the polymers, the linkers will comprise one or more functional groups for the attachment of ETMs, which will be done as will be appreciated by those in the art, for example through the use homo-or hetero- bifunctional linkers as are well known (see 1994 Pierce Chemical Company catalog, technical section on cross-linkers, pages 155-200, incorporated herein by reference)
• Suitable recruitment polymers include, but are not limited to, functionahzed styrenes, such as ammo styrene, functionahzed dextrans, and polyamino acids
• Preferred polymers are polyamino acids (both poly-D-amino acids and poly-L-ammo acids), such as polylysme, and polymers containing lysine and other ammo acids being particularly preferred
• Other suitable polyamino acids are polyglutamic acid, polyaspartic acid, co-polymers of lysine and glutamic or aspartic acid, co-polymers of lysine with alanine, tyrosine, phenylalanine, serine, tryptophan, and/or pro ne
• the recruitment linker comprises a metallocene polymer, as is described above
• the attachment of the recruitment linkers to the first portion of the label probe will depend on the composition of the recruitment linker, as will be appreciated by those in the art
• the recruitment linker is nucleic acid
• it is generally formed during the synthesis of the first portion of the label probe, with incorporation of nucleosides containing ETMs as required
• the first portion of the label probe and the recruitment linker may be made separately, and then attached
• there may be an overlapping section of complementarity, forming a section of double stranded nucleic acid that can then be chemically cross nked, for example by using psoralen as is known in the art
• attachment of the linker/polymer of the recruitment linker will be done generally using standard chemical techniques, such as will be appreciated by those in the art
• attachment can be similar to the attachment of insulators to nucleic acids
• recruitment linkers that are mixtures of nucleic acids and non-nucleic acids, either in a linear form (i e nucleic acid segments linked together with alkyl linkers) or in branched forms (nucleic acids with alkyl "branches" that may contain ETMs and may be additionally branched)
• tnphosphate nucleotides comprising the ETMs of the invention to a growing nucleic acid, for example during a polymerase chain reaction (PCR)
• PCR polymerase chain reaction
• preferred attachments in this embodiment are to the base or ribose of the nucleotide
• PCR amplification of a target sequence will result in target sequences comprising ETMs, generally randomly incorporated into the sequence
• the system of the invention can then be configured to allow detection using these ETMs, as is generally depicted in Figures 16A, 16B and 16D
• compositions utilizing electrodes comprising monolayers of conductive oligomers and capture probes, and target sequences that comprises a first portion that is capable of hybridizing to a component of an assay complex, and a second portion that does not hybridize to a component of an assay complex and comprises at least one covalently attached electron transfer moiety
• methods utilizing these compositioi is also provided
• ETMs may be added to non-recruitment linkers as well
• ETMs may be added to sections of label probes that do hybridize to components of the assay complex, for example the first portion, or to the target sequence as outlined above
• These ETMs may be used for electron transfer detection in some embodiments, or they may not, depending on the location and system
• the target sequence containing randomly incorporated ETMs is hybridized directly to the capture probe, as is depicted in Figure 16A
• there may be ETMs in the portion hybridizing to the capture probe If the capture probe is attached to the electrode using a conductive oligomer, these ETMs can be used to detect electron transfer as has been previously described Alternatively, these ETMs may not be specifically detected
• the recruitment linker when the recruitment linker is nucleic acid, it may be desirable in some instances to have some or all of the recruitment linker be double stranded
• the first recruitment linker comprises the covalently attached ETMs
• the second recruitment linker contains the ETMs, and the first recruitment linker does not, and the ETMs are recruited to the surface by hybridization of the second recruitment linker to the first
• both the first and second recruitment linkers comprise ETMs It should be noted, as discussed above, that nucleic acids comprising a large number of ETMs may not hybridize as well, i e the T m may be decreased, depending on the site of attachment and the characteristics of the ETM Thus, in general, when multiple ETMs are used on hybridizing strands, generally there are less than about 5, with less than about 3 being preferred, or alternatively the ETM
• non-covalently attached ETMs may be used in one embodiment, the ETM is a hybridization indicator Hybridization indicators serve as an ETM that will preferentially associate with double stranded nucleic acid is added, usually reversibly, similar to the method of Millan et al , Anal Chem 65 2317-2323 (1993), Millan et al , Anal Chem 662943-2948 (1994), both of which are hereby expressly incorporated by reference
• increases in the local concentration of ETMs, due to the association of the ETM hybridization indicator with double stranded nucleic acid at the surface can be monitored using the monolayers comprising the conductive oligomers
• Hybridization indicators include mtercalators and minor and/or major groove binding moieties
• mtercalators may be used, since intercalation generally only occurs in the presence of double stranded nucleic a d, only in the presence of double stranded nucleic acid will the ETMs concentrate Intercalating transition metal complex ETMs are.known in the art
• major or minor groove binding moieties such as methylene blue
• the systems of the invention may utilize non-covalently attached ETMs, as is generally described in Napier et al , Bioconj Chem 8 906 (1997), hereby expressly incorporated by reference
• changes in the redox state of certain molecules as a result of the presence of DNA i e guanine oxidation by ruthenium complexes
• SAMs comprising conductive oligomers
• the present invention provides electrodes comprising monolayers comprising conductive oligomers, generally including capture probes, and either target sequences or label probes comprising recruitment linkers containing ETMs
• the compositions of the invention are used to detect target sequences in a sample
• target sequence or grammatical equivalents herein means a nucleic acid sequence on a single strand of nucleic acid
• the target sequence may be a portion of a gene, a regulatory sequence, genomic DNA, cDNA, RNA including mRNA and rRNA, or others It may be any length, with the understanding that longer sequences are more specific
• the complementary target sequence may take many forms For example, it may be contained within a larger nucleic acid sequence, i e all or part of a gene or mRNA, a restriction fragment of a plasmid or genomic DNA, among others
• probes are made to hybridize to target sequences to determine the presence or absence of the target sequence
• the target sequence is prepared using known techniques
• the sample may be treated to lyse the cells, using known lysis buffers, electroporation, etc , with purification and/or amplification such as PCR occunng as needed, as will be appreciated by those in the art
• Probes of the present invention are designed to be complementary to a target sequence (either the target sequence of the sample or to other probe sequences, as is described below), such that hybridization of the target sequence and the probes of the present invention occurs
• this complementarity need not be perfect, there may be any number of base pair mismatches which will interfere with hybridization between the target sequence and the single stranded nucleic acids of the present invention
• the sequence is not a complementary target sequence
• substantially complementary herein is meant that the probes are sufficiently complementary to the target sequences to hybridize under normal reaction conditions
• nucleic acid compositions of the invention are useful as oligonucleotide probes
• the length of the probe will vary with the length of the target sequence and the hybridization and wash conditions
• oligonucleotide probes range from about 8 to about 50 nucleotides, with from about 10 to about 30 being preferred and from about 12 to about 25 being especially preferred
• very long probes may be used, e g 50 to 200-300 nucleotides in length
• nucleosides may be replaced with nucleic acids
• hybridization conditions may be used in the present invention, including high, moderate and low stringency conditions, see for example Maniatis et al , Molecular Cloning A Laboratory
• hybridization conditions may also vary when a non-ionic backbone, i e PNA is used, as is known in the art
• cross-linking agents may be added after target binding to cross-link, i e covalently attach, the two strands of the hybridization complex
• the systems of the invention may take on a large number of different configurations, as is generally depicted in the Figures
• there are three types of systems that can be used (1) systems in which the target sequence itself is labeled with ETMs (see Figures 16A, 16B and 16D), (2) systems in which label probes directly hybridize to the target sequences (see Figures 16C and 16H), and (3) systems in which label probes are indirectly hybridized to the target sequences, for example through the use of amplifier probes (see Figures 16E, 16F and 16G)
• the target sequence be immobilized on the electrode surface This is preferably done using capture probes and optionally one or more capture extender probes
• capture extender probes may be used, that allow a "universal" surface, s e a surface containing a single type of capture probe that can be used to detect any target sequence
• capture extender probes are generally depicted in Figure 15, and have a first portion that will hybridize to all or part of the capture probe, and a second portion that will hybridize to a portion of the target sequence This then allows the generation of customized soluble probes, which as will be appreciated by those in the art is generally simpler and less costly
• two capture extender probes may be used This has generally been done to stabilize assay complexes (for example when the target sequence is large, or when
• the nucleic acids are added after the formation of the SAM ((4) above) This may be done in a variety of ways, as will be appreciated by those in the art
• conductive oligomers with terminal functional groups are made, with preferred embodiments utilizing activated carboxylates and isothiocyanates, that will react with primary amines that are put onto the nucleic acid, as is generally depicted in Figure 6 using an activated carboxylate
• activated carboxylates and isothiocyanates that will react with primary amines that are put onto the nucleic acid, as is generally depicted in Figure 6 using an activated carboxylate
• the primary aromatic amines and secondary and tertiary amines of the bases should not react, thus allowing site specific addition of nucleic acids to the surface This allows the spotting of probes (either capture or detection probes, or both) using known methods (ink jet, spotting, etc ) onto the surface
• binding partner pairs can be utilized, i e one binding partner is attached to the terminus of the conductive oligomer, and the other to the end of the nucleic acid This may also be done without using a nucleic acid capture probe, that is, one binding partner serves as the capture probe and the other is attached to either the target sequence or a capture extender probe
• binding partner pairs include, but are not limited to, hapten pairs such as biotin/streptavidm, antigens/antibodies, NTA/histidme tags, etc. In general, smaller binding partners are preferred, such that the electrons can pass from the nucleic acid into the conductive oligomer to allow detection
• the binding partner when the target sequence itself is modified to contain a binding partner, the binding partner is attached via a modified nucleotide that can be enzymatically attached to the target sequence, for example during a PCR target amplification step Alternatively, the binding partner should be easily attached to the target sequence
• a capture extender probe may be utilized that has a nucleic acid portion for hybridization to the target as well as a binding partner (for example, the capture extender probe may comprise a non-nucleic acid portion such as an alkyl linker that is used to attach a binding partner)
• the capture extender probe may comprise a non-nucleic acid portion such as an alkyl linker that is used to attach a binding partner
• the target is not bound to the electrode surface using capture probes
• what is important, as for all the assays herein is that excess label probes be removed prior to detection and that the assay complex (the recruitment linker) be in proximity to the surface
• the assay complex may be present on beads that are added to the electrode comprising the monolayer
• the recruitment linkers comprising the ETMs may be placed in proximity to the conductive oligomer surface using techniques well known in the art, including gravity settling of the beads on the surface, electrostatic or magnetic interactions between bead components and the surface, using binding partner attachment as outlined above Alternatively, after the removal of excess reagents such as excess label probes, the assay complex may be driven down to the surface, for example by pulsing the system with a voltage sufficient to drive the assay complex to the surface
• preferred embodiments utilize assay complexes attached via nucleic acid capture probes
• the target sequence itself contains the ETMs
• this may be done using target sequences that have ETMs incorporated at any number of positions, as outlined above Representative examples are depicted in Figures 16A, 16B and 16D
• the 3'-5' orientation of the probes and targets is chosen to get the ETM-contaming structures (i e recruitment linkers or target sequences) as close to the surface of the monolayer as possible, and in the correct orientation This may be done using attachment via insulators or conductive oligomers as is generally shown in the Figures
• multiple capture probes can be utilized, either in a configuration such as depicted in Figure 16D, wherein the 5'-3' orientation of the capture probes is different, or where "loops" of target form when multiples of capture probes are used
• the label probes directly hybridize to the target sequences, as is generally depicted in Figure 16C
• the target sequence is preferably, but not required to be, immobilized on the surface using capture probes, including capture extender probes
• Label probes are then used to bring the ETMs into proximity of the surface of the monolayer comprising conductive oligomers
• multiple label probes are used, that is, label probes are designed such that the portion that hybridizes to the target sequence (labeled 141 in the figures) can be different for a number of different label probes, such that amplification of the signal occurs, since multiple label probes can bind for every target sequence
• n is an integer of at least one Depending on the sensitivity desired, the length of the target sequence, the number of ETMs per label probe, etc , preferred ranges of n are from 1 to 50, with from about 1 to about 20 being particularly preferred, and from about 2 to about 5 being especially preferred.
• n is an integer of at least one Depending on the sensitivity desired, the length
• the configuration of the system and the label probes are designed to recruit the ETMs as close as possible to the monolayer surface
• the label probes are hybridized to the target sequence indirectly That is, the present invention finds use in novel combinations of signal amplification technologies and electron transfer detection on electrodes, which may be particularly useful in sandwich hybridization assays, as generally depicted in Figure 16
• the amplifier probes of the invention are bound to the target sequence in a sample either directly or indirectly Since the amplifier probes preferably contain a relatively large number of amplification sequences that are available for binding of label probes, the detectable signal is significantly increased, and allows the detection limits of the target to be significantly improved
• These label and amplifier probes, and the detection methods described herein may be used in essentially any known nucleic acid hybridization formats, such as those in which the target is bound directly to a solid phase or in sandwich hybridization assays in which the target is bound to one or more nucleic acids that are in turn bound to the solid phase
• the amplifier probe contains a multiplicity of amplification sequences, although in some embodiments, as described below, the amplifier probe may contain only a single amplification sequence
• the amplifier probe may take on a number of different forms, either a branched conformation, a dendnmer conformation, or a linear "string" of amplification sequences
• the present invention provides assay complexes comprising at least one amplifier probe
• amplifier probe or “nucleic acid multimer” or “amplification multimer” or grammatical equivalents herein is meant a nucleic acid probe that is used to facilitate signal amplification
• Amplifier probes comprise at least a first single-stranded nucleic acid probe sequence, as defined below, and at least one single-stranded nucleic acid amplification sequence, with a multiplicity of amplification sequences being preferred
• Amplifier probes comprise a first probe sequence that is used, either directly or indirectly, to hybridize to the target sequence That is, the amplifier probe itself may have a first probe sequence that is substantially complementary to the target sequence (e g Figure 16E), or it has a first probe sequence that is substantially complementary to a portion of an additional probe, in this case called a label extender probe, that has a first portion that is substantially complementary to the target sequence (e g
• the first probe sequence of the amplifier probe is substantially complementary to the target sequence, as is generally depicted in Figure 16E
• the first probe sequence is of a length sufficient to give specificity and stability
• the probe sequences of the invention that are designed to hybridize to another nucleic acid are at least about 5 nucleosides long, with at least about 10 being preferred and at least about 15 being especially preferred
• the amplifier probes may form hairpin stem-loop structures in the absence of their target
• the length of the stem double-stranded sequence will be selected such that the hairpin structure is not favored in the presence of target
• the use of these type of probes, in the systems of the invention or in any nucleic acid detection systems, can result in a significant decrease in non-specific binding and thus an increase in the signal to noise ratio
• these hairpin structures comprise four components
• the first component is a target binding sequence, i e a region complementary to the target (which may be the sample target sequence or another probe sequence to which binding is desired), that is about 10 nucleosides long, with about 15 being preferred
• the second component is a loop sequence, that can facilitate the formation of nucleic acid loops Particularly preferred in this regard are repeats of GTC, which has been identified in Fragile X Syndrome as forming turns (When PNA analogs are used, turns comprising prohne residues may be preferred) Generally, from three to five repeats are used, with four to five being preferred
• the third component is a self-complementary region, which has a first portion that is complementary to a portion of the target sequence region and a second portion that comprises a first portion of the label probe binding sequence
• the fourth component is substantially complementary to a label probe (or other probe, as the case may be)
• the fourth component further comprises a "sticky end", that is, a portion that does not hybridize to any
• the amplifier probe does not hybridize to the sample target sequence directly, but instead hybridizes to a first portion of a label extender probe, as is generally depicted in Figure 16F
• a label extender probe As is generally depicted in Figure 16F
• the first probe sequence of the amplifier probe is substantially complementary to a first portion or domain of a first label extender single-stranded nucleic acid probe
• the label extender probe also contains a second portion or domain that is substantially complementary to a portion of the target sequence Both of these portions are preferably at least about 10 to about 50 nucleotides in length, with a range of about 15 to about 30 being preferred
• the terms "first" and “second” are not meant to confer an orientation of the sequences with respect to the 5'-3' orientation of the target or probe sequences For example, assuming
• more than one label extender probe-amplifier probe pair may be used, tht is, n is more than 1 That is, a plurality of label extender probes may be used, each with a portion that is substantially complementary to a different portion of the target sequence, this can serve as another level of amplification
• a preferred embodiment utilizes pools of at least two label extender probes, with the upper limit being set by the length of the target sequence
• more than one label extender probe is used with a single amplifier probe to reduce non-specific binding, as is depicted in Figure 16G and generally outlined in U S Patent No 5,681 ,697, incorporated by reference herein
• a first portion of the first label extender probe hybridizes to a first portion of the target sequence
• the second portion of the first label extender probe hybridizes to a first probe sequence of the amplifier probe
• a first portion of the second label extender probe hybridizes to a second portion of the target sequence
• the second portion of the second label extender probe hybridizes to a second probe sequence of the amplifier probe
• the label extender probes may interact with a preamplifier probe, described below, rather than the amplifier probe directly
• a preferred embodiment utilizes several different amplifier probes, each with first probe sequences that will hybridize to a different portion of the label extender probe
• the different amplifier probes contain different amplification sequences, although this is generally not preferred
• the amplifier probe also comprises at least one amplification sequence
• amplification sequence or “amplification segment” or grammatical equivalents herein is meant a sequence that is used, either directly or indirectly, to bind to a first portion of a label probe as is more fully described below
• the amplifier probe comprises a multiplicity of amplification sequences, with from about 3 to about 1000 being preferred, from about 10 to about 100 being particularly preferred, and about 50 being especially preferred In some cases, for example when linear amplifier probes are used, from 1 to about 20 is preferred with from about 5 to about 10 being particularly preferred
• the amplification sequences may be linked to each other in a variety of ways, as will be appreciated by those in the art They may be covalently linked directly to each other, or to intervening sequences or chemical moieties, through nucleic acid linkages such as phosphodiester bonds, PNA bonds, etc , or through interposed linking agents such ammo acid, carbohydrate or polyol bridges, or through other cross-linking agents or binding partners
• the s ⁇ te(s) of linkage may be at the ends of a segment, and/or at one or more internal nucleotides in the strand
• the amplification sequences are attached via nucleic acid linkages
• branched amplifier probes are used, as are generally described in U S Patent No 5,124,246, hereby incorporated by reference Branched amplifier probes may take on "fork-like” or “comb-like” conformations "Fork-like" branched amplifier probes generally have three or more oligonucleotide segments emanating from a point of origin to form a branched structure The point of origin may be another nucleotide segment or a multifunctional molecule to whcih at least three segments can be covalently or tightly bound "Comb- ke" branched amplifier probes have a linear backbone with a multiplicity of sidechain ohgonucleotides extending from theijackbone.
• the pendant segments will normally depend from a modified nucleotide or other organic moiety having the appropriate functional groups for attachment of ohgonucleotides
• a large number of amplification sequences are available for binding, either directly or indirectly, to detection probes
• these structures are made as is known in the art, using modified multifunctional nucleotides, as is described in U S Patent Nos 5,635,352 and 5,124,246, among others
• dendnmer amplifier probes are used, as are generally described in U S Patent No 5,175,270, hereby expressly incorporated by reference Dendrime ⁇ c amplifier probes have amplification sequences that are attached via hybridization, and thus have portions of double-stranded nucleic acid as a component of their structure The outer surface of the dendnmer amplifier probe has a multiplicity of amplification sequences
• linear amplifier probes are used, that have individual amplification sequences linked end-to-end either directly or with short intervening sequences to form a polymer
• linear amplification probes may form hairpin stem-loop structures, as is depicted in Figure 14
• the linear amplifier probe has a single amplification sequence This may be useful when cycles of hyb ⁇ dization/disassociation occurs, forming a pool of amplifier probe that was hybridized to the target and then removed to allow more probes to bind, or when large numbers of ETMs are used for each label probe
• linear amplifier probes comprise a multiplicity of amplification sequences
• the amplifier probe may be totally linear, totally branched, totally dend ⁇ meric, or any combination thereof
• the amplification sequences of the amplifier probe are used, either directly or indirectly, to bind to a label probe to allow detection
• the amplification sequences of the amplifier probe are substantially complementary to a first portion of a label probe
• amplifier extender probes are used, that have a first portion that binds to the amplification sequence and a second portion that binds to the first portion of the label probe
• compositions of the invention may include "preamplifier” molecules, which serves a bridging moiety between the label extender molecules and the amplifier probes In this way, more amplifier and thus more ETMs are ultimately bound to the detection probes
• Preamplifier molecules may be either linear or branched, and typically contain in the range of about 30-3000 nucleotides
• reaction may include a variety of other reagents may be included in the assays These include reagents like salts, buffers, neutral proteins, e g albumin, detergents, etc which may be used to facilitate optimal hybridization and detection, and/or reduce non-specific or background interactions Also reagents that otherwise improve the efficiency of the assay, such as protease inhibitors, nuclease inhibitors, anti-microbial agents, etc , may be used, depending on the sample preparation methods and purity of the target
• the methods are as follows
• the target is initially immobilized or attached to the electrode
• this is done by forming a hybridization complex between a capture probe and a portion of the target sequence
• a preferred embodiment utilizes capture extender probes, in this embodiment, a hybridization complex is formed between a portion of the target sequence and a first portion of a capture extender probe, and an additional hybridization complex between a second portion of the capture extender probe and a portion of the capture probe
• Additional preferred embodiments utilize additional capture probes, thus forming a hybridization complex between a portion of the target sequence and a first portion of a second capture extender probe, and an additional hybridization complex between a second portion of the second capture extender probe and a second portion of the capture probe
• the attachment of the target sequence to the electrode is done simultaneously with the other reactions
• the method proceeds with the introduction of amplifier probes, if utilized
• the amplifier probe comprises a first probe sequence that is substantially complementary to a portion of the target sequence, and at least one amplification sequence
• the first probe sequence of the amplifier probe is hybridized to the target sequence, and any unhyb ⁇ dized amplifier probe is removed.
• the target sequence is immobilized on a surface such as an electrode
• the removal of excess reagents generally is done via one or more washing steps, as will be appreciated by those in the art
• the target may be immobilized on any solid support
• the removal of excess reagents such as the probes ot the invention may be done by adding beads (i e solid support particles) that contain complementary sequences to the probes, such that the excess probes bind to the beads
• the beads can then be removed, for example by cent ⁇ fugation, filtration, the application of magnetic or electrostatic fields, etc
• the reaction mixture is then subjected to conditions (temperature, high salt, changes in pH, etc ) under which the amplifier probe disassociates from the target sequence, and the amplifier probe is collected
• the amplifier probe may then be added to an electrode comprising capture probes for the amplifier probes, label probes added, and detection is achieved
• a larger pool of probe is generated by adding more amplifier probe to the target sequence and the hybndization/disassociation reactions are repeated, to generate a larger pool of amplifier probe. This pool of amplifier probe is then added to an electrode comprising amplifier capture probes, label probes added, and detection proceeds
• the target sequence be immobilized on a solid support, including an electrode, using the methods described herein, although as will be appreciated by those in the art, alternate solid support attachment technologies may be used, such as attachment to glass, polymers, etc It is possible to do the reaction on one solid support and then add the pooled amplifier probe to an electrode for detection
• the amplifier probe comprises a multiplicity of amplification sequences
• the first probe sequence of the amplifier probe is hybridized to the target sequence, and any unhybndized amplifier probe is removed
• preferred embodiments utilize immobilized target sequences, wherein the target sequences are immobilized by hybridization with capture probes that are attached to the electrode, or hybridization to capture extender probes that in turn hybridize with immobilized capture probes as is described herein
• the capture probes and the detection probes are immobilized on the electrode, generally at the same "address"
• the first probe sequence of the amplifier probe is hybridized to a first portion of at least one label extender probe, and a second portion of the label extender probe is hybridized to a portion of the target sequence
• Other preferred embodiments utilize more than one label extender probe
• the amplification sequences of the amplifier probe are used directly for detection, by hybridizing at least one label probe sequence
• the invention thus provides assay complexes that minimally comprise a target sequence and a label probe "Assay complex" herein is meant the collection of hybridization complexes comprising nucleic acids, including probes and targets, that contains at least one ETM and thus allows detection
• the composition of the assay complex depends on the use of the different probe component outlined herein
• the assay complex comprises the capture probe and the target sequence
• the assay complexes may also include label probes, capture extender probes, label extender probes, and amplifier probes, as outlined herein, depending on the configuration used
• the assays are generally run under stringency conditions which allows formation of the label probe hybridization complex only in the presence of target Stringency can be controlled by altering a step parameter that is a thermodynamic variable, including, but not limited to, temperature, formamide concentration, salt concentration, chaotropic salt concentration pH, organic solvent concentration, etc
• a preferred method is as follows Single-stranded target sequence is incubated under hybridization conditions with the capture extender probes and the label extender probes A preferred embodiment does this reaction in the presence of the electrode with immobilized capture probes, although this may also be done in two steps, with the initial incubation and the subsequent addition to the electrode Excess reagents are washed off, and amplifier probes are then added If preamplifier probes are used, they may be added either prior to the amplifier probes or simultaneously with the amplifier probes Excess reagents are washed off, and label probes are then added Excess reagents are washed off, and detection proceeds as outlined below
• a number of capture probes that are each substantially complementary to a different portion of the target sequence are used
• the system when amplifier probes are used, the system is generally configured such that upon label probe binding, the recruitment linkers comprising the ETMs are placed in proximity to the monolayer surface
• the length of the linkers from the nucleic acid point of attachment to the ETMs may vary, particularly with the length of the capture probe when capture extender probes are used That is, longer capture probes, with capture extenders, can result in the target sequences being "held” further away from the surface than for shorter capture probes Adding extra linking sequences between the probe nucleic acid and the ETMs can result in the ETMs being spatially closer to the surface, giving better results
• nucleic acids utilized in the invention may also be ligated together prior to detection, if applicable, by using standard molecular biology techniques such as the use of a gase Similarly, if desirable for stability, cross-linking agents may be added to hold the structures stable
• compositions of the invention are generally synthesized as outlined below, generally utilizing techniques well known in the art As will be appreciated by those in the art, many of the techniques outlined below are directed to nucleic acids containing a nbose-phosphate backbone However, as outlined above, many alternate nucleic acid analogs may be utilized, some of which may not contain either ribose or phosphate in the backbone In these embodiments, for attachment at positions other than the base, attachment is done as will be appreciated by those in the art, depending on the backbone Thus, for example, attachment can be made at the carbon atoms of the PNA backbone, as is described below, or at either terminus of the PNA
• compositions may be made in several ways
• a preferred method first synthesizes a conductive oligomer attached to a nucleoside, with addition of additional nucleosides to form the capture probe followed by attachment to the electrode
• the whole capture probe may be made and then the completed conductive oligomer added, followed by attachment to the electrode
• a monolayer of conductive oligomer (some of which have functional groups for attachment of capture probes) is attached to the electrode first, followed by attachment of the capture probe
• the latter two methods may be preferred when conductive oligomers are used which are not stable in the solvents and under the conditions used in traditional nucleic acid synthesis
• compositions of the invention are made by first forming the conductive oligomer covalently attached to the nucleoside, followed by the addition of additional nucleosides to form a capture probe nucleic acid, with the last step comprising the addition of the conductive oligomer to the electrode
• the attachment of the conductive oligomer to the nucleoside may be done in several ways In a preferred embodiment, all or part of the conductive oligomer is synthesized first (generally with a functional group on the end for attachment to the electrode), which is then attached to the nucleoside
• nucleosides are then added as required, with the last step generally being attachment to the electrode
• oligomer units are added one at a time to the nucleoside, with addition of additional nucleosides and attachment to the electrode
• a number of representative syntheses are shown in the Figures of PCT US97/20014, expressly incorporated herein by reference
• the conductive oligomer is then attached to a nucleoside that may contain one (or more) of the oligomer units, attached as depicted herein
• attachment is to a ribose of the nbose-phosphate backbone
• attachment via amide and amine linkages are possible (see Figures 1 and 2 of CPT US97/20014)
• attachment is via a phosphate of the nbose-phosphate backbone
• Figure 4 shows attachment at the 3' position of the ribose
• attachment can also be made via the 2' position
• Z is an ethylene linker, although other linkers may be used as well, as will be appreciated by those in the art
• attachment is via the base
• a general scheme is depicted in Figure 3 of PCT US97/20014, using undine as the nucleoside and a phenylene-acetylene conductive oligomer
• amide linkages are also possible, using techniques well known in the art
• protecting groups may be added to the base prior to addition of the conductive oligomers, as is generally outlined in Figures 10 and 11 of PCT US97/20014
• the palladium cross-coupling reactions may be altered to prevent dimerization problems, i e two conductive oligomers dime ⁇ zing, rather than coupling to the base
• attachment to the base may be done by making the nucleoside with one unit of the oligomer, followed by the addition of others
• modified nucleosides Once the modified nucleosides are prepared, protected and activated, prior to attachment to the electrode, they may be incorporated into a growing oligonucleotide by standard synthetic techniques (Gait, Oligonucleotide Synthesis A Practical Approach, IRL Press, Oxford, UK 1984, Eckstein) in several ways
• one or more modified nucleosides are converted to the t ⁇ phosphate form and incorporated into a growing oligonucleotide chain by using standard molecular biology techniques such as with the use of the enzyme DNA polymerase I, T4 DNA polymerase, T7 DNA polymerase, Taq DNA polymerase, reverse transc ⁇ ptase, and RNA polymerases
• DNA polymerase I DNA polymerase I
• T4 DNA polymerase T7 DNA polymerase
• Taq DNA polymerase reverse transc ⁇ ptase
• RNA polymerases for the incorporation of a 3' modified nucleoside to a nucleic acid, terminal deoxynucleotidyltransferase may be used (Ratliff, Terminal deoxynucleotidyltransferase In The Enzymes, Vol 14A P D Boyer ed pp 105-118 Academic Press, San Diego, CA 1981)
• ETM attachment to the base or the backbone
• nucleic acids comprising ETMs in situ
• a target sequence can hybridize to a capture probe (for example on the surface) in such a way that the terminus of the target sequence is exposed, i e unhybndized
• enzyme and t ⁇ phosphate nucleotides labelled with ETMs allows the in situ creation of the label
• using labeled nucleotides recognized by polymerases can allow simultaneous PCR and detection, that is, the target sequences are generated in situ
• the modified nucleoside is converted to the phosphoramidite or H- phosphonate form, which are then used in solid-phase or solution syntheses of ohgonucleotides
• the modified nucleoside either for attachment at the ribose (i e ammo- or thiol-modified nucleosides) or the base, is incorporated into the oligonucleotide at either an internal position or the 5' terminus
• DMT 4',4-d ⁇ methoxyt ⁇ tyl
• a preferred method utilizes the attachment of the modified nucleoside (or the nucleoside replacement) to controlled pore glass (CPG) or other o gomeric supports
• CPG controlled pore glass
• the modified nucleoside is protected at the 5' end with DMT, and then reacted with succinic anhydride with activation
• the resulting succmyl compound is attached to CPG or other ohgomeric supports as is known in the art
• Further phosphoramidite nucleosides are added, either modified or not, to the 5' end after deprotection
• the present invention provides conductive oligomers or insulators covalently attached to nucleosides attached to solid ohgomeric supports such as CPG, and phosphoramidite derivatives of the nucleosides of the invention
• the invention further provides methods of making label probes with recruitment linkers comprising ETMs
• ETMs these synthetic reactions will depend on the character of the recruitment linker and the method of attachment of the ETM, as will be appreciated by those in the art
• the label probes are generally made as outlined herein with the incorporation of ETMs at one or more positions
• a transition metal complex is used as the ETM
• synthesis may occur in several ways
• the l ⁇ gand(s) are added to a nucleoside, followed by the transition metal ion, and then the nucleoside with the transition metal complex attached is added to an oligonucleotide, i e by addition to the nucleic acid synthesizer
• the hgand(s) may be attached, followed by incorportation into a growing oligonucleotide chain, followed by the addition of the metal ion
• ETMs are attached to a ribose of the nbose-phosphate backbone This is generally done as is outlined herein for conductive oligomers, as described herein, and in PCT publication WO 95/15971 , using ammo-modified or oxo-modified nucleosides, at either the 2' or 3' position of the ribose
• the ammo group may then be used either as a ligand, for example as a transition metal ligand for attachment of the metal ion, or as a chemically functional group that can be used for attachment of other ligands or organic ETMs, for example via amide linkages, as will be appreciated by those in the art
• the examples describe the synthesis of nucleosides with a variety of ETMs attached via the ribose
• ETMs are attached to a phosphate of the nbose-phosphate backbone
• this may be done using phosphodiester analogs such as phosphoramidite bonds, see generally PCT publication WO 95/15971 , or can be done in a similar manner to that depicted in Figures 4 and 5 of PCT US97/20014, where the conductive oligomer is replaced by a transition metal ligand or complex or an organic ETM, as well as is outlined in the Examples
• ETMs are attached to a base of the nucleoside
• ammo groups of the base either naturally occurring or added as is described herein (see the fiigures, for example) are used either as ligands for transition metal complexes or as a chemically functional group that can be used to add other ligands, for example via an amide linkage, or organic ETMs
• nucleosides containing halogen atoms attached to the heterocychc ring are commercially available Acetylene linked ligands may be added using the halogenated bases, as is generally known, see for example, Tzahs et al , Tetrahedron Lett 36(34) 6017-6020 (1995), Tzahs et al , Tetrahedron Lett 36(2) 3489-3490 (1995), and Tza s et al , Chem Communications (in press) 1996,
• the nucleosides are made with transition metal ligands, incorporated into a nucleic acid, and then the transition metal ion and any remaining necessary ligands are added as is known in the art In an alternative embodiment, the transition metal ion and additional ligands are added prior to incorporation into the nucleic acid
• the attachment linker is attached to the electrode
• the method will vary depending on the type of electrode used As is described herein, the attachment linkers are generally made with a terminal "A" linker to facilitate attachment to the electrode
• a sulfur-gold attachment is considered a covalent attachment
• conductive oligomers, insulators, and attachment linkers are covalently attached via sulfur linkages to the electrode
• traditional protecting groups for use of attaching molecules to gold electrodes are generally not ideal for use in both synthesis of the compositions described herein and inclusion in oligonucleotide synthetic reactions
• the present invention provides novel methods for the attachment of conductive oligomers to gold electrodes, utilizing unusual protecting groups, including ethylpy ⁇ dine, and t ⁇ methylsilylethyl as is depicted in the Figures
• unusual protecting groups including ethylpy ⁇ dine, and t ⁇ methylsilylethyl as is depicted in the Figures
• traditional protecting groups such as acetyl groups and others may be used See Greene et al , supra
• the subunit of the conductive oligomer which contains the sulfur atom for attachment to the electrode is protected with an ethyl-py ⁇ dme or t ⁇ methylsiiylethyl group
• this is generally done by contacting the subunit containing the sulfur atom (preferably in the form of a sulfhydryl) with a vinyl pyridme group or vinyl t ⁇ methylsilylethyl group under conditions whereby an ethylpy ⁇ dine group or t ⁇ methylsilylethyl group is added to the sulfur atom
• This subunit also generally contains a functional moiety for attachment of additional subunits, and thus additional subunits are attached to form the conductive oligomer
• the conductive oligomer is then attached to a nucleoside, and additional nucleosides attached
• the protecting group is then removed and the sulfur-gold covalent attachment is made Alternatively, all or part of the conductive oligomer is made, and then either a subunit containing a protected sulfur atom is added, or a sulfur atom is added and then protected
• the conductive oligomer is then attached to a nucleoside, and additional nucleosides attached Alternatively, the conductive oligomer attached to a nucleic acid is made, and then either a subunit containing a protected sulfur atom is added, or a sulfur atom is added and then protected
• the ethyl pyridme protecting group may be used as above, but removed after one or more steps and replaced with a standard protecting group like a disulfide Thus, the e
• subunit of a conductive polymer herein is meant at least the moiety of the conductive oligomer to which the sulfur atom is attached, although additional atoms may be present, including either functional groups which allow the addition of additional components of the conductive oligomer, or additional components of the conductive oligomer
• a subunit comprises at least the first Y group
• a preferred method comprises 1 ) adding an ethyl pyridme or t ⁇ methylsilylethyl protecting group to a sulfur atom attached to a first subunit of a conductive oligomer, generally done by adding a vinyl pyridme or t ⁇ methylsiiylethyl group to a sulfhydryl, 2) adding additional subunits to form the conductive oligomer, 3) adding at least a first nucleoside to the conductive oligomer, 4) adding additional nucleosides to the first nucleoside to form a nucleic acid, 5) attaching the conductive oligomer to the gold electrode This may also be done in the absence of nucleosides, as is described in the
• the above method may also be used to attach insulator molecules to a gold electrode
• a monolayer comprising conductive oligomers (and optionally insulators) is added to the electrode.
• the chemistry of addition is similar to or the same as the addition of conductive oligomers to the electrode, i e using a sulfur atom for attachment to a gold electrode, etc
• compositions comprising monolayers in addition to the conductive oligomers covalently attached to nucleic acids may be made in at least one of five ways (1 ) addition of the monolayer, followed by subsequent addition of the attachment linker-nucleic acid complex, (2) addition of theattachment linker-nucleic acid complex followed by addition of the monolayer, (3) simultaneous addition of the monolayer and attachment linker-nucleic acid complex, (4) formation of a monolayer (using any of 1 , 2 or 3) which includes attachment linkers which terminate in a functional moiety suitable for attachment of a completed nucleic acid, or (5) formation of a monolayer which includes attachment linkers which terminate in a functional moiety suitable for nucleic acid synthesis, i e the nucleic acid is synthesized on the surface of the monolayer as is known in the art
• suitable functional moieties include, but are not limited to, nucleosides, ammo groups, carboxyl groups, protected sulfur moieties, or hydroxy I groups for phosphoramidite addition
• the nucleic acid is a peptide nucleic acid or analog
• the invention provides peptide nucleic acids with at least one covalently attached ETM or attachment linker
• these moieties are covalently attached to an monome ⁇ c subunit of the PNA
• monome ⁇ c subunit of PNA herein is meant the -NH-CH 2 CH 2 -N(COCH 2 -Base)-CH 2 -CO- monomer, or derivatives (herein included within the definition of "nucleoside") of PNA
• the number of carbon atoms in the PNA backbone may be altered, see generally Nielsen et al , Chem Soc Rev 1997 page 73, which discloses a number of PNA derivatives, herein expressly incorporated by reference
• the amide bond linking the base to the backbone may be altered, phosphoramide and sulfuramide bonds may be used Alternatively, the moieties are attached to an internal monomenc subunit By "intern
• the moieties are covalently attached to the backbone of the PNA monomer
• the attachment is generally to one of the unsubstituted carbon atoms of the monomenc subunit, preferably the ⁇ -carbon of the backbone, as is depicted in Figures 31 and 32, although attachment at either of the carbon 1 or 2 positions, or the ⁇ -carbon of the amide bond linking the base to the backbone may be done
• moieties are added at the ⁇ -carbon atoms, either to a terminal monomenc subunit or an internal one
• a modified monomenc subunit is synthesized with an ETM or an attachment linker, or a functional group for its attachment, and then the base is added and the modified monomer can be incorporated into a growing PNA chain
• Figure 31 of PCT US97/20014 depicts the synthesis of a conductive oligomer covalently attached to the backbone of a PNA monomenc subunit
• Figure 32 of PCT US97/20014 depicts the synthesis of a ferrocene attached to the backbone of a monomenc subunit
• electrodes may be made that have any combination of nucleic acids, conductive oligomers and insulators
• compositions of the invention may additionally contain one or more labels at any position
• label herein is meant an element (e g an isotope) or chemical compound that is attached to enable the detection of the compound
• Preferred labels are radioactive isotopic labels, and colored or fluorescent dyes
• the labels may be incorporated into the compound at any position
• the compositions of the invention may also contain other moieties such as cross-linking agents to facilitate cross-linking of the target-probe complex See for example, Lukhtanov et al , Nucl Acids Res 24(4) 683 (1996) and Tabone et al , Biochem 33 375 (1994), both of which are expressly incorporated by reference Once made, the compositions find use in a number of applications, as described herein.
• compositions of the invention find use in hybridization assays.
• electrodes can be made that have a single species of nucleic acid, i.e. a single nucleic acid sequence, or multiple nucleic acid species.
• a solid support such as an electrode
• oligonucleotide arrays are well known in the art.
• techniques are known for "addressing" locations within an electrode and for the surface modification of electrodes.
• arrays of different nucleic acids are laid down on the electrode, each of which are covalently attached to the electrode via a conductive linker.
• the number of different probe species of oligonucleotides may vary widely, from one to thousands, with from about 4 to about 100,000 being preferred, and from about 10 to about 10,000 being particularly preferred.
• detection proceeds with electronic initiation. Without being limited by the mechanism or theory, detection is based on the transfer of electrons from the ETM to the electrode.
• Detection of electron transfer i.e. the presence of the ETMs, is generally initiated electronically, with voltage being preferred.
• a potential is applied to the assay complex. Precise control and variations in the applied potential can be via a potentiostat and either a three electrode system (one reference, one sample (or working) and one counter electrode) or a two electrode system (one sample and one counter electrode). This allows matching of applied potential to peak potential of the system which depends in part on the choice of ETMs and in part on the conductive oligomer used, the composition and integrity of the monolayer, and what type of reference electrode is used. As described herein, ferrocene is a preferred ETM.
• a co-reductant or co-oxidant (collectively, co-redoxant) is used, as an additional electron source or sink. See generally Sato et al., Bull. Chem. Soc. Jpn 66:1032 (1993); Uosaki et al., Electrochimica Acta 36:1799 (1991); and Alleman et al., J. Phys. Chem 100:17050
• an input electron source in solution is used in the initiation of electron transfer, preferably when initiation and detection are being done using DC current or at AC frequencies where diffusion is not limiting.
• preferred embodiments utilize monolayers that contain a minimum of "holes", such that short-circuiting of the system is avoided. This may be done in several general ways.
• an input electron source is used that has a lower or similar redox potential than the ETM of the label probe. Thus, at voltages above the redox potential of the input electron source, both the ETM and the input electron source are oxidized and can thus donate electrons; the ETM donates an electron to the electrode and the input source donates to the ETM.
• ferrocene as a ETM attached to the compositions of the invention as described in the examples, has a redox potential of roughly 200 mV in aqueous solution (which can change significantly depending on what the ferrocene is bound to, the manner of the linkage and the presence of any substitution groups).
• Ferrocyanide an electron source, has a redox potential of roughly 200 mV as well (in aqueous solution). Accordingly, at or above voltages of roughly 200 mV, ferrocene is converted to ferricenium, which then transfers an electron to the electrode. Now the ferricyanide can be oxidized to transfer an electron to the ETM.
• the electron source serves to amplify the signal generated in the system, as the electron source molecules rapidly and repeatedly donate electrons to the ETM attached to the nucleic acid.
• the rate of electron donation or acceptance will be limited by the rate of diffusion of the co-reductant, the electron transfer between the co-reductant and the ETM, which in turn is affected by the concentration and size, etc.
• input electron sources that have lower redox potentials than the ETM are used. At voltages less than the redox potential of the ETM, but higher than the redox potential of the electron source, the input source such as ferrocyanide is unable to be oxided and thus is unable to donate an electron to the ETM; i.e. no electron transfer occurs. Once ferrocene is oxidized, then there is a pathway for electron transfer.
• an input electron source is used that has a higher redox potential than the ETM of the label probe.
• luminol an electron source
• the ferrocene is oxided, and transfers a single electron to the electrode via the conductive oligomer.
• the ETM is unable to accept any electrons from the luminol electron source, since the voltages are less than the redox potential of the luminol.
• the luminol then transfers an electron to the ETM, allowing rapid and repeated electron transfer.
• the electron source serves to amplify the signal generated in the system, as the electron source molecules rapidly and repeatedly donate electrons to the ETM of the label probe.
• Luminol has the added benefit of becoming a chemiluminiscent species upon oxidation (see Jirka et al., Analytica Chimica Acta 284:345 (1993)), thus allowing photo-detection of electron transfer from the
• luminol can only be oxidized by transferring an electron to the ETM on the label probe
• the ETM is not present, i e when the target sequence is not hybridized to the composition of the invention, luminol is not significantly oxidized, resulting in a low photon emission and thus a low (if any) signal from the luminol In the presence of the target, a much larger signal is generated
• the measure of luminol oxidation by photon emission is an indirect measurement of the ability of the ETM to donate electrons to the electrode
• photon detection is generally more sensitive than electronic detection, the sensitivity of the system may be increased
• Suitable electron source molecules include, but are not limited to, ferricyanide, and luminol
• ETM such as a metallocene receiving an electron from the electrode, converting it to the metalhcenium, with the output electron acceptor then accepting the electron rapidly and repeatedly
• cobalticenium is the preferred ETM
• the presence of the ETMs at the surface of the monolayer can be detected in a variety of ways
• a variety of detection methods may be used, including, but not limited to, optical detection (as a result of spectral changes upon changes in redox states), which includes fluorescence, phosphorescence, luminiscence, chemiluminescence, electrochemiluminescence, and refractive index, and electronic detection, including, but not limited to, amperommetry, voltammetry, capacitance and impedence
• optical detection as a result of spectral changes upon changes in redox states
• electronic detection including, but not limited to, amperommetry, voltammetry, capacitance and impedence
• These methods include time or frequency dependent methods based on AC or DC currents, pulsed methods, lock-in techniques, filtering (high pass, low pass, band pass), and time-resolved techniques including time-resolved fiuoroscence
• the efficient transfer of electrons from the ETM to the electrode results in stereotyped changes in the redox state of the ETM
• ETMs including the complexes of ruthenium containing bipyndine, pyridme and imidazole rings
• these changes in redox state are associated with changes in spectral properties
• Significant differences in absorbance are observed between reduced and oxidized states for these molecules See for example Fabb ⁇ zzi et al , Chem Soc Rev 1995 pp197-202) These differences can be monitored using a spectrophotometer or simple photomultipher tube device
• possible electron donors and acceptors include all the derivatives listed above for photoactivation or initiation Preferred electron donors and acceptors have characteristically large spectral changes upon oxidation and reduction resulting in highly sensitive monitoring of electron transfer Such examples include Ru(NH 3 ) 4 py and Ru(bpy) 2 ⁇ m as preferred examples It should be understood that only the donor or acceptor that is being monitored by absorbance need have ideal spectral characteristics
• the electron transfer is detected fluoromet ⁇ cally Numerous transition metal complexes, including those of ruthenium, have distinct fluorescence properties Therefore, the change in redox state of the electron donors and electron acceptors attached to the nucleic acid can be monitored very sensitively using fluorescence, for example with Ru(4,7-b ⁇ phenyl 2 -phenanthrohne) 3 2+
• fluorescence for example with Ru(4,7-b ⁇ phenyl 2 -phenanthrohne) 3 2+
• the production of this compound can be easily measured using standard fluorescence assay techniques For example, laser induced fluorescence can be recorded in a standard single cell fluo ⁇ meter, a flow through "on-line” fluo ⁇ meter (such as those attached to a chromatography system) or a multi-sample "plate-reader” similar to those marketed for 96-well immuno assays
• fluorescence can be measured using fiber optic sensors with nucleic acid probes in solution or attached to the fiber optic Fluorescence is monitored using a photomultipher tube or other light detection instrument attached to the fiber optic The advantage of this system is the extremely small volumes of sample that can be assayed
• scanning fluorescence detectors such as the Fluorlmager sold by Molecular Dynamics are ideally suited to monitoring the fluorescence of modified nucleic acid molecules arrayed on solid surfaces
• Fluorlmager sold by Molecular Dynamics
• transition metal complexes display fluorescence with large Stokes shifts
• Suitable examples include bis- and trisphenanthrohne complexes and bis- and trisbipy ⁇ dyl complexes of transition metals such as ruthenium (see Juris, A , Balzani, V , et al Coord Chem Rev , V 84, p 85-277, 1988)
• Preferred examples display efficient fluorescence (reasonably high quantum yields) as well as low reorganization energies These include Ru(4,7-b ⁇ phenyl 2 -phenanthrohne) 3 2+ , Ru(4,4'-d ⁇ phenyl-2,2'- b ⁇ py ⁇ d ⁇ ne) 3 2+ and platinum complexes (see Cummmgs et al , J Am Chem Soc 118 1949-1960
• electrochemiluminescence is used as the basis of the electron transfer detection
• ETMs such as Ru 2+ (bpy) 3
• direct luminescence accompanies excited state decay Changes in this property are associated with nucleic acid hybridization and can be monitored with a simple photomultipher tube arrangement (see Blackburn, G F Clin Chem 37 1534-1539 (1991 ), and Juris et al , supra
• electronic detection is used, including amperommetry, voltammetry, capacitance, and impedence
• Suitable techniques include, but are not limited to, electrogravimetry, coulometry (including controlled potential coulometry and constant current coulometry), voltametry (cyclic voltametry, pulse voltametry (normal pulse voltametry, square wave voltametry, differential pulse voltametry, Osteryoung square wave voltametry, and couiostatic pulse techniques), stripping analysis (aniodic stripping analysis, cathiodic stripping analysis, square wave stripping voltammetry), conductance measurements (electrolytic conductance, direct analysis), time-dependent electrochemical analyses (chronoamperometry, chronopotentiometry, cyclic chronopotentiometry and amperometry, AC polography, chronogalvametry, and chronocoulometry), AC impedance measurement, capacitance measurement, AC voltametry, and photoelectrochemistry
• monitoring electron transfer is via amperometric detection
• This method of detection involves applying a potential (as compared to a separate reference electrode) between the nucleic acid-conjugated electrode and a reference (counter) electrode in the sample containing target genes of interest Electron transfer of differing efficiencies is induced in samples in the presence or absence of target nucleic acid, that is, the presence or absence of the target nucleic acid, and thus the label probe, can result in different currents
• the device for measuring electron transfer amperomet ⁇ cally involves sensitive current detection and includes a means of controlling the voltage potential, usually a potentiostat This voltage is optimized with reference to the potential of the electron donating complex on the label probe Possible electron donating complexes include those previously mentioned with complexes of iron, osmium, platinum, cobalt, rhenium and ruthenium being preferred and complexes of iron being most preferred
• potentiomet ⁇ c (or voltammet ⁇ c) measurements involve non-faradaic (no net current flow) processes and are utilized traditionally in pH and other ion detectors Similar sensors are used to monitor electron transfer between the ETM and the electrode.
• other properties of insulators (such as resistance) and of conductors (such as conductivity, impedance and capi tance) could be used to monitor electron transfer between ETM and the electrode
• any system that generates a current (such as electron transfer) also generates a small magnetic field, which may be monitored in some embodiments
• time resolution can greatly enhance the signal-to-noise results of monitors based on absorbance, fluorescence and electronic current
• the fast rates of electron transfer of the present invention result both in high signals and stereotyped delays between electron transfer initiation and completion By amplifying signals of particular delays, such as through the use of pulsed initiation of
• ETMs alternating current
• ETMs bound to an electrode
• traditional electrochemical theory such as exemplified in Laviron et al , J Electroanal Chem 97 135 (1979) and Laviron et al , J Electroanal Chem 105 35 (1979), both of which are incorporated by reference, do not accurately model the systems described herein, except for very small E AC (less than 10 mV) and relatively large numbers of molecules That is, the AC current (I) is not accurately described by Laviron's equation This may be due in part to the fact that this theory assumes an unlimited source and sink of electrons, which is not true in the present systems
• E DC is the electrode potential
• E 0 is the formal potential of the metal complex
• R is the gas constant
• T is the temperature in degrees Kelvin
• n is the number of electrons transferred
• F is faraday's constant
• [O] is the concentration of oxidized molecules and [R] is the concentration of reduced molecules
• Equation 2 Equation 2
• E DC is the DC component of the potential
• Equation 3 can be rearranged as follows, using normalization of the concentration to equal 1 for simplicity, as shown in Equations 4, 5 and 6 This requires the subsequent multiplication by the total number of molecules
• the total AC current will be the number of redox molecules C), times faraday's constant (F), times the AC frequency ( ⁇ ), times 0 5 (to take into account the AC amplitude), times the ratios derived above in Equation 7
• the AC voltage is approximated by the average, E AC 2/ ⁇
• Equation 11 does not incorporate the effect of electron transfer rate nor of instrument factors Electron transfer rate is important when the rate is close to or lower than the applied frequency
• ⁇ AC should be a function of all three, as depicted in Equation 12
• non-specifically bound label probes/ETMs show differences in impedance (i e higher impedances) than when the label probes containing the ETMs are specifically bound in the correct orientation
• the non-specifically bound material is washed away, resulting in an effective impedance of infinity
• AC detection gives several advantages as is generally discussed below, including an increase in sensitivity, and the ability to "filter out" background noise
• changes in impedance including, for example, bulk impedance
• frequency response when using AC initiation and detection methods, the frequency response of the system changes as a result of the presence of the ETM
• frequency response herein is meant a modification of signals as a result of electron transfer between the electrode and the ETM This modification is different depending on signal frequency
• a frequency response includes AC currents at one or more frequencies, phase shifts, DC offset voltages, faradaic impedance, etc
• a first input electrical signal is then applied to the system, preferably via at least the sample electrode (containing the complexes of the invention) and the counter electrode, to initiate electron transfer between the electrode and the ETM Three electrode systems may also be used, with the voltage applied to the reference and working electrodes
• the first input signal comprises at least an AC component
• the AC component may be of variable amplitude and frequency Generally, for use in the present methods, the AC amplitude ranges from about 1 mV to about 1 1 V, with from about 10 mV to about 800 mV being preferred, and from about 10 mV to about 500 mV being especially preferred
• the AC frequency ranges from about 0 01 Hz to about 100 MHz, with from about 10 Hz to about 10 MHz being preferred, and from about 100 Hz to about 20 MHz being especially preferred
• the first input signal comprises a DC component and an AC component That is, a DC offset voltage between the sample and counter electrodes is swept through the electrochemical potential of the ETM (for example, when ferrocene is used, the sweep is generally from 0 to 500 mV) (or alternatively, the working electrode is grounded and the reference electrode is swept from 0 to -500 mV)
• the sweep is used to identify the DC voltage at which the maximum response of the system is seen This is generally at or about the electrochemical potential of the ETM
• DC offset voltages of from about -1 V to about +1 1 V are preferred, with from about -500 mV to about +800 mV being especially preferred, and from about -300 mV to about 500 mV being particularly preferred
• the DC offset voltage is not zero
• an AC signal component of variable amplitude and frequency is applied If the ETM is present, and can
• a single input signal may be applied to differentiate between the presence and absence of the ETM (i e the presence of the target sequence) nucleic acid
• a plurality of input signals are applied as outlined herein, this may take a variety of forms, including using multiple frequencies, multiple DC offset voltages, or multiple AC amplitudes, or combinations of any or all of these
• DC offset voltages are used, although as outlined above, DC voltage sweeps are preferred This may be done at a single frequency, or at two or more frequencies
• the AC amplitude is varied Without being bound by theory, it appears that increasing the amplitude increases the driving force Thus, higher amplitudes, which result in higher overpotentials give faster rates of electron transfer Thus, generally, the same system gives an improved response (i e higher output signals) at any single frequency through the use of higher overpotentials at that frequency Thus, the amplitude may be increased at high frequencies to increase the rate of electron transfer through the system, resulting in greater sensitivity In addition, this may be used, for example, to induce responses in slower systems such as those that do not possess optimal spacing configurations
• measurements of the system are taken at at least two separate amplitudes or overpotentials, with measurements at a plurality of amplitudes being preferred.
• changes in response as a result of changes in amplitude may form the basis of identification, calibration and quantification of the system in addition, one or more AC frequencies can be used as well
• the AC frequency is varied At different frequencies, different molecules respond in different ways As will be appreciated by those in the art, increasing the frequency generally increases the output current However, when the frequency is greater than the rate at which electrons may travel between the electrode and the ETM, higher frequencies result in a loss or decrease of output signal At some point, the frequency will be greater than the rate of electron transfer between the ETM and the electrode, and then the output signal will also drop
• detection utilizes a single measurement of output signal at a single frequency
• the frequency response of the system in the absence of target sequence, and thus the absence of label probe containing ETMs can be previously determined to be very low at a particular high frequency Using this information, any response at a particular frequency, will show the presence of the assay complex That is, any response at a particular frequency is characteristic of the assay complex Thus, it may only be necessary to use a single input high frequency, and any changes in frequency response is an indication that the ETM is present, and thus that the target sequence is present
• the frequency response of a charge carrier or redox active molecule in solution will be limited by its diffusion coefficient and charge transfer coefficient Accordingly, at high frequencies, a charge carrier may not diffuse rapidly enough to transfer its charge to the electrode, and/or the charge transfer kinetics may not be fast enough This is particularly significant in embodiments that do not have good monolayers, i e have partial or insufficient monolayers, i e where the solvent is accessible to the electrode.
• the presence of "holes" where the electrode is accessible to the solvent can result in solvent charge carriers "short circuiting" the system, i e the reach the electrode and generate background signal
• one or more frequencies can be chosen that prevent a frequency response of one or more charge carriers in solution, whether or not a monolayer is present This is particularly significant since many biological fluids such as blood contain significant amounts of redox active molecules which can interfere with amperometric detection methods
• measurements of the system are taken at at least two separate frequencies, with measurements at a plurality of frequencies being preferred
• a plurality of frequencies includes a scan
• measuring the output signal, e g , the AC current, at a low input frequency such as 1 - 20 Hz, and comparing the response to the output signal at high frequency such as 10 - 100 kHz will show a frequency response difference between the presence and absence of the ETM
• the frequency response is determined at at least two, preferably at least about five, and more preferably at least about ten frequencies
• an output signal is received or detected
• the presence and magnitude of the output signal will depend on a number of factors, including the overpotential/amphtude of the input signal, the frequency of the input AC signal, the composition of the intervening medium, the DC offset, the environment of the system, the nature of the ETM, the solvent, and the type and concentration of salt
• the presence and magnitude of the output signal will depend in general on the
• the output signal comprises an AC current
• the magnitude of the output current will depend on a number of parameters By varying these parameters, the system may be optimized in a number of ways
• AC currents generated in the present invention range from about 1 femptoamp to about 1 milhamp, with currents from about 50 femptoamps to about 100 microamps being preferred, and from about 1 picoamp to about 1 microamp being especially preferred
• the output signal is phase shifted in the AC component relative to the input signal
• the systems of the present invention may be sufficiently uniform to allow phase-shifting based detection That is, the complex biomolecules of the invention through which electron transfer occurs react to the AC input in a homogeneous manner, similar to standard electronic components, such that a phase shift can be determined This may serve as the basis of detection between the presence and absence of the ETM, and/or differences between the presence of target-specific assay complexes comprising label probes and non-specific binding of the label probes to the system components
• the output signal is characteristic of the presence of the ETM, that is, the output signal is characteristic of the presence of the target-specific assay complex comprising label probes and ETMs
• the basis of the detection is a difference in the faradaic impedance of the system as a result of the formation of the assay complex Faradaic impedance is the impedance of the system between the electrode and the ETM Faradaic impedance is quite different from the bulk or dielectric impedance, which is the impedance of the bulk solution between the electrodes Many factors may change the faradaic impedance which may not effect the bulk impedance, and vice versa
• the assay complexes comprising the nucleic acids in this system have a certain faradaic impedance, that will depend on the distance between the ETM and the electrode, their electronic properties, and the composition of the intervening medium, among other things Of importance in the methods of the invention is that the faradaic impedance between the ETM and the electrode is signficantly different depending on whether the
• the present invention further provides apparatus for the detection of nucleic acids using AC detection methods
• the apparatus includes a test chamber which has at least a first measuring or sample electrode, and a second measuring or counter electrode Three electrode systems are also useful
• the first and second measuring electrodes are in contact with a test sample receiving region, such that in the presence of a liquid test sample, the two electrodes may be in electrical contact
• the first measuring electrode comprises a single stranded nucleic acid capture probe covalently attached via an attachment linker, and a monolayer comprising conductive oligomers, such as are described herein
• the apparatus further comprises an AC voltage source electrically connected to the test chamber, that is, to the measuring electrodes
• the AC voltage source is capable of delivering DC offset voltage as well
• the apparatus further comprises a processor capable of comparing the input signal and the output signal
• the processor is coupled to the electrodes and configured to receive an output signal, and thus detect the presence of the target nucleic acid
• compositions of the present invention may be used in a variety of research, clinical, quality control, or field testing settings
• the probes are used in genetic diagnosis
• probes can be made using the techniques disclosed herein to detect target sequences such as the gene for nonpolyposis colon cancer, the BRCA1 breast cancer gene, P53, which is a gene associated with a variety of cancers, the Apo E4 gene that indicates a greater risk of Alzheimer's disease, allowing for easy presymptomatic screening of patients, mutations in the cystic fibrosis gene, or any of the others well known in the art
• viral and bacterial detection is done using the complexes of the invention
• probes are designed to detect target sequences from a variety of bacteria and viruses
• current blood-screening techniques rely on the detection of anti-
• HIV antibodies The methods disclosed herein allow for direct screening of clinical samples to detect HIV nucleic acid sequences, particularly highly conserved HIV sequences In addition, this allows direct monitoring of circulating virus within a patient as an improved method of assessing the efficacy of anti-viral therapies Similarly, viruses associated with leukemia, HTLV-I and HTLV-II, may be detected in this way Bacterial infections such as tuberculosis, clymidia and other sexually transmitted diseases, may also be detected, for example using ⁇ bosomal RNA (rRNA) as the target sequences
• rRNA ⁇ bosomal RNA
• the nucleic acids of the invention find use as probes for toxic bacteria in the screening of water and food samples
• samples may be treated to lyse the bacteria to release its nucleic acid (particularly rRNA), and then probes designed to recognize bacterial strains, including, but not limited to, such pathogenic strains as, Salmonella, Campylobacter, Vibrio cholerae, Leishmania, enterotoxic strains of E coli, and Legionnaire's disease bacteria
• bioremediation strategies may be evaluated using the compositions of the invention
• the probes are used for forensic "DNA fingerprinting" to match crime-scene DNA against samples taken from victims and suspects
• the probes in an array are used for sequencing by hybridization
• the present invention provides for extremely specific and sensitive probes, which may, in some embodiments, detect target sequences without removal of unhybndized probe This will be useful in the generation of automated gene probe assays
• compositions of the invention are useful to detect successful gene amplification in PCR, thus allowing successful PCR reactions to be an indication of the presence or absence of a target sequence PCR may be used in this manner in several ways
• the PCR reaction is done as is known in the art, and then added to a composition of the invention comprising the target nucleic acid with a ETM, covalently attached to an electrode via a conductive oligomer with subsequent detection of the target sequence
• PCR is done using nucleotides labelled with a ETM, either in the presence of, or with subsequent addition to, an electrode with a conductive oligomer and a target nucleic acid Binding of the PCR product containing ETMs to the electrode composition will allow detection via electron transfer
• the nucleic acid attached to the electrode via a conductive polymer may be one PCR primer, with addition of a second primer labelled with an ETM Elongation results in double stranded nucleic acid with a ETM and electrode
• the arrays are used for mRNA detection
• a preferred embodiment utilizes either capture probes or capture extender probes that hybridize close to the 3' polyadenylation tail of the mRNAs This allows the use of one species of target binding probe for detection, i e the probe contains a poly-T portion that will bind to the poly-A tail of the mRNA target Generally, the probe will contain a second portion, preferably non-poly-T, that will bind to the detection probe (or other probe) This allows one target-binding probe to be made, and thus decreases the amount of different probe synthesis that is done
• restriction enzymes and ligation methods allows the creation of "universal" arrays
• monolayers comprising capture probes that comprise restriction endonuclease ends as is generally depicted in Figure 7 of PCT US97/20014
• an array comprising any number of restriction endonuclease sites is made Treating a target sample with one or more of these restriction endonucleases allows the targets to bind to the array This can be done without knowing the sequence of the target
• the target sequences can be ligated, as desired, using standard methods such as hgases, and the target sequence detected, using either standard labels or the methods of the invention
• the present invention provides methods which can result in sensitive detection of nucleic acids
• less than about 10 X 10 6 molecules are detected, with less than about 10 X 10 5 being preferred, less than 10 X 10 4 being particularly preferred, less than about 10 X 10 3 being especially preferred, and less than about 10 X 10 2 being most preferred
• this assumes a 1 1 correlation between target sequences and reporter molecules, if more than one reporter molecule (i e electron transfer moeity) is used for each target sequence, the sensitivity will go up
• N16 To a solution of N15 (11 50 gm, 27 17 mmol) in 300 mL dry pyridme cooled at 0°C, was added tnmethylsily chloride (13 71 mL, 0 11 mol, 4 0) The mixture was stirred at 0 °C for 40 mm Phenoxyacetyl chloride (9 38 mL, 67 93 mmol) was added The reaction was stirred at 0 °C for
• Electrodes containing the different compositions of the invention were made and used in AC detection methods The experiments were run as follows A DC offset voltage between the working (sample) electrode and the reference electrode was swept through the electrochemical potential of the ferrocene, typically from 0 to 500 mV On top of the DC offset, an AC signal of variable amplitude and frequency was applied The AC current at the excitation frequency was plotted versus the DC offset
• a capture probe D112, comprising a 25 base sequence was mixed with the Y5 conductive oligomer and the
• a capture extender probe D179 comprising a 24 base sequence perfectly complementary to the D112 capture probe, and a 24 base sequence perfectly complementary to the 2tar target, separated by a single base, was added, with the 2tar target
• the D179 molecule carries a ferrocene (using a C15 linkage to the base) at the end that is closest to the electrode
• the attachment linkers are conductive oligomers
• the use of an ETM at or near this position allows verification that the D179 molecule is present
• a ferrocene at this position has a different redox potential than the ETMs used for detection
• a label probe D309 (dendnmer) was added, comprising a 18 base sequence perfectly complementary to a portion of the target sequence, a 13 base sequence linker and four ferrocenes attached using a branching configuration
• a representative scan is shown in Figure 20A When the 2tar target was not added, a representative scan is shown in Figure 20B
• Example A A capture probe D94 was added with the Y5 and M44 conductive oligomer at a 2 2 1 ratio with the total thiol concentration being 833 ⁇ M on the electrode surface, as outlined above
• a target sequence (D336) comprising a 15 base sequence perfectly complementary to the D94 capture probe, a 14 base linker sequence, and 6 ferrocenes linked via the N6 compound was used
• a representative scan is shown in Figure 20C
• Example B A capture probe D94 was added with the Y5 and M44 conductive oligomer at a 2 2 1 ratio with the total thiol concentration being 833 ⁇ M on the electrode surface, as outlined above
• a target sequence (D429) comprising a 15 base sequence perfectly complementary to the D94 capture probe, a C131 ethylene glycol linker hooked to 6 ferrocenes linked via the N6 compound was used
• a representative scan is shown in Figure 20E
• the capture probe D112, Y5 conductive oligomer, the M44 insulator, and capture extender probe D179 were as outlined above
• Two label probes were added D295 comprising an 18 base sequence perfectly complementary to a portion of the target sequence, a 15 base sequence linker and six ferrocenes attached using the N6 linkage depicted in Figure 23 D297 is the same, except that it's 18 base sequence hybridizes to a different portion of the target sequence
• a representative scan is shown in Figure 20G When the 2tar target was not added, a representative scan is shown in Figure 20H
• the capture probe D112, Y5 conductive oligomer, the M44 insulator, and capture extender probe D179 were as outlined above
• Two label probes were added D296 comprising an 18 base sequence perfectly complementary to a portion of the target sequence, a 5 base sequence linker and six ferrocenes attached using the N6 linkage depicted in Figure 23 D298 is the same, except that it's 18 base sequence hybridizes to a different portion of the target sequence
• a representative scan is shown in Figure 201 When the 2tar target was not added, a representative scan is shown in Figure 20J
• Example A A capture probe D112, Y5 conductive oligomer and the M44 insulator were put on the electrode at 2 2 1 ratio with the total thiol concentration being 833 ⁇ M
• a target sequence MT1 was added, that comprises a sequence complementary to D112 and a 20 base sequence complementary to the label probe D358 were combined, in this case, the label probe D358 was added to the target sequence prior to the introduction to the electrode
• the label probe contains si ferrocenes attached using the N6 linkages depicted in Figure 23 A representative scan is shown in Figure 20L
• the replacment of MT1 with NC112 which is not complementary to the capture probe resulted in no signal, similarly, the removal of MT1 resulted in no signal
• Example B A capture probe D334, Y5 conductive oligomer and the M44 insulator were put on the electrode at 2 2 1 ratio with the total thiol concentration being 833 ⁇ M
• a target sequence LP280 was added, that comprises a sequence complementary
• the sense primer contained the ETMs (using the N6 linkage described herein), although as will be appreciated by those in the art, t ⁇ phosphate nucleotides containing ETMs could be used to label non-primer sequences
• the surface probe was designed to hybridize to 16 nucleotides of non-primer sequences, immediately adjacent to the primer sequence, that is, the labeled primer sequence will not bind to the surface probe Thus, only if amplification has occured, such that the amplified sequence will bind to the surface probe, will the detection of the adjacent ETMs proceed
• the target sequence in this case was the plasmid pBKBHIOS (NIH AIDS Research and Reference Reagent program - McKesson Bioservices, Rockville MD) which contains an 8 9 kb Sstl fragment of pBH10-R3 dervied from the HXB2 clone which contains the entire HIV-1 genome and has the Genbank accession code K03455 or M38432) inserted into the Sstl site on pBluesc ⁇ pt ll-KS(+) The insert is oriented such that transcription from the T7 promoter produces sense RNA
• the “sense” primer, D353 was as follows 5'-(N6)A(N6)AGGGCTGTTGGAAATGTGG-3'
• the "antisense” primer, D351 was as follows 5'-TGTTGGCTCTGGTCTGCTCTGA-3'
• the following is the expected PCR product of the reaction, comprising 140 bp
• the surface capture probe (without any overlap to the sense primer) D459 was as follows 5'- TTGGTGTCCTTCCTTU-4 unit w ⁇ re(C11)-3'
• PCR reaction conditions were standard TAQ polymerase at TAQ 10X buffer 1 ⁇ M of the primers was added to either 6 X 10 3 , 6X 10 6 or 6 X 10 7 molecules of template The reaction conditions were 90°C for 30 sec, 57°C for 30 sec, and 70°C for 1 minute
• the electrodes were prepared by melting 0 127 mm diamter pure gold wire on one end to form a ball The electrodes were dipped in aqua regia for 20 seconds and tehn rinse with water The SAM was deposited by dipping the electrode into a deposition solution of 1 34 0 7 D459 H6 M44 in 37 39 24 THF ACN water at 1 mM total thiol which was heated at 50°C for five minutes prior to the introduction of the electrodes The electrodes were added and then removed immediately to room temperature to sit for 15 minutes Electrodes were then transferred to M44 (in 37 39 24 THF ACN water at 400 ⁇ M total thiol concentration) The electrodes sat in M44 at room tern for 5 minutes, then the following heat cycling was applied 70°C for 1 minute, followed by 55°C for 30 sec, repeating this cycle 2 more times followed by a 0 3 °C ramp down to RT with soaking at RT for 10 minutes The electrodes were taken out of M44 solution, rinsed in 2XSSC
• a surface probe D368 (5'-(H2)CCTTCCTTTCCACAU-4 unit w ⁇ re(C11)-3') was attached to an electrode comprising M44 and H6 (H6 is a two unit wire terminating in an acetylene bond) at a ratio of D368 H6:M44 of 1 4 1 with a total thiol concentration of 833 ⁇ M
• H6 is a two unit wire terminating in an acetylene bond
• a ligation probe HIVLIG (5'-CCACCAGATCTTCCCTAA AAAATTAGCCTGTCTCTCAGTACAATCTTTCATTTGGTGT-3')
• the target sequence HIVCOMP 5'-
• ATGTGGAAAGAAAGGACACC TTGAMGATTGTACTGAGAGACAGGCTAATTTTTTAGGGAAGATCTGG- 3' was added, with hgase and the reaction allowed to proceed
• the reaction conditions were as follows 10 ⁇ M of HIVLIG annealed to HIVCOMP were hybridized to the electrode surface (in 6XSSC) for 80 m The surface was rinsed in gase buffer The gase (T4) and buffer were added and incubated for 2 hours at RT Triton X at 10 "4 M was added at 70°C to allow the denaturation of the newly formed hybridization complex, resulting in the newly formed long surface probe (comprising D368 ligated to the HIVLIG probe)
• the addition of the D456 signalling probe (5'-(N6)G(N6)CT(N60C(N60G(N6)C(N6)TTCTGCACCGTAAGCCA TCAAAGATTGTACTGAG-3') allowed detection (results not shown)
• the capture probe for a rRNA assay containing 0, 4 and 8 ethylene glycol units was tested on four separate electrode surfaces
• Surface 1 contained 2 1 ratio of H6 M44, with a total thiol concentration of 500 ⁇ M
• Surface 2 contained a 2 2 1 ratio of D568/H6/M44 with a total thiol concentration of 833 ⁇ M
• Surface 3 contained a 2 2 1 ratio of D570/H6/M44 with a total thiol concentration of 833 ⁇ M
• D568 was a capture probe comprising 5'-GTC AAT GAG CAA AGG TAT TAA (P282)-3' P282 was a thiol
• D569 was a capture probe comprising 4 ethylene glycol units 5'-GTC AAT GAG CAA AGG TAT TAA (C131) (P282)-3' D570 was a capture probe comprising 8 ethylene glycol units 5'-GTC AAT GAG CAA AGG TAT TAA (C131)
• 6-ferrocene containing label probes Additional tack down points, and a plurality of label probes, is contemplated
• Hybridization solutions were annealed by heating at 70°C for 30 seconds and then cooling to 22°C over ⁇ 38 seconds
• the molecules were all in 4X SSC at twice the targeted concentrations, with the rRNA at 35 U S C ⁇ ⁇ M, the capture sequence at 1 0 ⁇ M, and the label probes at 3 ⁇ M
• the solution was diluted 1 1 with fetal calf serum, halving the concentrations and changing the solvent to 2X SSC with 50% FCS
• FCS FCS
• Hybridization was done as follows After the 2X SSC dip described above, the derivatized electrode was placed into an eppendorf tube with 20 ⁇ L hybridization solution It was allowed to hybridize at room temperature for 10 minutes Immediately before measurement, the electrode was briefly dipped in room temperature 2X SSC It was then transferred into the 1 M NaCI0 4 electrolyte and an alternating current voltammogram was taken with an applied alternating current of 10 Hz frequency and a 25 mV center-to-peak amplitude
• D405 has the structure 5'-(C23)(C23)(C23) (C23)(C23)(C23)(C23) (C23)(C23) (C23)AT CTG TGT CCA TGG T-3'
• the system was run with two surfaces the "+” surface was a 2 2 1 ratio of D94:H6:M44, with a total thiol concentration of 833 ⁇ M
• the "-" surface was a 2 2 1 ratio of D109:H6:M44, with a total thiol concentration of 833 ⁇ M
• the results, shown in Figure 25B show that the system gave a good signal in the presence of a complementary capture probe

Applications Claiming Priority (7)

Publications (1)

Family

ID=27374777

Family Applications (1)

Country Status (5)

Families Citing this family (23)

Family Cites Families (6)

• 1999
  • 1999-01-27 WO PCT/US1999/001703 patent/WO1999057319A1/en active IP Right Grant
  • 1999-01-27 JP JP2000547270A patent/JP2002513592A/ja active Pending
  • 1999-01-27 EP EP99904314A patent/EP1075541A1/de not_active Withdrawn
  • 1999-01-27 CA CA002327525A patent/CA2327525A1/en not_active Abandoned
  • 1999-01-27 AU AU24735/99A patent/AU765597B2/en not_active Ceased

Non-Patent Citations (1)

Also Published As

Similar Documents

Legal Events