WO1999057319A1 - Electronic detection of nucleic acids using monolayers - Google Patents

Electronic detection of nucleic acids using monolayers Download PDF

Info

Publication number
WO1999057319A1
WO1999057319A1 PCT/US1999/001703 US9901703W WO9957319A1 WO 1999057319 A1 WO1999057319 A1 WO 1999057319A1 US 9901703 W US9901703 W US 9901703W WO 9957319 A1 WO9957319 A1 WO 9957319A1
Authority
WO
WIPO (PCT)
Prior art keywords
probe
preferred
label
nucleic acid
target sequence
Prior art date
Application number
PCT/US1999/001703
Other languages
French (fr)
Inventor
Cynthia Bamdad
Changyun Yu
Original Assignee
Clinical Micro Sensors
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Clinical Micro Sensors filed Critical Clinical Micro Sensors
Priority to JP2000547270A priority Critical patent/JP2002513592A/en
Priority to AU24735/99A priority patent/AU765597B2/en
Priority to EP99904314A priority patent/EP1075541A1/en
Priority to CA002327525A priority patent/CA2327525A1/en
Publication of WO1999057319A1 publication Critical patent/WO1999057319A1/en
Priority to AU2003271352A priority patent/AU2003271352A1/en

Links

Classifications

    • BPERFORMING OPERATIONS; TRANSPORTING
    • B82NANOTECHNOLOGY
    • B82YSPECIFIC USES OR APPLICATIONS OF NANOSTRUCTURES; MEASUREMENT OR ANALYSIS OF NANOSTRUCTURES; MANUFACTURE OR TREATMENT OF NANOSTRUCTURES
    • B82Y15/00Nanotechnology for interacting, sensing or actuating, e.g. quantum dots as markers in protein assays or molecular motors
    • BPERFORMING OPERATIONS; TRANSPORTING
    • B82NANOTECHNOLOGY
    • B82YSPECIFIC USES OR APPLICATIONS OF NANOSTRUCTURES; MEASUREMENT OR ANALYSIS OF NANOSTRUCTURES; MANUFACTURE OR TREATMENT OF NANOSTRUCTURES
    • B82Y30/00Nanotechnology for materials or surface science, e.g. nanocomposites
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813Hybridisation assays
    • C12Q1/6816Hybridisation assays characterised by the detection means
    • C12Q1/6825Nucleic acid detection involving sensors
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6869Methods for sequencing
    • C12Q1/6874Methods for sequencing involving nucleic acid arrays, e.g. sequencing by hybridisation
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N27/00Investigating or analysing materials by the use of electric, electrochemical, or magnetic means
    • G01N27/26Investigating or analysing materials by the use of electric, electrochemical, or magnetic means by investigating electrochemical variables; by using electrolysis or electrophoresis
    • G01N27/28Electrolytic cell components
    • G01N27/30Electrodes, e.g. test electrodes; Half-cells
    • G01N27/327Biochemical electrodes, e.g. electrical or mechanical details for in vitro measurements
    • G01N27/3275Sensing specific biomolecules, e.g. nucleic acid strands, based on an electrode surface reaction
    • G01N27/3277Sensing specific biomolecules, e.g. nucleic acid strands, based on an electrode surface reaction being a redox reaction, e.g. detection by cyclic voltammetry
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2610/00Assays involving self-assembled monolayers [SAMs]

Definitions

  • the present invention is directed to methods and compositions for the use of self-assembled monolayers with electronically exposed termini to electronically detect nucleic acids.
  • Gene probe assays currently play roles in identifying infectious organisms such as bacteria and viruses, in probing the expression of normal genes and identifying mutant genes such as oncogenes, in typing tissue for compatibility preceding tissue transplantation, in matching tissue or blood samples for forensic medicine, and for exploring homology among genes from different species.
  • a gene probe assay should be sensitive, specific and easily automatable (for a review, see Nickerson, Current Opinion in Biotechnology 4:48-51 (1993)).
  • the requirement for sensitivity i.e. low detection limits
  • PCR polymerase chain reaction
  • other amplification technologies which allow researchers to amplify exponentially a specific nucleic acid sequence before analysis (for a review, see Abramson et al., Current Opinion in Biotechnology, 4:41-47 (1993)).
  • Branched DNA signal amplification relies on the synthesis of branched nucleic acids, containing a multiplicity of nucleic acid “arms” that function to increase the amount of label that can be put onto one probe This technology is generally described in U S Patent Nos
  • dendnmers of nucleic acids serve to vastly increase the amount of label that can be added to a single molecule, using a similar idea but different compositions
  • This technology is as described in U.S Patent No 5,175,270 and Nilsen et al , J Theor Biol 187 273 (1997), both of which are incorporated herein by reference
  • compositions comprising electrodes comprising a monolayer comprising conductive oligomers, and a capture probe
  • the composition further comprises a target sequence comprising a first portion that is capable of hybridizing to the capture probe, and a second portion that does not hybridize to the capture probe and comprises at least one covalently attached electron transfer moiety
  • compositions comprising electrodes comprising a monolayer comprising conductive oligomers, and a capture probe
  • the compositions further comprise a label probe comprising a first portion that is capable of hybridizing to a component of an assay complex, and a second portion comprising a recruitment linker that does not hybridize to a component of an assay complex and comprises at least one covalently attached electron transfer moiety
  • the invention provides methods of detecting a target nucleic acid sequence in a test sample comprising attaching said target sequence to an electrode comprising a monolayer of conductive oligomers
  • Label probes are directly or indirectly attached to the target sequence to form an assay complex, wherein the label probe comprises a first portion capable of hybridizing to a component of the assay complex, and a second portion comprising a recruitment linker that does not hybridize to a component of the assay complex and comprises at least one covalently attached electron transfer moiety
  • the method further comprises detecting electron transfer between said ETM and said electrode
  • the methods comprise attaching a target sequence to an electrode, and directly or indirectly attaching a first portion of at least one label probe containing at least one ETM to the target sequence
  • the method further comprises detecting electron transfer between said ETM and said electrode
  • the target sequence is attached to the electrode by (1) hybridization to a capture probe (2) by hybridizing a first portion of the target sequence to a first capture extender probe, and hybridizing a second portion of the first capture extender probe to a capture probe on the electrode, or (3) hybridizing a first portion of the target sequence to a first portion of a first capture extender probe, hybridizing a second portion of the first capture extender probe to a first portion of an capture probe on the electrode, hybridizing a second portion of the target sequence to a first portion of a second capture extender probe, and hybridizing a second portion of the second capture extender probe to a second portion of the capture probe
  • the label probe is attached to the target sequence by a variety of methods, including (1) hybridizing said first portion of said label probe to a first portion of
  • Kits and apparatus comprising the compositions of the method are also provided.
  • Figures 1A-10 depict depict a number of different compositions of the invention, the results are shown in Example 1 and 2 Figure 1A depicts I, also referred to as P290 Figure 1 B depicts II, also referred to as P291 Figure 1C depicts III, also referred to as W31 Figure 1 D depicts IV, also referred to as N6 Figure 1 E depicts V, also referred to as P292 Figure 1 F depicts II, also referred to as C23 Figure 1G depicts VII, also referred to as C15 Figure 1 H depicts VIII, also referred to as C95 Figure 11 depicts Y63 Figure U depicts another compound of the invention Figure 1 K depicts N11 Figure 1L depicts C131, with a phosphoramidite group and a DMT protecting group Figure 1M depicts W38, also with a phosphoramidite group and a DMT protecting group Figure 1 N depicts the commercially available moiety that enables "branching" to occur, as its incorporation into a growing oligonucleotide chain results in
  • Figure 2 depicts the synthetic scheme of a preferred attachment of an ETM, in this case ferrocene, to a nucleoside (in this case adenosine) via an oxo linkage to the nbose, forming the N6 compound of the invention
  • Figure 3 is similar to Figure 2 except that the nucleoside is cytidine, forming the W38 compound of the invention
  • Figure 4 depicts the synthetic scheme of a preferred attachment of an ETM, in this case ferrocene, to a nucleoside via the phosphate, forming the Y63 compound of the invention
  • Figure 5 depicts the synthetic scheme of a tnphosphate nucleotide, in this case adenosine, with an attached ETM, in this case ferrocene, via an oxo linkage to the nbose
  • Figure 6 depicts the use of an activated carboxylate for the addition of a nucleic acid functionalized with a primary amine to a pre-formed SAM
  • Figure 7 depicts a schematic of the use of "universal" type gene chips, utilizing restriction endonuclease sites
  • Figures 8A and 8B depicts two phosphate attachments of conductive oligomers that can be used to add the conductive oligomers at the 5' position, or any position
  • Figure 9 depicts the synthesis of an insulator (C109) to the nbose of a nucleoside for attachment to an electrode
  • Figure 10 depicts the synthetic scheme of ethylene glycol terminated conductive oligomers
  • Figures 11 A, 11 B and 11C depict the synthesis of three different "branch" points (in this case each using adenosine as the base), to allow the addition of ETM polymers
  • Figure 11 A depicts the synthesis of the N17 compound of the invention
  • Figure 11 B depicts the synthesis of the W90 compound
  • Figure 11C depicts the synthesis of the N38 compound
  • Figure 12 depicts a schematic of the synthesis of simultaneous incorporation of multiple ETMs into a nucleic acid, using the N17 "branch" point nucleoside
  • Figure 13 depicts a schematic of an alternate method of adding large numbers of ETMs simultaneously to a nucleic acid using a "branch" point phosphoramidite, in this case utilizing three branch points (although two branch points are also possible, see for example Figure 1 N) as is known in the art
  • each end point can contain any number of ETMs
  • Figure 14 shows a representative hairpin structure 500 is a target binding sequence, 510 is a loop sequence, 520 is a self-complementary region, 530 is substantially complementary to a detection probe, and 530 is the "sticky end", that is, a portion that does not hybridize to any other portion of the probe, that contains the ETMs
  • Figures 15A, 15B and 15C depict three preferred embodiments for attaching a target sequence to the electrode
  • Figure 15A depicts a target sequence 120 hybridized to a capture probe 100 linked via a attachment linker 106, which as outlined herein may be either a conductive oligomer or an insulator
  • the electrode 105 comprises a monolayer of passivation agent 107, which can comprise conductive oligomers (herein depicted as 108) and/or insulators (herein depicted as 109)
  • n is an integer of at least 1 , although as will be appreciated by those in the art, the system may not utilize a capture probe at all (i e n is zero), although this is generally not preferred
  • the upper limit of n will depend on the length of the target sequence and the required sensitivity
  • Figure 15B depicts the use of a single capture extender probe 110 with a first portion 111 that will hybridize to a first portion of the target sequence 120 and a second portion that will hybridize to the capture
  • Figures 16A, 16B, 16C, 16D, 16E, 4F and 4G depict some of the embodiments of the invention All of the monolayers depicted herein show the presence of both conductive oligomers 108 and insulators 107 in roughly a 1 1 ratio, although as discussed herein, a variety of different ratios may be used, or the insulator may be completely absent.
  • any one of these structures may be repeated for a particular target sequence, that is, for long target sequences, there may be multiple assay complexes formed
  • any of the electrode- attachment embodiments of Figure 15 may be used in any of these systems
  • Figures 16A, 16B and 16D have the target sequence 120 containing the ETMs 135, as discussed herein, these may be added enzymatically, for example during a PCR reaction using nucleotides modified with ETMs, resulting in essentially random incorporation throughout the target sequence, or added to the terminus of the target sequence
  • Figure 16C depicts the use of two different capture probes 100 and 100', that hybridize to different portions of the target sequence 120 As will be appreciated by those in the art, the 5'-3' orientation of the two capture probes in this embodiment is different
  • Figure 16C depicts the use of label probes 145 that hybridize directly to the target sequence 120
  • Figure 16C shows the use of a label probe 145, comprising a first portion 141 that hybridizes to a portion of the target sequence 120, a second portion 142 comprising ETMs 135
  • Figures 16E, 16F and 16G depict systems utilizing label probes 145 that do not hybridize directly to the target, but rather to amplifier probes that are directly (Figure 16E) or indirectly (Figures 16F and 16G) hybridized to the target sequence
  • Figure 16E utilizes an amplifier probe 150 has a first portion
  • a first label extender probe 160 comprising a first portion 161 that hybridizes to the target sequence 120 and a second portion 162 that hybridizes to a first portion 151 of amplifier probe 150
  • a second portion 152 of the amplifier probe 150 hybridizes to a first portion 141 of the label probe 140, which also comprises a recruitment linker 142 comprising ETMs 135 Figure 16G adds a second label extender probe 170, with a first portion 171 that hybridizes to a portion of the target sequence 120 and a second portion that hybridizes to a portion of the amplifier probe
  • Figure 16H depicts a system that utilizes multiple label probes The first portion 141 of the label probe
  • Figures 17A, 17B, 17C, 17D and 17E depict different possible configurations of label probes and attachments of ETMs
  • the recruitment linker is nucleic acid
  • in Figures 17D and E is is not
  • A nucleoside replacement
  • B attachment to a base
  • C attachment to a nbose
  • D attachment to a phosphate
  • E metallocene polymer (although as described herein, this can be a polymer of other ETMs as well), attached to a base, nbose or phosphate (or other backbone analogs)
  • F dendnmer structure, attached via a base, nbose or phosphate (or other backbone analogs)
  • G attachment via a "branching" structure, through base, nbose or phosphate (or other backbone analogs)
  • H attachment of metallocene (or other ETM) polymers
  • I attachment via a dendnmer structure
  • J attachment using standard link
  • Figure 18 depicts an improvement utilizing a stem-loop probe This can be desirable as it creates torsional strain on the surface-bound probe, which has been shown to increase binding efficiency and in some cases thermodynamic stability
  • the surface bound probe comprises a capture probe 100, a first stem-loop sequence 550, a target binding sequence 560, and a second stem-loop sequence 570 that is substantially complementary to the first stem-loop sequence
  • the target sequence 120 which can contain the ETMs 135 either directly or indirectly using a label probe 145, the effective concentration of the target at the surface increases
  • FIGS 19A-19AA depict some of the sequences used in Example 1
  • Figures 20A - 20O depict representative scans from the experiments outlined in Example 1 Unless otherwise noted, all scans were run at initial voltage -0 11 V, final voltage 0 5 V, with points taken every 10 mV, amplitude of 0 025, frequency of 10 Hz, a sample period of 1 sec, a quiet time of 2 sec
  • Figure 20A has a peak potential of 0 160 V, a peak current of 1 092 X 10 8 A, and a peak A of 7 563 X 10 "10
  • VA Figure 20C has a peak potential of 0 190 V, a peak current of 2 046 X 10 "7 A, and a peak area of 2 046 X 10 8
  • VA Figure 20d has a peak potential of 0 190 V, a peak current of 3 552 X 10 8 A, and a peak A of 3 568 X 10 "9
  • VA Figure 20E has a peak potential of 0 190 V, a peak current of 2 3762 X 10 "7 A, and
  • Figure 21 depicts the ligation chain reaction (LCR) experiment of Example 13
  • Figures 22A and 22B depicts the results of Example 12
  • the "hybrid code” refers to the system number, + and - refer to the presence or absence of the rRNA target
  • FIGS 23A, 23B, 23C, 23D, 23E and 23F depict the compositions and results of Example 13
  • FIGS. 24A and 24B depict the compositions and results from Example 13
  • FIGS 25A and 25B depict the set up of two of the experiments of Example 8.
  • Figure 26 shows the results of a PCR experiment as outlined in Example 9 DETAILED DESCRIPTION OF THE INVENTION
  • nucleic acid detection particularly in array formats, is rapidly expanding, with fluorescent based detection systems being the most common
  • detection based on electron transfer see U S Pat No 5,591 ,578
  • This electron transfer detection is based on the finding that electron transfer can proceed through the stacked ⁇ orbitals (the " ⁇ -way") of the heterocyc c bases of double stranded (hybridized) nucleic acid, thus allowing differentiation between single stranded and double stranded nucleic acids
  • nucleic acids are made that contain covalently attached ETMs, which, upon hybridization to a complementary strand, allows electron transfer to occur between the ETMs via the " ⁇ -way", and thus resulting in detection of a target sequence
  • Further improvements on the system described in PCT US97/20014, allows the attachment of nucleic acids to electrodes using conductive oligomers, i e chemical "wires", such that upon formation of double stranded nucleic acids containing ETMs, electron
  • the present invention is directed to the discovery that the presence or absence of the ETMs can be directly detected using conductive oligomers, that is, the electrons from the ETMs need not travel through the stacked ⁇ orbitals in order to generate a signal Instead, the presence of ETMs on the surface of a SAM, that comprises conductive oligomers, can be directly detected
  • a label probe comprising an ETM is brought to the surface, and detection of the ETM can proceed, putatively through the conductive ohgomer to the electrode
  • the role of the SAM comprising the conductive oligomers is to "raise" the electronic surface of the electrode, while still providing the benefits of shielding the electrode from solution components and reducing the amount of non-specific binding to the electrodes
  • the role of the nucleic acids is to provide specificity for a recruitment of ETMs to the surface, where they can be detected using conductive oligomers with electronically exposed termini
  • the present invention provides methods and compositions useful in the detection of nucleic acids
  • the compositions of the invention can take on a wide variety of configurations, as is generally outlined in the Figures
  • preferred systems of the invention work as follows
  • a target nucleic acid sequence is attached (via hybridization) to an electrode comprising a monolayer including conductive oligomers
  • This attachment can be either directly to a capture probe on the surface, or indirectly, using capture extender probes
  • a label probe is then added, forming an assay complex, that has a first portion that is capable of hybridizing to a component of the assay complex, and a second portion that does not hybridize to a component of the assay complex and contains at least one covalently attached ETM
  • the attachment of the label probe may be direct (i e hybridization to a portion of the target sequence), or indirect (i e hybridization to an amplifier probe that hybridizes to the target sequence), with all the required nucleic acids forming an assay complex As a result
  • compositions comprise an electrode comprising a monolayer
  • an electrode herein is meant a composition, which, when connected to an electronic device, is able to sense a current or charge and convert it to a signal
  • an electrode can be defined as a composition which can apply a potential to and/or pass electrons to or from species in the solution
  • an electrode is an ETM as described herein
  • Preferred electodes include, but are not limited to, certain metals and their oxides, including gold, platinum, palladium, silicon, aluminum, metal oxide electrodes including platinum oxide, titanium oxide, tin oxide, indium tin oxide, palladium oxide, silicon oxide, aluminum oxide, molybdenum oxide (Mo 2 0 6 ), tungsten oxide W0 3 ) and ruthenium oxides, and carbon (including glassy carbon electrodes graphite and carbon paste)
  • Preferred electrodes include gold, silicon, carbon and metal oxide electrodes, with gold being particularly preferred
  • the electrodes described herein are depicted as a flat surface, which is only one of the possible conformations of the electrode and is for schematic purposes only
  • the conformation of the electrode will vary with the detection method used
  • flat planar electrodes may be preferred for optical detection methods, or when arrays of nucleic acids are made, thus requiring addressable locations for both synthesis and detection
  • the electrode may be in the form of a tube, with the SAMs comprising conductive oligomers and nucleic acids bound to the inner surface This allows a maximum of surface area containing the nucleic acids to be exposed to a small volume of sample
  • the electrode comprises a monolayer, comprising conductive oligomers
  • monolayer or “self- assembled monolayer” or “SAM” herein is meant a relatively ordered assembly of molecules spontaneously chemisorbed on a surface, in which the molecules are oriented approximately parallel to each other and roughly perpendicular to the surface Each of the molecules includes a functional group that adheres to the surface, and a portion that interacts with neighboring molecules in the monolayer to form the relatively ordered array
  • a "mixed" monolayer comprises a heterogeneous monolayer, that is, where at least two different molecules make up the monolayer
  • the SAM may comprise conductive oligomers alone, or a mixture of conductive oligomers and insulators As outlined herein, the efficiency of oligonucleotide hybridization may increase when the oligonucleotide is at a distance from the electrode Similarly, non-specific binding of biomolecules, including the nucleic acids, to an electrode is generally reduced when a monolayer is present Thus, a mono
  • the monolayer comprises conductive oligomers
  • conductive oligomer herein is meant a substantially conducting oligomer, preferably linear, some embodiments of which are referred to in the literature as “molecular wires”
  • substantially conducting herein is meant that the oligomer is capable of transfe ⁇ ng electrons at 100 Hz
  • the conductive oligomer has substantially overlapping ⁇ -orbitals, i e conjugated ⁇ -orbitals, as between the monomenc units of the conductive oligomer, although the conductive oligomer may also contain one or more sigma ( ⁇ ) bonds
  • a conductive oligomer may be defined functionally by its ability to inject or receive electrons into or from an associated ETM
  • the conductive oligomer is more conductive than the insulators as defined herein
  • the conductive oligomers of the invention are to be distinguished from electroactive polymers, that themselves may donate or accept electrons
  • the conductive oligomers have a conductivity, S, of from between about 10 "6 to about 10 4 ⁇ cm 1 , with from about 10 5 to about 10 3 ⁇ 1 cm 1 being preferred, with these S values being calculated for molecules ranging from about 20A to about 200A
  • insulators have a conductivity S of about 10 7 ⁇ 1 cm 1 or lower, with less than about 10 8 ⁇ 'cm 1 being preferred See generally Gardner et al , Sensors and Actuators A 51 (1995) 57-66, incorporated herein by reference
  • Desired characteristics of a conductive oligomer include high conductivity, sufficient solubility in organic solvents and/or water for synthesis and use of the compositions of the invention, and preferably chemical resistance to reactions that occur i) during nucleic acid synthesis (such that nucleosides containing the conductive oligomers may be added to a nucleic acid synthesizer during the synthesis of the compositions of the invention), n) during the attachment of the conductive oligomer to an electrode, or in) during hybridization assays
  • conductive oligomers that will promote the formation of self-assembled monolayers are preferred
  • the oligomers of the invention comprise at least two monome ⁇ c subunits, as described herein As is described more fully below, oligomers include homo- and hetero-oligomers, and include polymers
  • the conductive oligomer has the structure depicted in Structure 1
  • the conductive oligomer of Structure 1 may be attached to ETMs, such as electrodes, transition metal complexes, organic ETMs, and metallocenes, and to nucleic acids, or to several of these Unless otherwise noted, the conductive oligomers depicted herein will be attached at the left side to an electrode, that is, as depicted in Structure 1 , the left “Y” is connected to the electrode as described herein If the conductive oligomer is to be attached to a nucleic acid, the right "Y", if present, is attached to the nucleic acid, either directly or through the use of a linker, as is described herein
  • Y is an aromatic group
  • n is an integer from 1 to 50
  • g is either 1 or zero
  • e is an integer from zero to 10
  • m is zero or 1
  • B-D is a tond able 10 conjugate with neighboring bonds (herein referred to as a "conjugated'boiid" , preferably selected from acetylene, B-
  • e is preferably 1
  • D is preferably carbonyl, or a heteroatom moiety, wherein the heteroatom is selected from oxygen, sulfur, nitrogen, silicon or phosphorus
  • suitable heteroatom moieties include, but are not limited to, -NH and -NR, wherein R is as defined herein, substituted sulfur, sulfonyl (-S0 2 -) sulfoxide (-SO-), phosphine oxide (-PO- and -RPO-), and thiophosphine (-PS- and -RPS-)
  • R
  • aromatic group or grammatical equivalents herein is meant an aromatic monocyclic or polycychc hydrocarbon moiety generally containing 5 to 14 carbon atoms (although larger polycychc rings structures may be made) and any carbocy c ketone or thioketone derivative thereof, wherein the carbon atom with the free valence is a member of an aromatic ring
  • Aromatic groups include arylene groups and aromatic groups with more than two atoms removed
  • aromatic includes heterocycle
  • Heterocycle or “heteroaryl” means an aromatic group wherein 1 to 5 of the indicated carbon atoms are replaced by a heteroatom chosen from nitrogen, oxygen, sulfur, phosphorus, boron and silicon wherein the atom with the free valence is a member of an aromatic ring, and any heterocyclic ketone and thioketone derivative thereof
  • heterocycle includes thienyl, furyl, pyrrolyl, pyrimidinyl, oxalyl, indolyl,
  • the Y aromatic groups of the conductive oligomer may be different, i e the conductive oligomer may be a heteroo gomer That is, a conductive oligomer may comprise a oligomer of a single type of Y groups, or of multiple types of Y groups
  • the aromatic group may be substituted with a substitution group, generally depicted herein as R R groups may be added as necessary to affect the packing of the conductive oligomers, i e R groups may be used to alter the association of the oligomers in the monolayer R groups may also be added to 1 ) alter the solubility of the oligomer or of compositions containing the oligomers, 2) alter the conjugation or electrochemical potential of the system, and 3) alter the charge or characteristics at the surface of the monolayer
  • R groups are preferred to increase solubility when solution synthesis is done
  • the R groups, and their positions are chosen to minimally effect the packing of the conductive oligomers on a surface, particularly within a monolayer, as described below
  • the R groups are chosen to minimally effect the packing of the conductive oligomers on a surface, particularly within a monolayer, as described below
  • only small R groups are used within the monolayer, with larger R grouDs generally above the surface of the monolayer
  • attachment of methyl groups to the portion of the conductive oligomer within the monolayer to increase solubility is preferred, with attachment of longer alkoxy groups, for example, C3 to C10, is preferably done above the monolayer surface
  • this generally means that attachment of ste ⁇ cally significant R groups is not done on any of the first two or three oligomer subunits, depending on the average length of the molecules making up the monolayer
  • R groups include, but are not limited to, hydrogen, alkyl, alcohol, aromatic, ammo, amido, nitro, ethers, esters, aldehydes, sulfonyl, silicon moieties, halogens, sulfur containing moieties, phosphorus containing moieties, and ethylene glycols
  • R is hydrogen when the position is unsubstituted It should be noted that some positions may allow two substitution groups, R and R', in which case the R and R' groups may be either the same or different
  • alkyl group or grammatical equivalents herein is meant a straight or branched chain alkyl group, with straight chain alkyl groups being preferred If branched, it may be branched at one or more positions, and unless specified, at any position
  • the alkyl group may range from about 1 to about 30 carbon atoms (C1 -C30), with a preferred embodiment utilizing from about 1 to about 20 carbon atoms
  • alkyl group (C1 -C20), with about C1 through about C12 to about C15 being preferred, and C1 to C5 being particularly preferred, although in some embodiments the alkyl group may be much larger
  • cycloalkyl groups such as C5 and C6 rings, and heterocyclic rings with nitrogen, oxygen, sulfur or phosphorus
  • Alkyl also includes heteroalkyl, with heteroatoms of sulfur, oxygen, nitrogen, and silicone being preferred
  • Alkyl includes substituted alkyl groups
  • substituted alkyl group herein is meant an alkyl group further comprising one or more substitution moieties "R", as defined above
  • nitro group herein is meant an -N0 2 group
  • sulfur containing moieties herein is meant compounds containing sulfur atoms, including but not limited to, thia-, thio- and sulfo- compounds, thiols (-SH and -SR), and sulfides (-RSR-)
  • phosphorus containing moieties herein is meant compounds containing phosphorus, including, but not limited to, phosphmes and phosphates
  • silicon containing moieties herein is meant compounds containing silicon
  • ether herein is meant an -O-R group
  • Preferred ethers include alkoxy groups, with -0-(CH 2 ) 2 CH 3 and -0-(CH 2 ) 4 CH 3 being preferred
  • esters herein is meant a -COOR group
  • halogen herein is meant bromine, iodine, chlorine, or fluorine
  • Preferred substituted alkyls are partially or fully halogenated alkyls such as CF 3 , etc
  • aldehyde herein is meant -RCHO groups
  • alcohol herein is meant -OH groups, and alkyl alcohols -ROH
  • ethylene glycol or "(poly)ethylene glycol” herein is meant a -(0-CH 2 -CH 2 ) n - group, although each carbon atom of the ethylene group may also be singly or doubly substituted, i e -(0-CR 2 -CR 2 ) n -, with R as described above
  • Ethylene glycol derivatives with other heteroatoms in place of oxygen i e -(N- CH 2 -CH 2 ) n - or -(S-CH 2 -CH 2 ) n -, or with substitution groups
  • substitution groups include, but are not limited to, methyl, ethyl, propyl, alkoxy groups such as -0-(CH 2 ) 2 CH 3 and -0-(CH 2 ) 4 CH 3 and ethylene glycol and derivatives thereof.
  • Preferred aromatic groups include, but are not limited to, phenyl, naphthyl, naphthalene, anthracene, phenanthroline, pyrole, pyridine, thiophene, porphyrins, and substituted derivatives of each of these, included fused ring derivatives.
  • B-D is a bond linking two atoms or chemical moieties.
  • B-D is a conjugated bond, containing overlapping or conjugated ⁇ -orbitals.
  • B-D bonds are acetylene, alkene, amide, and substituted derivatives of these three, and azo.
  • B-D bonds are acetylene, alkene and amide.
  • the oligomer components attached to double bonds may be in the trans or cis -conformation, or mixtures.
  • either B or O may include carbon, nitrogen or silicon.
  • substitution groups are- as-defined as above for R.
  • e is preferably 1 and the D moiety may be carbonyl or a heteroatom moiety as defined above.
  • the terminal B-D bond may be an amide bond
  • the rest of the B-D bonds may be acetylene bonds.
  • amide bonds when amide bonds are present, as few amide bonds as possible are preferable, but in some embodiments all the B-D bonds are amide bonds.
  • B-D bond may be present in the conductive oligomer within a monolayer as described below, and another type above the monolayer level, for example to give greater flexibility for nucleic acid hybridization when the nucleic acid is attached via a conductive oligomer.
  • n is an integer from 1 to 50, although longer oligomers may also be used (see for example Schumm et al., Angew. Chem. Int. Ed. Engl. 1994 33(13):1360).
  • the hybridization should occur at a distance from the surface, i e the kinetics of hybridization increase as a function of the distance from the surface, particularly for long oligonucleotides of 200 to 300 basepairs
  • the length of the conductive oligomer is such that the closest nucleotide of the nucleic acid is positioned from about 6A to about 100A (although distances of up to 500A may be used) from the electrode surface, with from about 15A to about 60A being preferred and from about 25A to about 60A also being preferred
  • n will depend on the size of the aromatic group, but generally will be from about 1 to about 20, with from about 2 to about 15 being preferred and from about 3 to about 10 being especially preferred
  • m is either 0 or 1 That is, when m is 0, the conductive oligomer may terminate in the B-D bond or D moiety, i e the D atom is attached to the nucleic acid either directly or via a linker
  • the conductive oligomer may terminate in the B-D bond or D moiety, i e the D atom is attached to the nucleic acid either directly or via a linker
  • the conductive oligomer may terminate in the B-D bond or D moiety, i e the D atom is attached to the nucleic acid either directly or via a linker
  • the D atom may be the nitrogen atom of the ammo-modified nbose
  • the conductive oligomer may terminate in Y, an aromatic group, i e the aromatic group is attached to the nucleic acid or linker
  • conductive oligomers falling within the Structure 1 and Structure 8 formulas, as well as other conductive oligomers, as are generally known in the art, including for example, compounds comprising fused aromatic rings or Teflon®-l ⁇ ke oligomers, such as -(CF 2 ) n -, -(CHF) n - and -(CFR) n - See for example, Schumm et al , Angew Chem Intl Ed Engl 33 1361 (1994), Grosshenny et al , Platinum Metals Rev 40(1 ) 26-35 (1996), Tour, Chem Rev 96 537-553 (1996), Hsung et al ,
  • Structure 2 is Structure 1 when g is 1 Preferred embodiments of Structure 2 include e is zero, Y is pyrole or substituted pyrole, e is zero, Y is thiophene or substituted thiophene, e is zero, Y is furan or substituted furan, e is zero, Y is phenyl or substituted phenyl, e is zero, Y is pyridme or substituted pyridme, e is 1 , B-D is acetylene and Y is phenyl or substituted phenyl (see Structure 4 below) A preferred embodiment of Structure 2 is also when e is one, depicted as Structure 3 below
  • Preferred embodiments of Structure 3 are Y is phenyl or substituted phenyl and B-D is azo, Y is phenyl or substituted phenyl and B-D is acetylene, Y is phenyl or substituted phenyl and B-D is alkene, Y is pyridme or substituted pyridme and B-D is acetylene, Y is thiophene or substituted thiophene and B-D is acetylene, Y is furan or substituted furan and B-D is acetylene, Y is thiophene or furan (or substituted thiophene or furan) and B-D are alternating alkene and acetylene bonds
  • any Structure 3 oligomers may be substituted with any of the other structures depicted herein, i e Structure 1 or 8 oligomer, or other conducting oligomer, and the use of such Structure 3 depiction is not meant to limit the scope of the invention
  • Structure 4 includes n is two, m is one, and R is hydrogen, n is three, m is zero, and R is hydrogen, and the use of R groups to increase solubility Structure ⁇
  • the conductive oligomers are pseudopeptide oligomers
  • the amide bond in Structure 5 is depicted with the carbonyl to the left, i e -
  • Structure 5 the reverse may also be used, i e -NHCO-
  • Particularly preferred embodiments of Structure 5 include n is two, m is one, and R is hydrogen, n is three, m is zero, and R is hydrogen (in this embodiment, the terminal nitrogen (the D atom) may be the nitrogen of the ammo-modified nbose), and the use of R groups to increase solubility Structure 6
  • Preferred embodiments of Structure 6 include the first n is two, second n is one, m is zero, and all R groups are hydrogen, or the use of R groups to increase solubility.
  • Preferred embodiments of Structure 7 include: the first n is three, the second n is from 1-3, with m being either 0 or 1 , and the use of R groups to increase solubility.
  • the conductive oligomer has the structure depicted in Structure 8:
  • C are carbon atoms
  • n is an integer from 1 to 50
  • m is 0 or 1
  • J is a heteroatom selected from the group consisting of oxygen, nitrogen, silicon, phosphorus, sulfur, carbonyl or sulfoxide
  • the G bond of each subunit may be the same or different than the G bonds of other subunits; that is, alternating oligomers of alkene and acetylene bonds could be used, etc.
  • G is an alkane bond
  • the number of alkane bonds in the oligomer should be kept to a minimum, with about six or less sigma bonds per conductive oligomer being preferred.
  • Alkene bonds are preferred, and are generally depicted herein, although alkane and acetylene bonds may be substituted in any structure or embodiment described herein as will be appreciated by those in the art.
  • m 0 then at least one of the G bonds is not an alkane bond.
  • the m of Structure 8 is zero In a particularly preferred embodiment, m is zero and G is an alkene bond, as is depicted in Structure 9
  • alkene oligomer of structure 9, and others depicted herein, are generally depicted in the preferred trans configuration, although oligomers of as or mixtures of trans and cis may also be used As above, R groups may be added to alter the packing of the compositions on an electrode, the hydrophilicity or hydrophobicity of the oligomer, and the flexibility, i e the rotational, torsional or longitudinal flexibility of the oligomer n is as defined above
  • R is hydrogen, although R may be also alkyl groups and polyethylene glycols or derivatives
  • the conductive oligomer may be a mixture of different types of oligomers, for example of structures 1 and 8
  • the terminus of at least some of the conductive oligomers in the monolayer are electronically exposed
  • electroconductive oligomers may or may not have terminal groups
  • there is no additional terminal group and the conductive oligomer terminates with one of the groups depicted in Structures 1 to 9, for example, a B-
  • a terminal group is added, sometimes depicted herein as "Q"
  • a terminal group may be used for several reasons, for example, to contribute to the electronic availability of the conductive oligomer for detection of ETMs, or to alter the surface of the SAM for other reasons, for example to prevent non-specific binding
  • Preferred terminal groups include -NH 2 , -OH, - COOH, and alkyl groups such as -CH 3 , and (poly)alkylox ⁇ des such as (poly)ethylene glycol, with - OCH 2 CH 2 OH, -(OCH 2 CH 2 0) 2 H, -(OCH 2 CH 2 0) 3 H, and -(OCH 2 CH 2 0) 4 H being preferred
  • the monolayer may comprise different conductive oligomer species, although preferably the different species are chosen such that a reasonably uniform SAM can be formed.
  • the monolayer may comprise different conductive oligomer species, although preferably the different species are chosen such that a reasonably uniform SAM can be formed.
  • nucleic acids are covalently attached to the electrode using conductive oligomers
  • preferred embodiments utilize conductive oligomers that terminate below the surface of the rest of the monolayer, i.e. below the insulator layer, if used, or below some fraction of the other conductive oligomers.
  • the use of different conductive oligomers may be done to facilitate monolayer formation, or to make monolayers with altered properties.
  • the monolayer may further comprise insulator moieties.
  • insulator herein is meant a substantially nonconducting oligomer, preferably linear.
  • substantially nonconducting herein is meant that the insulator will not transfer electrons at 100 Hz. The rate of electron transfer through the insulator is preferrably slower than the rate through the conductive oligomers described herein.
  • trie insulators have a conductivity, S, of about 10 "7 ⁇ "1 c ⁇ r 1 or lower, with less tharrabout 10 "8 ⁇ 'cm ' 1 being preferred. See- generally Gardner et ai., supra.
  • insulators are alkyl or heteroalkyl oligomers or moieties with sigma bonds, although any particular insulator molecule may contain aromatic groups or one or more conjugated bonds.
  • heteroalkyl herein is meant an alkyl group that has at least one heteroatom, i.e. nitrogen, oxygen, sulfur, phosphorus, silicon or boron included in the chain.
  • the insulator may be quite similar to a conductive oligomer with the addition of one or more heteroatoms or bonds that serve to inhibit or slow, preferably substantially, electron transfer.
  • Suitable insulators include, but are not limited to, -(CH 2 ) n -, -(CRH) n -, and - (CR 2 ) n -, ethylene glycol or derivatives using other heteroatoms in place of oxygen, i.e. nitrogen or sulfur (sulfur derivatives are not preferred when the electrode is gold).
  • the insulators may be substituted with R groups as defined herein to alter the packing of the moieties or conductive oligomers on an electrode, the hydrophilicity or hydrophobicity of the insulator, and the flexibility, i e the rotational, torsional or longitudinal flexibility of the insulator
  • R groups as defined herein to alter the packing of the moieties or conductive oligomers on an electrode, the hydrophilicity or hydrophobicity of the insulator, and the flexibility, i e the rotational, torsional or longitudinal flexibility of the insulator
  • branched alkyl groups may be used
  • the insulators may contain terminal groups, as outlined above, particularly to influence the surface of the monolayer
  • the length of the species making up the monolayer will vary as needed As outlined above, it appears that hybridization is more efficient at a distance from the surface
  • the species to which nucleic acids are attached (as outlined below, these can be either insulators or conductive oligomers) may be basically the same length as the monolayer forming species or longer than them, resulting in the nucleic acids being more accessible to the solvent for hybridization
  • the conductive oligomers to which the nucleic acids are attached may be shorter than the monolayer
  • the actual combinations and ratios of the different species making up the monolayer can vary widely Generally, three component systems are preferred, with the first species comprising a nucleic acid containing species (i e a capture probe, that can be attached to the electrode via either an insulator or a conductive oligomer, as is more fully described below)
  • the second species are the conductive oligomers
  • the third species are insulators
  • the first species can comprise from about 90% to about 1 %, with from about 20% to about 40% being preferred, and from about 30% to about 40% being especially preferred for short oligonucleotide targets and from about 10% to about 20% preferred for longer targets
  • the second species can comprise from about 1 % to about 90%, with from about 20% to about 90% being preferred, and from about 40% to about 60% being especially preferred
  • the third species can comprise from about 1 % to about 90% with from about 20% to about 40% being preferred, and from about 15% to about 30% being especially preferred Preferred ratios of first second.third species are 2 2 1 for short targets
  • first and second species are used, comprising the first and second species
  • the first species can comprise from about 90% to about 1 %, with from about 1% to about 40% being preferred, and from about 10% to about 40% being especially preferred
  • the second species can comprise from about 1% to about 90%, with from about 10% to about 60% being preferred, and from about 20% to about 40% being especially preferred
  • the attachment linkers with covalently attached nucleosides or nucleic acids as depicted herein are covalently attached to an electrode
  • one end or terminus of the attachment linker is attached to the nucleoside or nucleic acid, and the other is attached to an electrode
  • the attachment linker may be attached at two sites to the electrode, as is generally depicted in Structures 11-13 Generally, some type of linker is used, as depicted below as "A" in Structure 10, where "X" is the conductive oligomer, "I" is
  • A is a linker or atom
  • A is a linker or atom
  • A may be a sulfur moiety when a gold electrode is used
  • A when metal oxide electrodes are used, A may be a silicon (silane) moiety attached to the oxygen of the oxide (see for example Chen et al , Langmuir 10 3332-3337 (1994), Lenhard et al , J Electroanal Chem 78 195-201 (1977), both of which are expressly incorporated by reference)
  • A When carbon based electrodes are used, A may be an ammo moiety (preferably a primary amine, see for example Deinhammer et al , Langmuir 10 1306-1313 (1994))
  • preferred A moieties include, but are not limited to, silane moieties, sulfur moieties (including alkyl sulfur moieties), and ammo moieties
  • epoxide type linkages with redox polymers such as are known in the art are not used
  • the insulators and conductive oligomers may be attached to the electrode with more than one "A" moiety, the "A" moieties may be the same or different
  • the electrode is a gold electrode
  • "A" is a sulfur atom or moiety
  • multiple sulfur atoms may be used to attach the conductive oligomer to the electrode, such as is generally depicted below in Structures 11 , 12 and 13
  • other such structures can be made In Structures 11 , 12 and 13, the A moiety is just a sulfur atom, but substituted sulfur moieties may also be used Structure 11
  • a conductive oligomer terminating in a single carbon atom with three sulfur moities attached to the electrode may also comprise a "Q" terminal group
  • the electrode is a gold electrode, and attachment is via a sulfur linkage as is well known in the art, i e the A moiety is a sulfur atom or moiety Although the exact characteristics of the gold-sulfur attachment are not known, this linkage is considered covalent for the purposes of this invention
  • a representative structure is depicted in Structure 14, using the Structure 3 conductive oligomer, although as for all the structures depicted herein, any of the conductive oligomers, or combinations of conductive oligomers, may be used Similarly, any of the conductive oligomers or insulators may also comprise terminal groups as described herein Structure 14 depicts the "A" linker as comprising just a sulfur atom, although additional atoms may be present (i e linkers from the sulfur to the conductive oligomer or substitution groups) In addition, Structure 14 shows the sulfur atom attached to the Y aromatic group, but as will be appreciated by those in the art, it may be attached to the B-D group (i e an acety
  • the electrode is a carbon electrode, i e a glassy carbon electrode, and attachment is via a nitrogen of an amine group
  • a representative structure is depicted in Structure 15 Again, additional atoms may be present, i e Z type linkers and/or terminal groups
  • the oxygen atom is from the oxide of the metal oxide electrode
  • the Si atom may also contain other atoms, i e be a silicon moiety containing substitution groups
  • Other attachments for SAMs to other electrodes are known in the art, see for example Napier et al , Langmuir, 1997, for attachment to indium tin oxide electrodes, and also the chemisorption of phosphates to an indium tin oxide electrode (talk by H Holden Thorpe, CHI conference, May 4-5, 1998)
  • the electrode comprising the monolayer including conductive oligomers further comprises a nucleic acid capture probe
  • nucleic acid or "oligonucleotide” or grammatical equivalents herein means at least two nucleotides covalently linked together
  • a nucleic acid of the present invention will generally contain phosphodiester bonds, although in some cases, as outlined below, nucleic acid analogs are included that may have alternate backbones, comprising, for example, phosphoramide (Beaucage et al , Tetrahedron 49(10) 1925 (1993) and references therein, Letsmger, J Org Chem 35 3800 (1970), Spnnzl et al , Eur J Biochem 81 579 (1977), Letsmger et al , Nucl Acids Res 14 3487 (1986), Sawai et al, Chem Lett 805 (1984), Letsmger et al , J Am Chem Soc 110 4470 (1988), and Pau
  • nucleic acid analogs may find use in the present invention
  • mixtures of naturally occurring nucleic acids and analogs can be made, for example, at the site of conductive oligomer or ETM attachment, an analog structure may be used
  • PNA peptide nucleic acids
  • PNA backbones are substantially non-ionic under neutral conditions, in contrast to the highly charged phosphodiester backbone of naturally occurring nucleic acids
  • Tm melting temperature
  • RNA typically exhibit a 2-4°C drop in Tm for an internal mismatch Wth the non-ionic PNA backbone, the drop is closer to 7-9°C
  • salt concentration is particularly advantageous in the systems of the present invention, as a reduced salt hybridization solution has a lower Faradaic current than a physiological salt solution (in the range of 150 mM)
  • the nucleic acids may be single stranded or double stranded, as specified, or contain portions of both double stranded or single stranded sequence
  • the nucleic acid may be DNA, both genomic and cDNA, RNA or a hybrid, where the nucleic acid contains any combination of deoxy ⁇ bo- and nbo- nucleotides, and any combination of bases, including uracil, adenine, thymme, cytosme, guanme, inosme, xathanme hypoxathan e, isocytosine, isoguanme, etc
  • a preferred embodiment utilizes isocytosine and isoguanme in nucleic acids designed to be complementary to other probes, rather than target sequences, as this reduces non-specific hybridization, as is generally described in U S
  • nucleoside includes nucleotides as well as nucleoside and nucleotide analogs, and modified nucleosides such as ammo modified nucleosides
  • nucleoside includes non-naturally occunng analog structures
  • nucleoside includes non-naturally occunng analog structures
  • the capture probe nucleic acid is covalently attached to the electrode This attachment can be via a conductive oligomer or via an insulator
  • capture probe or “anchor probe” herein is meant a component of an assay complex as defined herein that allows the attachment of a target sequence to the electrode, for the purposes of detection
  • attachment of the target sequence to the capture probe may be direct (i e the target sequence hybridizes to the capture probe) or indirect (one or more capture extender probes are used)
  • covalently attached herein is meant that two moieties are attached by at least one bond, including sigma bonds, pi bonds and coordination bonds
  • the capture probes may have botf ' i nucleic and non- nucleic acid portions
  • flexible linkers such as alkyl groups, including polyethylene glycol linkers, may be used to get the nucleic acid portion of the capture probe off the electrode surface This may be particularly useful when the target sequences are large, for example
  • the capture probe nucleic acid is covalently attached to the electrode, via an "attachment linker", that can be either a conductive oligomer or via an insulator
  • an attachment linker that can be either a conductive oligomer or via an insulator
  • one end of the attachment linker is attached to a nucleic acid, and the other end (although as will be appreciated by those in the art, it need not be the exact terminus for either) is attached to the electrode
  • any of structures depicted herein may further comprise a nucleic acid effectively as a terminal group
  • the present invention provides compositions comprising nucleic acids covalently attached to electrodes as is generally depicted below in Structure 17 Structure 17
  • F is a linkage that allows the covalent attachment of the electrode and the conductive oligomer or insulator, including bonds, atoms or linkers such as is described herein, for example as "A", defined below
  • F 2 is a linkage that allows the covalent attachment of the conductive oligomer or insulator to the nucleic acid, and may be a bond, an atom or a linkage as is herein described
  • F 2 may be part of the conductive oligomer, part of the insulator, part of the nucleic acid, or exogeneous to both, for example, as defined herein for "Z"
  • the capture probe nucleic acid is covalently attached to the electrode via a conductive oligomer
  • the covalent attachment of the nucleic acid and the conductive oligomer may be accomplished in several ways In a preferred embodiment, the attachment is via attachment to the base of the nucleoside, via attachment to the backbone of the nucleic acid (either the nbose, the phosphate, or to an analogous group of a nucleic acid analog backbone), or via a transition metal ligand, as described below.
  • the techniques outlined below are generally described for naturally occunng nucleic acids, although as will be appreciated by those in the art, similar techniques may be used with nucleic acid analogs
  • the conductive oligomer is attached to the base of a nucleoside of the nucleic acid This may be done in several ways, depending on the oligomer, as is described below In one embodiment, the oligomer is attached to a terminal nucleoside, i e either the 3' or 5' nucleoside of the nucleic acid Alternatively, the conductive oligomer is attached to an internal nucleoside
  • attachment is to the 5 or 6 position of py ⁇ midines such as undine, cytosme and thymme
  • the linkage is preferably via the 8 position
  • Attachment to non-standard bases is preferably done at the comparable positions
  • the attachment is direct, that is, there are no intervening atoms between the conductive oligomer and the base
  • conductive oligomers with terminal acetylene bonds are attached directly to the base Structure 18 is an example of this linkage, using a Structure 3 conductive oligomer and undine as the base, although other bases and conductive oligomers can be used as will be appreciated by those in the art
  • the pentose structures depicted herein may have hydrogen, hydroxy, phosphates or other groups such as ammo groups attached
  • the pentose and nucleoside structures depicted herein are depicted non-conventionally, as mirror images of the normal rendering
  • the pentose and nucleoside structures may also contain additional groups, such as protecting groups, at any position, for example as needed during synthesis
  • the base may contain additional modifications as needed, i e the carbonyl or amine groups may be altered or protected, for example as is depicted in Figure 18A of PCT US97/20014 This may be required to prevent significant dimerization of conductive oligomers instead of coupling to the lodinatmg base
  • changing the components of the palladium reaction may be desirable also R groups may be preferred on longer conductive oligomers to increase solubility
  • the attachment is any number of different Z linkers, including amide and amine linkages, as is generally depicted in Structure 19 using undine as the base and a Structure 3 oligomer
  • Z is a linker
  • Z is a short linker of about 1 to about 10 atoms, with from 1 to 5 atoms being preferred, that may or may not contain alkene, alkynyl, amine, amide, azo, imine, etc , bonds
  • Linkers are known in the art, for example, homo-or hetero-bifunctional linkers as are well known (see 1994 Pierce Chemical Company catalog, technical section on cross-linkers, pages 155-200, incorporated herein by reference)
  • Preferred Z linkers include, but are not limited to, alkyl groups (including substituted alkyl groups and alkyl groups containing heteroatom moieties), with short alkyl groups, esters, amide, amine, epoxy groups and ethylene glycol and derivatives being preferred, with propyl, acetylene, and C 2 alkene being especially preferred Z may also be a sulfone group, forming sulfonamide linkages as discussed below
  • the attachment of the nucleic acid and the conductive oligomer is done via attachment to the backbone of the nucleic acid This may be done in a number of ways, including attachment to a nbose of the ⁇ bose-phosphate backbone, or to the phosphate of the backbone, or other groups of analogous backbones
  • the site of attachment in this embodiment may be to a 3' or 5' terminal nucleotide, or to an internal nucleotide, as is more fully described below
  • the conductive oligomer is attached to the nbose of the nbose-phosphate backbone This may be done in several ways As is known in the art, nucleosides that are modified at either the 2' or 3' position of the nbose with ammo groups, sulfur groups, silicone groups, phosphorus groups, or oxo groups can be made (Imazawa et al , J Org Chem , 44 2039 (1979), Hobbs et al , J Org Chem 42(4) 714 (1977), Verheyden et al , J Orrg Chem 36(2) 250 (1971 ), McGee et al , J Org Chem 61 781-785 (1996), Mikhailopulo et al , Liebigs Ann Chem 513-519 (1993), McGee et al , Nucleosides & Nucieotides 14(6) 323 (1995), ail of which are incorporated by reference) These modified
  • a preferred embodiment utilizes ammo-modified nucleosides These ammo-modified ⁇ boses can then be used to form either amide or amine linkages to the conductive oligomers
  • the ammo group is attached directly to the nbose, although as will be appreciated by those in the art, short linkers such as those described herein for "Z" may be present between the ammo group and the nbose
  • an amide linkage is used for attachment to the nbose
  • m is zero and thus the conductive oligomer terminates in the amide bond
  • the nitrogen of the ammo group of the ammo-modified nbose is the "D" atom of the conductive oligomer
  • Structure 20 has the terminal bond fixed as an amide bond
  • a heteroatom linkage is used, i e oxo, amine, sulfur, etc
  • a preferred embodiment utilizes an amine linkage
  • the nitrogen of the ammo-modified nbose may be the "D" atom of the conductive oligomer when the Structure 3 conductive oligomer is used
  • Structures 21 and 22 depict nucleosides with the Structures 3 and 9 conductive oligomers, respectively, using the nitrogen as the heteroatom, athough other heteroatoms can be used
  • both m and t are not zero
  • a preferred Z here is a methylene group, or other aliphatic alkyl linkers One, two or three carbons in this position are particularly useful for synthetic reasons, see PCT US97/20014
  • Suitable linkers include methylene and ethylene
  • the conductive oligomer is covalently attached to the nucleic acid via the phosphate of the nbose-phosphate backbone (or analog) of a nucleic acid
  • the attachment is direct, utilizes a linker or via an amide bond
  • Structure 23 depicts a direct linkage
  • Structure 24 depicts linkage via an amide bond (both utilize the Structure 3 conductive oligomer, although Structure 8 conductive oligomers are also possible)
  • Structures 23 and 24 depict the conductive oligomer in the 3' position, although the 5' position is also possible
  • both Structures 23 and 24 depict naturally occurring phosphodiester bonds, although as those in the art will appreciate, non-standard analogs of phosphodiester bonds may also be used
  • Structure 24 depicts a preferred embodiment, wherein the terminal B-D bond is an amide bond, the terminal Y is not present, and Z is a linker, as defined herein
  • the conductive oligomer is covalently attached to the nucleic acid via a transition metal ligand
  • the conductive oligomer is covalently attached to a ligand which provides one or more of the coordination atoms for a transition metal
  • the ligand to which the conductive oligomer is attached also has the nucleic acid attached, as is generally depicted below in Structure 25
  • the con ⁇ uctive oligomer is attached to one ligand
  • the nucleic acid is attached to another ligand, as is generally depicted below in Structure 26
  • the conductive oligomer is covalently attached to the nucleic acid
  • Both of these structures depict Structure 3 conductive oligomers, although other oligomers may be utilized Structures 25 and 26 depict two representative structures
  • M is a metal atom, with transition metals being preferred Suitable transition metals for use in the invention include, but are not limited to, cadmium (Cd), copper (Cu), cobalt (Co), palladium (Pd), zinc (Zn), iron (Fe), ruthenium (Ru), rhodium (Rh), osmium (Os), rhenium (Re), platinium (Pt), scandium (Sc), titanium (Ti), Vanadium (V), chromium (Cr), manganese (Mn), nickel (Ni), Molybdenum (Mo), technetium (Tc), tungsten (W), and indium (Ir) That is, the first series of transition metals, the platinum metals (Ru, Rh, Pd, Os, Ir and Pt), along with Fe, Re, W, Mo and Tc, are preferred Particularly preferred are ruthenium, rhenium, osmium, platinium, cobalt
  • L are the co-ligands, that provide the coordination atoms for the binding of the metal ion
  • the number and nature of the co-hgands will depend on the coordination number of the metal ion
  • Mono-, di- or polydentate co-ligands may be used at any position
  • r may range from zero (when all coordination atoms are provided by the other two ligands) to four, when all the co-hgands are monodentate
  • r will be from 0 to 8, depending on the coordination number of the metal ion and the choice of the other ligands
  • the metal ion has a coordination number of six and both the ligand attached to the conductive oligomer and the ligand attached to the nucleic acid are at least bidentate, that is, r is preferably zero one (i e the remaining co-hgand is bidentate) or two (two monodentate co-ligands are used)
  • Suitable ligands can be the same or different Suitable ligands fall into two categories ligands which use nitrogen, oxygen, sulfur, carbon or phosphorus atoms (depending on the metal ion) as the coordination atoms (generally referred to in the literature as sigma ( ⁇ ) donors) and organometalhc ligands such as metallocene ligands (generally referred to in the literature as pi ( ⁇ ) donors, and depicted herein as L Suitable nitrogen donating ligands are well known in the art and include, but are not limited to, NH 2 , NHR, NRR', pyridme, pyrazme, isonicotinamide, imidazole, bipyndine and substituted derivatives of bipyndine, terpy ⁇ dme and substituted derivatives, phenanthrolmes, particularly 1 ,10-phenanthrol ⁇ ne (abbreviated phen) and substituted derivatives of phen
  • Suitable sigma donating ligands using carbon, oxygen, sulfur and phosphorus are known in the art
  • suitable sigma carbon donors are found in Cotton and Wilkenson, Advanced Organic
  • oxygen ligands include crown ethers, water and others known in the art Phosphmes and substituted phosphmes are also suitable, see page 38 of Cotton and Wilkenson
  • oxygen, sulfur, phosphorus and nitrogen-donating ligands are attached in such a manner as to allow the heteroatoms to serve as coordination atoms
  • organometallic ligands are used In addition to purely organic compounds for use as redox moieties, and various transition metal coordination complexes with ⁇ -bonded organic ligand with donor atoms as heterocyclic or exocyc c substituents, there is available a wide variety of transition metal organometallic compounds with ⁇ -bonded organic ligands (see Advanced Inorganic Chemistry, 5th Ed , Cotton & Wilkinson, John Wiley & Sons, 1988, chapter 26, Organometallics, A Concise Introduction, Elschenbroich et al , 2nd Ed , 1992, VCH, and Comprehensive Organometallic Chemistry II, A Review of the Literature 1982-1994, Abel et al Ed , Vol 7, chapters 7, 8, 10 & 11 , Pergamon Press, hereby expressly incorporated by reference)
  • Such organometallic ligands include cyclic aromatic compounds such as the cyclopentadienide ion [C 5 H 5 (-1 )] and various organometall
  • the ligand is generally attached via one of the carbon atoms of the organometallic ligand, although attachment may be via other atoms for heterocychc ligands
  • Preferred organometallic ligands include metallocene ligands, including substituted derivatives and the metalloceneophanes (see page 1174 of Cotton and Wilkenson, supra)
  • derivatives of metallocene ligands such as methylcyclopentadienyl, with multiple methyl groups being preferred, such as pentamethylcyclopentadienyl, can be used to increase the stability of the metallocene
  • only one of the two metallocene ligands of a metallocene are derivatized
  • any combination of ligands may be used Preferred combinations include a) all ligands are nitrogen donating ligands, b) all ligands are organometallic ligands, and c) the ligand at the terminus of the conductive oligomer is a metallocene ligand and the ligand provided by the nucleic acid is a nitrogen donating ligand, with the other ligands, if needed, are either nitrogen donating ligands or metallocene ligands, or a mixture
  • These combinations are depicted in representative structures using the conductive oligomer of Structure 3 are depicted in Structures 27 (using phenanthrolme and ammo as representative ligands), 28 (using ferrocene as the metal-hgand combination) and 29 (using cyclopentadienyl and ammo as representative ligands)
  • the ligands used in the invention show altered fluoroscent properties depending on the redox state of the chelated metal ion As described below, this thus serves as an additional mode of detection of electron transfer between the ETM and the electrode
  • the ligand attached to the nucleic acid is an ammo group attached to the 2' or 3' position of a nbose of the nbose-phosphate backbone
  • This ligand may contain a multiplicity of ammo groups so as to form a polydentate ligand which binds the metal ion
  • Other preferred ligands include cyclopentadiene and phenanthrol e
  • metal ions to connect the nucleic acids can serve as an internal control or calibration of the system, to evaluate the number of available nucleic acids on the surface
  • metal ions are used to connect the nucleic acids to the conductive oligomers, it is generally desirable to have this metal ion complex have a different redox potential than that of the ETMs used in the rest of the system, as described below This is generally true so as to be able to distinguish the presence of the capture probe from the presence of the target sequence This may be useful for identification, calibration and/or quantification
  • the amount of capture probe on an electrode may be compared to the amount of hybridized double stranded nucleic acid to quantify the amount of target sequence in a sample This is quite significant to serve as an internal control of the sensor or system This allows a measurement either prior to the addition of target or after, on the same molecules that will be used for detection, rather than rely on a similar but different control system
  • the actual molecules that will be used for the detection can be used to be used for the detection.
  • the capture probe nucleic acids are covalently attached to the electrode via an insulator
  • insulators such as alkyl groups
  • the attachment of nucleic acids to insulators such as alkyl groups is well known, and can be done to the base or the backbone, including the nbose or phosphate for backbones containing these moieties, or to alternate backbones for nucleic acid analogs
  • different capture probes, or one capture probes with a multiplicity of different capture extender probes can be used
  • the present invention provides electrodes comprising monolayers comprising conductive oligomers and capture probes, useful in nucleic acid detection systems
  • the compositions further comprise a label probe
  • the label probe is nucleic acid, generally single stranded, although as more fully outlined below, it may contain double-stranded portions
  • the label probe comprises a first portion that is capable of hybridizing to a component of the assay complex, defined below, and a second portion that does not hybridize to a component of an assay complex and comprises at least one covalently attached ETM
  • ETMs label probes with covalently attached ETMs
  • ETMs electron donor moiety
  • electron acceptor moiety or grammatical equivalents herein refers to molecules capable of electron transfer under certain conditions It is to be understood that electron donor and acceptor capabilities are relative, that is, a molecule which can lose an electron under certain experimental conditions will be able to accept an electron under different experimental conditions It is to be understood that the number of possible electron donor moieties and electron acceptor moieties is very large, and that one skilled in the art of electron transfer compounds will be able to utilize a number of compounds in the present invention
  • Preferred ETMs include, but are not limited to, transition metal complexes, organic ETMs, and electrodes
  • the ETMs are transition metal complexes
  • Transition metals are those whose atoms have a partial or complete d shell of electrons Suitable transition metals for use in the invention are listed above
  • transition metals are complexed with a variety of ligands, L, defined above, to form suitable transition metal complexes, as is well known in the art
  • organic electron donors and acceptors may be covalently attached to the nucleic acid for use in the invention
  • organic molecules include, but are not limited to, nboflavin, xanthene dyes, azine dyes, acndine orange, diazapyrenium dichlonde (DAP 2+ ), methylviologen, ethidium bromide, quinones such as N,N'- d ⁇ methylanthra(2,1 ,9-def6,5,10-d'eOd ⁇ soqu ⁇ nol ⁇ ne dichlonde (ADIQ + ), porphy ⁇ ns ([meso-tetrak ⁇ s(N- methyl-x-pyr ⁇ d ⁇ n ⁇ um)porphyr ⁇ n tetrachlo ⁇ de], varlamme blue B hydrochlo ⁇ de, Bmdschedler's green, 2,6-d ⁇ chloro ⁇ ndophenol, 2,6-d ⁇ bromophenohnd
  • the electron donors and acceptors are redox proteins as are known in the art However, redox proteins in many embodiments are not preferred
  • ETMs are metallocenes, with ferrocene being particularly preferred
  • a plurality of ETMs are used as is shown in the examples, the use of multiple ETMs provides signal amplification and thus allows more sensitive detection limits As discussed below, while the use of multiple ETMs on nucleic acids that hybridize to complementary strands can cause decreases in T m s of the hybridization complexes depending on the number, site of attachment and spacing between the multiple ETMs, this is not a factor when the ETMs are on the recruitment linker, since this does not hybridize to a complementary sequence Accordingly, pluralities of ETMs are preferred, with at least about 2 ETMs per recruitment linker being preferred, and at least about 10 being particularly preferred, and at least about 20 to 50 being especially preferred In some instances, very large numbers of ETMs (100 to 1000) can be used
  • the portion of the label probe (or target, in some embodiments) that comprises the ETMs can be nucleic acid, or it can be a non-nucleic acid linker that links the first hybndizable portion of the label probe to the ETMs That is, since this portion of the label probe is not required for hybridization, it need not be nucleic acid, although this may be done for ease of synthesis
  • the recruitment linker may comprise double-stranded portions
  • the recruitment linker is nucleic acid (including analogs), and attachment of the ETMs can be via (1 ) a base, (2) the backbone, including the nbose, the phosphate, or comparable structures in nucleic acid analogs, (3) nucleoside replacement,
  • the recruitment linker is a nucleic acid, and comprises covalently attached ETMs
  • the ETMs may be attached to nucleosides within the nucleic acid in a variety of positions
  • Preferred embodiments include, but are not limited to, (1) attachment to the base of the nucleoside, (2) attachment of the ETM as a base replacement, (3) attachment to the backbone of the nucleic acid, including either to a nbose of the ⁇ bose-phosphate backbone or to a phosphate moiety, or to analogous structures in nucleic acid analogs, and (4) attachment via metallocene polymers, with the latter being preferred
  • the recruitment linker is nucleic acid
  • secondary label probes that have a first portion that will hybridize to a portion of the primary label probes and a second portion comprising a recruitment linker as is defined herein This is generally depicted in Figure 16H, this is similar to the use of an amplifier probe, except that both the primary and the secondary label probes comprise ETMs
  • the ETM is attached to the base of a nucleoside as is generally outlined above for attachment of the conductive oligomer Attachment can be to an internal nucleoside or a terminal nucleoside
  • the covalent attachment to the base will depend in part on the ETM chosen, but in general is similar to the attachment of conductive oligomers to bases, as outlined above Attachment may generally be done to any position of the base
  • the ETM is a transition metal complex, and thus attachment of a suitable metal ligand to the base leads to the covalent attachment of the
  • the C4 attached ammo group of cytosine, the C6 attached ammo group of adenine, or the C2 attached ammo group of guanme may be used as a transition metal ligand
  • Structure 30 depicts a representative structure in the presence of the metal ion and any other necessary ligands, Structure 30 depicts undine, although as for all the structures herein, any other base may also be used Structure 30
  • L a is a ligand, which may include nitrogen, oxygen, sulfur or phosphorus donating ligands or organometallic ligands such as metallocene ligands
  • Suitable L a ligands include, but not limited to, phenanthroline, imidazole, bpy and terpy L r and M are as defined above
  • a linker (“Z") may be included between the nucleoside and the ETM
  • the linkage may be done using a linker, which may utilize an amide linkage (see generally Telser et al J Am Chem Soc 111 7221-7226 (1989), Telser et al , J Am Chem Soc 111 7226-7232 (1989), both of which are expressly incorporated by reference)
  • a linker which may utilize an amide linkage (see generally Telser et al J Am Chem Soc 111 7221-7226 (1989), Telser et al , J Am Chem Soc 111 7226-7232 (1989), both of which are expressly incorporated by reference)
  • L is a ligand as defined above, with L r and M as defined above as well
  • L is ammo, phen, byp and terpy
  • the ETM attached to a nucleoside is a metallocene, i e thel and L r of
  • Structure 31 are both metallocene ligands, L m , as described above Structure 32 depicts a preferred embodiment wherein the metallocene is ferrocene, and the base is undine, although other bases may be used Structure 32
  • Preferred metallocenes include ferrocene, cobaltocene and osmiumocene
  • the ETM is attached to a nbose at any position of the nbose-phosphate backbone of the nucleic acid, i e either the 5' or 3' terminus or any internal nucleoside Ribose in this case can include ribose analogs
  • nucleosides that are modified at either the 2' or 3' position of the ribose can be made, with nitrogen, oxygen, sulfur and phosphorus-containing modifications possible Ammo-modified and oxygen-modified ribose is preferred See generally PCT publication WO 95/15971 , incorporated herein by reference
  • modification groups may be used as a transition metal ligand, or as a chemically functional moiety for attachment of other transition metal ligands and organometallic ligands, or organic electron donor moieties as will be appreciated by those in the art
  • a linker such as depicted herein for "Z" may be used as well, or a linker such as depicted herein for "Z
  • a metallocene serves as the ETM, and is attached via an amide bond as depicted below in Structure 33
  • the examples outline the synthesis of a preferred compound when the metallocene is ferrocene Structure 33
  • Z is a linker, as defined herein, with 1-16 atoms being preferred, and 2-4 atoms being particularly preferred, and t is either one or zero
  • oxo linkages are used, as is generally depicted in Structure 35
  • an ETM is attached to a phosphate at any position of the nbose-phosphate backbone of the nucleic acid
  • phosphodiester bond analogs such as phosphoramide or phosphoramidite linkages may be incorporated into a nucleic acid, where the heteroatom (i e nitrogen) serves as a transition metal ligand (see PCT publication WO 95/15971 , incorporated by reference)
  • the conductive oligomers depicted in Structures 23 and 24 may be replaced by El Ms
  • the composition has the structure shown in Structure 36 Structure 36
  • alkyl-based linkers can be used to create multiple branching structures comprising one or more ETMs at the terminus of each branch (although internal ETMs can be used as well) Generally, this is done by creating branch points containing multiple hydroxy groups, which optionally can then be used to add additional branch points The terminal hydroxy groups can then be used in phosphoramidite reactions to add ETMs, as is generally done below for the nucleoside replacement and metallocene polymer reactions
  • the branch point can be an internal one or a terminal one, and can be a chemical branch point or a nucleoside branch point
  • an ETM such as a metallocene is used as a "nucleoside replacement", serving as an ETM
  • the distance between the two cyclopentadiene rings of ferrocene is similar to the orthongonal distance between two bases in a double stranded nucleic acid
  • Other metallocenes in addition to ferrocene may be used, for example, air stable metallocenes such as those containing cobalt or ruthenium
  • metallocene moieties may be incorporated into the backbone of a nucleic acid, as is generally depicted in Structure 37 (nucleic acid with a nbose-phosphate backbone) and Structure 38 (peptide nucleic acid backbone) Structures 37 and 38 depict ferrocene, although as will be appreciated by those in the art, other metallocenes may be used as well
  • air stable metallocenes are preferred, including metallocenes utilizing ruthenium and cobalt as the metal
  • Z is a linker as defined above, with generally short, alkyl groups, including heteroatoms such as oxygen being preferred Generally, what is important is the length of the linker, such that minimal perturbations of a double stranded nucleic acid is effected, as is more fully described below Thus, methylene, ethylene, ethylene giycols, propylene and butylene are all preferred, with ethylene and ethylene glycol being particularly preferred.
  • each Z linker may be the same or different Structure 37 depicts a nbose-phosphate backbone, although as will be appreciated by those in the art, nucleic acid analogs may also be used, including ribose analogs and phosphate bond analogs
  • ETMs in addition to metallocenes, as nucleoside replacements or in polymer embodiments, described below
  • the ETM is a transition metal complex other than a metallocene, comprising one, two or three (or more) ligands
  • the ligands can be functiona zed as depicted for the ferrocene to allow the addition of phosphoramidite groups
  • Particularly preferred in this embodiment are complexes comprising at least two ring (for example, aryl and substituted aryl) ligands, where each of the ligands comprises functional groups for attachment via phosphoramidite chemistry
  • this type of reaction creating polymers of ETMs either as a portion of the backbone of the nucleic acid or as "side groups" of the nucleic acids, to allow amplification of the signals generated herein,
  • nucleic acid analogs are made, that is, the invention piovides nucieic acids having a backbone comprising at least one metallocene
  • a metallocene such as ferrocene (or other ETM)
  • the invention piovides nucieic acids having a backbone comprising at least one metallocene
  • nucleic acids having metallocenes attached to the backbone i e via a ribose, a phosphate, etc
  • two nucleic acids each made up of a traditional nucleic acid or analog may be covalently attached to each other via a metallocene
  • a metallocene derivative or substituted metallocene is provided, wherein each of the two aromatic rings of the metallocene has a nucleic acid substitutent group
  • it is possible to incorporate more than one metallocene into the backbone either with nucleotides in between and/or with adjacent
  • nucleic acid substitutent groups it is also desirable in some instances to add additional substituent groups to one or both of the aromatic rings of the metallocene (or ETM)
  • additional substituent groups to one or both of the aromatic rings of the metallocene (or ETM)
  • these nucleoside replacements are generally part of probe sequences to be hybridized with a substantially complementary nucleic acid, for example a target sequence or another probe sequence
  • substitutent groups to the metallocene rings to facilitate hydrogen bonding to the base or bases on the opposite strand
  • substitutent groups include, but are not limited to, amide groups, amine groups, carboxy c acids, and alcohols, including substituted alcohols
  • these substitutent groups can be attached via linkers as well, although in general this is not preferred
  • substituent groups on an ETM may be added to alter the redox properties of the ETM
  • substituent groups on an ETM may be added to alter the redox properties of the ETM
  • substituent groups on the metallocene may allow two different
  • the intermediate components are also provided.
  • the invention provides phosphoramidite metallocenes, as generally depicted in Structure 39
  • PG is a protecting group, generally suitable for use in nucleic acid synthesis, with DMT, MMT and TMT all being preferred
  • the aromatic rings can either be the rings of the metallocene, or aromatic rings of ligands for transition metal complexes or other organic ETMs
  • the aromatic rings may be the same or different, and may be substituted as discussed herein
  • Structure 40 depicts the ferrocene derivative
  • Structure 41 depicts the ferrocene peptide nucleic acid (PNA) monomer, that can be added to PNA synthesis as is known in the art and depicted within the Figures and Examples
  • the PG protecting group is suitable for use in peptide nucleic acid synthesis, with MMT, boc and Fmoc being preferred
  • ETM or metallocene polymers which are added to the nucleic acids, rather than as backbone replacements, as is more fully described below
  • the ETMs are attached as polymers, for example as metallocene polymers, in a "branched" configuration similar to the "branched DNA” embodiments herein and as outlined in U S Patent No 5,124,246, using modified functionahzed nucleotides
  • the general idea is as follows A modified phosphoramidite nucleotide is generated that can ultimately contain a free hydroxy group that can be used in the attachment of phosphoramidite ETMs such as metallocenes
  • This free hydroxy group could be on the base or the backbone, such as the ribose or the phosphate (although as will be appreciated by those in the art, nucleic acid analogs containing other structures can also be used)
  • the modified nucleotide is incorporated into a nucleic acid, and any hydroxy protecting groups are removed, thus leaving the free hydroxyl
  • ETMs such as metallocene ETMs
  • Additional phosphoramidite ETMs such as metallocenes can be added, to form "ETM polymers", including "metallocene polymers” as depicted herein, particularly for ferrocene
  • it is desirable to increase the solubility of the polymers by adding a "capping" group to the terminal ETM in the polymer, for example a final phosphate group to the metallocene as is generally depicted in Figure 12
  • a "capping" group to the terminal ETM in the polymer, for example a final phosphate group to the metallocene as is generally
  • a preferred embodiment of this general idea is outlined in the Figures
  • the 2' position of a ribose of a phosphoramidite nucleotide is first functionahzed to contain a protected hydroxy group, in this case via an oxo-hnkage, although any number of linkers can be used, as is generally described herein for Z linkers
  • the protected modified nucleotide is then incorporated via standard phosphoramidite chemistry into a growing nucleic acid
  • the protecting group is removed, and the free hydroxy group is used, again using standard phosphoramidite chemistry to add a phosphoramidite metallocene such as ferrocene
  • a similar reaction is possible for nucleic acid analogs
  • nucleic acid analogs For example, using peptide nucleic acids and the metallocene monomer shown in Structure 41, peptide nucleic acid structures containing metallocene polymers could be generated
  • the present invention provides recruitment linkers of nucleic acids comprising "branches" of metallocene polymers as is generally depicted in Figures 12 and 13 Preferred embodiments also utilize metallocene polymers from one to about 50 metallocenes >n length, with from about 5 to about 20 hemg preferred and from about 5 to about 10 being especially preferred
  • the recruitment linker is nucleic acid
  • any combination of ETM attachments may be done
  • the recruitment linker is not nucleic acid, and instead may be any sort of linker or polymer
  • any linker or polymer that can be modified to contain ETMs can be used
  • the polymers or linkers should be reasonably soluble and contain suitable functional groups for the addition of ETMs
  • a "recruitment polymer” comprises at least two or three subunits, which are covalently attached At least some portion of the monomenc subunits contain functional groups for the covalent attachment of ETMs
  • coupling moieties are used to covalently link the subunits with the ETMs
  • Preferred functional groups for attachment are ammo groups, carboxy groups, oxo groups and thiol groups, with ammo groups being particularly preferred
  • Suitable linkers include, but are not limited to, alkyl linkers (including heteroalkyl (including (poly)ethylene glycol-type structures), substituted alkyl, aryalkyl linkers, etc As above for the polymers, the linkers will comprise one or more functional groups for the attachment of ETMs, which will be done as will be appreciated by those in the art, for example through the use homo-or hetero- bifunctional linkers as are well known (see 1994 Pierce Chemical Company catalog, technical section on cross-linkers, pages 155-200, incorporated herein by reference)
  • Suitable recruitment polymers include, but are not limited to, functionahzed styrenes, such as ammo styrene, functionahzed dextrans, and polyamino acids
  • Preferred polymers are polyamino acids (both poly-D-amino acids and poly-L-ammo acids), such as polylysme, and polymers containing lysine and other ammo acids being particularly preferred
  • Other suitable polyamino acids are polyglutamic acid, polyaspartic acid, co-polymers of lysine and glutamic or aspartic acid, co-polymers of lysine with alanine, tyrosine, phenylalanine, serine, tryptophan, and/or pro ne
  • the recruitment linker comprises a metallocene polymer, as is described above
  • the attachment of the recruitment linkers to the first portion of the label probe will depend on the composition of the recruitment linker, as will be appreciated by those in the art
  • the recruitment linker is nucleic acid
  • it is generally formed during the synthesis of the first portion of the label probe, with incorporation of nucleosides containing ETMs as required
  • the first portion of the label probe and the recruitment linker may be made separately, and then attached
  • there may be an overlapping section of complementarity, forming a section of double stranded nucleic acid that can then be chemically cross nked, for example by using psoralen as is known in the art
  • attachment of the linker/polymer of the recruitment linker will be done generally using standard chemical techniques, such as will be appreciated by those in the art
  • attachment can be similar to the attachment of insulators to nucleic acids
  • recruitment linkers that are mixtures of nucleic acids and non-nucleic acids, either in a linear form (i e nucleic acid segments linked together with alkyl linkers) or in branched forms (nucleic acids with alkyl "branches" that may contain ETMs and may be additionally branched)
  • tnphosphate nucleotides comprising the ETMs of the invention to a growing nucleic acid, for example during a polymerase chain reaction (PCR)
  • PCR polymerase chain reaction
  • preferred attachments in this embodiment are to the base or ribose of the nucleotide
  • PCR amplification of a target sequence will result in target sequences comprising ETMs, generally randomly incorporated into the sequence
  • the system of the invention can then be configured to allow detection using these ETMs, as is generally depicted in Figures 16A, 16B and 16D
  • compositions utilizing electrodes comprising monolayers of conductive oligomers and capture probes, and target sequences that comprises a first portion that is capable of hybridizing to a component of an assay complex, and a second portion that does not hybridize to a component of an assay complex and comprises at least one covalently attached electron transfer moiety
  • methods utilizing these compositioi is also provided
  • ETMs may be added to non-recruitment linkers as well
  • ETMs may be added to sections of label probes that do hybridize to components of the assay complex, for example the first portion, or to the target sequence as outlined above
  • These ETMs may be used for electron transfer detection in some embodiments, or they may not, depending on the location and system
  • the target sequence containing randomly incorporated ETMs is hybridized directly to the capture probe, as is depicted in Figure 16A
  • there may be ETMs in the portion hybridizing to the capture probe If the capture probe is attached to the electrode using a conductive oligomer, these ETMs can be used to detect electron transfer as has been previously described Alternatively, these ETMs may not be specifically detected
  • the recruitment linker when the recruitment linker is nucleic acid, it may be desirable in some instances to have some or all of the recruitment linker be double stranded
  • the first recruitment linker comprises the covalently attached ETMs
  • the second recruitment linker contains the ETMs, and the first recruitment linker does not, and the ETMs are recruited to the surface by hybridization of the second recruitment linker to the first
  • both the first and second recruitment linkers comprise ETMs It should be noted, as discussed above, that nucleic acids comprising a large number of ETMs may not hybridize as well, i e the T m may be decreased, depending on the site of attachment and the characteristics of the ETM Thus, in general, when multiple ETMs are used on hybridizing strands, generally there are less than about 5, with less than about 3 being preferred, or alternatively the ETM
  • non-covalently attached ETMs may be used in one embodiment, the ETM is a hybridization indicator Hybridization indicators serve as an ETM that will preferentially associate with double stranded nucleic acid is added, usually reversibly, similar to the method of Millan et al , Anal Chem 65 2317-2323 (1993), Millan et al , Anal Chem 662943-2948 (1994), both of which are hereby expressly incorporated by reference
  • increases in the local concentration of ETMs, due to the association of the ETM hybridization indicator with double stranded nucleic acid at the surface can be monitored using the monolayers comprising the conductive oligomers
  • Hybridization indicators include mtercalators and minor and/or major groove binding moieties
  • mtercalators may be used, since intercalation generally only occurs in the presence of double stranded nucleic a d, only in the presence of double stranded nucleic acid will the ETMs concentrate Intercalating transition metal complex ETMs are.known in the art
  • major or minor groove binding moieties such as methylene blue
  • the systems of the invention may utilize non-covalently attached ETMs, as is generally described in Napier et al , Bioconj Chem 8 906 (1997), hereby expressly incorporated by reference
  • changes in the redox state of certain molecules as a result of the presence of DNA i e guanine oxidation by ruthenium complexes
  • SAMs comprising conductive oligomers
  • the present invention provides electrodes comprising monolayers comprising conductive oligomers, generally including capture probes, and either target sequences or label probes comprising recruitment linkers containing ETMs
  • the compositions of the invention are used to detect target sequences in a sample
  • target sequence or grammatical equivalents herein means a nucleic acid sequence on a single strand of nucleic acid
  • the target sequence may be a portion of a gene, a regulatory sequence, genomic DNA, cDNA, RNA including mRNA and rRNA, or others It may be any length, with the understanding that longer sequences are more specific
  • the complementary target sequence may take many forms For example, it may be contained within a larger nucleic acid sequence, i e all or part of a gene or mRNA, a restriction fragment of a plasmid or genomic DNA, among others
  • probes are made to hybridize to target sequences to determine the presence or absence of the target sequence
  • the target sequence is prepared using known techniques
  • the sample may be treated to lyse the cells, using known lysis buffers, electroporation, etc , with purification and/or amplification such as PCR occunng as needed, as will be appreciated by those in the art
  • Probes of the present invention are designed to be complementary to a target sequence (either the target sequence of the sample or to other probe sequences, as is described below), such that hybridization of the target sequence and the probes of the present invention occurs
  • this complementarity need not be perfect, there may be any number of base pair mismatches which will interfere with hybridization between the target sequence and the single stranded nucleic acids of the present invention
  • the sequence is not a complementary target sequence
  • substantially complementary herein is meant that the probes are sufficiently complementary to the target sequences to hybridize under normal reaction conditions
  • nucleic acid compositions of the invention are useful as oligonucleotide probes
  • the length of the probe will vary with the length of the target sequence and the hybridization and wash conditions
  • oligonucleotide probes range from about 8 to about 50 nucleotides, with from about 10 to about 30 being preferred and from about 12 to about 25 being especially preferred
  • very long probes may be used, e g 50 to 200-300 nucleotides in length
  • nucleosides may be replaced with nucleic acids
  • hybridization conditions may be used in the present invention, including high, moderate and low stringency conditions, see for example Maniatis et al , Molecular Cloning A Laboratory
  • hybridization conditions may also vary when a non-ionic backbone, i e PNA is used, as is known in the art
  • cross-linking agents may be added after target binding to cross-link, i e covalently attach, the two strands of the hybridization complex
  • the systems of the invention may take on a large number of different configurations, as is generally depicted in the Figures
  • there are three types of systems that can be used (1) systems in which the target sequence itself is labeled with ETMs (see Figures 16A, 16B and 16D), (2) systems in which label probes directly hybridize to the target sequences (see Figures 16C and 16H), and (3) systems in which label probes are indirectly hybridized to the target sequences, for example through the use of amplifier probes (see Figures 16E, 16F and 16G)
  • the target sequence be immobilized on the electrode surface This is preferably done using capture probes and optionally one or more capture extender probes
  • capture extender probes may be used, that allow a "universal" surface, s e a surface containing a single type of capture probe that can be used to detect any target sequence
  • capture extender probes are generally depicted in Figure 15, and have a first portion that will hybridize to all or part of the capture probe, and a second portion that will hybridize to a portion of the target sequence This then allows the generation of customized soluble probes, which as will be appreciated by those in the art is generally simpler and less costly
  • two capture extender probes may be used This has generally been done to stabilize assay complexes (for example when the target sequence is large, or when
  • the nucleic acids are added after the formation of the SAM ((4) above) This may be done in a variety of ways, as will be appreciated by those in the art
  • conductive oligomers with terminal functional groups are made, with preferred embodiments utilizing activated carboxylates and isothiocyanates, that will react with primary amines that are put onto the nucleic acid, as is generally depicted in Figure 6 using an activated carboxylate
  • activated carboxylates and isothiocyanates that will react with primary amines that are put onto the nucleic acid, as is generally depicted in Figure 6 using an activated carboxylate
  • the primary aromatic amines and secondary and tertiary amines of the bases should not react, thus allowing site specific addition of nucleic acids to the surface This allows the spotting of probes (either capture or detection probes, or both) using known methods (ink jet, spotting, etc ) onto the surface
  • binding partner pairs can be utilized, i e one binding partner is attached to the terminus of the conductive oligomer, and the other to the end of the nucleic acid This may also be done without using a nucleic acid capture probe, that is, one binding partner serves as the capture probe and the other is attached to either the target sequence or a capture extender probe
  • binding partner pairs include, but are not limited to, hapten pairs such as biotin/streptavidm, antigens/antibodies, NTA/histidme tags, etc. In general, smaller binding partners are preferred, such that the electrons can pass from the nucleic acid into the conductive oligomer to allow detection
  • the binding partner when the target sequence itself is modified to contain a binding partner, the binding partner is attached via a modified nucleotide that can be enzymatically attached to the target sequence, for example during a PCR target amplification step Alternatively, the binding partner should be easily attached to the target sequence
  • a capture extender probe may be utilized that has a nucleic acid portion for hybridization to the target as well as a binding partner (for example, the capture extender probe may comprise a non-nucleic acid portion such as an alkyl linker that is used to attach a binding partner)
  • the capture extender probe may comprise a non-nucleic acid portion such as an alkyl linker that is used to attach a binding partner
  • the target is not bound to the electrode surface using capture probes
  • what is important, as for all the assays herein is that excess label probes be removed prior to detection and that the assay complex (the recruitment linker) be in proximity to the surface
  • the assay complex may be present on beads that are added to the electrode comprising the monolayer
  • the recruitment linkers comprising the ETMs may be placed in proximity to the conductive oligomer surface using techniques well known in the art, including gravity settling of the beads on the surface, electrostatic or magnetic interactions between bead components and the surface, using binding partner attachment as outlined above Alternatively, after the removal of excess reagents such as excess label probes, the assay complex may be driven down to the surface, for example by pulsing the system with a voltage sufficient to drive the assay complex to the surface
  • preferred embodiments utilize assay complexes attached via nucleic acid capture probes
  • the target sequence itself contains the ETMs
  • this may be done using target sequences that have ETMs incorporated at any number of positions, as outlined above Representative examples are depicted in Figures 16A, 16B and 16D
  • the 3'-5' orientation of the probes and targets is chosen to get the ETM-contaming structures (i e recruitment linkers or target sequences) as close to the surface of the monolayer as possible, and in the correct orientation This may be done using attachment via insulators or conductive oligomers as is generally shown in the Figures
  • multiple capture probes can be utilized, either in a configuration such as depicted in Figure 16D, wherein the 5'-3' orientation of the capture probes is different, or where "loops" of target form when multiples of capture probes are used
  • the label probes directly hybridize to the target sequences, as is generally depicted in Figure 16C
  • the target sequence is preferably, but not required to be, immobilized on the surface using capture probes, including capture extender probes
  • Label probes are then used to bring the ETMs into proximity of the surface of the monolayer comprising conductive oligomers
  • multiple label probes are used, that is, label probes are designed such that the portion that hybridizes to the target sequence (labeled 141 in the figures) can be different for a number of different label probes, such that amplification of the signal occurs, since multiple label probes can bind for every target sequence
  • n is an integer of at least one Depending on the sensitivity desired, the length of the target sequence, the number of ETMs per label probe, etc , preferred ranges of n are from 1 to 50, with from about 1 to about 20 being particularly preferred, and from about 2 to about 5 being especially preferred.
  • n is an integer of at least one Depending on the sensitivity desired, the length
  • the configuration of the system and the label probes are designed to recruit the ETMs as close as possible to the monolayer surface
  • the label probes are hybridized to the target sequence indirectly That is, the present invention finds use in novel combinations of signal amplification technologies and electron transfer detection on electrodes, which may be particularly useful in sandwich hybridization assays, as generally depicted in Figure 16
  • the amplifier probes of the invention are bound to the target sequence in a sample either directly or indirectly Since the amplifier probes preferably contain a relatively large number of amplification sequences that are available for binding of label probes, the detectable signal is significantly increased, and allows the detection limits of the target to be significantly improved
  • These label and amplifier probes, and the detection methods described herein may be used in essentially any known nucleic acid hybridization formats, such as those in which the target is bound directly to a solid phase or in sandwich hybridization assays in which the target is bound to one or more nucleic acids that are in turn bound to the solid phase
  • the amplifier probe contains a multiplicity of amplification sequences, although in some embodiments, as described below, the amplifier probe may contain only a single amplification sequence
  • the amplifier probe may take on a number of different forms, either a branched conformation, a dendnmer conformation, or a linear "string" of amplification sequences
  • the present invention provides assay complexes comprising at least one amplifier probe
  • amplifier probe or “nucleic acid multimer” or “amplification multimer” or grammatical equivalents herein is meant a nucleic acid probe that is used to facilitate signal amplification
  • Amplifier probes comprise at least a first single-stranded nucleic acid probe sequence, as defined below, and at least one single-stranded nucleic acid amplification sequence, with a multiplicity of amplification sequences being preferred
  • Amplifier probes comprise a first probe sequence that is used, either directly or indirectly, to hybridize to the target sequence That is, the amplifier probe itself may have a first probe sequence that is substantially complementary to the target sequence (e g Figure 16E), or it has a first probe sequence that is substantially complementary to a portion of an additional probe, in this case called a label extender probe, that has a first portion that is substantially complementary to the target sequence (e g
  • the first probe sequence of the amplifier probe is substantially complementary to the target sequence, as is generally depicted in Figure 16E
  • the first probe sequence is of a length sufficient to give specificity and stability
  • the probe sequences of the invention that are designed to hybridize to another nucleic acid are at least about 5 nucleosides long, with at least about 10 being preferred and at least about 15 being especially preferred
  • the amplifier probes may form hairpin stem-loop structures in the absence of their target
  • the length of the stem double-stranded sequence will be selected such that the hairpin structure is not favored in the presence of target
  • the use of these type of probes, in the systems of the invention or in any nucleic acid detection systems, can result in a significant decrease in non-specific binding and thus an increase in the signal to noise ratio
  • these hairpin structures comprise four components
  • the first component is a target binding sequence, i e a region complementary to the target (which may be the sample target sequence or another probe sequence to which binding is desired), that is about 10 nucleosides long, with about 15 being preferred
  • the second component is a loop sequence, that can facilitate the formation of nucleic acid loops Particularly preferred in this regard are repeats of GTC, which has been identified in Fragile X Syndrome as forming turns (When PNA analogs are used, turns comprising prohne residues may be preferred) Generally, from three to five repeats are used, with four to five being preferred
  • the third component is a self-complementary region, which has a first portion that is complementary to a portion of the target sequence region and a second portion that comprises a first portion of the label probe binding sequence
  • the fourth component is substantially complementary to a label probe (or other probe, as the case may be)
  • the fourth component further comprises a "sticky end", that is, a portion that does not hybridize to any
  • the amplifier probe does not hybridize to the sample target sequence directly, but instead hybridizes to a first portion of a label extender probe, as is generally depicted in Figure 16F
  • a label extender probe As is generally depicted in Figure 16F
  • the first probe sequence of the amplifier probe is substantially complementary to a first portion or domain of a first label extender single-stranded nucleic acid probe
  • the label extender probe also contains a second portion or domain that is substantially complementary to a portion of the target sequence Both of these portions are preferably at least about 10 to about 50 nucleotides in length, with a range of about 15 to about 30 being preferred
  • the terms "first" and “second” are not meant to confer an orientation of the sequences with respect to the 5'-3' orientation of the target or probe sequences For example, assuming
  • more than one label extender probe-amplifier probe pair may be used, tht is, n is more than 1 That is, a plurality of label extender probes may be used, each with a portion that is substantially complementary to a different portion of the target sequence, this can serve as another level of amplification
  • a preferred embodiment utilizes pools of at least two label extender probes, with the upper limit being set by the length of the target sequence
  • more than one label extender probe is used with a single amplifier probe to reduce non-specific binding, as is depicted in Figure 16G and generally outlined in U S Patent No 5,681 ,697, incorporated by reference herein
  • a first portion of the first label extender probe hybridizes to a first portion of the target sequence
  • the second portion of the first label extender probe hybridizes to a first probe sequence of the amplifier probe
  • a first portion of the second label extender probe hybridizes to a second portion of the target sequence
  • the second portion of the second label extender probe hybridizes to a second probe sequence of the amplifier probe
  • the label extender probes may interact with a preamplifier probe, described below, rather than the amplifier probe directly
  • a preferred embodiment utilizes several different amplifier probes, each with first probe sequences that will hybridize to a different portion of the label extender probe
  • the different amplifier probes contain different amplification sequences, although this is generally not preferred
  • the amplifier probe also comprises at least one amplification sequence
  • amplification sequence or “amplification segment” or grammatical equivalents herein is meant a sequence that is used, either directly or indirectly, to bind to a first portion of a label probe as is more fully described below
  • the amplifier probe comprises a multiplicity of amplification sequences, with from about 3 to about 1000 being preferred, from about 10 to about 100 being particularly preferred, and about 50 being especially preferred In some cases, for example when linear amplifier probes are used, from 1 to about 20 is preferred with from about 5 to about 10 being particularly preferred
  • the amplification sequences may be linked to each other in a variety of ways, as will be appreciated by those in the art They may be covalently linked directly to each other, or to intervening sequences or chemical moieties, through nucleic acid linkages such as phosphodiester bonds, PNA bonds, etc , or through interposed linking agents such ammo acid, carbohydrate or polyol bridges, or through other cross-linking agents or binding partners
  • the s ⁇ te(s) of linkage may be at the ends of a segment, and/or at one or more internal nucleotides in the strand
  • the amplification sequences are attached via nucleic acid linkages
  • branched amplifier probes are used, as are generally described in U S Patent No 5,124,246, hereby incorporated by reference Branched amplifier probes may take on "fork-like” or “comb-like” conformations "Fork-like" branched amplifier probes generally have three or more oligonucleotide segments emanating from a point of origin to form a branched structure The point of origin may be another nucleotide segment or a multifunctional molecule to whcih at least three segments can be covalently or tightly bound "Comb- ke" branched amplifier probes have a linear backbone with a multiplicity of sidechain ohgonucleotides extending from theijackbone.
  • the pendant segments will normally depend from a modified nucleotide or other organic moiety having the appropriate functional groups for attachment of ohgonucleotides
  • a large number of amplification sequences are available for binding, either directly or indirectly, to detection probes
  • these structures are made as is known in the art, using modified multifunctional nucleotides, as is described in U S Patent Nos 5,635,352 and 5,124,246, among others
  • dendnmer amplifier probes are used, as are generally described in U S Patent No 5,175,270, hereby expressly incorporated by reference Dendrime ⁇ c amplifier probes have amplification sequences that are attached via hybridization, and thus have portions of double-stranded nucleic acid as a component of their structure The outer surface of the dendnmer amplifier probe has a multiplicity of amplification sequences
  • linear amplifier probes are used, that have individual amplification sequences linked end-to-end either directly or with short intervening sequences to form a polymer
  • linear amplification probes may form hairpin stem-loop structures, as is depicted in Figure 14
  • the linear amplifier probe has a single amplification sequence This may be useful when cycles of hyb ⁇ dization/disassociation occurs, forming a pool of amplifier probe that was hybridized to the target and then removed to allow more probes to bind, or when large numbers of ETMs are used for each label probe
  • linear amplifier probes comprise a multiplicity of amplification sequences
  • the amplifier probe may be totally linear, totally branched, totally dend ⁇ meric, or any combination thereof
  • the amplification sequences of the amplifier probe are used, either directly or indirectly, to bind to a label probe to allow detection
  • the amplification sequences of the amplifier probe are substantially complementary to a first portion of a label probe
  • amplifier extender probes are used, that have a first portion that binds to the amplification sequence and a second portion that binds to the first portion of the label probe
  • compositions of the invention may include "preamplifier” molecules, which serves a bridging moiety between the label extender molecules and the amplifier probes In this way, more amplifier and thus more ETMs are ultimately bound to the detection probes
  • Preamplifier molecules may be either linear or branched, and typically contain in the range of about 30-3000 nucleotides
  • reaction may include a variety of other reagents may be included in the assays These include reagents like salts, buffers, neutral proteins, e g albumin, detergents, etc which may be used to facilitate optimal hybridization and detection, and/or reduce non-specific or background interactions Also reagents that otherwise improve the efficiency of the assay, such as protease inhibitors, nuclease inhibitors, anti-microbial agents, etc , may be used, depending on the sample preparation methods and purity of the target
  • the methods are as follows
  • the target is initially immobilized or attached to the electrode
  • this is done by forming a hybridization complex between a capture probe and a portion of the target sequence
  • a preferred embodiment utilizes capture extender probes, in this embodiment, a hybridization complex is formed between a portion of the target sequence and a first portion of a capture extender probe, and an additional hybridization complex between a second portion of the capture extender probe and a portion of the capture probe
  • Additional preferred embodiments utilize additional capture probes, thus forming a hybridization complex between a portion of the target sequence and a first portion of a second capture extender probe, and an additional hybridization complex between a second portion of the second capture extender probe and a second portion of the capture probe
  • the attachment of the target sequence to the electrode is done simultaneously with the other reactions
  • the method proceeds with the introduction of amplifier probes, if utilized
  • the amplifier probe comprises a first probe sequence that is substantially complementary to a portion of the target sequence, and at least one amplification sequence
  • the first probe sequence of the amplifier probe is hybridized to the target sequence, and any unhyb ⁇ dized amplifier probe is removed.
  • the target sequence is immobilized on a surface such as an electrode
  • the removal of excess reagents generally is done via one or more washing steps, as will be appreciated by those in the art
  • the target may be immobilized on any solid support
  • the removal of excess reagents such as the probes ot the invention may be done by adding beads (i e solid support particles) that contain complementary sequences to the probes, such that the excess probes bind to the beads
  • the beads can then be removed, for example by cent ⁇ fugation, filtration, the application of magnetic or electrostatic fields, etc
  • the reaction mixture is then subjected to conditions (temperature, high salt, changes in pH, etc ) under which the amplifier probe disassociates from the target sequence, and the amplifier probe is collected
  • the amplifier probe may then be added to an electrode comprising capture probes for the amplifier probes, label probes added, and detection is achieved
  • a larger pool of probe is generated by adding more amplifier probe to the target sequence and the hybndization/disassociation reactions are repeated, to generate a larger pool of amplifier probe. This pool of amplifier probe is then added to an electrode comprising amplifier capture probes, label probes added, and detection proceeds
  • the target sequence be immobilized on a solid support, including an electrode, using the methods described herein, although as will be appreciated by those in the art, alternate solid support attachment technologies may be used, such as attachment to glass, polymers, etc It is possible to do the reaction on one solid support and then add the pooled amplifier probe to an electrode for detection
  • the amplifier probe comprises a multiplicity of amplification sequences
  • the first probe sequence of the amplifier probe is hybridized to the target sequence, and any unhybndized amplifier probe is removed
  • preferred embodiments utilize immobilized target sequences, wherein the target sequences are immobilized by hybridization with capture probes that are attached to the electrode, or hybridization to capture extender probes that in turn hybridize with immobilized capture probes as is described herein
  • the capture probes and the detection probes are immobilized on the electrode, generally at the same "address"
  • the first probe sequence of the amplifier probe is hybridized to a first portion of at least one label extender probe, and a second portion of the label extender probe is hybridized to a portion of the target sequence
  • Other preferred embodiments utilize more than one label extender probe
  • the amplification sequences of the amplifier probe are used directly for detection, by hybridizing at least one label probe sequence
  • the invention thus provides assay complexes that minimally comprise a target sequence and a label probe "Assay complex" herein is meant the collection of hybridization complexes comprising nucleic acids, including probes and targets, that contains at least one ETM and thus allows detection
  • the composition of the assay complex depends on the use of the different probe component outlined herein
  • the assay complex comprises the capture probe and the target sequence
  • the assay complexes may also include label probes, capture extender probes, label extender probes, and amplifier probes, as outlined herein, depending on the configuration used
  • the assays are generally run under stringency conditions which allows formation of the label probe hybridization complex only in the presence of target Stringency can be controlled by altering a step parameter that is a thermodynamic variable, including, but not limited to, temperature, formamide concentration, salt concentration, chaotropic salt concentration pH, organic solvent concentration, etc
  • a preferred method is as follows Single-stranded target sequence is incubated under hybridization conditions with the capture extender probes and the label extender probes A preferred embodiment does this reaction in the presence of the electrode with immobilized capture probes, although this may also be done in two steps, with the initial incubation and the subsequent addition to the electrode Excess reagents are washed off, and amplifier probes are then added If preamplifier probes are used, they may be added either prior to the amplifier probes or simultaneously with the amplifier probes Excess reagents are washed off, and label probes are then added Excess reagents are washed off, and detection proceeds as outlined below
  • a number of capture probes that are each substantially complementary to a different portion of the target sequence are used
  • the system when amplifier probes are used, the system is generally configured such that upon label probe binding, the recruitment linkers comprising the ETMs are placed in proximity to the monolayer surface
  • the length of the linkers from the nucleic acid point of attachment to the ETMs may vary, particularly with the length of the capture probe when capture extender probes are used That is, longer capture probes, with capture extenders, can result in the target sequences being "held” further away from the surface than for shorter capture probes Adding extra linking sequences between the probe nucleic acid and the ETMs can result in the ETMs being spatially closer to the surface, giving better results
  • nucleic acids utilized in the invention may also be ligated together prior to detection, if applicable, by using standard molecular biology techniques such as the use of a gase Similarly, if desirable for stability, cross-linking agents may be added to hold the structures stable
  • compositions of the invention are generally synthesized as outlined below, generally utilizing techniques well known in the art As will be appreciated by those in the art, many of the techniques outlined below are directed to nucleic acids containing a nbose-phosphate backbone However, as outlined above, many alternate nucleic acid analogs may be utilized, some of which may not contain either ribose or phosphate in the backbone In these embodiments, for attachment at positions other than the base, attachment is done as will be appreciated by those in the art, depending on the backbone Thus, for example, attachment can be made at the carbon atoms of the PNA backbone, as is described below, or at either terminus of the PNA
  • compositions may be made in several ways
  • a preferred method first synthesizes a conductive oligomer attached to a nucleoside, with addition of additional nucleosides to form the capture probe followed by attachment to the electrode
  • the whole capture probe may be made and then the completed conductive oligomer added, followed by attachment to the electrode
  • a monolayer of conductive oligomer (some of which have functional groups for attachment of capture probes) is attached to the electrode first, followed by attachment of the capture probe
  • the latter two methods may be preferred when conductive oligomers are used which are not stable in the solvents and under the conditions used in traditional nucleic acid synthesis
  • compositions of the invention are made by first forming the conductive oligomer covalently attached to the nucleoside, followed by the addition of additional nucleosides to form a capture probe nucleic acid, with the last step comprising the addition of the conductive oligomer to the electrode
  • the attachment of the conductive oligomer to the nucleoside may be done in several ways In a preferred embodiment, all or part of the conductive oligomer is synthesized first (generally with a functional group on the end for attachment to the electrode), which is then attached to the nucleoside
  • nucleosides are then added as required, with the last step generally being attachment to the electrode
  • oligomer units are added one at a time to the nucleoside, with addition of additional nucleosides and attachment to the electrode
  • a number of representative syntheses are shown in the Figures of PCT US97/20014, expressly incorporated herein by reference
  • the conductive oligomer is then attached to a nucleoside that may contain one (or more) of the oligomer units, attached as depicted herein
  • attachment is to a ribose of the nbose-phosphate backbone
  • attachment via amide and amine linkages are possible (see Figures 1 and 2 of CPT US97/20014)
  • attachment is via a phosphate of the nbose-phosphate backbone
  • Figure 4 shows attachment at the 3' position of the ribose
  • attachment can also be made via the 2' position
  • Z is an ethylene linker, although other linkers may be used as well, as will be appreciated by those in the art
  • attachment is via the base
  • a general scheme is depicted in Figure 3 of PCT US97/20014, using undine as the nucleoside and a phenylene-acetylene conductive oligomer
  • amide linkages are also possible, using techniques well known in the art
  • protecting groups may be added to the base prior to addition of the conductive oligomers, as is generally outlined in Figures 10 and 11 of PCT US97/20014
  • the palladium cross-coupling reactions may be altered to prevent dimerization problems, i e two conductive oligomers dime ⁇ zing, rather than coupling to the base
  • attachment to the base may be done by making the nucleoside with one unit of the oligomer, followed by the addition of others
  • modified nucleosides Once the modified nucleosides are prepared, protected and activated, prior to attachment to the electrode, they may be incorporated into a growing oligonucleotide by standard synthetic techniques (Gait, Oligonucleotide Synthesis A Practical Approach, IRL Press, Oxford, UK 1984, Eckstein) in several ways
  • one or more modified nucleosides are converted to the t ⁇ phosphate form and incorporated into a growing oligonucleotide chain by using standard molecular biology techniques such as with the use of the enzyme DNA polymerase I, T4 DNA polymerase, T7 DNA polymerase, Taq DNA polymerase, reverse transc ⁇ ptase, and RNA polymerases
  • DNA polymerase I DNA polymerase I
  • T4 DNA polymerase T7 DNA polymerase
  • Taq DNA polymerase reverse transc ⁇ ptase
  • RNA polymerases for the incorporation of a 3' modified nucleoside to a nucleic acid, terminal deoxynucleotidyltransferase may be used (Ratliff, Terminal deoxynucleotidyltransferase In The Enzymes, Vol 14A P D Boyer ed pp 105-118 Academic Press, San Diego, CA 1981)
  • ETM attachment to the base or the backbone
  • nucleic acids comprising ETMs in situ
  • a target sequence can hybridize to a capture probe (for example on the surface) in such a way that the terminus of the target sequence is exposed, i e unhybndized
  • enzyme and t ⁇ phosphate nucleotides labelled with ETMs allows the in situ creation of the label
  • using labeled nucleotides recognized by polymerases can allow simultaneous PCR and detection, that is, the target sequences are generated in situ
  • the modified nucleoside is converted to the phosphoramidite or H- phosphonate form, which are then used in solid-phase or solution syntheses of ohgonucleotides
  • the modified nucleoside either for attachment at the ribose (i e ammo- or thiol-modified nucleosides) or the base, is incorporated into the oligonucleotide at either an internal position or the 5' terminus
  • DMT 4',4-d ⁇ methoxyt ⁇ tyl
  • a preferred method utilizes the attachment of the modified nucleoside (or the nucleoside replacement) to controlled pore glass (CPG) or other o gomeric supports
  • CPG controlled pore glass
  • the modified nucleoside is protected at the 5' end with DMT, and then reacted with succinic anhydride with activation
  • the resulting succmyl compound is attached to CPG or other ohgomeric supports as is known in the art
  • Further phosphoramidite nucleosides are added, either modified or not, to the 5' end after deprotection
  • the present invention provides conductive oligomers or insulators covalently attached to nucleosides attached to solid ohgomeric supports such as CPG, and phosphoramidite derivatives of the nucleosides of the invention
  • the invention further provides methods of making label probes with recruitment linkers comprising ETMs
  • ETMs these synthetic reactions will depend on the character of the recruitment linker and the method of attachment of the ETM, as will be appreciated by those in the art
  • the label probes are generally made as outlined herein with the incorporation of ETMs at one or more positions
  • a transition metal complex is used as the ETM
  • synthesis may occur in several ways
  • the l ⁇ gand(s) are added to a nucleoside, followed by the transition metal ion, and then the nucleoside with the transition metal complex attached is added to an oligonucleotide, i e by addition to the nucleic acid synthesizer
  • the hgand(s) may be attached, followed by incorportation into a growing oligonucleotide chain, followed by the addition of the metal ion
  • ETMs are attached to a ribose of the nbose-phosphate backbone This is generally done as is outlined herein for conductive oligomers, as described herein, and in PCT publication WO 95/15971 , using ammo-modified or oxo-modified nucleosides, at either the 2' or 3' position of the ribose
  • the ammo group may then be used either as a ligand, for example as a transition metal ligand for attachment of the metal ion, or as a chemically functional group that can be used for attachment of other ligands or organic ETMs, for example via amide linkages, as will be appreciated by those in the art
  • the examples describe the synthesis of nucleosides with a variety of ETMs attached via the ribose
  • ETMs are attached to a phosphate of the nbose-phosphate backbone
  • this may be done using phosphodiester analogs such as phosphoramidite bonds, see generally PCT publication WO 95/15971 , or can be done in a similar manner to that depicted in Figures 4 and 5 of PCT US97/20014, where the conductive oligomer is replaced by a transition metal ligand or complex or an organic ETM, as well as is outlined in the Examples
  • ETMs are attached to a base of the nucleoside
  • ammo groups of the base either naturally occurring or added as is described herein (see the fiigures, for example) are used either as ligands for transition metal complexes or as a chemically functional group that can be used to add other ligands, for example via an amide linkage, or organic ETMs
  • nucleosides containing halogen atoms attached to the heterocychc ring are commercially available Acetylene linked ligands may be added using the halogenated bases, as is generally known, see for example, Tzahs et al , Tetrahedron Lett 36(34) 6017-6020 (1995), Tzahs et al , Tetrahedron Lett 36(2) 3489-3490 (1995), and Tza s et al , Chem Communications (in press) 1996,
  • the nucleosides are made with transition metal ligands, incorporated into a nucleic acid, and then the transition metal ion and any remaining necessary ligands are added as is known in the art In an alternative embodiment, the transition metal ion and additional ligands are added prior to incorporation into the nucleic acid
  • the attachment linker is attached to the electrode
  • the method will vary depending on the type of electrode used As is described herein, the attachment linkers are generally made with a terminal "A" linker to facilitate attachment to the electrode
  • a sulfur-gold attachment is considered a covalent attachment
  • conductive oligomers, insulators, and attachment linkers are covalently attached via sulfur linkages to the electrode
  • traditional protecting groups for use of attaching molecules to gold electrodes are generally not ideal for use in both synthesis of the compositions described herein and inclusion in oligonucleotide synthetic reactions
  • the present invention provides novel methods for the attachment of conductive oligomers to gold electrodes, utilizing unusual protecting groups, including ethylpy ⁇ dine, and t ⁇ methylsilylethyl as is depicted in the Figures
  • unusual protecting groups including ethylpy ⁇ dine, and t ⁇ methylsilylethyl as is depicted in the Figures
  • traditional protecting groups such as acetyl groups and others may be used See Greene et al , supra
  • the subunit of the conductive oligomer which contains the sulfur atom for attachment to the electrode is protected with an ethyl-py ⁇ dme or t ⁇ methylsiiylethyl group
  • this is generally done by contacting the subunit containing the sulfur atom (preferably in the form of a sulfhydryl) with a vinyl pyridme group or vinyl t ⁇ methylsilylethyl group under conditions whereby an ethylpy ⁇ dine group or t ⁇ methylsilylethyl group is added to the sulfur atom
  • This subunit also generally contains a functional moiety for attachment of additional subunits, and thus additional subunits are attached to form the conductive oligomer
  • the conductive oligomer is then attached to a nucleoside, and additional nucleosides attached
  • the protecting group is then removed and the sulfur-gold covalent attachment is made Alternatively, all or part of the conductive oligomer is made, and then either a subunit containing a protected sulfur atom is added, or a sulfur atom is added and then protected
  • the conductive oligomer is then attached to a nucleoside, and additional nucleosides attached Alternatively, the conductive oligomer attached to a nucleic acid is made, and then either a subunit containing a protected sulfur atom is added, or a sulfur atom is added and then protected
  • the ethyl pyridme protecting group may be used as above, but removed after one or more steps and replaced with a standard protecting group like a disulfide Thus, the e
  • subunit of a conductive polymer herein is meant at least the moiety of the conductive oligomer to which the sulfur atom is attached, although additional atoms may be present, including either functional groups which allow the addition of additional components of the conductive oligomer, or additional components of the conductive oligomer
  • a subunit comprises at least the first Y group
  • a preferred method comprises 1 ) adding an ethyl pyridme or t ⁇ methylsilylethyl protecting group to a sulfur atom attached to a first subunit of a conductive oligomer, generally done by adding a vinyl pyridme or t ⁇ methylsiiylethyl group to a sulfhydryl, 2) adding additional subunits to form the conductive oligomer, 3) adding at least a first nucleoside to the conductive oligomer, 4) adding additional nucleosides to the first nucleoside to form a nucleic acid, 5) attaching the conductive oligomer to the gold electrode This may also be done in the absence of nucleosides, as is described in the
  • the above method may also be used to attach insulator molecules to a gold electrode
  • a monolayer comprising conductive oligomers (and optionally insulators) is added to the electrode.
  • the chemistry of addition is similar to or the same as the addition of conductive oligomers to the electrode, i e using a sulfur atom for attachment to a gold electrode, etc
  • compositions comprising monolayers in addition to the conductive oligomers covalently attached to nucleic acids may be made in at least one of five ways (1 ) addition of the monolayer, followed by subsequent addition of the attachment linker-nucleic acid complex, (2) addition of theattachment linker-nucleic acid complex followed by addition of the monolayer, (3) simultaneous addition of the monolayer and attachment linker-nucleic acid complex, (4) formation of a monolayer (using any of 1 , 2 or 3) which includes attachment linkers which terminate in a functional moiety suitable for attachment of a completed nucleic acid, or (5) formation of a monolayer which includes attachment linkers which terminate in a functional moiety suitable for nucleic acid synthesis, i e the nucleic acid is synthesized on the surface of the monolayer as is known in the art
  • suitable functional moieties include, but are not limited to, nucleosides, ammo groups, carboxyl groups, protected sulfur moieties, or hydroxy I groups for phosphoramidite addition
  • the nucleic acid is a peptide nucleic acid or analog
  • the invention provides peptide nucleic acids with at least one covalently attached ETM or attachment linker
  • these moieties are covalently attached to an monome ⁇ c subunit of the PNA
  • monome ⁇ c subunit of PNA herein is meant the -NH-CH 2 CH 2 -N(COCH 2 -Base)-CH 2 -CO- monomer, or derivatives (herein included within the definition of "nucleoside") of PNA
  • the number of carbon atoms in the PNA backbone may be altered, see generally Nielsen et al , Chem Soc Rev 1997 page 73, which discloses a number of PNA derivatives, herein expressly incorporated by reference
  • the amide bond linking the base to the backbone may be altered, phosphoramide and sulfuramide bonds may be used Alternatively, the moieties are attached to an internal monomenc subunit By "intern
  • the moieties are covalently attached to the backbone of the PNA monomer
  • the attachment is generally to one of the unsubstituted carbon atoms of the monomenc subunit, preferably the ⁇ -carbon of the backbone, as is depicted in Figures 31 and 32, although attachment at either of the carbon 1 or 2 positions, or the ⁇ -carbon of the amide bond linking the base to the backbone may be done
  • moieties are added at the ⁇ -carbon atoms, either to a terminal monomenc subunit or an internal one
  • a modified monomenc subunit is synthesized with an ETM or an attachment linker, or a functional group for its attachment, and then the base is added and the modified monomer can be incorporated into a growing PNA chain
  • Figure 31 of PCT US97/20014 depicts the synthesis of a conductive oligomer covalently attached to the backbone of a PNA monomenc subunit
  • Figure 32 of PCT US97/20014 depicts the synthesis of a ferrocene attached to the backbone of a monomenc subunit
  • electrodes may be made that have any combination of nucleic acids, conductive oligomers and insulators
  • compositions of the invention may additionally contain one or more labels at any position
  • label herein is meant an element (e g an isotope) or chemical compound that is attached to enable the detection of the compound
  • Preferred labels are radioactive isotopic labels, and colored or fluorescent dyes
  • the labels may be incorporated into the compound at any position
  • the compositions of the invention may also contain other moieties such as cross-linking agents to facilitate cross-linking of the target-probe complex See for example, Lukhtanov et al , Nucl Acids Res 24(4) 683 (1996) and Tabone et al , Biochem 33 375 (1994), both of which are expressly incorporated by reference Once made, the compositions find use in a number of applications, as described herein.
  • compositions of the invention find use in hybridization assays.
  • electrodes can be made that have a single species of nucleic acid, i.e. a single nucleic acid sequence, or multiple nucleic acid species.
  • a solid support such as an electrode
  • oligonucleotide arrays are well known in the art.
  • techniques are known for "addressing" locations within an electrode and for the surface modification of electrodes.
  • arrays of different nucleic acids are laid down on the electrode, each of which are covalently attached to the electrode via a conductive linker.
  • the number of different probe species of oligonucleotides may vary widely, from one to thousands, with from about 4 to about 100,000 being preferred, and from about 10 to about 10,000 being particularly preferred.
  • detection proceeds with electronic initiation. Without being limited by the mechanism or theory, detection is based on the transfer of electrons from the ETM to the electrode.
  • Detection of electron transfer i.e. the presence of the ETMs, is generally initiated electronically, with voltage being preferred.
  • a potential is applied to the assay complex. Precise control and variations in the applied potential can be via a potentiostat and either a three electrode system (one reference, one sample (or working) and one counter electrode) or a two electrode system (one sample and one counter electrode). This allows matching of applied potential to peak potential of the system which depends in part on the choice of ETMs and in part on the conductive oligomer used, the composition and integrity of the monolayer, and what type of reference electrode is used. As described herein, ferrocene is a preferred ETM.
  • a co-reductant or co-oxidant (collectively, co-redoxant) is used, as an additional electron source or sink. See generally Sato et al., Bull. Chem. Soc. Jpn 66:1032 (1993); Uosaki et al., Electrochimica Acta 36:1799 (1991); and Alleman et al., J. Phys. Chem 100:17050
  • an input electron source in solution is used in the initiation of electron transfer, preferably when initiation and detection are being done using DC current or at AC frequencies where diffusion is not limiting.
  • preferred embodiments utilize monolayers that contain a minimum of "holes", such that short-circuiting of the system is avoided. This may be done in several general ways.
  • an input electron source is used that has a lower or similar redox potential than the ETM of the label probe. Thus, at voltages above the redox potential of the input electron source, both the ETM and the input electron source are oxidized and can thus donate electrons; the ETM donates an electron to the electrode and the input source donates to the ETM.
  • ferrocene as a ETM attached to the compositions of the invention as described in the examples, has a redox potential of roughly 200 mV in aqueous solution (which can change significantly depending on what the ferrocene is bound to, the manner of the linkage and the presence of any substitution groups).
  • Ferrocyanide an electron source, has a redox potential of roughly 200 mV as well (in aqueous solution). Accordingly, at or above voltages of roughly 200 mV, ferrocene is converted to ferricenium, which then transfers an electron to the electrode. Now the ferricyanide can be oxidized to transfer an electron to the ETM.
  • the electron source serves to amplify the signal generated in the system, as the electron source molecules rapidly and repeatedly donate electrons to the ETM attached to the nucleic acid.
  • the rate of electron donation or acceptance will be limited by the rate of diffusion of the co-reductant, the electron transfer between the co-reductant and the ETM, which in turn is affected by the concentration and size, etc.
  • input electron sources that have lower redox potentials than the ETM are used. At voltages less than the redox potential of the ETM, but higher than the redox potential of the electron source, the input source such as ferrocyanide is unable to be oxided and thus is unable to donate an electron to the ETM; i.e. no electron transfer occurs. Once ferrocene is oxidized, then there is a pathway for electron transfer.
  • an input electron source is used that has a higher redox potential than the ETM of the label probe.
  • luminol an electron source
  • the ferrocene is oxided, and transfers a single electron to the electrode via the conductive oligomer.
  • the ETM is unable to accept any electrons from the luminol electron source, since the voltages are less than the redox potential of the luminol.
  • the luminol then transfers an electron to the ETM, allowing rapid and repeated electron transfer.
  • the electron source serves to amplify the signal generated in the system, as the electron source molecules rapidly and repeatedly donate electrons to the ETM of the label probe.
  • Luminol has the added benefit of becoming a chemiluminiscent species upon oxidation (see Jirka et al., Analytica Chimica Acta 284:345 (1993)), thus allowing photo-detection of electron transfer from the
  • luminol can only be oxidized by transferring an electron to the ETM on the label probe
  • the ETM is not present, i e when the target sequence is not hybridized to the composition of the invention, luminol is not significantly oxidized, resulting in a low photon emission and thus a low (if any) signal from the luminol In the presence of the target, a much larger signal is generated
  • the measure of luminol oxidation by photon emission is an indirect measurement of the ability of the ETM to donate electrons to the electrode
  • photon detection is generally more sensitive than electronic detection, the sensitivity of the system may be increased
  • Suitable electron source molecules include, but are not limited to, ferricyanide, and luminol
  • ETM such as a metallocene receiving an electron from the electrode, converting it to the metalhcenium, with the output electron acceptor then accepting the electron rapidly and repeatedly
  • cobalticenium is the preferred ETM
  • the presence of the ETMs at the surface of the monolayer can be detected in a variety of ways
  • a variety of detection methods may be used, including, but not limited to, optical detection (as a result of spectral changes upon changes in redox states), which includes fluorescence, phosphorescence, luminiscence, chemiluminescence, electrochemiluminescence, and refractive index, and electronic detection, including, but not limited to, amperommetry, voltammetry, capacitance and impedence
  • optical detection as a result of spectral changes upon changes in redox states
  • electronic detection including, but not limited to, amperommetry, voltammetry, capacitance and impedence
  • These methods include time or frequency dependent methods based on AC or DC currents, pulsed methods, lock-in techniques, filtering (high pass, low pass, band pass), and time-resolved techniques including time-resolved fiuoroscence
  • the efficient transfer of electrons from the ETM to the electrode results in stereotyped changes in the redox state of the ETM
  • ETMs including the complexes of ruthenium containing bipyndine, pyridme and imidazole rings
  • these changes in redox state are associated with changes in spectral properties
  • Significant differences in absorbance are observed between reduced and oxidized states for these molecules See for example Fabb ⁇ zzi et al , Chem Soc Rev 1995 pp197-202) These differences can be monitored using a spectrophotometer or simple photomultipher tube device
  • possible electron donors and acceptors include all the derivatives listed above for photoactivation or initiation Preferred electron donors and acceptors have characteristically large spectral changes upon oxidation and reduction resulting in highly sensitive monitoring of electron transfer Such examples include Ru(NH 3 ) 4 py and Ru(bpy) 2 ⁇ m as preferred examples It should be understood that only the donor or acceptor that is being monitored by absorbance need have ideal spectral characteristics
  • the electron transfer is detected fluoromet ⁇ cally Numerous transition metal complexes, including those of ruthenium, have distinct fluorescence properties Therefore, the change in redox state of the electron donors and electron acceptors attached to the nucleic acid can be monitored very sensitively using fluorescence, for example with Ru(4,7-b ⁇ phenyl 2 -phenanthrohne) 3 2+
  • fluorescence for example with Ru(4,7-b ⁇ phenyl 2 -phenanthrohne) 3 2+
  • the production of this compound can be easily measured using standard fluorescence assay techniques For example, laser induced fluorescence can be recorded in a standard single cell fluo ⁇ meter, a flow through "on-line” fluo ⁇ meter (such as those attached to a chromatography system) or a multi-sample "plate-reader” similar to those marketed for 96-well immuno assays
  • fluorescence can be measured using fiber optic sensors with nucleic acid probes in solution or attached to the fiber optic Fluorescence is monitored using a photomultipher tube or other light detection instrument attached to the fiber optic The advantage of this system is the extremely small volumes of sample that can be assayed
  • scanning fluorescence detectors such as the Fluorlmager sold by Molecular Dynamics are ideally suited to monitoring the fluorescence of modified nucleic acid molecules arrayed on solid surfaces
  • Fluorlmager sold by Molecular Dynamics
  • transition metal complexes display fluorescence with large Stokes shifts
  • Suitable examples include bis- and trisphenanthrohne complexes and bis- and trisbipy ⁇ dyl complexes of transition metals such as ruthenium (see Juris, A , Balzani, V , et al Coord Chem Rev , V 84, p 85-277, 1988)
  • Preferred examples display efficient fluorescence (reasonably high quantum yields) as well as low reorganization energies These include Ru(4,7-b ⁇ phenyl 2 -phenanthrohne) 3 2+ , Ru(4,4'-d ⁇ phenyl-2,2'- b ⁇ py ⁇ d ⁇ ne) 3 2+ and platinum complexes (see Cummmgs et al , J Am Chem Soc 118 1949-1960
  • electrochemiluminescence is used as the basis of the electron transfer detection
  • ETMs such as Ru 2+ (bpy) 3
  • direct luminescence accompanies excited state decay Changes in this property are associated with nucleic acid hybridization and can be monitored with a simple photomultipher tube arrangement (see Blackburn, G F Clin Chem 37 1534-1539 (1991 ), and Juris et al , supra
  • electronic detection is used, including amperommetry, voltammetry, capacitance, and impedence
  • Suitable techniques include, but are not limited to, electrogravimetry, coulometry (including controlled potential coulometry and constant current coulometry), voltametry (cyclic voltametry, pulse voltametry (normal pulse voltametry, square wave voltametry, differential pulse voltametry, Osteryoung square wave voltametry, and couiostatic pulse techniques), stripping analysis (aniodic stripping analysis, cathiodic stripping analysis, square wave stripping voltammetry), conductance measurements (electrolytic conductance, direct analysis), time-dependent electrochemical analyses (chronoamperometry, chronopotentiometry, cyclic chronopotentiometry and amperometry, AC polography, chronogalvametry, and chronocoulometry), AC impedance measurement, capacitance measurement, AC voltametry, and photoelectrochemistry
  • monitoring electron transfer is via amperometric detection
  • This method of detection involves applying a potential (as compared to a separate reference electrode) between the nucleic acid-conjugated electrode and a reference (counter) electrode in the sample containing target genes of interest Electron transfer of differing efficiencies is induced in samples in the presence or absence of target nucleic acid, that is, the presence or absence of the target nucleic acid, and thus the label probe, can result in different currents
  • the device for measuring electron transfer amperomet ⁇ cally involves sensitive current detection and includes a means of controlling the voltage potential, usually a potentiostat This voltage is optimized with reference to the potential of the electron donating complex on the label probe Possible electron donating complexes include those previously mentioned with complexes of iron, osmium, platinum, cobalt, rhenium and ruthenium being preferred and complexes of iron being most preferred
  • potentiomet ⁇ c (or voltammet ⁇ c) measurements involve non-faradaic (no net current flow) processes and are utilized traditionally in pH and other ion detectors Similar sensors are used to monitor electron transfer between the ETM and the electrode.
  • other properties of insulators (such as resistance) and of conductors (such as conductivity, impedance and capi tance) could be used to monitor electron transfer between ETM and the electrode
  • any system that generates a current (such as electron transfer) also generates a small magnetic field, which may be monitored in some embodiments
  • time resolution can greatly enhance the signal-to-noise results of monitors based on absorbance, fluorescence and electronic current
  • the fast rates of electron transfer of the present invention result both in high signals and stereotyped delays between electron transfer initiation and completion By amplifying signals of particular delays, such as through the use of pulsed initiation of
  • ETMs alternating current
  • ETMs bound to an electrode
  • traditional electrochemical theory such as exemplified in Laviron et al , J Electroanal Chem 97 135 (1979) and Laviron et al , J Electroanal Chem 105 35 (1979), both of which are incorporated by reference, do not accurately model the systems described herein, except for very small E AC (less than 10 mV) and relatively large numbers of molecules That is, the AC current (I) is not accurately described by Laviron's equation This may be due in part to the fact that this theory assumes an unlimited source and sink of electrons, which is not true in the present systems
  • E DC is the electrode potential
  • E 0 is the formal potential of the metal complex
  • R is the gas constant
  • T is the temperature in degrees Kelvin
  • n is the number of electrons transferred
  • F is faraday's constant
  • [O] is the concentration of oxidized molecules and [R] is the concentration of reduced molecules
  • Equation 2 Equation 2
  • E DC is the DC component of the potential
  • Equation 3 can be rearranged as follows, using normalization of the concentration to equal 1 for simplicity, as shown in Equations 4, 5 and 6 This requires the subsequent multiplication by the total number of molecules
  • the total AC current will be the number of redox molecules C), times faraday's constant (F), times the AC frequency ( ⁇ ), times 0 5 (to take into account the AC amplitude), times the ratios derived above in Equation 7
  • the AC voltage is approximated by the average, E AC 2/ ⁇
  • Equation 11 does not incorporate the effect of electron transfer rate nor of instrument factors Electron transfer rate is important when the rate is close to or lower than the applied frequency
  • ⁇ AC should be a function of all three, as depicted in Equation 12
  • non-specifically bound label probes/ETMs show differences in impedance (i e higher impedances) than when the label probes containing the ETMs are specifically bound in the correct orientation
  • the non-specifically bound material is washed away, resulting in an effective impedance of infinity
  • AC detection gives several advantages as is generally discussed below, including an increase in sensitivity, and the ability to "filter out" background noise
  • changes in impedance including, for example, bulk impedance
  • frequency response when using AC initiation and detection methods, the frequency response of the system changes as a result of the presence of the ETM
  • frequency response herein is meant a modification of signals as a result of electron transfer between the electrode and the ETM This modification is different depending on signal frequency
  • a frequency response includes AC currents at one or more frequencies, phase shifts, DC offset voltages, faradaic impedance, etc
  • a first input electrical signal is then applied to the system, preferably via at least the sample electrode (containing the complexes of the invention) and the counter electrode, to initiate electron transfer between the electrode and the ETM Three electrode systems may also be used, with the voltage applied to the reference and working electrodes
  • the first input signal comprises at least an AC component
  • the AC component may be of variable amplitude and frequency Generally, for use in the present methods, the AC amplitude ranges from about 1 mV to about 1 1 V, with from about 10 mV to about 800 mV being preferred, and from about 10 mV to about 500 mV being especially preferred
  • the AC frequency ranges from about 0 01 Hz to about 100 MHz, with from about 10 Hz to about 10 MHz being preferred, and from about 100 Hz to about 20 MHz being especially preferred
  • the first input signal comprises a DC component and an AC component That is, a DC offset voltage between the sample and counter electrodes is swept through the electrochemical potential of the ETM (for example, when ferrocene is used, the sweep is generally from 0 to 500 mV) (or alternatively, the working electrode is grounded and the reference electrode is swept from 0 to -500 mV)
  • the sweep is used to identify the DC voltage at which the maximum response of the system is seen This is generally at or about the electrochemical potential of the ETM
  • DC offset voltages of from about -1 V to about +1 1 V are preferred, with from about -500 mV to about +800 mV being especially preferred, and from about -300 mV to about 500 mV being particularly preferred
  • the DC offset voltage is not zero
  • an AC signal component of variable amplitude and frequency is applied If the ETM is present, and can
  • a single input signal may be applied to differentiate between the presence and absence of the ETM (i e the presence of the target sequence) nucleic acid
  • a plurality of input signals are applied as outlined herein, this may take a variety of forms, including using multiple frequencies, multiple DC offset voltages, or multiple AC amplitudes, or combinations of any or all of these
  • DC offset voltages are used, although as outlined above, DC voltage sweeps are preferred This may be done at a single frequency, or at two or more frequencies
  • the AC amplitude is varied Without being bound by theory, it appears that increasing the amplitude increases the driving force Thus, higher amplitudes, which result in higher overpotentials give faster rates of electron transfer Thus, generally, the same system gives an improved response (i e higher output signals) at any single frequency through the use of higher overpotentials at that frequency Thus, the amplitude may be increased at high frequencies to increase the rate of electron transfer through the system, resulting in greater sensitivity In addition, this may be used, for example, to induce responses in slower systems such as those that do not possess optimal spacing configurations
  • measurements of the system are taken at at least two separate amplitudes or overpotentials, with measurements at a plurality of amplitudes being preferred.
  • changes in response as a result of changes in amplitude may form the basis of identification, calibration and quantification of the system in addition, one or more AC frequencies can be used as well
  • the AC frequency is varied At different frequencies, different molecules respond in different ways As will be appreciated by those in the art, increasing the frequency generally increases the output current However, when the frequency is greater than the rate at which electrons may travel between the electrode and the ETM, higher frequencies result in a loss or decrease of output signal At some point, the frequency will be greater than the rate of electron transfer between the ETM and the electrode, and then the output signal will also drop
  • detection utilizes a single measurement of output signal at a single frequency
  • the frequency response of the system in the absence of target sequence, and thus the absence of label probe containing ETMs can be previously determined to be very low at a particular high frequency Using this information, any response at a particular frequency, will show the presence of the assay complex That is, any response at a particular frequency is characteristic of the assay complex Thus, it may only be necessary to use a single input high frequency, and any changes in frequency response is an indication that the ETM is present, and thus that the target sequence is present
  • the frequency response of a charge carrier or redox active molecule in solution will be limited by its diffusion coefficient and charge transfer coefficient Accordingly, at high frequencies, a charge carrier may not diffuse rapidly enough to transfer its charge to the electrode, and/or the charge transfer kinetics may not be fast enough This is particularly significant in embodiments that do not have good monolayers, i e have partial or insufficient monolayers, i e where the solvent is accessible to the electrode.
  • the presence of "holes" where the electrode is accessible to the solvent can result in solvent charge carriers "short circuiting" the system, i e the reach the electrode and generate background signal
  • one or more frequencies can be chosen that prevent a frequency response of one or more charge carriers in solution, whether or not a monolayer is present This is particularly significant since many biological fluids such as blood contain significant amounts of redox active molecules which can interfere with amperometric detection methods
  • measurements of the system are taken at at least two separate frequencies, with measurements at a plurality of frequencies being preferred
  • a plurality of frequencies includes a scan
  • measuring the output signal, e g , the AC current, at a low input frequency such as 1 - 20 Hz, and comparing the response to the output signal at high frequency such as 10 - 100 kHz will show a frequency response difference between the presence and absence of the ETM
  • the frequency response is determined at at least two, preferably at least about five, and more preferably at least about ten frequencies
  • an output signal is received or detected
  • the presence and magnitude of the output signal will depend on a number of factors, including the overpotential/amphtude of the input signal, the frequency of the input AC signal, the composition of the intervening medium, the DC offset, the environment of the system, the nature of the ETM, the solvent, and the type and concentration of salt
  • the presence and magnitude of the output signal will depend in general on the
  • the output signal comprises an AC current
  • the magnitude of the output current will depend on a number of parameters By varying these parameters, the system may be optimized in a number of ways
  • AC currents generated in the present invention range from about 1 femptoamp to about 1 milhamp, with currents from about 50 femptoamps to about 100 microamps being preferred, and from about 1 picoamp to about 1 microamp being especially preferred
  • the output signal is phase shifted in the AC component relative to the input signal
  • the systems of the present invention may be sufficiently uniform to allow phase-shifting based detection That is, the complex biomolecules of the invention through which electron transfer occurs react to the AC input in a homogeneous manner, similar to standard electronic components, such that a phase shift can be determined This may serve as the basis of detection between the presence and absence of the ETM, and/or differences between the presence of target-specific assay complexes comprising label probes and non-specific binding of the label probes to the system components
  • the output signal is characteristic of the presence of the ETM, that is, the output signal is characteristic of the presence of the target-specific assay complex comprising label probes and ETMs
  • the basis of the detection is a difference in the faradaic impedance of the system as a result of the formation of the assay complex Faradaic impedance is the impedance of the system between the electrode and the ETM Faradaic impedance is quite different from the bulk or dielectric impedance, which is the impedance of the bulk solution between the electrodes Many factors may change the faradaic impedance which may not effect the bulk impedance, and vice versa
  • the assay complexes comprising the nucleic acids in this system have a certain faradaic impedance, that will depend on the distance between the ETM and the electrode, their electronic properties, and the composition of the intervening medium, among other things Of importance in the methods of the invention is that the faradaic impedance between the ETM and the electrode is signficantly different depending on whether the
  • the present invention further provides apparatus for the detection of nucleic acids using AC detection methods
  • the apparatus includes a test chamber which has at least a first measuring or sample electrode, and a second measuring or counter electrode Three electrode systems are also useful
  • the first and second measuring electrodes are in contact with a test sample receiving region, such that in the presence of a liquid test sample, the two electrodes may be in electrical contact
  • the first measuring electrode comprises a single stranded nucleic acid capture probe covalently attached via an attachment linker, and a monolayer comprising conductive oligomers, such as are described herein
  • the apparatus further comprises an AC voltage source electrically connected to the test chamber, that is, to the measuring electrodes
  • the AC voltage source is capable of delivering DC offset voltage as well
  • the apparatus further comprises a processor capable of comparing the input signal and the output signal
  • the processor is coupled to the electrodes and configured to receive an output signal, and thus detect the presence of the target nucleic acid
  • compositions of the present invention may be used in a variety of research, clinical, quality control, or field testing settings
  • the probes are used in genetic diagnosis
  • probes can be made using the techniques disclosed herein to detect target sequences such as the gene for nonpolyposis colon cancer, the BRCA1 breast cancer gene, P53, which is a gene associated with a variety of cancers, the Apo E4 gene that indicates a greater risk of Alzheimer's disease, allowing for easy presymptomatic screening of patients, mutations in the cystic fibrosis gene, or any of the others well known in the art
  • viral and bacterial detection is done using the complexes of the invention
  • probes are designed to detect target sequences from a variety of bacteria and viruses
  • current blood-screening techniques rely on the detection of anti-
  • HIV antibodies The methods disclosed herein allow for direct screening of clinical samples to detect HIV nucleic acid sequences, particularly highly conserved HIV sequences In addition, this allows direct monitoring of circulating virus within a patient as an improved method of assessing the efficacy of anti-viral therapies Similarly, viruses associated with leukemia, HTLV-I and HTLV-II, may be detected in this way Bacterial infections such as tuberculosis, clymidia and other sexually transmitted diseases, may also be detected, for example using ⁇ bosomal RNA (rRNA) as the target sequences
  • rRNA ⁇ bosomal RNA
  • the nucleic acids of the invention find use as probes for toxic bacteria in the screening of water and food samples
  • samples may be treated to lyse the bacteria to release its nucleic acid (particularly rRNA), and then probes designed to recognize bacterial strains, including, but not limited to, such pathogenic strains as, Salmonella, Campylobacter, Vibrio cholerae, Leishmania, enterotoxic strains of E coli, and Legionnaire's disease bacteria
  • bioremediation strategies may be evaluated using the compositions of the invention
  • the probes are used for forensic "DNA fingerprinting" to match crime-scene DNA against samples taken from victims and suspects
  • the probes in an array are used for sequencing by hybridization
  • the present invention provides for extremely specific and sensitive probes, which may, in some embodiments, detect target sequences without removal of unhybndized probe This will be useful in the generation of automated gene probe assays
  • compositions of the invention are useful to detect successful gene amplification in PCR, thus allowing successful PCR reactions to be an indication of the presence or absence of a target sequence PCR may be used in this manner in several ways
  • the PCR reaction is done as is known in the art, and then added to a composition of the invention comprising the target nucleic acid with a ETM, covalently attached to an electrode via a conductive oligomer with subsequent detection of the target sequence
  • PCR is done using nucleotides labelled with a ETM, either in the presence of, or with subsequent addition to, an electrode with a conductive oligomer and a target nucleic acid Binding of the PCR product containing ETMs to the electrode composition will allow detection via electron transfer
  • the nucleic acid attached to the electrode via a conductive polymer may be one PCR primer, with addition of a second primer labelled with an ETM Elongation results in double stranded nucleic acid with a ETM and electrode
  • the arrays are used for mRNA detection
  • a preferred embodiment utilizes either capture probes or capture extender probes that hybridize close to the 3' polyadenylation tail of the mRNAs This allows the use of one species of target binding probe for detection, i e the probe contains a poly-T portion that will bind to the poly-A tail of the mRNA target Generally, the probe will contain a second portion, preferably non-poly-T, that will bind to the detection probe (or other probe) This allows one target-binding probe to be made, and thus decreases the amount of different probe synthesis that is done
  • restriction enzymes and ligation methods allows the creation of "universal" arrays
  • monolayers comprising capture probes that comprise restriction endonuclease ends as is generally depicted in Figure 7 of PCT US97/20014
  • an array comprising any number of restriction endonuclease sites is made Treating a target sample with one or more of these restriction endonucleases allows the targets to bind to the array This can be done without knowing the sequence of the target
  • the target sequences can be ligated, as desired, using standard methods such as hgases, and the target sequence detected, using either standard labels or the methods of the invention
  • the present invention provides methods which can result in sensitive detection of nucleic acids
  • less than about 10 X 10 6 molecules are detected, with less than about 10 X 10 5 being preferred, less than 10 X 10 4 being particularly preferred, less than about 10 X 10 3 being especially preferred, and less than about 10 X 10 2 being most preferred
  • this assumes a 1 1 correlation between target sequences and reporter molecules, if more than one reporter molecule (i e electron transfer moeity) is used for each target sequence, the sensitivity will go up
  • N16 To a solution of N15 (11 50 gm, 27 17 mmol) in 300 mL dry pyridme cooled at 0°C, was added tnmethylsily chloride (13 71 mL, 0 11 mol, 4 0) The mixture was stirred at 0 °C for 40 mm Phenoxyacetyl chloride (9 38 mL, 67 93 mmol) was added The reaction was stirred at 0 °C for
  • Electrodes containing the different compositions of the invention were made and used in AC detection methods The experiments were run as follows A DC offset voltage between the working (sample) electrode and the reference electrode was swept through the electrochemical potential of the ferrocene, typically from 0 to 500 mV On top of the DC offset, an AC signal of variable amplitude and frequency was applied The AC current at the excitation frequency was plotted versus the DC offset
  • a capture probe D112, comprising a 25 base sequence was mixed with the Y5 conductive oligomer and the
  • a capture extender probe D179 comprising a 24 base sequence perfectly complementary to the D112 capture probe, and a 24 base sequence perfectly complementary to the 2tar target, separated by a single base, was added, with the 2tar target
  • the D179 molecule carries a ferrocene (using a C15 linkage to the base) at the end that is closest to the electrode
  • the attachment linkers are conductive oligomers
  • the use of an ETM at or near this position allows verification that the D179 molecule is present
  • a ferrocene at this position has a different redox potential than the ETMs used for detection
  • a label probe D309 (dendnmer) was added, comprising a 18 base sequence perfectly complementary to a portion of the target sequence, a 13 base sequence linker and four ferrocenes attached using a branching configuration
  • a representative scan is shown in Figure 20A When the 2tar target was not added, a representative scan is shown in Figure 20B
  • Example A A capture probe D94 was added with the Y5 and M44 conductive oligomer at a 2 2 1 ratio with the total thiol concentration being 833 ⁇ M on the electrode surface, as outlined above
  • a target sequence (D336) comprising a 15 base sequence perfectly complementary to the D94 capture probe, a 14 base linker sequence, and 6 ferrocenes linked via the N6 compound was used
  • a representative scan is shown in Figure 20C
  • Example B A capture probe D94 was added with the Y5 and M44 conductive oligomer at a 2 2 1 ratio with the total thiol concentration being 833 ⁇ M on the electrode surface, as outlined above
  • a target sequence (D429) comprising a 15 base sequence perfectly complementary to the D94 capture probe, a C131 ethylene glycol linker hooked to 6 ferrocenes linked via the N6 compound was used
  • a representative scan is shown in Figure 20E
  • the capture probe D112, Y5 conductive oligomer, the M44 insulator, and capture extender probe D179 were as outlined above
  • Two label probes were added D295 comprising an 18 base sequence perfectly complementary to a portion of the target sequence, a 15 base sequence linker and six ferrocenes attached using the N6 linkage depicted in Figure 23 D297 is the same, except that it's 18 base sequence hybridizes to a different portion of the target sequence
  • a representative scan is shown in Figure 20G When the 2tar target was not added, a representative scan is shown in Figure 20H
  • the capture probe D112, Y5 conductive oligomer, the M44 insulator, and capture extender probe D179 were as outlined above
  • Two label probes were added D296 comprising an 18 base sequence perfectly complementary to a portion of the target sequence, a 5 base sequence linker and six ferrocenes attached using the N6 linkage depicted in Figure 23 D298 is the same, except that it's 18 base sequence hybridizes to a different portion of the target sequence
  • a representative scan is shown in Figure 201 When the 2tar target was not added, a representative scan is shown in Figure 20J
  • Example A A capture probe D112, Y5 conductive oligomer and the M44 insulator were put on the electrode at 2 2 1 ratio with the total thiol concentration being 833 ⁇ M
  • a target sequence MT1 was added, that comprises a sequence complementary to D112 and a 20 base sequence complementary to the label probe D358 were combined, in this case, the label probe D358 was added to the target sequence prior to the introduction to the electrode
  • the label probe contains si ferrocenes attached using the N6 linkages depicted in Figure 23 A representative scan is shown in Figure 20L
  • the replacment of MT1 with NC112 which is not complementary to the capture probe resulted in no signal, similarly, the removal of MT1 resulted in no signal
  • Example B A capture probe D334, Y5 conductive oligomer and the M44 insulator were put on the electrode at 2 2 1 ratio with the total thiol concentration being 833 ⁇ M
  • a target sequence LP280 was added, that comprises a sequence complementary
  • the sense primer contained the ETMs (using the N6 linkage described herein), although as will be appreciated by those in the art, t ⁇ phosphate nucleotides containing ETMs could be used to label non-primer sequences
  • the surface probe was designed to hybridize to 16 nucleotides of non-primer sequences, immediately adjacent to the primer sequence, that is, the labeled primer sequence will not bind to the surface probe Thus, only if amplification has occured, such that the amplified sequence will bind to the surface probe, will the detection of the adjacent ETMs proceed
  • the target sequence in this case was the plasmid pBKBHIOS (NIH AIDS Research and Reference Reagent program - McKesson Bioservices, Rockville MD) which contains an 8 9 kb Sstl fragment of pBH10-R3 dervied from the HXB2 clone which contains the entire HIV-1 genome and has the Genbank accession code K03455 or M38432) inserted into the Sstl site on pBluesc ⁇ pt ll-KS(+) The insert is oriented such that transcription from the T7 promoter produces sense RNA
  • the “sense” primer, D353 was as follows 5'-(N6)A(N6)AGGGCTGTTGGAAATGTGG-3'
  • the "antisense” primer, D351 was as follows 5'-TGTTGGCTCTGGTCTGCTCTGA-3'
  • the following is the expected PCR product of the reaction, comprising 140 bp
  • the surface capture probe (without any overlap to the sense primer) D459 was as follows 5'- TTGGTGTCCTTCCTTU-4 unit w ⁇ re(C11)-3'
  • PCR reaction conditions were standard TAQ polymerase at TAQ 10X buffer 1 ⁇ M of the primers was added to either 6 X 10 3 , 6X 10 6 or 6 X 10 7 molecules of template The reaction conditions were 90°C for 30 sec, 57°C for 30 sec, and 70°C for 1 minute
  • the electrodes were prepared by melting 0 127 mm diamter pure gold wire on one end to form a ball The electrodes were dipped in aqua regia for 20 seconds and tehn rinse with water The SAM was deposited by dipping the electrode into a deposition solution of 1 34 0 7 D459 H6 M44 in 37 39 24 THF ACN water at 1 mM total thiol which was heated at 50°C for five minutes prior to the introduction of the electrodes The electrodes were added and then removed immediately to room temperature to sit for 15 minutes Electrodes were then transferred to M44 (in 37 39 24 THF ACN water at 400 ⁇ M total thiol concentration) The electrodes sat in M44 at room tern for 5 minutes, then the following heat cycling was applied 70°C for 1 minute, followed by 55°C for 30 sec, repeating this cycle 2 more times followed by a 0 3 °C ramp down to RT with soaking at RT for 10 minutes The electrodes were taken out of M44 solution, rinsed in 2XSSC
  • a surface probe D368 (5'-(H2)CCTTCCTTTCCACAU-4 unit w ⁇ re(C11)-3') was attached to an electrode comprising M44 and H6 (H6 is a two unit wire terminating in an acetylene bond) at a ratio of D368 H6:M44 of 1 4 1 with a total thiol concentration of 833 ⁇ M
  • H6 is a two unit wire terminating in an acetylene bond
  • a ligation probe HIVLIG (5'-CCACCAGATCTTCCCTAA AAAATTAGCCTGTCTCTCAGTACAATCTTTCATTTGGTGT-3')
  • the target sequence HIVCOMP 5'-
  • ATGTGGAAAGAAAGGACACC TTGAMGATTGTACTGAGAGACAGGCTAATTTTTTAGGGAAGATCTGG- 3' was added, with hgase and the reaction allowed to proceed
  • the reaction conditions were as follows 10 ⁇ M of HIVLIG annealed to HIVCOMP were hybridized to the electrode surface (in 6XSSC) for 80 m The surface was rinsed in gase buffer The gase (T4) and buffer were added and incubated for 2 hours at RT Triton X at 10 "4 M was added at 70°C to allow the denaturation of the newly formed hybridization complex, resulting in the newly formed long surface probe (comprising D368 ligated to the HIVLIG probe)
  • the addition of the D456 signalling probe (5'-(N6)G(N6)CT(N60C(N60G(N6)C(N6)TTCTGCACCGTAAGCCA TCAAAGATTGTACTGAG-3') allowed detection (results not shown)
  • the capture probe for a rRNA assay containing 0, 4 and 8 ethylene glycol units was tested on four separate electrode surfaces
  • Surface 1 contained 2 1 ratio of H6 M44, with a total thiol concentration of 500 ⁇ M
  • Surface 2 contained a 2 2 1 ratio of D568/H6/M44 with a total thiol concentration of 833 ⁇ M
  • Surface 3 contained a 2 2 1 ratio of D570/H6/M44 with a total thiol concentration of 833 ⁇ M
  • D568 was a capture probe comprising 5'-GTC AAT GAG CAA AGG TAT TAA (P282)-3' P282 was a thiol
  • D569 was a capture probe comprising 4 ethylene glycol units 5'-GTC AAT GAG CAA AGG TAT TAA (C131) (P282)-3' D570 was a capture probe comprising 8 ethylene glycol units 5'-GTC AAT GAG CAA AGG TAT TAA (C131)
  • 6-ferrocene containing label probes Additional tack down points, and a plurality of label probes, is contemplated
  • Hybridization solutions were annealed by heating at 70°C for 30 seconds and then cooling to 22°C over ⁇ 38 seconds
  • the molecules were all in 4X SSC at twice the targeted concentrations, with the rRNA at 35 U S C ⁇ ⁇ M, the capture sequence at 1 0 ⁇ M, and the label probes at 3 ⁇ M
  • the solution was diluted 1 1 with fetal calf serum, halving the concentrations and changing the solvent to 2X SSC with 50% FCS
  • FCS FCS
  • Hybridization was done as follows After the 2X SSC dip described above, the derivatized electrode was placed into an eppendorf tube with 20 ⁇ L hybridization solution It was allowed to hybridize at room temperature for 10 minutes Immediately before measurement, the electrode was briefly dipped in room temperature 2X SSC It was then transferred into the 1 M NaCI0 4 electrolyte and an alternating current voltammogram was taken with an applied alternating current of 10 Hz frequency and a 25 mV center-to-peak amplitude
  • D405 has the structure 5'-(C23)(C23)(C23) (C23)(C23)(C23)(C23) (C23)(C23) (C23)AT CTG TGT CCA TGG T-3'
  • the system was run with two surfaces the "+” surface was a 2 2 1 ratio of D94:H6:M44, with a total thiol concentration of 833 ⁇ M
  • the "-" surface was a 2 2 1 ratio of D109:H6:M44, with a total thiol concentration of 833 ⁇ M
  • the results, shown in Figure 25B show that the system gave a good signal in the presence of a complementary capture probe

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Physics & Mathematics (AREA)
  • Molecular Biology (AREA)
  • Analytical Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Nanotechnology (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Biochemistry (AREA)
  • Immunology (AREA)
  • Biophysics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • General Physics & Mathematics (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Electrochemistry (AREA)
  • Pathology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Spectroscopy & Molecular Physics (AREA)
  • Composite Materials (AREA)
  • Condensed Matter Physics & Semiconductors (AREA)
  • Materials Engineering (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Apparatus Associated With Microorganisms And Enzymes (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

The present invention is directed to the electronic detection of nucleic acids using self-assembled monolayers.

Description

ELECTRONIC DETECTION OF NUCLEIC ACIDS USING MONOLAYERS
This application is a continuing application of U.S.S.N.s 60/084,509, filed May 6, 1998; 60/084,425, filed May 6, 1998; and 09/135,183, filed August 17, 1998.
FIELD OF THE INVENTION
The present invention is directed to methods and compositions for the use of self-assembled monolayers with electronically exposed termini to electronically detect nucleic acids.
BACKGROUND OF THE INVENTION
The detection of specific nucleic acids is an important tool for diagnostic medicine and molecular biology research. Gene probe assays currently play roles in identifying infectious organisms such as bacteria and viruses, in probing the expression of normal genes and identifying mutant genes such as oncogenes, in typing tissue for compatibility preceding tissue transplantation, in matching tissue or blood samples for forensic medicine, and for exploring homology among genes from different species.
Ideally, a gene probe assay should be sensitive, specific and easily automatable (for a review, see Nickerson, Current Opinion in Biotechnology 4:48-51 (1993)). The requirement for sensitivity (i.e. low detection limits) has been greatly alleviated by the development of the polymerase chain reaction (PCR) and other amplification technologies which allow researchers to amplify exponentially a specific nucleic acid sequence before analysis (for a review, see Abramson et al., Current Opinion in Biotechnology, 4:41-47 (1993)).
Specificity, in contrast, remains a problem in many currently available gene probe assays. The extent of molecular complementarity between probe and target defines the specificity of the interaction. Variations in the concentrations of probes, of targets and of salts in the hybridization medium, in the reaction temperature, and in the length of the probe may alter or influence the specificity of the probe/target interaction
It may be possible under some limited circumstances to distinguish targets with perfect complementarity from targets with mismatches, although this is generally very difficult using traditional technology, since small variations in the reaction conditions will alter the hybridization New experimental techniques for mismatch detection with standard probes include DNA ligation assays where single point mismatches prevent ligation and probe digestion assays in which mismatches create sites for probe cleavage
Finally, the automation of gene probe assays remains an area in which current technologies are lacking Such assays generally rely on the hybridization of a labelled probe to a target sequence followed by the separation of the unhybndized free probe This separation is generally achieved by gel electrophoresis or solid phase capture and washing of the target DNA, and is generally quite difficult to automate easily
The time consuming nature of these separation steps has led to two distinct avenues of development One involves the development of high-speed, high-throughput automatable electrophoretic and other separation techniques The other involves the development of non-separation homogeneous gene probe assays
Several techniques have been developed which serve as signal amplification technologies for the detection of nucleic acids "Branched DNA" signal amplification relies on the synthesis of branched nucleic acids, containing a multiplicity of nucleic acid "arms" that function to increase the amount of label that can be put onto one probe This technology is generally described in U S Patent Nos
5,681 ,702, 5,597,909, 5,545,730, 5,594,117, 5,591 ,584, 5,571 ,670, 5,580,731 , 5,571 ,670, 5,591 ,584, 5,624,802, 5,635,352, 5,594,118, 5,359,100, 5,124,246 and 5,681 ,697, all of which are hereby incorporated by reference
Similarly, dendnmers of nucleic acids serve to vastly increase the amount of label that can be added to a single molecule, using a similar idea but different compositions This technology is as described in U.S Patent No 5,175,270 and Nilsen et al , J Theor Biol 187 273 (1997), both of which are incorporated herein by reference
PCT applications WO 95/15971 , PCT/US96/09769, PCT/US97/09739, WO96/40712 and WO98/20162 describe novel compositions comprising nucleic acids containing electron transfer moieties, including electrodes, which allow for novel detection methods of nucleic acid hybridization SUMMARY OF THE INVENTION
In accordance with the objects outlined above, the present invention provides compositions comprising electrodes comprising a monolayer comprising conductive oligomers, and a capture probe The composition further comprises a target sequence comprising a first portion that is capable of hybridizing to the capture probe, and a second portion that does not hybridize to the capture probe and comprises at least one covalently attached electron transfer moiety
In an additional aspect, the invention provides compositions comprising electrodes comprising a monolayer comprising conductive oligomers, and a capture probe The compositions further comprise a label probe comprising a first portion that is capable of hybridizing to a component of an assay complex, and a second portion comprising a recruitment linker that does not hybridize to a component of an assay complex and comprises at least one covalently attached electron transfer moiety
In a further embodiment, the invention provides methods of detecting a target nucleic acid sequence in a test sample comprising attaching said target sequence to an electrode comprising a monolayer of conductive oligomers Label probes are directly or indirectly attached to the target sequence to form an assay complex, wherein the label probe comprises a first portion capable of hybridizing to a component of the assay complex, and a second portion comprising a recruitment linker that does not hybridize to a component of the assay complex and comprises at least one covalently attached electron transfer moiety The method further comprises detecting electron transfer between said ETM and said electrode
In a further aspect, the methods comprise attaching a target sequence to an electrode, and directly or indirectly attaching a first portion of at least one label probe containing at least one ETM to the target sequence The method further comprises detecting electron transfer between said ETM and said electrode The target sequence is attached to the electrode by (1) hybridization to a capture probe (2) by hybridizing a first portion of the target sequence to a first capture extender probe, and hybridizing a second portion of the first capture extender probe to a capture probe on the electrode, or (3) hybridizing a first portion of the target sequence to a first portion of a first capture extender probe, hybridizing a second portion of the first capture extender probe to a first portion of an capture probe on the electrode, hybridizing a second portion of the target sequence to a first portion of a second capture extender probe, and hybridizing a second portion of the second capture extender probe to a second portion of the capture probe The label probe is attached to the target sequence by a variety of methods, including (1) hybridizing said first portion of said label probe to a first portion of the target sequence, (2) hybridizing a first portion of an amplifier probe to a first portion of the target sequence, and hybridizing at least one amplication sequence of the amplifier probe to the first portion of at least one label probe, (3) hybridizing a first portion of a first label extender probe to a first portion of a target sequence, hybridizing a second portion of the first label extender probe to a first portion of an amplifier probe, and hybridizing at least one amplication sequence of the amplifier probe to the first portion of at least one label probe, (4) hybridizing a first portion of a first label extender probe to a first portion of a target sequence, hybridizing a second portion of the first label extender probe to a first portion of an amplifier probe, hybridizing a first portion of a second label extender probe to a second portion of a target sequence, hybridizing a second portion of the second label extender probe to a first portion of an amplifier probe, and hybridizing at least one amplication sequence of the amplifier probe to the first portion of at least one label probe
Kits and apparatus comprising the compositions of the method are also provided
BRiEF BESC IPTION OF THE DRAWINGS
Figures 1A-10 depict depict a number of different compositions of the invention, the results are shown in Example 1 and 2 Figure 1A depicts I, also referred to as P290 Figure 1 B depicts II, also referred to as P291 Figure 1C depicts III, also referred to as W31 Figure 1 D depicts IV, also referred to as N6 Figure 1 E depicts V, also referred to as P292 Figure 1 F depicts II, also referred to as C23 Figure 1G depicts VII, also referred to as C15 Figure 1 H depicts VIII, also referred to as C95 Figure 11 depicts Y63 Figure U depicts another compound of the invention Figure 1 K depicts N11 Figure 1L depicts C131, with a phosphoramidite group and a DMT protecting group Figure 1M depicts W38, also with a phosphoramidite group and a DMT protecting group Figure 1 N depicts the commercially available moiety that enables "branching" to occur, as its incorporation into a growing oligonucleotide chain results in addition at both the DMT protected oxygens Figure 10 depicts glen, also with a phosphoramidite group and a DMT protecting group, that serves as a non-nucleic acid linker Figures 1A to 1G and 1 J are shown without the phosphoramidite and protecting groups (i e DMT) that are readily added
Figure 2 depicts the synthetic scheme of a preferred attachment of an ETM, in this case ferrocene, to a nucleoside (in this case adenosine) via an oxo linkage to the nbose, forming the N6 compound of the invention Figure 3 is similar to Figure 2 except that the nucleoside is cytidine, forming the W38 compound of the invention
Figure 4 depicts the synthetic scheme of a preferred attachment of an ETM, in this case ferrocene, to a nucleoside via the phosphate, forming the Y63 compound of the invention
Figure 5 depicts the synthetic scheme of a tnphosphate nucleotide, in this case adenosine, with an attached ETM, in this case ferrocene, via an oxo linkage to the nbose
Figure 6 depicts the use of an activated carboxylate for the addition of a nucleic acid functionalized with a primary amine to a pre-formed SAM
Figure 7 depicts a schematic of the use of "universal" type gene chips, utilizing restriction endonuclease sites
Figures 8A and 8B depicts two phosphate attachments of conductive oligomers that can be used to add the conductive oligomers at the 5' position, or any position
Figure 9 depicts the synthesis of an insulator (C109) to the nbose of a nucleoside for attachment to an electrode
Figure 10 depicts the synthetic scheme of ethylene glycol terminated conductive oligomers
Figures 11 A, 11 B and 11C depict the synthesis of three different "branch" points (in this case each using adenosine as the base), to allow the addition of ETM polymers Figure 11 A depicts the synthesis of the N17 compound of the invention Figure 11 B depicts the synthesis of the W90 compound, and Figure 11C depicts the synthesis of the N38 compound
Figure 12 depicts a schematic of the synthesis of simultaneous incorporation of multiple ETMs into a nucleic acid, using the N17 "branch" point nucleoside
Figure 13 depicts a schematic of an alternate method of adding large numbers of ETMs simultaneously to a nucleic acid using a "branch" point phosphoramidite, in this case utilizing three branch points (although two branch points are also possible, see for example Figure 1 N) as is known in the art As will be appreciated by those in the art, each end point can contain any number of ETMs Figure 14 shows a representative hairpin structure 500 is a target binding sequence, 510 is a loop sequence, 520 is a self-complementary region, 530 is substantially complementary to a detection probe, and 530 is the "sticky end", that is, a portion that does not hybridize to any other portion of the probe, that contains the ETMs
Figures 15A, 15B and 15C depict three preferred embodiments for attaching a target sequence to the electrode Figure 15A depicts a target sequence 120 hybridized to a capture probe 100 linked via a attachment linker 106, which as outlined herein may be either a conductive oligomer or an insulator The electrode 105 comprises a monolayer of passivation agent 107, which can comprise conductive oligomers (herein depicted as 108) and/or insulators (herein depicted as 109) As for all the embodiments depicted in the figures, n is an integer of at least 1 , although as will be appreciated by those in the art, the system may not utilize a capture probe at all (i e n is zero), although this is generally not preferred The upper limit of n will depend on the length of the target sequence and the required sensitivity Figure 15B depicts the use of a single capture extender probe 110 with a first portion 111 that will hybridize to a first portion of the target sequence 120 and a second portion that will hybridize to the capture probe 100 Figure 15C depicts the use of two capture extender probes 110 and 130 The first capture extender probe 110 has a first portion 111 that will hybridize to a first portion of the target sequence 120 and a second portion 112 that will hybridize to a first portion 102 of the capture probe 100 The second capture extender probe 130 has a first portion 132 that will hybridize to a second portion of the target sequence 120 and a second portion 131 that will hybridize to a second portion 101 of the capture probe 100 As will be appreciated by those in the art, any of these attachment configurations may be used with any of the other systems, including the embodiments of Figure 16
Figures 16A, 16B, 16C, 16D, 16E, 4F and 4G depict some of the embodiments of the invention All of the monolayers depicted herein show the presence of both conductive oligomers 108 and insulators 107 in roughly a 1 1 ratio, although as discussed herein, a variety of different ratios may be used, or the insulator may be completely absent In addition, as will be appreciated by those in the art, any one of these structures may be repeated for a particular target sequence, that is, for long target sequences, there may be multiple assay complexes formed Additionally, any of the electrode- attachment embodiments of Figure 15 may be used in any of these systems
Figures 16A, 16B and 16D have the target sequence 120 containing the ETMs 135, as discussed herein, these may be added enzymatically, for example during a PCR reaction using nucleotides modified with ETMs, resulting in essentially random incorporation throughout the target sequence, or added to the terminus of the target sequence Figure 16C depicts the use of two different capture probes 100 and 100', that hybridize to different portions of the target sequence 120 As will be appreciated by those in the art, the 5'-3' orientation of the two capture probes in this embodiment is different
Figure 16C depicts the use of label probes 145 that hybridize directly to the target sequence 120 Figure 16C shows the use of a label probe 145, comprising a first portion 141 that hybridizes to a portion of the target sequence 120, a second portion 142 comprising ETMs 135
Figures 16E, 16F and 16G depict systems utilizing label probes 145 that do not hybridize directly to the target, but rather to amplifier probes that are directly (Figure 16E) or indirectly (Figures 16F and 16G) hybridized to the target sequence Figure 16E utilizes an amplifier probe 150 has a first portion
151 that hybridizes to the target sequence 120 and at least one second portion 152, i e the amplifier sequence, that hybridizes to the first portion 141 of the label probe Figure 16F is similar, except that a first label extender probe 160 is used, comprising a first portion 161 that hybridizes to the target sequence 120 and a second portion 162 that hybridizes to a first portion 151 of amplifier probe 150 A second portion 152 of the amplifier probe 150 hybridizes to a first portion 141 of the label probe 140, which also comprises a recruitment linker 142 comprising ETMs 135 Figure 16G adds a second label extender probe 170, with a first portion 171 that hybridizes to a portion of the target sequence 120 and a second portion that hybridizes to a portion of the amplifier probe
Figure 16H depicts a system that utilizes multiple label probes The first portion 141 of the label probe
140 can hybridize to all or part of the recruitment linker 142
Figures 17A, 17B, 17C, 17D and 17E depict different possible configurations of label probes and attachments of ETMs In Figures 17A-C, the recruitment linker is nucleic acid, in Figures 17D and E, is is not A = nucleoside replacement, B = attachment to a base, C = attachment to a nbose, D = attachment to a phosphate, E = metallocene polymer (although as described herein, this can be a polymer of other ETMs as well), attached to a base, nbose or phosphate (or other backbone analogs), F = dendnmer structure, attached via a base, nbose or phosphate (or other backbone analogs), G = attachment via a "branching" structure, through base, nbose or phosphate (or other backbone analogs), H = attachment of metallocene (or other ETM) polymers, I = attachment via a dendnmer structure, J = attachment using standard linkers
Figure 18 depicts an improvement utilizing a stem-loop probe This can be desirable as it creates torsional strain on the surface-bound probe, which has been shown to increase binding efficiency and in some cases thermodynamic stability In this case, the surface bound probe comprises a capture probe 100, a first stem-loop sequence 550, a target binding sequence 560, and a second stem-loop sequence 570 that is substantially complementary to the first stem-loop sequence Upon addition of the target sequence 120, which can contain the ETMs 135 either directly or indirectly using a label probe 145, the effective concentration of the target at the surface increases
Figures 19A-19AA depict some of the sequences used in Example 1
Figures 20A - 20O depict representative scans from the experiments outlined in Example 1 Unless otherwise noted, all scans were run at initial voltage -0 11 V, final voltage 0 5 V, with points taken every 10 mV, amplitude of 0 025, frequency of 10 Hz, a sample period of 1 sec, a quiet time of 2 sec Figure 20A has a peak potential of 0 160 V, a peak current of 1 092 X 108 A, and a peak A of 7 563 X 10"10 VA Figure 20C has a peak potential of 0 190 V, a peak current of 2 046 X 10"7 A, and a peak area of 2 046 X 108 VA Figure 20d has a peak potential of 0 190 V, a peak current of 3 552 X 108 A, and a peak A of 3 568 X 10"9 VA Figure 20E has a peak potential of 0 190 V, a peak current of 2 3762 X 10"7 A, and a peak area of 2 594 X 108 VA Figure 20F has a peak potential of 0 180 V, a peak current of 2 992 X 108 A, and a peak area of 2 709 X 109 VA Figure 20G has a peak potential of 0 150 V, a peak current of 1 494 X 10"7 A, and a peak area of 1 1 X 108 VA Figure 20H has a peak potential of 0 160 V, a peak current of 1 967 X 108 A, and a peak area of 1 443 X 10"9 VA Figure 20I has a peak potential of 0 150 V, a peak current of 8 031 X 108 A, and a peak area of 6 033 X 109 VA Figure 20J has a peak potential of 0 150 V, a peak current of 8 871 X 109 A, and a peak area of 5 51 X 10"10 VA Figure 20L has a peak potential of 0 140 V, a peak current of 2 449 X 108 A, and a peak area of 1 706 X 109 VA Figure 20M has a peak potential of 0 150 V, a peak current of 6 637 X 10"8 A, and a peak area of 7 335 X 109 VA Figure 20N has a peak potential of 0 140 V, a peak current of 2 877 X 10"9 A, and a peak area of 2 056 X 10"10 VA
Figure 21 depicts the ligation chain reaction (LCR) experiment of Example 13
Figures 22A and 22B depicts the results of Example 12 The "hybrid code" refers to the system number, + and - refer to the presence or absence of the rRNA target
Figures 23A, 23B, 23C, 23D, 23E and 23F depict the compositions and results of Example 13
Figures 24A and 24B depict the compositions and results from Example 13
Figures 25A and 25B depict the set up of two of the experiments of Example 8
Figure 26 shows the results of a PCR experiment as outlined in Example 9 DETAILED DESCRIPTION OF THE INVENTION
The field of nucleic acid detection, particularly in array formats, is rapidly expanding, with fluorescent based detection systems being the most common In addition, recent and novel work has utilized detection based on electron transfer, see U S Pat No 5,591 ,578 This electron transfer detection is based on the finding that electron transfer can proceed through the stacked π orbitals (the "π-way") of the heterocyc c bases of double stranded (hybridized) nucleic acid, thus allowing differentiation between single stranded and double stranded nucleic acids Thus, nucleic acids are made that contain covalently attached ETMs, which, upon hybridization to a complementary strand, allows electron transfer to occur between the ETMs via the "π-way", and thus resulting in detection of a target sequence Further improvements on the system, described in PCT US97/20014, allows the attachment of nucleic acids to electrodes using conductive oligomers, i e chemical "wires", such that upon formation of double stranded nucleic acids containing ETMs, electron transfer can proceed between the ETM and the electrode, thus enabling electronic detection of target nucleic acids This previous work also reported on the use of self-assembled monolayers (SAMs) to electronically shield the electrodes from solution components and significantly decrease the amount of non-specific binding to the electrodes
The present invention is directed to the discovery that the presence or absence of the ETMs can be directly detected using conductive oligomers, that is, the electrons from the ETMs need not travel through the stacked π orbitals in order to generate a signal Instead, the presence of ETMs on the surface of a SAM, that comprises conductive oligomers, can be directly detected Thus, upon hybridization of a target sequence, a label probe comprising an ETM is brought to the surface, and detection of the ETM can proceed, putatively through the conductive ohgomer to the electrode Essentially, the role of the SAM comprising the conductive oligomers is to "raise" the electronic surface of the electrode, while still providing the benefits of shielding the electrode from solution components and reducing the amount of non-specific binding to the electrodes Viewed differently, the role of the nucleic acids is to provide specificity for a recruitment of ETMs to the surface, where they can be detected using conductive oligomers with electronically exposed termini
Accordingly, the present invention provides methods and compositions useful in the detection of nucleic acids As will be appreciated by those in the art, the compositions of the invention can take on a wide variety of configurations, as is generally outlined in the Figures As is more fully outlined below, preferred systems of the invention work as follows A target nucleic acid sequence is attached (via hybridization) to an electrode comprising a monolayer including conductive oligomers This attachment can be either directly to a capture probe on the surface, or indirectly, using capture extender probes A label probe is then added, forming an assay complex, that has a first portion that is capable of hybridizing to a component of the assay complex, and a second portion that does not hybridize to a component of the assay complex and contains at least one covalently attached ETM The attachment of the label probe may be direct (i e hybridization to a portion of the target sequence), or indirect (i e hybridization to an amplifier probe that hybridizes to the target sequence), with all the required nucleic acids forming an assay complex As a result of the hybridization of the first portion of the label probe, the second portion of the label probe, the "recruitment linker", containing the ETMs is brought into spatial proximity of the conductive oligomer surface on the electrode, and the presence of the ETM can then be detected electronically
Thus, in a preferred embodiment, the compositions comprise an electrode comprising a monolayer
By "electrode" herein is meant a composition, which, when connected to an electronic device, is able to sense a current or charge and convert it to a signal Alternatively an electrode can be defined as a composition which can apply a potential to and/or pass electrons to or from species in the solution Thus, an electrode is an ETM as described herein Preferred electodes are known in the art and include, but are not limited to, certain metals and their oxides, including gold, platinum, palladium, silicon, aluminum, metal oxide electrodes including platinum oxide, titanium oxide, tin oxide, indium tin oxide, palladium oxide, silicon oxide, aluminum oxide, molybdenum oxide (Mo206), tungsten oxide W03) and ruthenium oxides, and carbon (including glassy carbon electrodes graphite and carbon paste) Preferred electrodes include gold, silicon, carbon and metal oxide electrodes, with gold being particularly preferred
The electrodes described herein are depicted as a flat surface, which is only one of the possible conformations of the electrode and is for schematic purposes only The conformation of the electrode will vary with the detection method used For example, flat planar electrodes may be preferred for optical detection methods, or when arrays of nucleic acids are made, thus requiring addressable locations for both synthesis and detection Alternatively, for single probe analysis, the electrode may be in the form of a tube, with the SAMs comprising conductive oligomers and nucleic acids bound to the inner surface This allows a maximum of surface area containing the nucleic acids to be exposed to a small volume of sample
The electrode comprises a monolayer, comprising conductive oligomers By "monolayer" or "self- assembled monolayer" or "SAM" herein is meant a relatively ordered assembly of molecules spontaneously chemisorbed on a surface, in which the molecules are oriented approximately parallel to each other and roughly perpendicular to the surface Each of the molecules includes a functional group that adheres to the surface, and a portion that interacts with neighboring molecules in the monolayer to form the relatively ordered array A "mixed" monolayer comprises a heterogeneous monolayer, that is, where at least two different molecules make up the monolayer The SAM may comprise conductive oligomers alone, or a mixture of conductive oligomers and insulators As outlined herein, the efficiency of oligonucleotide hybridization may increase when the oligonucleotide is at a distance from the electrode Similarly, non-specific binding of biomolecules, including the nucleic acids, to an electrode is generally reduced when a monolayer is present Thus, a monolayer facilitates the maintenance of the nucleic acid away from the electrode surface In addition, a monolayer serves to keep charge carriers away from the surface of the electrode Thus, this layer helps to prevent electrical contact between the electrodes and the ETMs, or between the electrode and charged species within the solvent Such contact can result in a direct "short circuit" or an indirect short circuit via charged species which may be present in the sample Accordingly, the monolayer is preferably tightly packed in a uniform layer on the electrode surface, such that a minimum of "holes" exist The monolayer thus serves as a physical barrier to block solvent accesibi ty to the electrode
In a preferred embodiment, the monolayer comprises conductive oligomers By "conductive oligomer" herein is meant a substantially conducting oligomer, preferably linear, some embodiments of which are referred to in the literature as "molecular wires" By "substantially conducting" herein is meant that the oligomer is capable of transfeπng electrons at 100 Hz Generally, the conductive oligomer has substantially overlapping π-orbitals, i e conjugated π-orbitals, as between the monomenc units of the conductive oligomer, although the conductive oligomer may also contain one or more sigma (σ) bonds Additionally, a conductive oligomer may be defined functionally by its ability to inject or receive electrons into or from an associated ETM Furthermore, the conductive oligomer is more conductive than the insulators as defined herein Additionally, the conductive oligomers of the invention are to be distinguished from electroactive polymers, that themselves may donate or accept electrons
In a preferred embodiment, the conductive oligomers have a conductivity, S, of from between about 10"6 to about 104 Ω cm 1, with from about 105 to about 103 Ω 1cm 1 being preferred, with these S values being calculated for molecules ranging from about 20A to about 200A As described below, insulators have a conductivity S of about 107 Ω 1cm 1 or lower, with less than about 108 Ω 'cm 1 being preferred See generally Gardner et al , Sensors and Actuators A 51 (1995) 57-66, incorporated herein by reference
Desired characteristics of a conductive oligomer include high conductivity, sufficient solubility in organic solvents and/or water for synthesis and use of the compositions of the invention, and preferably chemical resistance to reactions that occur i) during nucleic acid synthesis (such that nucleosides containing the conductive oligomers may be added to a nucleic acid synthesizer during the synthesis of the compositions of the invention), n) during the attachment of the conductive oligomer to an electrode, or in) during hybridization assays In addition, conductive oligomers that will promote the formation of self-assembled monolayers are preferred The oligomers of the invention comprise at least two monomeπc subunits, as described herein As is described more fully below, oligomers include homo- and hetero-oligomers, and include polymers
In a preferred embodiment, the conductive oligomer has the structure depicted in Structure 1
Structure 1
Figure imgf000014_0001
As will be understood by those in the art, all of the structures depicted herein may have additional atoms or structures, i e the conductive oligomer of Structure 1 may be attached to ETMs, such as electrodes, transition metal complexes, organic ETMs, and metallocenes, and to nucleic acids, or to several of these Unless otherwise noted, the conductive oligomers depicted herein will be attached at the left side to an electrode, that is, as depicted in Structure 1 , the left "Y" is connected to the electrode as described herein If the conductive oligomer is to be attached to a nucleic acid, the right "Y", if present, is attached to the nucleic acid, either directly or through the use of a linker, as is described herein
In this embodiment, Y is an aromatic group, n is an integer from 1 to 50, g is either 1 or zero, e is an integer from zero to 10, and m is zero or 1 When g is 1 , B-D is a tond able 10 conjugate with neighboring bonds (herein referred to as a "conjugated'boiid" , preferably selected from acetylene, B-
D is a conjugated bond, preferably selected from acetylene, alkene, substituted alkene, amide, azo, - C=N- (including -N=C-, -CR=N- and -N=CR-), -Sι=Sι-, and -Sι=C- (including -C=Sι-, -Sι=CR- and - CR=Sι-) When g is zero, e is preferably 1 , D is preferably carbonyl, or a heteroatom moiety, wherein the heteroatom is selected from oxygen, sulfur, nitrogen, silicon or phosphorus Thus, suitable heteroatom moieties include, but are not limited to, -NH and -NR, wherein R is as defined herein, substituted sulfur, sulfonyl (-S02-) sulfoxide (-SO-), phosphine oxide (-PO- and -RPO-), and thiophosphine (-PS- and -RPS-) However, when the conductive oligomer is to be attached to a gold electrode, as outlined below, sulfur derivatives are not preferred
By "aromatic group" or grammatical equivalents herein is meant an aromatic monocyclic or polycychc hydrocarbon moiety generally containing 5 to 14 carbon atoms (although larger polycychc rings structures may be made) and any carbocy c ketone or thioketone derivative thereof, wherein the carbon atom with the free valence is a member of an aromatic ring Aromatic groups include arylene groups and aromatic groups with more than two atoms removed For the purposes of this application aromatic includes heterocycle "Heterocycle" or "heteroaryl" means an aromatic group wherein 1 to 5 of the indicated carbon atoms are replaced by a heteroatom chosen from nitrogen, oxygen, sulfur, phosphorus, boron and silicon wherein the atom with the free valence is a member of an aromatic ring, and any heterocyclic ketone and thioketone derivative thereof Thus, heterocycle includes thienyl, furyl, pyrrolyl, pyrimidinyl, oxalyl, indolyl, punnyl, quinolyl, isoquinolyl, thiazolyl, imidozyl, etc
Importantly, the Y aromatic groups of the conductive oligomer may be different, i e the conductive oligomer may be a heteroo gomer That is, a conductive oligomer may comprise a oligomer of a single type of Y groups, or of multiple types of Y groups
The aromatic group may be substituted with a substitution group, generally depicted herein as R R groups may be added as necessary to affect the packing of the conductive oligomers, i e R groups may be used to alter the association of the oligomers in the monolayer R groups may also be added to 1 ) alter the solubility of the oligomer or of compositions containing the oligomers, 2) alter the conjugation or electrochemical potential of the system, and 3) alter the charge or characteristics at the surface of the monolayer
In a preferred embodiment, when the conductive oligomer is greater than three subunits, R groups are preferred to increase solubility when solution synthesis is done However, the R groups, and their positions, are chosen to minimally effect the packing of the conductive oligomers on a surface, particularly within a monolayer, as described below In general, only small R groups are used within the monolayer, with larger R grouDs generally above the surface of the monolayer Thus for example the attachment of methyl groups to the portion of the conductive oligomer within the monolayer to increase solubility is preferred, with attachment of longer alkoxy groups, for example, C3 to C10, is preferably done above the monolayer surface In general, for the systems described herein, this generally means that attachment of steπcally significant R groups is not done on any of the first two or three oligomer subunits, depending on the average length of the molecules making up the monolayer
Suitable R groups include, but are not limited to, hydrogen, alkyl, alcohol, aromatic, ammo, amido, nitro, ethers, esters, aldehydes, sulfonyl, silicon moieties, halogens, sulfur containing moieties, phosphorus containing moieties, and ethylene glycols In the structures depicted herein, R is hydrogen when the position is unsubstituted It should be noted that some positions may allow two substitution groups, R and R', in which case the R and R' groups may be either the same or different
By "alkyl group" or grammatical equivalents herein is meant a straight or branched chain alkyl group, with straight chain alkyl groups being preferred If branched, it may be branched at one or more positions, and unless specified, at any position The alkyl group may range from about 1 to about 30 carbon atoms (C1 -C30), with a preferred embodiment utilizing from about 1 to about 20 carbon atoms
(C1 -C20), with about C1 through about C12 to about C15 being preferred, and C1 to C5 being particularly preferred, although in some embodiments the alkyl group may be much larger Also included within the definition of an alkyl group are cycloalkyl groups such as C5 and C6 rings, and heterocyclic rings with nitrogen, oxygen, sulfur or phosphorus Alkyl also includes heteroalkyl, with heteroatoms of sulfur, oxygen, nitrogen, and silicone being preferred Alkyl includes substituted alkyl groups By "substituted alkyl group" herein is meant an alkyl group further comprising one or more substitution moieties "R", as defined above
By "ammo groups" or grammatical equivalents herein is meant -NH2, -NHR and -NR2 groups, with R being as defined herein
By "nitro group" herein is meant an -N02 group
By "sulfur containing moieties" herein is meant compounds containing sulfur atoms, including but not limited to, thia-, thio- and sulfo- compounds, thiols (-SH and -SR), and sulfides (-RSR-) By "phosphorus containing moieties" herein is meant compounds containing phosphorus, including, but not limited to, phosphmes and phosphates By "silicon containing moieties" herein is meant compounds containing silicon
By "ether" herein is meant an -O-R group Preferred ethers include alkoxy groups, with -0-(CH2)2CH3 and -0-(CH2)4CH3 being preferred
By "ester" herein is meant a -COOR group
By "halogen" herein is meant bromine, iodine, chlorine, or fluorine Preferred substituted alkyls are partially or fully halogenated alkyls such as CF3, etc
By "aldehyde" herein is meant -RCHO groups
By "alcohol" herein is meant -OH groups, and alkyl alcohols -ROH
By "amido" herein is meant -RCONH- or RCONR- groups
By "ethylene glycol" or "(poly)ethylene glycol" herein is meant a -(0-CH2-CH2)n- group, although each carbon atom of the ethylene group may also be singly or doubly substituted, i e -(0-CR2-CR2)n-, with R as described above Ethylene glycol derivatives with other heteroatoms in place of oxygen (i e -(N- CH2-CH2)n- or -(S-CH2-CH2)n-, or with substitution groups) are also preferred Preferred substitution groups include, but are not limited to, methyl, ethyl, propyl, alkoxy groups such as -0-(CH2)2CH3 and -0-(CH2)4CH3 and ethylene glycol and derivatives thereof.
Preferred aromatic groups include, but are not limited to, phenyl, naphthyl, naphthalene, anthracene, phenanthroline, pyrole, pyridine, thiophene, porphyrins, and substituted derivatives of each of these, included fused ring derivatives.
In the conductive oligomers depicted herein, when g is 1 , B-D is a bond linking two atoms or chemical moieties. In a preferred embodiment, B-D is a conjugated bond, containing overlapping or conjugated π-orbitals.
Preferred B-D bonds are selected from acetylene (-C_;C-, also called alkyne or ethyne), alkene (- CH=CH-, also called ethylene), substituted alkene (-CR=CR-, -CH=CR- and -CR=CH-), amide (-NH- CO- and -NR-CO- or -CO-NH- and -CO-NR-), azo (-N=N-), esters and thioesters (-C0-0-, -0-C0-, - CS-O- and -0-CS-) and other conjugated bonds such as (-CH=N-, -CR=N-, -N=CH- and -N=CR-), (-
SiH=SiH-, -SiR=SiH-, -SiR=SiH-, and -SiR=SiR-), (-SiH=CH-, -SiR=CH-, -SiH=CR-, -SiR=CR-, - CH=SiH-, -CR=SiH-, -CH=SiR-, and -CR=SiR-). Particularly preferred B-D bonds are acetylene, alkene, amide, and substituted derivatives of these three, and azo. Especially preferred B-D bonds are acetylene, alkene and amide. The oligomer components attached to double bonds may be in the trans or cis -conformation, or mixtures. Thus, either B or O may include carbon, nitrogen or silicon.
The substitution groups are- as-defined as above for R.
When g=0 in the Structure 1 conductive oligomer, e is preferably 1 and the D moiety may be carbonyl or a heteroatom moiety as defined above.
As above for the Y rings, within any single conductive oligomer, the B-D bonds (or D moieties, when g=0) may be all the same, or at least one may be different. For example, when m is zero, the terminal B-D bond may be an amide bond, and the rest of the B-D bonds may be acetylene bonds. Generally, when amide bonds are present, as few amide bonds as possible are preferable, but in some embodiments all the B-D bonds are amide bonds. Thus, as outlined above for the Y rings, one type of
B-D bond may be present in the conductive oligomer within a monolayer as described below, and another type above the monolayer level, for example to give greater flexibility for nucleic acid hybridization when the nucleic acid is attached via a conductive oligomer.
In the structures depicted herein, n is an integer from 1 to 50, although longer oligomers may also be used (see for example Schumm et al., Angew. Chem. Int. Ed. Engl. 1994 33(13):1360). Without being bound by theory, it appears that for efficient hybridization of nucleic acids on a surface, the hybridization should occur at a distance from the surface, i e the kinetics of hybridization increase as a function of the distance from the surface, particularly for long oligonucleotides of 200 to 300 basepairs Accordingly, when a nucleic acid is attached via a conductive oligomer, as is more fully described below, the length of the conductive oligomer is such that the closest nucleotide of the nucleic acid is positioned from about 6A to about 100A (although distances of up to 500A may be used) from the electrode surface, with from about 15A to about 60A being preferred and from about 25A to about 60A also being preferred Accordingly, n will depend on the size of the aromatic group, but generally will be from about 1 to about 20, with from about 2 to about 15 being preferred and from about 3 to about 10 being especially preferred
In the structures depicted herein, m is either 0 or 1 That is, when m is 0, the conductive oligomer may terminate in the B-D bond or D moiety, i e the D atom is attached to the nucleic acid either directly or via a linker In some embodiments, for example when the conductive oligomer is attached to a phosphate of the πbose-phosphate backbone of a nucleic acid, there may be additional atoms, such as a linker, attached between the conductive oligomer and the nucleic acid Additionally, as outlined below, the D atom may be the nitrogen atom of the ammo-modified nbose Alternatively, when m is 1 , the conductive oligomer may terminate in Y, an aromatic group, i e the aromatic group is attached to the nucleic acid or linker
As will be appreciated by those in the art, a large number of possible conductive oligomers may be utilized These include conductive oligomers falling within the Structure 1 and Structure 8 formulas, as well as other conductive oligomers, as are generally known in the art, including for example, compounds comprising fused aromatic rings or Teflon®-lιke oligomers, such as -(CF2)n-, -(CHF)n- and -(CFR)n- See for example, Schumm et al , Angew Chem Intl Ed Engl 33 1361 (1994), Grosshenny et al , Platinum Metals Rev 40(1 ) 26-35 (1996), Tour, Chem Rev 96 537-553 (1996), Hsung et al ,
Organometalhcs 14 4808-4815 (1995, and references cited therein, all of which are expressly incorporated by reference
Particularly preferred conductive oligomers of this embodiment are depicted below
Structure 2
Figure imgf000018_0001
Structure 2 is Structure 1 when g is 1 Preferred embodiments of Structure 2 include e is zero, Y is pyrole or substituted pyrole, e is zero, Y is thiophene or substituted thiophene, e is zero, Y is furan or substituted furan, e is zero, Y is phenyl or substituted phenyl, e is zero, Y is pyridme or substituted pyridme, e is 1 , B-D is acetylene and Y is phenyl or substituted phenyl (see Structure 4 below) A preferred embodiment of Structure 2 is also when e is one, depicted as Structure 3 below
Structure 3
Figure imgf000019_0001
Preferred embodiments of Structure 3 are Y is phenyl or substituted phenyl and B-D is azo, Y is phenyl or substituted phenyl and B-D is acetylene, Y is phenyl or substituted phenyl and B-D is alkene, Y is pyridme or substituted pyridme and B-D is acetylene, Y is thiophene or substituted thiophene and B-D is acetylene, Y is furan or substituted furan and B-D is acetylene, Y is thiophene or furan (or substituted thiophene or furan) and B-D are alternating alkene and acetylene bonds
Most of the structures depicted herein utilize a Structure 3 conductive oligomer However, any Structure 3 oligomers may be substituted with any of the other structures depicted herein, i e Structure 1 or 8 oligomer, or other conducting oligomer, and the use of such Structure 3 depiction is not meant to limit the scope of the invention
Particularly preferred embodiments of Structure 3 include Structures 4, 5, 6 and 7, depicted below
Structure 4
Figure imgf000019_0002
Particularly preferred embodiments of Structure 4 include n is two, m is one, and R is hydrogen, n is three, m is zero, and R is hydrogen, and the use of R groups to increase solubility Structure δ
Figure imgf000019_0003
When the B-D bond is an amide bond, as in Structure 5, the conductive oligomers are pseudopeptide oligomers Although the amide bond in Structure 5 is depicted with the carbonyl to the left, i e -
CONH-, the reverse may also be used, i e -NHCO- Particularly preferred embodiments of Structure 5 include n is two, m is one, and R is hydrogen, n is three, m is zero, and R is hydrogen (in this embodiment, the terminal nitrogen (the D atom) may be the nitrogen of the ammo-modified nbose), and the use of R groups to increase solubility Structure 6
Figure imgf000020_0001
Preferred embodiments of Structure 6 include the first n is two, second n is one, m is zero, and all R groups are hydrogen, or the use of R groups to increase solubility.
Structure 7
Figure imgf000020_0002
Preferred embodiments of Structure 7 include: the first n is three, the second n is from 1-3, with m being either 0 or 1 , and the use of R groups to increase solubility.
In a preferred embodiment, the conductive oligomer has the structure depicted in Structure 8:
Structure 8
Figure imgf000020_0003
In this embodiment, C are carbon atoms, n is an integer from 1 to 50, m is 0 or 1 , J is a heteroatom selected from the group consisting of oxygen, nitrogen, silicon, phosphorus, sulfur, carbonyl or sulfoxide, and G is a bond selected from alkane, alkene or acetylene, such that together with the two carbon atoms the C-G-C group is an alkene (-CH=CH-), substituted alkene (-CR=CR-) or mixtures thereof (-CH=CR- or -CR=CH-), acetylene (-C-ΞC-), or alkane (-CR2-CR2-, with R being either hydrogen or a substitution group as described herein). The G bond of each subunit may be the same or different than the G bonds of other subunits; that is, alternating oligomers of alkene and acetylene bonds could be used, etc. However, when G is an alkane bond, the number of alkane bonds in the oligomer should be kept to a minimum, with about six or less sigma bonds per conductive oligomer being preferred. Alkene bonds are preferred, and are generally depicted herein, although alkane and acetylene bonds may be substituted in any structure or embodiment described herein as will be appreciated by those in the art.
In some embodiments, for example when ETMs are not present, if m=0 then at least one of the G bonds is not an alkane bond. In a preferred embodiment, the m of Structure 8 is zero In a particularly preferred embodiment, m is zero and G is an alkene bond, as is depicted in Structure 9
Structure 9
Figure imgf000021_0001
The alkene oligomer of structure 9, and others depicted herein, are generally depicted in the preferred trans configuration, although oligomers of as or mixtures of trans and cis may also be used As above, R groups may be added to alter the packing of the compositions on an electrode, the hydrophilicity or hydrophobicity of the oligomer, and the flexibility, i e the rotational, torsional or longitudinal flexibility of the oligomer n is as defined above
In a preferred embodiment, R is hydrogen, although R may be also alkyl groups and polyethylene glycols or derivatives
In an alternative embodiment, the conductive oligomer may be a mixture of different types of oligomers, for example of structures 1 and 8
In addition, the terminus of at least some of the conductive oligomers in the monolayer are electronically exposed By "electronically exposed" herein is meant that upon the placement of an ETM in close proximity to the terminus, and after initiation with the appropriate signal, a signal dependent on the presence of the ETM may be detected The conductive oligomers may or may not have terminal groups Thus, in a preferred embodiment, there is no additional terminal group, and the conductive oligomer terminates with one of the groups depicted in Structures 1 to 9, for example, a B-
D bond such as an acetylene bond Alternatively, in a preferred embodiment, a terminal group is added, sometimes depicted herein as "Q" A terminal group may be used for several reasons, for example, to contribute to the electronic availability of the conductive oligomer for detection of ETMs, or to alter the surface of the SAM for other reasons, for example to prevent non-specific binding For example, there may be negatively charged groups on the terminus to form a negatively charged surface such that when the nucleic acid is DNA or RNA the nucleic acid is repelled or prevented from lying down on the surface, to facilitate hybridization Preferred terminal groups include -NH2, -OH, - COOH, and alkyl groups such as -CH3, and (poly)alkyloxιdes such as (poly)ethylene glycol, with - OCH2CH2OH, -(OCH2CH20)2H, -(OCH2CH20)3H, and -(OCH2CH20)4H being preferred In one embodiment, it is possible to use mixtures of conductive oligomers with different types of terminal groups. Thus, for example, some of the terminal groups may facilitate detection, and some may prevent non-specific binding.
It will be appreciated that the monolayer may comprise different conductive oligomer species, although preferably the different species are chosen such that a reasonably uniform SAM can be formed. Thus, for example, when nucleic acids are covalently attached to the electrode using conductive oligomers, it is possible to have one type of conductive oligomer used to attach the nucleic acid, and another type functioning to detect the ETM. Similarly, it may be desirable to have mixtures of different lengths of conductive oligomers in the monolayer, to help reduce non-specific signals. Thus, for example, preferred embodiments utilize conductive oligomers that terminate below the surface of the rest of the monolayer, i.e. below the insulator layer, if used, or below some fraction of the other conductive oligomers. Similarly, the use of different conductive oligomers may be done to facilitate monolayer formation, or to make monolayers with altered properties.
In a preferred embodiment, the monolayer may further comprise insulator moieties. By "insulator" herein is meant a substantially nonconducting oligomer, preferably linear. By "substantially nonconducting" herein is meant that the insulator will not transfer electrons at 100 Hz. The rate of electron transfer through the insulator is preferrably slower than the rate through the conductive oligomers described herein.
In a preferred embodiment, trie insulators have a conductivity, S, of about 10"7 Ω"1cπr1 or lower, with less tharrabout 10"8 Ω 'cm' 1 being preferred. See- generally Gardner et ai., supra.
Generally, insulators are alkyl or heteroalkyl oligomers or moieties with sigma bonds, although any particular insulator molecule may contain aromatic groups or one or more conjugated bonds. By "heteroalkyl" herein is meant an alkyl group that has at least one heteroatom, i.e. nitrogen, oxygen, sulfur, phosphorus, silicon or boron included in the chain. Alternatively, the insulator may be quite similar to a conductive oligomer with the addition of one or more heteroatoms or bonds that serve to inhibit or slow, preferably substantially, electron transfer.
Suitable insulators are known in the art, and include, but are not limited to, -(CH2)n-, -(CRH)n-, and - (CR2)n-, ethylene glycol or derivatives using other heteroatoms in place of oxygen, i.e. nitrogen or sulfur (sulfur derivatives are not preferred when the electrode is gold).
As for the conductive oligomers, the insulators may be substituted with R groups as defined herein to alter the packing of the moieties or conductive oligomers on an electrode, the hydrophilicity or hydrophobicity of the insulator, and the flexibility, i e the rotational, torsional or longitudinal flexibility of the insulator For example, branched alkyl groups may be used Similarly, the insulators may contain terminal groups, as outlined above, particularly to influence the surface of the monolayer
The length of the species making up the monolayer will vary as needed As outlined above, it appears that hybridization is more efficient at a distance from the surface The species to which nucleic acids are attached (as outlined below, these can be either insulators or conductive oligomers) may be basically the same length as the monolayer forming species or longer than them, resulting in the nucleic acids being more accessible to the solvent for hybridization In some embodiments, the conductive oligomers to which the nucleic acids are attached may be shorter than the monolayer
As will be appreciated by those in the art, the actual combinations and ratios of the different species making up the monolayer can vary widely Generally, three component systems are preferred, with the first species comprising a nucleic acid containing species (i e a capture probe, that can be attached to the electrode via either an insulator or a conductive oligomer, as is more fully described below) The second species are the conductive oligomers, and the third species are insulators In this embodiment, the first species can comprise from about 90% to about 1 %, with from about 20% to about 40% being preferred, and from about 30% to about 40% being especially preferred for short oligonucleotide targets and from about 10% to about 20% preferred for longer targets The second species can comprise from about 1 % to about 90%, with from about 20% to about 90% being preferred, and from about 40% to about 60% being especially preferred The third species can comprise from about 1 % to about 90% with from about 20% to about 40% being preferred, and from about 15% to about 30% being especially preferred Preferred ratios of first second.third species are 2 2 1 for short targets, 1 3 1 for longer targets, with total thiol concentration in the 500 μM to 1 mM range, and 833 μM being preferred
In a preferred embodiment, two component systems are used, comprising the first and second species In this embodiment, the first species can comprise from about 90% to about 1 %, with from about 1% to about 40% being preferred, and from about 10% to about 40% being especially preferred The second species can comprise from about 1% to about 90%, with from about 10% to about 60% being preferred, and from about 20% to about 40% being especially preferred
The covalent attachment of the conductive oligomers and insulators may be accomplished in a variety of ways, depending on the electrode and the composition of the insulators and conductive oligomers used In a preferred embodiment, the attachment linkers with covalently attached nucleosides or nucleic acids as depicted herein are covalently attached to an electrode Thus, one end or terminus of the attachment linker is attached to the nucleoside or nucleic acid, and the other is attached to an electrode In some embodiments it may be desirable to have the attachment linker attached at a position other than a terminus, or even to have a branched attachment linker that is attached to an electrode at one terminus and to two or more nucleosides at other termini, although this is not preferred Similarly, the attachment linker may be attached at two sites to the electrode, as is generally depicted in Structures 11-13 Generally, some type of linker is used, as depicted below as "A" in Structure 10, where "X" is the conductive oligomer, "I" is an insulator and the hatched surface is the electrode
Structure 10
Figure imgf000024_0001
In this embodiment, A is a linker or atom The choice of "A" will depend in part on the characteristics of the electrode Thus, for example, A may be a sulfur moiety when a gold electrode is used
Alternatively, when metal oxide electrodes are used, A may be a silicon (silane) moiety attached to the oxygen of the oxide (see for example Chen et al , Langmuir 10 3332-3337 (1994), Lenhard et al , J Electroanal Chem 78 195-201 (1977), both of which are expressly incorporated by reference) When carbon based electrodes are used, A may be an ammo moiety (preferably a primary amine, see for example Deinhammer et al , Langmuir 10 1306-1313 (1994)) Thus, preferred A moieties include, but are not limited to, silane moieties, sulfur moieties (including alkyl sulfur moieties), and ammo moieties In a preferred embodiment, epoxide type linkages with redox polymers such as are known in the art are not used
Although depicted herein as a single moiety, the insulators and conductive oligomers may be attached to the electrode with more than one "A" moiety, the "A" moieties may be the same or different Thus, for example, when the electrode is a gold electrode, and "A" is a sulfur atom or moiety, multiple sulfur atoms may be used to attach the conductive oligomer to the electrode, such as is generally depicted below in Structures 11 , 12 and 13 As will be appreciated by those in the art, other such structures can be made In Structures 11 , 12 and 13, the A moiety is just a sulfur atom, but substituted sulfur moieties may also be used Structure 11
Figure imgf000025_0001
Structure 12
Figure imgf000025_0002
Structure 13
Figure imgf000025_0003
It should also be noted that similar to Structure 13, it may be possible to have a a conductive oligomer terminating in a single carbon atom with three sulfur moities attached to the electrode Additionally, although not always depicted herein, the conductive oligomers and insulators may also comprise a "Q" terminal group
In a preferred embodiment, the electrode is a gold electrode, and attachment is via a sulfur linkage as is well known in the art, i e the A moiety is a sulfur atom or moiety Although the exact characteristics of the gold-sulfur attachment are not known, this linkage is considered covalent for the purposes of this invention A representative structure is depicted in Structure 14, using the Structure 3 conductive oligomer, although as for all the structures depicted herein, any of the conductive oligomers, or combinations of conductive oligomers, may be used Similarly, any of the conductive oligomers or insulators may also comprise terminal groups as described herein Structure 14 depicts the "A" linker as comprising just a sulfur atom, although additional atoms may be present (i e linkers from the sulfur to the conductive oligomer or substitution groups) In addition, Structure 14 shows the sulfur atom attached to the Y aromatic group, but as will be appreciated by those in the art, it may be attached to the B-D group (i e an acetylene) as well Structure 14
Figure imgf000026_0001
In a preferred embodiment, the electrode is a carbon electrode, i e a glassy carbon electrode, and attachment is via a nitrogen of an amine group A representative structure is depicted in Structure 15 Again, additional atoms may be present, i e Z type linkers and/or terminal groups
Structure 15
Figure imgf000026_0002
Structure 16
Figure imgf000026_0003
In Structure 16 the oxygen atom is from the oxide of the metal oxide electrode The Si atom may also contain other atoms, i e be a silicon moiety containing substitution groups Other attachments for SAMs to other electrodes are known in the art, see for example Napier et al , Langmuir, 1997, for attachment to indium tin oxide electrodes, and also the chemisorption of phosphates to an indium tin oxide electrode (talk by H Holden Thorpe, CHI conference, May 4-5, 1998)
In a preferred embodiment, the electrode comprising the monolayer including conductive oligomers further comprises a nucleic acid capture probe By "nucleic acid" or "oligonucleotide" or grammatical equivalents herein means at least two nucleotides covalently linked together A nucleic acid of the present invention will generally contain phosphodiester bonds, although in some cases, as outlined below, nucleic acid analogs are included that may have alternate backbones, comprising, for example, phosphoramide (Beaucage et al , Tetrahedron 49(10) 1925 (1993) and references therein, Letsmger, J Org Chem 35 3800 (1970), Spnnzl et al , Eur J Biochem 81 579 (1977), Letsmger et al , Nucl Acids Res 14 3487 (1986), Sawai et al, Chem Lett 805 (1984), Letsmger et al , J Am Chem Soc 110 4470 (1988), and Pauwels et al , Chemica Scπpta 26 141 91986)), phosphorothioate (Mag et al , Nucleic Acids Res 19 1437 (1991 ), and U S Patent No 5,644,048), phosphorodithioate (Bnu et al . J Am Chem Soc 111 2321 (1989), O-methylphophoroamidite linkages (see Eckstein, O gonucleotides and Analogues A Practical Approach, Oxford University Press), and peptide nucleic acid backbones and linkages (see Egholm, J Am Chem Soc 114 1895 (1992), Meier et al , Chem Int Ed Engl 31 1008 (1992), Nielsen, Nature, 365 566 (1993), Carlsson et al , Nature 380 207 (1996), all of which are incorporated by reference) Other analog nucleic acids include those with positive backbones (Denpcy et al , Proc Natl Acad Sci USA 92 6097 (1995), non-ionic backbones (U S Patent Nos 5,386,023, 5,637,684, 5,602,240, 5,216,141 and 4,469,863, Kiedrowshi et al , Angew Chem Intl Ed English 30 423 (1991 ), Letsmger et al , J Am Chem Soc 110 4470 (1988), Letsmger et al , Nucleoside & Nucleotide 13 1597 (1994), Chapters 2 and 3, ASC Symposium Series 580,
"Carbohydrate Modifications in Antisense Research", Ed Y S Sanghui and P Dan Cook, Mesmaeker et al , Bioorganic & Medicinal Chem Lett 4 395 (1994), Jeffs et al , J Biomolecular NMR 34 17 (1994), Tetrahedron Lett 37 743 (1996)) and non-πbose backbones, including those described in U S Patent Nos 5,235,033 and 5,034,506, and Chapters 6 and 7, ASC Symposium Series 580, "Carbohydrate Modifications in Antisense Research", Ed Y S Sanghui and P Dan Cook Nucleic acids containing one or more carbocyclic sugars are also included within the definition of nucleic acids (see Jenkins et al , Chem Soc Rev (1995) pp169-176) Several nucleic acid analogs are described in Rawls, C & E News June 2, 1997 page 35 All of these references are hereby expressly incorporated by reference These modifications of the πbose-phosphate backbone may be done to facilitate the addition of ETMs, or to increase the stability and half-life of such molecules in physiological environments
As will be appreciated by those in the art, all of these nucleic acid analogs may find use in the present invention In addition, mixtures of naturally occurring nucleic acids and analogs can be made, for example, at the site of conductive oligomer or ETM attachment, an analog structure may be used
Alternatively, mixtures of different nucleic acid analogs, and mixtures of naturally occunng nucleic acids and analogs may be made
Particularly preferred are peptide nucleic acids (PNA) which includes peptide nucleic acid analogs These backbones are substantially non-ionic under neutral conditions, in contrast to the highly charged phosphodiester backbone of naturally occurring nucleic acids This results in two advantages First, the PNA backbone exhibits improved hybridization kinetics PNAs have larger changes in the melting temperature (Tm) for mismatched versus perfectly matched basepairs DNA and RNA typically exhibit a 2-4°C drop in Tm for an internal mismatch Wth the non-ionic PNA backbone, the drop is closer to 7-9°C This allows for better detection of mismatches Similarly, due to their non-ionic nature, hybridization of the bases attached to these backbones is relatively insensitive to salt concentration This is particularly advantageous in the systems of the present invention, as a reduced salt hybridization solution has a lower Faradaic current than a physiological salt solution (in the range of 150 mM)
The nucleic acids may be single stranded or double stranded, as specified, or contain portions of both double stranded or single stranded sequence The nucleic acid may be DNA, both genomic and cDNA, RNA or a hybrid, where the nucleic acid contains any combination of deoxyπbo- and nbo- nucleotides, and any combination of bases, including uracil, adenine, thymme, cytosme, guanme, inosme, xathanme hypoxathan e, isocytosine, isoguanme, etc A preferred embodiment utilizes isocytosine and isoguanme in nucleic acids designed to be complementary to other probes, rather than target sequences, as this reduces non-specific hybridization, as is generally described in U S
Patent No 5,681 ,702 As used herein, the term "nucleoside" includes nucleotides as well as nucleoside and nucleotide analogs, and modified nucleosides such as ammo modified nucleosides In addition, "nucleoside" includes non-naturally occunng analog structures Thus for example the individual units of a peptide nucleic acid, each containing a base, are referred to herein as a nucleoside
The capture probe nucleic acid is covalently attached to the electrode This attachment can be via a conductive oligomer or via an insulator By "capture probe" or "anchor probe" herein is meant a component of an assay complex as defined herein that allows the attachment of a target sequence to the electrode, for the purposes of detection As is more fully outlined below, attachment of the target sequence to the capture probe may be direct (i e the target sequence hybridizes to the capture probe) or indirect (one or more capture extender probes are used) By "covalently attached" herein is meant that two moieties are attached by at least one bond, including sigma bonds, pi bonds and coordination bonds In addition, as is more fully outlined below, the capture probes may have botf'i nucleic and non- nucleic acid portions Thus, for example, flexible linkers such as alkyl groups, including polyethylene glycol linkers, may be used to get the nucleic acid portion of the capture probe off the electrode surface This may be particularly useful when the target sequences are large, for example when genomic DNA or rRNA is the target The use of capture probes comprising flexible ethylene glycol linkers is shown in Example 13
The capture probe nucleic acid is covalently attached to the electrode, via an "attachment linker", that can be either a conductive oligomer or via an insulator Thus, one end of the attachment linker is attached to a nucleic acid, and the other end (although as will be appreciated by those in the art, it need not be the exact terminus for either) is attached to the electrode Thus, any of structures depicted herein may further comprise a nucleic acid effectively as a terminal group Thus, the present invention provides compositions comprising nucleic acids covalently attached to electrodes as is generally depicted below in Structure 17 Structure 17
Figure imgf000029_0001
In Structure 17, the hatched marks on the left represent an electrode X is a conductive oligomer and I is an insulator as defined herein F, is a linkage that allows the covalent attachment of the electrode and the conductive oligomer or insulator, including bonds, atoms or linkers such as is described herein, for example as "A", defined below F2 is a linkage that allows the covalent attachment of the conductive oligomer or insulator to the nucleic acid, and may be a bond, an atom or a linkage as is herein described F2 may be part of the conductive oligomer, part of the insulator, part of the nucleic acid, or exogeneous to both, for example, as defined herein for "Z"
In a preferred embodiment, the capture probe nucleic acid is covalently attached to the electrode via a conductive oligomer The covalent attachment of the nucleic acid and the conductive oligomer may be accomplished in several ways In a preferred embodiment, the attachment is via attachment to the base of the nucleoside, via attachment to the backbone of the nucleic acid (either the nbose, the phosphate, or to an analogous group of a nucleic acid analog backbone), or via a transition metal ligand, as described below The techniques outlined below are generally described for naturally occunng nucleic acids, although as will be appreciated by those in the art, similar techniques may be used with nucleic acid analogs
In a preferred embodiment the conductive oligomer is attached to the base of a nucleoside of the nucleic acid This may be done in several ways, depending on the oligomer, as is described below In one embodiment, the oligomer is attached to a terminal nucleoside, i e either the 3' or 5' nucleoside of the nucleic acid Alternatively, the conductive oligomer is attached to an internal nucleoside
The point of attachment to the base will vary with the base Generally, attachment at any position is possible In some embodiments, for example when the probe containing the ETMs may be used for hybridization, it is preferred to attach at positions not involved in hydrogen bonding to the complementary base Thus, for example, generally attachment is to the 5 or 6 position of pyπmidines such as undine, cytosme and thymme For punnes such as adenine and guanme, the linkage is preferably via the 8 position Attachment to non-standard bases is preferably done at the comparable positions In one embodiment, the attachment is direct, that is, there are no intervening atoms between the conductive oligomer and the base In this embodiment, for example, conductive oligomers with terminal acetylene bonds are attached directly to the base Structure 18 is an example of this linkage, using a Structure 3 conductive oligomer and undine as the base, although other bases and conductive oligomers can be used as will be appreciated by those in the art
Structure 18
Figure imgf000030_0001
It should be noted that the pentose structures depicted herein may have hydrogen, hydroxy, phosphates or other groups such as ammo groups attached In addition, the pentose and nucleoside structures depicted herein are depicted non-conventionally, as mirror images of the normal rendering In addition, the pentose and nucleoside structures may also contain additional groups, such as protecting groups, at any position, for example as needed during synthesis
In addition, the base may contain additional modifications as needed, i e the carbonyl or amine groups may be altered or protected, for example as is depicted in Figure 18A of PCT US97/20014 This may be required to prevent significant dimerization of conductive oligomers instead of coupling to the lodinatmg base In addition, changing the components of the palladium reaction may be desirable also R groups may be preferred on longer conductive oligomers to increase solubility
In an alternative embodiment, the attachment is any number of different Z linkers, including amide and amine linkages, as is generally depicted in Structure 19 using undine as the base and a Structure 3 oligomer
Structure 19
Figure imgf000030_0002
In this embodiment, Z is a linker Preferably, Z is a short linker of about 1 to about 10 atoms, with from 1 to 5 atoms being preferred, that may or may not contain alkene, alkynyl, amine, amide, azo, imine, etc , bonds Linkers are known in the art, for example, homo-or hetero-bifunctional linkers as are well known (see 1994 Pierce Chemical Company catalog, technical section on cross-linkers, pages 155-200, incorporated herein by reference) Preferred Z linkers include, but are not limited to, alkyl groups (including substituted alkyl groups and alkyl groups containing heteroatom moieties), with short alkyl groups, esters, amide, amine, epoxy groups and ethylene glycol and derivatives being preferred, with propyl, acetylene, and C2 alkene being especially preferred Z may also be a sulfone group, forming sulfonamide linkages as discussed below
In a preferred embodiment, the attachment of the nucleic acid and the conductive oligomer is done via attachment to the backbone of the nucleic acid This may be done in a number of ways, including attachment to a nbose of the πbose-phosphate backbone, or to the phosphate of the backbone, or other groups of analogous backbones
As a preliminary matter, it should be understood that the site of attachment in this embodiment may be to a 3' or 5' terminal nucleotide, or to an internal nucleotide, as is more fully described below
In a preferred embodiment, the conductive oligomer is attached to the nbose of the nbose-phosphate backbone This may be done in several ways As is known in the art, nucleosides that are modified at either the 2' or 3' position of the nbose with ammo groups, sulfur groups, silicone groups, phosphorus groups, or oxo groups can be made (Imazawa et al , J Org Chem , 44 2039 (1979), Hobbs et al , J Org Chem 42(4) 714 (1977), Verheyden et al , J Orrg Chem 36(2) 250 (1971 ), McGee et al , J Org Chem 61 781-785 (1996), Mikhailopulo et al , Liebigs Ann Chem 513-519 (1993), McGee et al , Nucleosides & Nucieotides 14(6) 323 (1995), ail of which are incorporated by reference) These modified nucleosides are then used to add the conductive oligomers
A preferred embodiment utilizes ammo-modified nucleosides These ammo-modified πboses can then be used to form either amide or amine linkages to the conductive oligomers In a preferred embodiment, the ammo group is attached directly to the nbose, although as will be appreciated by those in the art, short linkers such as those described herein for "Z" may be present between the ammo group and the nbose
In a preferred embodiment, an amide linkage is used for attachment to the nbose Preferably, if the conductive oligomer of Structures 1 -3 is used, m is zero and thus the conductive oligomer terminates in the amide bond In this embodiment, the nitrogen of the ammo group of the ammo-modified nbose is the "D" atom of the conductive oligomer Thus, a preferred attachment of this embodiment is depicted in Structure 20 (using the Structure 3 conductive oligomer)
Structure 20
Figure imgf000032_0001
As will be appreciated by those in the art, Structure 20 has the terminal bond fixed as an amide bond
In a preferred embodiment, a heteroatom linkage is used, i e oxo, amine, sulfur, etc A preferred embodiment utilizes an amine linkage Again, as outlined above for the amide linkages, for amine linkages, the nitrogen of the ammo-modified nbose may be the "D" atom of the conductive oligomer when the Structure 3 conductive oligomer is used Thus, for example, Structures 21 and 22 depict nucleosides with the Structures 3 and 9 conductive oligomers, respectively, using the nitrogen as the heteroatom, athough other heteroatoms can be used
Structure 21
Figure imgf000032_0002
In Structure 21 , preferably both m and t are not zero A preferred Z here is a methylene group, or other aliphatic alkyl linkers One, two or three carbons in this position are particularly useful for synthetic reasons, see PCT US97/20014
Structure 22
Figure imgf000032_0003
In Structure 22, Z is as defined above Suitable linkers include methylene and ethylene
In an alternative embodiment, the conductive oligomer is covalently attached to the nucleic acid via the phosphate of the nbose-phosphate backbone (or analog) of a nucleic acid In this embodiment, the attachment is direct, utilizes a linker or via an amide bond Structure 23 depicts a direct linkage, and Structure 24 depicts linkage via an amide bond (both utilize the Structure 3 conductive oligomer, although Structure 8 conductive oligomers are also possible) Structures 23 and 24 depict the conductive oligomer in the 3' position, although the 5' position is also possible Furthermore, both Structures 23 and 24 depict naturally occurring phosphodiester bonds, although as those in the art will appreciate, non-standard analogs of phosphodiester bonds may also be used
Structure 23
Figure imgf000033_0001
In Structure 23, if the terminal Y is present (i e m=1 ), then preferably Z is not present (i e t=0) If the terminal Y is not present, then Z is preferably present
Structure 24 depicts a preferred embodiment, wherein the terminal B-D bond is an amide bond, the terminal Y is not present, and Z is a linker, as defined herein
Structure 24
Figure imgf000033_0002
In a preferred embodiment, the conductive oligomer is covalently attached to the nucleic acid via a transition metal ligand In this embodiment, the conductive oligomer is covalently attached to a ligand which provides one or more of the coordination atoms for a transition metal In one embodiment, the ligand to which the conductive oligomer is attached also has the nucleic acid attached, as is generally depicted below in Structure 25 Alternatively, the conαuctive oligomer is attached to one ligand, and the nucleic acid is attached to another ligand, as is generally depicted below in Structure 26 Thus, in the presence of the transition metal, the conductive oligomer is covalently attached to the nucleic acid Both of these structures depict Structure 3 conductive oligomers, although other oligomers may be utilized Structures 25 and 26 depict two representative structures
Structure 25
Figure imgf000033_0003
Structure 26
Figure imgf000034_0001
L,
In the structures depicted herein, M is a metal atom, with transition metals being preferred Suitable transition metals for use in the invention include, but are not limited to, cadmium (Cd), copper (Cu), cobalt (Co), palladium (Pd), zinc (Zn), iron (Fe), ruthenium (Ru), rhodium (Rh), osmium (Os), rhenium (Re), platinium (Pt), scandium (Sc), titanium (Ti), Vanadium (V), chromium (Cr), manganese (Mn), nickel (Ni), Molybdenum (Mo), technetium (Tc), tungsten (W), and indium (Ir) That is, the first series of transition metals, the platinum metals (Ru, Rh, Pd, Os, Ir and Pt), along with Fe, Re, W, Mo and Tc, are preferred Particularly preferred are ruthenium, rhenium, osmium, platinium, cobalt and iron
L are the co-ligands, that provide the coordination atoms for the binding of the metal ion As will be appreciated by those in the art, the number and nature of the co-hgands will depend on the coordination number of the metal ion Mono-, di- or polydentate co-ligands may be used at any position Thus, for example, when the metal has a coordination number of six, the L from the terminus of the conductive oligomer, the L contributed from the nucleic acid, and r, add up to six Thus, when the metal has a coordination number of six, r may range from zero (when all coordination atoms are provided by the other two ligands) to four, when all the co-hgands are monodentate Thus generally, r will be from 0 to 8, depending on the coordination number of the metal ion and the choice of the other ligands
In one embodiment, the metal ion has a coordination number of six and both the ligand attached to the conductive oligomer and the ligand attached to the nucleic acid are at least bidentate, that is, r is preferably zero one (i e the remaining co-hgand is bidentate) or two (two monodentate co-ligands are used)
As will be appreciated in the art, the co-hgands can be the same or different Suitable ligands fall into two categories ligands which use nitrogen, oxygen, sulfur, carbon or phosphorus atoms (depending on the metal ion) as the coordination atoms (generally referred to in the literature as sigma (σ) donors) and organometalhc ligands such as metallocene ligands (generally referred to in the literature as pi (π) donors, and depicted herein as L Suitable nitrogen donating ligands are well known in the art and include, but are not limited to, NH2, NHR, NRR', pyridme, pyrazme, isonicotinamide, imidazole, bipyndine and substituted derivatives of bipyndine, terpyπdme and substituted derivatives, phenanthrolmes, particularly 1 ,10-phenanthrolιne (abbreviated phen) and substituted derivatives of phenanthrolmes such as 4,7-dιmethylphenanthrolιne and dιpyπdol[3,2-a 2',3'-c]phenazιne (abbreviated dppz), dipyndophenazine, 1 ,4,5,8,9,12-hexaazatπphenylene (abbreviated hat), 9,10- phenanthrenequ one diimme (abbreviated phi), 1 ,4,5,8-tetraazaphenanthrene (abbreviated tap), 1 ,4,8,11-tetra-azacyclotetradecane (abbreviated cyclam), EDTA, EGTA and isocyanide Substituted derivatives, including fused derivatives, may also be used In some embodiments, porphyrms and substituted derivatives of the porphynn family may be used See for example, Comprehensive
Coordination Chemistry, Ed Wilkinson et al , Pergammon Press, 1987, Chapters 13 2 (pp73-98), 21 1 (pp 813-898) and 21 3 (pp 915-957), all of which are hereby expressly incorporated by reference
Suitable sigma donating ligands using carbon, oxygen, sulfur and phosphorus are known in the art For example, suitable sigma carbon donors are found in Cotton and Wilkenson, Advanced Organic
Chemistry, Sth Edition, John Wiley & Sons, 1988, hereby incorporated by reference, see page 38, for example Similarly, suitable oxygen ligands include crown ethers, water and others known in the art Phosphmes and substituted phosphmes are also suitable, see page 38 of Cotton and Wilkenson
The oxygen, sulfur, phosphorus and nitrogen-donating ligands are attached in such a manner as to allow the heteroatoms to serve as coordination atoms
In a preferred embodiment, organometallic ligands are used In addition to purely organic compounds for use as redox moieties, and various transition metal coordination complexes with δ-bonded organic ligand with donor atoms as heterocyclic or exocyc c substituents, there is available a wide variety of transition metal organometallic compounds with π-bonded organic ligands (see Advanced Inorganic Chemistry, 5th Ed , Cotton & Wilkinson, John Wiley & Sons, 1988, chapter 26, Organometallics, A Concise Introduction, Elschenbroich et al , 2nd Ed , 1992, VCH, and Comprehensive Organometallic Chemistry II, A Review of the Literature 1982-1994, Abel et al Ed , Vol 7, chapters 7, 8, 10 & 11 , Pergamon Press, hereby expressly incorporated by reference) Such organometallic ligands include cyclic aromatic compounds such as the cyclopentadienide ion [C5H5(-1 )] and various ring substituted and ring fused derivatives, such as the mdenylide (-1) ion, that yield a class of bιs(cyclopentadιeyl) metal compounds, (i e the metallocenes), see for example Robins et al , J Am Chem Soc 104 1882-1893 (1982), and Gassman et al , J Am Chem Soc 108 4228-4229 (1986), incorporated by reference Of these, ferrocene [(C5H5)2Fe] and its derivatives are prototypical examples which have been used in a wide variety of chemical (Connelly et al , Chem Rev 96 877- 910 (1996), incorporated by reference) and electrochemical (Geiger et al , Advances in Organometallic Chemistry 23 1-93, and Geiger et al , Advances in Organometallic Chemistry 24 87, incorporated by reference) electron transfer or "redox" reactions Metallocene derivatives of a variety of the first, second and third row transition metals are potential candidates as redox moieties that are covalently attached to either the nbose ring or the nucleoside base of nucleic acid Other potentially suitable organometallic ligands include cyclic arenes such as benzene, to yield bιs(arene)metal compounds and their ring substituted and ring fused derivatives, of which bιs(benzene)chromιum is a prototypical example, Other acyclic π-bonded ligands such as the allyl(-1 ) ion, or butadiene yield potentially suitable organometallic compounds, and all such ligands, in conjuction with other π-bonded and δ- bonded ligands constitute the general class of organometallic compounds in which there is a metal to carbon bond Electrochemical studies of various dimers and oligomers of such compounds with bridging organic ligands, and additional non-bridging ligands, as well as with and without metal-metal bonds are potential candidate redox moieties in nucleic acid analysis
When one or more of the co- gands is an organometallic ligand, the ligand is generally attached via one of the carbon atoms of the organometallic ligand, although attachment may be via other atoms for heterocychc ligands Preferred organometallic ligands include metallocene ligands, including substituted derivatives and the metalloceneophanes (see page 1174 of Cotton and Wilkenson, supra) For example, derivatives of metallocene ligands such as methylcyclopentadienyl, with multiple methyl groups being preferred, such as pentamethylcyclopentadienyl, can be used to increase the stability of the metallocene In a preferred embodiment, only one of the two metallocene ligands of a metallocene are derivatized
As described herein, any combination of ligands may be used Preferred combinations include a) all ligands are nitrogen donating ligands, b) all ligands are organometallic ligands, and c) the ligand at the terminus of the conductive oligomer is a metallocene ligand and the ligand provided by the nucleic acid is a nitrogen donating ligand, with the other ligands, if needed, are either nitrogen donating ligands or metallocene ligands, or a mixture These combinations are depicted in representative structures using the conductive oligomer of Structure 3 are depicted in Structures 27 (using phenanthrolme and ammo as representative ligands), 28 (using ferrocene as the metal-hgand combination) and 29 (using cyclopentadienyl and ammo as representative ligands)
Structure 27
Figure imgf000036_0001
Structure 28
Figure imgf000036_0002
Structure 29
Figure imgf000037_0001
In a preferred embodiment, the ligands used in the invention show altered fluoroscent properties depending on the redox state of the chelated metal ion As described below, this thus serves as an additional mode of detection of electron transfer between the ETM and the electrode
In a preferred embodiment, as is described more fully below, the ligand attached to the nucleic acid is an ammo group attached to the 2' or 3' position of a nbose of the nbose-phosphate backbone This ligand may contain a multiplicity of ammo groups so as to form a polydentate ligand which binds the metal ion Other preferred ligands include cyclopentadiene and phenanthrol e
The use of metal ions to connect the nucleic acids can serve as an internal control or calibration of the system, to evaluate the number of available nucleic acids on the surface However, as will be appreciated by those in the art, if metal ions are used to connect the nucleic acids to the conductive oligomers, it is generally desirable to have this metal ion complex have a different redox potential than that of the ETMs used in the rest of the system, as described below This is generally true so as to be able to distinguish the presence of the capture probe from the presence of the target sequence This may be useful for identification, calibration and/or quantification Thus, the amount of capture probe on an electrode may be compared to the amount of hybridized double stranded nucleic acid to quantify the amount of target sequence in a sample This is quite significant to serve as an internal control of the sensor or system This allows a measurement either prior to the addition of target or after, on the same molecules that will be used for detection, rather than rely on a similar but different control system Thus, the actual molecules that will be used for the detection can be quantified prior to any experiment This is a significant advantage over prior methods
In a preferred embodiment, the capture probe nucleic acids are covalently attached to the electrode via an insulator The attachment of nucleic acids to insulators such as alkyl groups is well known, and can be done to the base or the backbone, including the nbose or phosphate for backbones containing these moieties, or to alternate backbones for nucleic acid analogs
In a preferred embodiment, there may be one or more different capture probe species on the surface, as is generally depicted in the Figures In some embodiments, there may be one type of capture probe, or one type of capture probe extender, as is more fully described below Alternatively, different capture probes, or one capture probes with a multiplicity of different capture extender probes can be used Similarly, it may be desirable to use auxiliary capture probes that comprise relatively short probe sequences, that can be used to "tack down" components of the system, for example the recruitment linkers, to increase the concentration of ETMs at the surface
Thus the present invention provides electrodes comprising monolayers comprising conductive oligomers and capture probes, useful in nucleic acid detection systems In a preferred embodiment, the compositions further comprise a label probe The label probe is nucleic acid, generally single stranded, although as more fully outlined below, it may contain double-stranded portions The label probe comprises a first portion that is capable of hybridizing to a component of the assay complex, defined below, and a second portion that does not hybridize to a component of an assay complex and comprises at least one covalently attached ETM
Thus, label probes with covalently attached ETMs are provided The terms "electron donor moiety", "electron acceptor moiety", and "ETMs" (ETMs) or grammatical equivalents herein refers to molecules capable of electron transfer under certain conditions It is to be understood that electron donor and acceptor capabilities are relative, that is, a molecule which can lose an electron under certain experimental conditions will be able to accept an electron under different experimental conditions It is to be understood that the number of possible electron donor moieties and electron acceptor moieties is very large, and that one skilled in the art of electron transfer compounds will be able to utilize a number of compounds in the present invention Preferred ETMs include, but are not limited to, transition metal complexes, organic ETMs, and electrodes
In a preferred embodiment, the ETMs are transition metal complexes Transition metals are those whose atoms have a partial or complete d shell of electrons Suitable transition metals for use in the invention are listed above
The transition metals are complexed with a variety of ligands, L, defined above, to form suitable transition metal complexes, as is well known in the art
In addition to transition metal complexes, other organic electron donors and acceptors may be covalently attached to the nucleic acid for use in the invention These organic molecules include, but are not limited to, nboflavin, xanthene dyes, azine dyes, acndine orange,
Figure imgf000038_0001
diazapyrenium dichlonde (DAP2+), methylviologen, ethidium bromide, quinones such as N,N'- dιmethylanthra(2,1 ,9-def6,5,10-d'eOdιιsoquιnolιne dichlonde (ADIQ +), porphyπns ([meso-tetrakιs(N- methyl-x-pyrιdιnιum)porphyrιn tetrachloπde], varlamme blue B hydrochloπde, Bmdschedler's green, 2,6-dιchloroιndophenol, 2,6-dιbromophenohndophenol, Brilliant crest blue (3-amιno-9-dιmethyl-amιno- 10-methylphenoxyazιne chloride), methylene blue, Nile blue A (aminoaphthodiethylaminophenoxazine sulfate), ιndιgo-5,5',7,7'-tetrasulfonιc acid, ιndιgo-5,5',7-tπsulfonιc acid, phenosafranme, ιndιgo-5- monosulfonic acid, safranme T, bιs(dιmethylglyoxιmato)-ιron(ll) chloride, indulme scarlet, neutral red, anthracene, coronene, pyrene, 9-phenylanthracene, rubrene, bmaphthyl, DPA, phenothiazene, fluoranthene, phenanthrene, chrysene, 1 ,8-dιphenyl-1 ,3,5,7-octatetracene, naphthalene, acenaphthalene, perylene, TMPD and analogs and substituted derivatives of these compounds
In one embodiment, the electron donors and acceptors are redox proteins as are known in the art However, redox proteins in many embodiments are not preferred
The choice of the specific ETMs will be influenced by the type of electron transfer detection used, as is generally outlined below Preferred ETMs are metallocenes, with ferrocene being particularly preferred
In a preferred embodiment, a plurality of ETMs are used As is shown in the examples, the use of multiple ETMs provides signal amplification and thus allows more sensitive detection limits As discussed below, while the use of multiple ETMs on nucleic acids that hybridize to complementary strands can cause decreases in Tms of the hybridization complexes depending on the number, site of attachment and spacing between the multiple ETMs, this is not a factor when the ETMs are on the recruitment linker, since this does not hybridize to a complementary sequence Accordingly, pluralities of ETMs are preferred, with at least about 2 ETMs per recruitment linker being preferred, and at least about 10 being particularly preferred, and at least about 20 to 50 being especially preferred In some instances, very large numbers of ETMs (100 to 1000) can be used
As will be appreciated by those in the art, the portion of the label probe (or target, in some embodiments) that comprises the ETMs (termed herein a "recruitment linker" or "signal carrier") can be nucleic acid, or it can be a non-nucleic acid linker that links the first hybndizable portion of the label probe to the ETMs That is, since this portion of the label probe is not required for hybridization, it need not be nucleic acid, although this may be done for ease of synthesis In some embodiments, as is more fully outlined below, the recruitment linker may comprise double-stranded portions Thus, as will be appreciated by those in the art, there are a variety of configurations that can be used In a preferred embodiment, the recruitment linker is nucleic acid (including analogs), and attachment of the ETMs can be via (1 ) a base, (2) the backbone, including the nbose, the phosphate, or comparable structures in nucleic acid analogs, (3) nucleoside replacement, described below, or (4) metallocene polymers, as described below In a preferred embodiment, the recruitment linker is non-nucleic acid, and can be either a metallocene polymer or an alkyl-type polymer (including heteroalkyl, as is more fully described below) containing ETM substitution groups These options are generally depicted in the Figures
In a preferred embodiment, the recruitment linker is a nucleic acid, and comprises covalently attached ETMs The ETMs may be attached to nucleosides within the nucleic acid in a variety of positions
Preferred embodiments include, but are not limited to, (1) attachment to the base of the nucleoside, (2) attachment of the ETM as a base replacement, (3) attachment to the backbone of the nucleic acid, including either to a nbose of the πbose-phosphate backbone or to a phosphate moiety, or to analogous structures in nucleic acid analogs, and (4) attachment via metallocene polymers, with the latter being preferred
In addition, as is described below, when the recruitment linker is nucleic acid, it may be desirable to use secondary label probes, that have a first portion that will hybridize to a portion of the primary label probes and a second portion comprising a recruitment linker as is defined herein This is generally depicted in Figure 16H, this is similar to the use of an amplifier probe, except that both the primary and the secondary label probes comprise ETMs
In a preferred embodiment, the ETM is attached to the base of a nucleoside as is generally outlined above for attachment of the conductive oligomer Attachment can be to an internal nucleoside or a terminal nucleoside
The covalent attachment to the base will depend in part on the ETM chosen, but in general is similar to the attachment of conductive oligomers to bases, as outlined above Attachment may generally be done to any position of the base In a preferred embodiment, the ETM is a transition metal complex, and thus attachment of a suitable metal ligand to the base leads to the covalent attachment of the
ETM Alternatively, similar types of linkages may be used for the attachment of organic ETMs, as will be appreciated by those in the art
In one embodiment, the C4 attached ammo group of cytosine, the C6 attached ammo group of adenine, or the C2 attached ammo group of guanme may be used as a transition metal ligand
Ligands containing aromatic groups can be attached via acetylene linkages as is known in the art (see Comprehensive Organic Synthesis, Trost et al , Ed , Pergamon Press, Chapter 2 4 Coupling Reactions Between sp2 and sp Carbon Centers, Sonogashira, pp521-549, and pp950-953, hereby incorporated by reference) Structure 30 depicts a representative structure in the presence of the metal ion and any other necessary ligands, Structure 30 depicts undine, although as for all the structures herein, any other base may also be used Structure 30
Figure imgf000041_0001
La is a ligand, which may include nitrogen, oxygen, sulfur or phosphorus donating ligands or organometallic ligands such as metallocene ligands Suitable La ligands include, but not limited to, phenanthroline, imidazole, bpy and terpy Lr and M are as defined above Again, it will be appreciated by those in the art, a linker ("Z") may be included between the nucleoside and the ETM
Similarly, as for the conductive oligomers, the linkage may be done using a linker, which may utilize an amide linkage (see generally Telser et al J Am Chem Soc 111 7221-7226 (1989), Telser et al , J Am Chem Soc 111 7226-7232 (1989), both of which are expressly incorporated by reference) These structures are generally depicted below in Structure 31 , which again uses undine as the base, although as above, the other bases may also be used
Structure 31
Figure imgf000041_0002
In this embodiment, L is a ligand as defined above, with Lr and M as defined above as well Preferably, L is ammo, phen, byp and terpy
In a preferred embodiment, the ETM attached to a nucleoside is a metallocene, i e thel and Lr of
Structure 31 are both metallocene ligands, Lm, as described above Structure 32 depicts a preferred embodiment wherein the metallocene is ferrocene, and the base is undine, although other bases may be used Structure 32
Figure imgf000042_0001
Preliminary data suggest that Structure 32 may cyclize, with the second acetylene carbon atom attacking the carbonyl oxygen, forming a furan- ke structure Preferred metallocenes include ferrocene, cobaltocene and osmiumocene
In a preferred embodiment, the ETM is attached to a nbose at any position of the nbose-phosphate backbone of the nucleic acid, i e either the 5' or 3' terminus or any internal nucleoside Ribose in this case can include ribose analogs As is known in the art, nucleosides that are modified at either the 2' or 3' position of the ribose can be made, with nitrogen, oxygen, sulfur and phosphorus-containing modifications possible Ammo-modified and oxygen-modified ribose is preferred See generally PCT publication WO 95/15971 , incorporated herein by reference These modification groups may be used as a transition metal ligand, or as a chemically functional moiety for attachment of other transition metal ligands and organometallic ligands, or organic electron donor moieties as will be appreciated by those in the art In this embodiment, a linker such as depicted herein for "Z" may be used as well, or a conductive oligomer between the ribose and the ETM Preferred embodiments utilize attachment at the 2' or 3' position of the ribose, with the 2' position being preferred Thus for example, the conductive oligomers depicted in Structure 13, 14 and 15 may be replaced by ETMs, alternatively, the ETMs may be added to the free terminus of the conductive oligomer
In a preferred embodiment, a metallocene serves as the ETM, and is attached via an amide bond as depicted below in Structure 33 The examples outline the synthesis of a preferred compound when the metallocene is ferrocene Structure 33
Figure imgf000042_0002
M In a preferred embodiment, amine linkages are used, as is generally depicted in Structure 34
Structure 34
Figure imgf000043_0001
Z is a linker, as defined herein, with 1-16 atoms being preferred, and 2-4 atoms being particularly preferred, and t is either one or zero
In a preferred embodiment, oxo linkages are used, as is generally depicted in Structure 35
Structure 35
Figure imgf000043_0002
In Structure 35, Z is a linker, as defined herein, and t is either one or zero Preferred Z linkers include alkyl groups including heteroalkyl groups such as (CH2)n and (CH2CH20)n, with n from 1 to 10 being preferred, and n = 1 to 4 being especially preferred, and n=4 being particularly preferred
Linkages utilizing other heteroatoms are also possible
In a preferred embodiment, an ETM is attached to a phosphate at any position of the nbose-phosphate backbone of the nucleic acid This may be done in a variety of ways In one embodiment phosphodiester bond analogs such as phosphoramide or phosphoramidite linkages may be incorporated into a nucleic acid, where the heteroatom (i e nitrogen) serves as a transition metal ligand (see PCT publication WO 95/15971 , incorporated by reference) Alternatively, the conductive oligomers depicted in Structures 23 and 24 may be replaced by El Ms In a preferred embodiment, the composition has the structure shown in Structure 36 Structure 36
Figure imgf000044_0001
In Structure 361 , the ETM is attached via a phosphate linkage, generally through the use of a linker, Z Preferred Z linkers include alkyl groups, including heteroalkyl groups such as (CH2)n, (CH2CH20)n, with n from 1 to 10 being preferred, and n = 1 to 4 being especially preferred, and n=4 being particularly preferred
When the ETM is attached to the base or the backbone of the nucleoside, it is possible to attach the ETMs via "dendnmer" structures, as is more fully outlined below As is generally depicted in the
Figures, alkyl-based linkers can be used to create multiple branching structures comprising one or more ETMs at the terminus of each branch (although internal ETMs can be used as well) Generally, this is done by creating branch points containing multiple hydroxy groups, which optionally can then be used to add additional branch points The terminal hydroxy groups can then be used in phosphoramidite reactions to add ETMs, as is generally done below for the nucleoside replacement and metallocene polymer reactions The branch point can be an internal one or a terminal one, and can be a chemical branch point or a nucleoside branch point
In a preferred embodiment, an ETM such as a metallocene is used as a "nucleoside replacement", serving as an ETM For example, the distance between the two cyclopentadiene rings of ferrocene is similar to the orthongonal distance between two bases in a double stranded nucleic acid Other metallocenes in addition to ferrocene may be used, for example, air stable metallocenes such as those containing cobalt or ruthenium Thus, metallocene moieties may be incorporated into the backbone of a nucleic acid, as is generally depicted in Structure 37 (nucleic acid with a nbose-phosphate backbone) and Structure 38 (peptide nucleic acid backbone) Structures 37 and 38 depict ferrocene, although as will be appreciated by those in the art, other metallocenes may be used as well In general, air stable metallocenes are preferred, including metallocenes utilizing ruthenium and cobalt as the metal
Figure imgf000045_0001
In Structure 37, Z is a linker as defined above, with generally short, alkyl groups, including heteroatoms such as oxygen being preferred Generally, what is important is the length of the linker, such that minimal perturbations of a double stranded nucleic acid is effected, as is more fully described below Thus, methylene, ethylene, ethylene giycols, propylene and butylene are all preferred, with ethylene and ethylene glycol being particularly preferred In addition, each Z linker may be the same or different Structure 37 depicts a nbose-phosphate backbone, although as will be appreciated by those in the art, nucleic acid analogs may also be used, including ribose analogs and phosphate bond analogs
Structure 38
Figure imgf000046_0001
In Structure 38, preferred Z groups are as listed above, and again, each Z linker can be the same or different As above, other nucleic acid analogs may be used as well
In addition, although the structures and discussion above depicts metallocenes, and particularly ferrocene, this same general idea can be used to add ETMs in addition to metallocenes, as nucleoside replacements or in polymer embodiments, described below Thus, for example, when the ETM is a transition metal complex other than a metallocene, comprising one, two or three (or more) ligands, the ligands can be functiona zed as depicted for the ferrocene to allow the addition of phosphoramidite groups Particularly preferred in this embodiment are complexes comprising at least two ring (for example, aryl and substituted aryl) ligands, where each of the ligands comprises functional groups for attachment via phosphoramidite chemistry As will be appreciated by those in the art, this type of reaction, creating polymers of ETMs either as a portion of the backbone of the nucleic acid or as "side groups" of the nucleic acids, to allow amplification of the signals generated herein, can be done with virtually any ETM that can be functionahzed to contain the correct chemical groups
Thus, by inserting a metallocene such as ferrocene (or other ETM) into the backbone of a nucleic acid, nucleic acid analogs are made, that is, the invention piovides nucieic acids having a backbone comprising at least one metallocene This is distinguished from nucleic acids having metallocenes attached to the backbone, i e via a ribose, a phosphate, etc That is, two nucleic acids each made up of a traditional nucleic acid or analog (nucleic acids in this case including a single nucleoside), may be covalently attached to each other via a metallocene Viewed differently, a metallocene derivative or substituted metallocene is provided, wherein each of the two aromatic rings of the metallocene has a nucleic acid substitutent group In addition, as is more fully outlined below, it is possible to incorporate more than one metallocene into the backbone, either with nucleotides in between and/or with adjacent metallocenes When adjacent metallocenes are added to the backbone, this is similar to the process described below as "metallocene polymers", that is, there are areas of metallocene polymers within the backbone
In addition to the nucleic acid substitutent groups, it is also desirable in some instances to add additional substituent groups to one or both of the aromatic rings of the metallocene (or ETM) For example, as these nucleoside replacements are generally part of probe sequences to be hybridized with a substantially complementary nucleic acid, for example a target sequence or another probe sequence, it is possible to add substitutent groups to the metallocene rings to facilitate hydrogen bonding to the base or bases on the opposite strand These may be added to any position on the metallocene rings Suitable substitutent groups include, but are not limited to, amide groups, amine groups, carboxy c acids, and alcohols, including substituted alcohols In addition, these substitutent groups can be attached via linkers as well, although in general this is not preferred
In addition, substituent groups on an ETM, particularly metallocenes such as ferrocene, may be added to alter the redox properties of the ETM Thus, for example, in some embodiments, as is more fully described below, it may be desirable to have different ETMs attached in different ways (i e base or ribose attachment), on different probes, or for different purposes (for example, calibration or as an internal standard) Thus, the addition of substituent groups on the metallocene may allow two different
ETMs to be distinguished
In order to generate these metallocene-backbone nucleic acid analogs, the intermediate components are also provided Thus, in a preferred embodiment, the invention provides phosphoramidite metallocenes, as generally depicted in Structure 39
Structure 39 PG O
Z AROMATIC RING
M
Z AROMATIC RING
O
H H,
NCH2CH2C- -N -
-CH
CH CHa
H3C CH3 In Structure 39, PG is a protecting group, generally suitable for use in nucleic acid synthesis, with DMT, MMT and TMT all being preferred The aromatic rings can either be the rings of the metallocene, or aromatic rings of ligands for transition metal complexes or other organic ETMs The aromatic rings may be the same or different, and may be substituted as discussed herein
Structure 40 depicts the ferrocene derivative
Structure 40
Figure imgf000048_0001
These phosphoramidite analogs can be added to standard oligonucleotide syntheses as is known in the art
Structure 41 depicts the ferrocene peptide nucleic acid (PNA) monomer, that can be added to PNA synthesis as is known in the art and depicted within the Figures and Examples
Structure 41
Figure imgf000048_0002
/
OH
In Structure 41 , the PG protecting group is suitable for use in peptide nucleic acid synthesis, with MMT, boc and Fmoc being preferred
These same intermediate compounds can be used to form ETM or metallocene polymers, which are added to the nucleic acids, rather than as backbone replacements, as is more fully described below In a preferred embodiment, the ETMs are attached as polymers, for example as metallocene polymers, in a "branched" configuration similar to the "branched DNA" embodiments herein and as outlined in U S Patent No 5,124,246, using modified functionahzed nucleotides The general idea is as follows A modified phosphoramidite nucleotide is generated that can ultimately contain a free hydroxy group that can be used in the attachment of phosphoramidite ETMs such as metallocenes
This free hydroxy group could be on the base or the backbone, such as the ribose or the phosphate (although as will be appreciated by those in the art, nucleic acid analogs containing other structures can also be used) The modified nucleotide is incorporated into a nucleic acid, and any hydroxy protecting groups are removed, thus leaving the free hydroxyl Upon the addition of a phosphoramidite ETM such as a metallocene, as described above in structures 39 and 40, ETMs, such as metallocene ETMs, are added Additional phosphoramidite ETMs such as metallocenes can be added, to form "ETM polymers", including "metallocene polymers" as depicted herein, particularly for ferrocene In addition, in some embodiments, it is desirable to increase the solubility of the polymers by adding a "capping" group to the terminal ETM in the polymer, for example a final phosphate group to the metallocene as is generally depicted in Figure 12 Other suitable solubility enhancing "capping" groups will be appreciated by those in the art It should be noted that these solubility enhancing groups can be added to the polymers in other places, including to the ligand rings, for example on the metallocenes as discussed herein
A preferred embodiment of this general idea is outlined in the Figures In this embodiment, the 2' position of a ribose of a phosphoramidite nucleotide is first functionahzed to contain a protected hydroxy group, in this case via an oxo-hnkage, although any number of linkers can be used, as is generally described herein for Z linkers The protected modified nucleotide is then incorporated via standard phosphoramidite chemistry into a growing nucleic acid The protecting group is removed, and the free hydroxy group is used, again using standard phosphoramidite chemistry to add a phosphoramidite metallocene such as ferrocene A similar reaction is possible for nucleic acid analogs For example, using peptide nucleic acids and the metallocene monomer shown in Structure 41, peptide nucleic acid structures containing metallocene polymers could be generated
Thus, the present invention provides recruitment linkers of nucleic acids comprising "branches" of metallocene polymers as is generally depicted in Figures 12 and 13 Preferred embodiments also utilize metallocene polymers from one to about 50 metallocenes >n length, with from about 5 to about 20 hemg preferred and from about 5 to about 10 being especially preferred
In addition, when the recruitment linker is nucleic acid, any combination of ETM attachments may be done In a preferred embodiment, the recruitment linker is not nucleic acid, and instead may be any sort of linker or polymer As will be appreciated by those in the art, generally any linker or polymer that can be modified to contain ETMs can be used In general, the polymers or linkers should be reasonably soluble and contain suitable functional groups for the addition of ETMs
As used herein, a "recruitment polymer" comprises at least two or three subunits, which are covalently attached At least some portion of the monomenc subunits contain functional groups for the covalent attachment of ETMs In some embodiments coupling moieties are used to covalently link the subunits with the ETMs Preferred functional groups for attachment are ammo groups, carboxy groups, oxo groups and thiol groups, with ammo groups being particularly preferred As will be appreciated by those in the art, a wide variety of recruitment polymers are possible
Suitable linkers include, but are not limited to, alkyl linkers (including heteroalkyl (including (poly)ethylene glycol-type structures), substituted alkyl, aryalkyl linkers, etc As above for the polymers, the linkers will comprise one or more functional groups for the attachment of ETMs, which will be done as will be appreciated by those in the art, for example through the use homo-or hetero- bifunctional linkers as are well known (see 1994 Pierce Chemical Company catalog, technical section on cross-linkers, pages 155-200, incorporated herein by reference)
Suitable recruitment polymers include, but are not limited to, functionahzed styrenes, such as ammo styrene, functionahzed dextrans, and polyamino acids Preferred polymers are polyamino acids (both poly-D-amino acids and poly-L-ammo acids), such as polylysme, and polymers containing lysine and other ammo acids being particularly preferred Other suitable polyamino acids are polyglutamic acid, polyaspartic acid, co-polymers of lysine and glutamic or aspartic acid, co-polymers of lysine with alanine, tyrosine, phenylalanine, serine, tryptophan, and/or pro ne
In a preferred embodiment, the recruitment linker comprises a metallocene polymer, as is described above
The attachment of the recruitment linkers to the first portion of the label probe will depend on the composition of the recruitment linker, as will be appreciated by those in the art When the recruitment linker is nucleic acid, it is generally formed during the synthesis of the first portion of the label probe, with incorporation of nucleosides containing ETMs as required Alternatively, the first portion of the label probe and the recruitment linker may be made separately, and then attached For example, there may be an overlapping section of complementarity, forming a section of double stranded nucleic acid that can then be chemically cross nked, for example by using psoralen as is known in the art When non-nucleic acid recruitment linkers are used, attachment of the linker/polymer of the recruitment linker will be done generally using standard chemical techniques, such as will be appreciated by those in the art For example, when alkyl-based linkers are used, attachment can be similar to the attachment of insulators to nucleic acids
In addition, it is possible to have recruitment linkers that are mixtures of nucleic acids and non-nucleic acids, either in a linear form (i e nucleic acid segments linked together with alkyl linkers) or in branched forms (nucleic acids with alkyl "branches" that may contain ETMs and may be additionally branched)
In a preferred embodiment, it is the target sequence itself that carries the ETMs, rather than the recruitment linker of a label probe For example, as is more fully described below, it is possible to enzymatically add tnphosphate nucleotides comprising the ETMs of the invention to a growing nucleic acid, for example during a polymerase chain reaction (PCR) As will be recognized by those in the art, while several enzymes have been shown to generally tolerate modified nucleotides, some of the modified nucleotides of the invention, for example the "nucleoside replacement" embodiments and putatively some of the phosphate attachments, may or may not be recognized by the enzymes to allow incorporation into a growing nucleic acid Therefore, preferred attachments in this embodiment are to the base or ribose of the nucleotide
Thus, for example, PCR amplification of a target sequence, as is well known in the art, will result in target sequences comprising ETMs, generally randomly incorporated into the sequence The system of the invention can then be configured to allow detection using these ETMs, as is generally depicted in Figures 16A, 16B and 16D
Alternatively, as outlined more fully below, it is possible to enzymatically add nucleotides comprising ETMs to the terminus of a nucleic acid, for example a target nucleic acid In this embodiment, an effective "recruitment linker" is added to the terminus of the target sequence, that can then be used for detection Thus the invention provides compositions utilizing electrodes comprising monolayers of conductive oligomers and capture probes, and target sequences that comprises a first portion that is capable of hybridizing to a component of an assay complex, and a second portion that does not hybridize to a component of an assay complex and comprises at least one covalently attached electron transfer moiety Similarly, methods utilizing these compositioi is are also provided
It is also possible to have ETMs connected to probe sequences, i e sequences designed to hybridize to complementary sequences Thus, ETMs may be added to non-recruitment linkers as well For example, there may be ETMs added to sections of label probes that do hybridize to components of the assay complex, for example the first portion, or to the target sequence as outlined above These ETMs may be used for electron transfer detection in some embodiments, or they may not, depending on the location and system For example, in some embodiments, when for example the target sequence containing randomly incorporated ETMs is hybridized directly to the capture probe, as is depicted in Figure 16A, there may be ETMs in the portion hybridizing to the capture probe If the capture probe is attached to the electrode using a conductive oligomer, these ETMs can be used to detect electron transfer as has been previously described Alternatively, these ETMs may not be specifically detected
Similarly, in some embodiments, when the recruitment linker is nucleic acid, it may be desirable in some instances to have some or all of the recruitment linker be double stranded In one embodiment, there may be a second recruitment linker, substantially complementary to the first recruitment linker, that can hybridize to the first recruitment linker In a preferred embodiment, the first recruitment linker comprises the covalently attached ETMs In an alternative embodiment, the second recruitment linker contains the ETMs, and the first recruitment linker does not, and the ETMs are recruited to the surface by hybridization of the second recruitment linker to the first In yet another embodiment, both the first and second recruitment linkers comprise ETMs It should be noted, as discussed above, that nucleic acids comprising a large number of ETMs may not hybridize as well, i e the Tm may be decreased, depending on the site of attachment and the characteristics of the ETM Thus, in general, when multiple ETMs are used on hybridizing strands, generally there are less than about 5, with less than about 3 being preferred, or alternatively the ETMs should be spaced sufficiently far apart that the intervening nucleotides can sufficiently hybridize to allow good kinetics
In one embodiment, non-covalently attached ETMs may be used In one embodiment, the ETM is a hybridization indicator Hybridization indicators serve as an ETM that will preferentially associate with double stranded nucleic acid is added, usually reversibly, similar to the method of Millan et al , Anal Chem 65 2317-2323 (1993), Millan et al , Anal Chem 662943-2948 (1994), both of which are hereby expressly incorporated by reference In this embodiment, increases in the local concentration of ETMs, due to the association of the ETM hybridization indicator with double stranded nucleic acid at the surface, can be monitored using the monolayers comprising the conductive oligomers
Hybridization indicators include mtercalators and minor and/or major groove binding moieties In a preferred embodiment, mtercalators may be used, since intercalation generally only occurs in the presence of double stranded nucleic a d, only in the presence of double stranded nucleic acid will the ETMs concentrate Intercalating transition metal complex ETMs are.known in the art Similarly, major or minor groove binding moieties, such as methylene blue, may also be used in this embodiment Similarly, the systems of the invention may utilize non-covalently attached ETMs, as is generally described in Napier et al , Bioconj Chem 8 906 (1997), hereby expressly incorporated by reference In this embodiment, changes in the redox state of certain molecules as a result of the presence of DNA (i e guanine oxidation by ruthenium complexes) can be detected using the SAMs comprising conductive oligomers as well
Thus, the present invention provides electrodes comprising monolayers comprising conductive oligomers, generally including capture probes, and either target sequences or label probes comprising recruitment linkers containing ETMs In a preferred embodiment, the compositions of the invention are used to detect target sequences in a sample The term "target sequence" or grammatical equivalents herein means a nucleic acid sequence on a single strand of nucleic acid The target sequence may be a portion of a gene, a regulatory sequence, genomic DNA, cDNA, RNA including mRNA and rRNA, or others It may be any length, with the understanding that longer sequences are more specific As will be appreciated by those in the art, the complementary target sequence may take many forms For example, it may be contained within a larger nucleic acid sequence, i e all or part of a gene or mRNA, a restriction fragment of a plasmid or genomic DNA, among others As is outlined more fully below, probes are made to hybridize to target sequences to determine the presence or absence of the target sequence in a sample Generally speaking, this term will be understood by those skilled in the art The target sequence may also be comprised of different target domains, for example, a first target domain of the sample target sequence may hybridize to a capture probe or a portion of capture extender probe, a second target domain may hybridize to a portion of an amplifier probe, a label probe, or a different capture or capture extender probe, etc The target domains may be adjacent or separated The terms "first" and "second" are not meant to confer an orientation of the sequences with respect to the 5'-3' orientation of the target sequence For example, assuming a 5'-3' orientation of the complementary target sequence, the first target domain may be located either 5' to the second domain, or 3' to the second domain
If required, the target sequence is prepared using known techniques For example, the sample may be treated to lyse the cells, using known lysis buffers, electroporation, etc , with purification and/or amplification such as PCR occunng as needed, as will be appreciated by those in the art
Probes of the present invention are designed to be complementary to a target sequence (either the target sequence of the sample or to other probe sequences, as is described below), such that hybridization of the target sequence and the probes of the present invention occurs As outlined below, this complementarity need not be perfect, there may be any number of base pair mismatches which will interfere with hybridization between the target sequence and the single stranded nucleic acids of the present invention However, if the number of mutations is so great that no hybridization can occur under even the least stringent of hybridization conditions, the sequence is not a complementary target sequence Thus, by "substantially complementary" herein is meant that the probes are sufficiently complementary to the target sequences to hybridize under normal reaction conditions
Generally, the nucleic acid compositions of the invention are useful as oligonucleotide probes As is appreciated by those in the art, the length of the probe will vary with the length of the target sequence and the hybridization and wash conditions Generally, oligonucleotide probes range from about 8 to about 50 nucleotides, with from about 10 to about 30 being preferred and from about 12 to about 25 being especially preferred In some cases, very long probes may be used, e g 50 to 200-300 nucleotides in length Thus, in the structures depicted herein, nucleosides may be replaced with nucleic acids
A variety of hybridization conditions may be used in the present invention, including high, moderate and low stringency conditions, see for example Maniatis et al , Molecular Cloning A Laboratory
Manual, 2d Edition, 1989, and Short Protocols in Molecular Biology, ed Ausubel, et al, hereby incorporated by referenece The hybridization conditions may also vary when a non-ionic backbone, i e PNA is used, as is known in the art In addition, cross-linking agents may be added after target binding to cross-link, i e covalently attach, the two strands of the hybridization complex
As will be appreciated by those in the art, the systems of the invention may take on a large number of different configurations, as is generally depicted in the Figures In general, there are three types of systems that can be used (1) systems in which the target sequence itself is labeled with ETMs (see Figures 16A, 16B and 16D), (2) systems in which label probes directly hybridize to the target sequences (see Figures 16C and 16H), and (3) systems in which label probes are indirectly hybridized to the target sequences, for example through the use of amplifier probes (see Figures 16E, 16F and 16G)
In all three of these systems, it is preferred, although not required, that the target sequence be immobilized on the electrode surface This is preferably done using capture probes and optionally one or more capture extender probes When only capture probes are utilized, it is necessary to have unique capture probes for each target sequence, that is, the surface must be customized to contain unique capture probes Alternatively, capture extender probes may be used, that allow a "universal" surface, s e a surface containing a single type of capture probe that can be used to detect any target sequence "Capture extender" probes are generally depicted in Figure 15, and have a first portion that will hybridize to all or part of the capture probe, and a second portion that will hybridize to a portion of the target sequence This then allows the generation of customized soluble probes, which as will be appreciated by those in the art is generally simpler and less costly As shown herein (e g Figure 15C), two capture extender probes may be used This has generally been done to stabilize assay complexes (for example when the target sequence is large, or when large amplifier probes (particularly branched or dendnmer amplifier probes) are used
In a preferred embodiment, the nucleic acids are added after the formation of the SAM ((4) above) This may be done in a variety of ways, as will be appreciated by those in the art In one embodiment, conductive oligomers with terminal functional groups are made, with preferred embodiments utilizing activated carboxylates and isothiocyanates, that will react with primary amines that are put onto the nucleic acid, as is generally depicted in Figure 6 using an activated carboxylate These two reagents have the advantage of being stable in aqueous solution, yet react with primary alkylamines However, the primary aromatic amines and secondary and tertiary amines of the bases should not react, thus allowing site specific addition of nucleic acids to the surface This allows the spotting of probes (either capture or detection probes, or both) using known methods (ink jet, spotting, etc ) onto the surface
In addition, there are a number of non-nucleic acid methods that can be used to immobilize a nucleic acid on a surface For example, binding partner pairs can be utilized, i e one binding partner is attached to the terminus of the conductive oligomer, and the other to the end of the nucleic acid This may also be done without using a nucleic acid capture probe, that is, one binding partner serves as the capture probe and the other is attached to either the target sequence or a capture extender probe
That is, either the target sequence comprises the binding partner, or a capture extender probe that will hybridize to the target sequence comprises the binding partner Suitable binding partner pairs include, but are not limited to, hapten pairs such as biotin/streptavidm, antigens/antibodies, NTA/histidme tags, etc In general, smaller binding partners are preferred, such that the electrons can pass from the nucleic acid into the conductive oligomer to allow detection
In a preferred embodiment, when the target sequence itself is modified to contain a binding partner, the binding partner is attached via a modified nucleotide that can be enzymatically attached to the target sequence, for example during a PCR target amplification step Alternatively, the binding partner should be easily attached to the target sequence
Alternatively, a capture extender probe may be utilized that has a nucleic acid portion for hybridization to the target as well as a binding partner (for example, the capture extender probe may comprise a non-nucleic acid portion such as an alkyl linker that is used to attach a binding partner) In this embodiment, it may be desirable to cross-link the double-stranded nucleic acid of the target and capture extender probe for stability, for example using psoralen as is known in the art In one embodiment, the target is not bound to the electrode surface using capture probes In this embodiment, what is important, as for all the assays herein, is that excess label probes be removed prior to detection and that the assay complex (the recruitment linker) be in proximity to the surface As will be appreciated by those in the art, this may be accomplished in other ways For example, the assay complex may be present on beads that are added to the electrode comprising the monolayer
The recruitment linkers comprising the ETMs may be placed in proximity to the conductive oligomer surface using techniques well known in the art, including gravity settling of the beads on the surface, electrostatic or magnetic interactions between bead components and the surface, using binding partner attachment as outlined above Alternatively, after the removal of excess reagents such as excess label probes, the assay complex may be driven down to the surface, for example by pulsing the system with a voltage sufficient to drive the assay complex to the surface
However, preferred embodiments utilize assay complexes attached via nucleic acid capture probes
In a preferred embodiment, the target sequence itself contains the ETMs As discussed above, this may be done using target sequences that have ETMs incorporated at any number of positions, as outlined above Representative examples are depicted in Figures 16A, 16B and 16D In this embodiment, as for the others of the system, the 3'-5' orientation of the probes and targets is chosen to get the ETM-contaming structures (i e recruitment linkers or target sequences) as close to the surface of the monolayer as possible, and in the correct orientation This may be done using attachment via insulators or conductive oligomers as is generally shown in the Figures In addition, as will be appreciated by those in the art, multiple capture probes can be utilized, either in a configuration such as depicted in Figure 16D, wherein the 5'-3' orientation of the capture probes is different, or where "loops" of target form when multiples of capture probes are used
In a preferred embodiment, the label probes directly hybridize to the target sequences, as is generally depicted in Figure 16C In these embodiments, the target sequence is preferably, but not required to be, immobilized on the surface using capture probes, including capture extender probes Label probes are then used to bring the ETMs into proximity of the surface of the monolayer comprising conductive oligomers In a preferred embodiment, multiple label probes are used, that is, label probes are designed such that the portion that hybridizes to the target sequence (labeled 141 in the figures) can be different for a number of different label probes, such that amplification of the signal occurs, since multiple label probes can bind for every target sequence Thus, as depicted in the figures, n is an integer of at least one Depending on the sensitivity desired, the length of the target sequence, the number of ETMs per label probe, etc , preferred ranges of n are from 1 to 50, with from about 1 to about 20 being particularly preferred, and from about 2 to about 5 being especially preferred In addition, if "generic" label probes are desired, label extender probes can be used as generally described below for use with amplifier probes
As above, generally in this embodiment the configuration of the system and the label probes are designed to recruit the ETMs as close as possible to the monolayer surface
In a preferred embodiment, the label probes are hybridized to the target sequence indirectly That is, the present invention finds use in novel combinations of signal amplification technologies and electron transfer detection on electrodes, which may be particularly useful in sandwich hybridization assays, as generally depicted in Figure 16 In these embodiments, the amplifier probes of the invention are bound to the target sequence in a sample either directly or indirectly Since the amplifier probes preferably contain a relatively large number of amplification sequences that are available for binding of label probes, the detectable signal is significantly increased, and allows the detection limits of the target to be significantly improved These label and amplifier probes, and the detection methods described herein, may be used in essentially any known nucleic acid hybridization formats, such as those in which the target is bound directly to a solid phase or in sandwich hybridization assays in which the target is bound to one or more nucleic acids that are in turn bound to the solid phase
In general, these embodiments may be described as follows An amplifier probe is hybridized to the target sequence, either directly (e g Figure 16E), or through the use of a label extender probe (e g
Figure 16F and 16G), which serves to allow "generic" amplifier probes to be made The target sequence is preferably, but not required to be, immobilized on the electrode using capture probes Preferably, the amplifier probe contains a multiplicity of amplification sequences, although in some embodiments, as described below, the amplifier probe may contain only a single amplification sequence The amplifier probe may take on a number of different forms, either a branched conformation, a dendnmer conformation, or a linear "string" of amplification sequences These amplification sequences are used to form hybridization complexes with label probes, and the ETMs can be detected using the electrode
Accordingly, the present invention provides assay complexes comprising at least one amplifier probe
By "amplifier probe" or "nucleic acid multimer" or "amplification multimer" or grammatical equivalents herein is meant a nucleic acid probe that is used to facilitate signal amplification Amplifier probes comprise at least a first single-stranded nucleic acid probe sequence, as defined below, and at least one single-stranded nucleic acid amplification sequence, with a multiplicity of amplification sequences being preferred Amplifier probes comprise a first probe sequence that is used, either directly or indirectly, to hybridize to the target sequence That is, the amplifier probe itself may have a first probe sequence that is substantially complementary to the target sequence (e g Figure 16E), or it has a first probe sequence that is substantially complementary to a portion of an additional probe, in this case called a label extender probe, that has a first portion that is substantially complementary to the target sequence (e g
Figure 16F) In a preferred embodiment, the first probe sequence of the amplifier probe is substantially complementary to the target sequence, as is generally depicted in Figure 16E
In general, as for all the probes herein, the first probe sequence is of a length sufficient to give specificity and stability Thus generally, the probe sequences of the invention that are designed to hybridize to another nucleic acid (i e probe sequences, amplification sequences, portions or domains of larger probes) are at least about 5 nucleosides long, with at least about 10 being preferred and at least about 15 being especially preferred
In a preferred embodiment, as is depicted in Figure 14, the amplifier probes, or any of the other probes of the invention, may form hairpin stem-loop structures in the absence of their target The length of the stem double-stranded sequence will be selected such that the hairpin structure is not favored in the presence of target The use of these type of probes, in the systems of the invention or in any nucleic acid detection systems, can result in a significant decrease in non-specific binding and thus an increase in the signal to noise ratio
Generally, these hairpin structures comprise four components The first component is a target binding sequence, i e a region complementary to the target (which may be the sample target sequence or another probe sequence to which binding is desired), that is about 10 nucleosides long, with about 15 being preferred The second component is a loop sequence, that can facilitate the formation of nucleic acid loops Particularly preferred in this regard are repeats of GTC, which has been identified in Fragile X Syndrome as forming turns (When PNA analogs are used, turns comprising prohne residues may be preferred) Generally, from three to five repeats are used, with four to five being preferred The third component is a self-complementary region, which has a first portion that is complementary to a portion of the target sequence region and a second portion that comprises a first portion of the label probe binding sequence The fourth component is substantially complementary to a label probe (or other probe, as the case may be) The fourth component further comprises a "sticky end", that is, a portion that does not hybridize to any other portion of the probe, and preferably contains most, if not all, of the ETMs The general structure is depicted in Figure 14 As will be appreciated by those in the art, the any or all of the probes described herein may be configured to form hairpins in the absence of their targets, including the amplifier, capture, capture extender, label and label extender probes In a preferred embodiment, several different amplifier probes are used, each with first probe sequences that will hybridize to a different portion of the target sequence That is, there is more than one level of amplification, the amplifier probe provides an amplification of signal due to a multiplicity of labelling events, and several different amplifier probes, each with this multiplicity of labels, for each target sequence is used Thus, preferred embodiments utilize at least two different pools of amplifier probes, each pool having a different probe sequence for hybridization to different portions of the target sequence, the only real limitation on the number of different amplifier probes will be the length of the original target sequence In addition, it is also possible that the different amplifier probes contain different amplification sequences, although this is generally not preferred
In a preferred embodiment, the amplifier probe does not hybridize to the sample target sequence directly, but instead hybridizes to a first portion of a label extender probe, as is generally depicted in Figure 16F This is particularly useful to allow the use of "generic" amplifier probes, that is, amplifier probes that can be used with a variety of different targets This may be desirable since several of the amplifier probes require special synthesis techniques Thus, the addition of a relatively short probe as a label extender probe is preferred Thus, the first probe sequence of the amplifier probe is substantially complementary to a first portion or domain of a first label extender single-stranded nucleic acid probe The label extender probe also contains a second portion or domain that is substantially complementary to a portion of the target sequence Both of these portions are preferably at least about 10 to about 50 nucleotides in length, with a range of about 15 to about 30 being preferred The terms "first" and "second" are not meant to confer an orientation of the sequences with respect to the 5'-3' orientation of the target or probe sequences For example, assuming a 5'-3' orientation of the complementary target sequence, the first portion may be located either 5' to the second portion, or 3' to the second portion For convenience herein, the order of probe sequences are generally shown from left to right
In a preferred embodiment, more than one label extender probe-amplifier probe pair may be used, tht is, n is more than 1 That is, a plurality of label extender probes may be used, each with a portion that is substantially complementary to a different portion of the target sequence, this can serve as another level of amplification Thus, a preferred embodiment utilizes pools of at least two label extender probes, with the upper limit being set by the length of the target sequence
In a preferred embodiment, more than one label extender probe is used with a single amplifier probe to reduce non-specific binding, as is depicted in Figure 16G and generally outlined in U S Patent No 5,681 ,697, incorporated by reference herein In this embodiment, a first portion of the first label extender probe hybridizes to a first portion of the target sequence, and the second portion of the first label extender probe hybridizes to a first probe sequence of the amplifier probe A first portion of the second label extender probe hybridizes to a second portion of the target sequence, and the second portion of the second label extender probe hybridizes to a second probe sequence of the amplifier probe These form structures sometimes referred to as "cruciform" structures or configurations, and are generally done to confer stability when large branched or dendrimenc amplifier probes are used
In addition, as will be appreciated by those in the art, the label extender probes may interact with a preamplifier probe, described below, rather than the amplifier probe directly
Similarly, as outlined above, a preferred embodiment utilizes several different amplifier probes, each with first probe sequences that will hybridize to a different portion of the label extender probe In addition, as outlined above, it is also possible that the different amplifier probes contain different amplification sequences, although this is generally not preferred
In addition to the first probe sequence, the amplifier probe also comprises at least one amplification sequence An "amplification sequence" or "amplification segment" or grammatical equivalents herein is meant a sequence that is used, either directly or indirectly, to bind to a first portion of a label probe as is more fully described below Preferably, the amplifier probe comprises a multiplicity of amplification sequences, with from about 3 to about 1000 being preferred, from about 10 to about 100 being particularly preferred, and about 50 being especially preferred In some cases, for example when linear amplifier probes are used, from 1 to about 20 is preferred with from about 5 to about 10 being particularly preferred
The amplification sequences may be linked to each other in a variety of ways, as will be appreciated by those in the art They may be covalently linked directly to each other, or to intervening sequences or chemical moieties, through nucleic acid linkages such as phosphodiester bonds, PNA bonds, etc , or through interposed linking agents such ammo acid, carbohydrate or polyol bridges, or through other cross-linking agents or binding partners The sιte(s) of linkage may be at the ends of a segment, and/or at one or more internal nucleotides in the strand In a preferred embodiment, the amplification sequences are attached via nucleic acid linkages
In a preferred embodiment, branched amplifier probes are used, as are generally described in U S Patent No 5,124,246, hereby incorporated by reference Branched amplifier probes may take on "fork-like" or "comb-like" conformations "Fork-like" branched amplifier probes generally have three or more oligonucleotide segments emanating from a point of origin to form a branched structure The point of origin may be another nucleotide segment or a multifunctional molecule to whcih at least three segments can be covalently or tightly bound "Comb- ke" branched amplifier probes have a linear backbone with a multiplicity of sidechain ohgonucleotides extending from theijackbone. In either conformation, the pendant segments will normally depend from a modified nucleotide or other organic moiety having the appropriate functional groups for attachment of ohgonucleotides Furthermore, in either conformation, a large number of amplification sequences are available for binding, either directly or indirectly, to detection probes In general, these structures are made as is known in the art, using modified multifunctional nucleotides, as is described in U S Patent Nos 5,635,352 and 5,124,246, among others
In a preferred embodiment, dendnmer amplifier probes are used, as are generally described in U S Patent No 5,175,270, hereby expressly incorporated by reference Dendrimeπc amplifier probes have amplification sequences that are attached via hybridization, and thus have portions of double-stranded nucleic acid as a component of their structure The outer surface of the dendnmer amplifier probe has a multiplicity of amplification sequences
In a preferred embodiment, linear amplifier probes are used, that have individual amplification sequences linked end-to-end either directly or with short intervening sequences to form a polymer As with the other amplifier configurations, there may be additional sequences or moieties between the amplification sequences In addition, as outlined herein, linear amplification probes may form hairpin stem-loop structures, as is depicted in Figure 14
In one embodiment, the linear amplifier probe has a single amplification sequence This may be useful when cycles of hybπdization/disassociation occurs, forming a pool of amplifier probe that was hybridized to the target and then removed to allow more probes to bind, or when large numbers of ETMs are used for each label probe However, in a preferred embodiment, linear amplifier probes comprise a multiplicity of amplification sequences
In addition, the amplifier probe may be totally linear, totally branched, totally dendπmeric, or any combination thereof
The amplification sequences of the amplifier probe are used, either directly or indirectly, to bind to a label probe to allow detection In a preferred embodiment, the amplification sequences of the amplifier probe are substantially complementary to a first portion of a label probe Alternatively, amplifier extender probes are used, that have a first portion that binds to the amplification sequence and a second portion that binds to the first portion of the label probe
In addition, the compositions of the invention may include "preamplifier" molecules, which serves a bridging moiety between the label extender molecules and the amplifier probes In this way, more amplifier and thus more ETMs are ultimately bound to the detection probes Preamplifier molecules may be either linear or branched, and typically contain in the range of about 30-3000 nucleotides
The reactions outlined below may be accomplished in a variety of ways, as will be appreciated by those in the art Components of the reaction may be added simultaneously, or sequentially, in any order, with preferred embodiments outlined below In addition, the reaction may include a variety of other reagents may be included in the assays These include reagents like salts, buffers, neutral proteins, e g albumin, detergents, etc which may be used to facilitate optimal hybridization and detection, and/or reduce non-specific or background interactions Also reagents that otherwise improve the efficiency of the assay, such as protease inhibitors, nuclease inhibitors, anti-microbial agents, etc , may be used, depending on the sample preparation methods and purity of the target
Generally, the methods are as follows In a preferred embodiment, the target is initially immobilized or attached to the electrode In one embodiment, this is done by forming a hybridization complex between a capture probe and a portion of the target sequence A preferred embodiment utilizes capture extender probes, in this embodiment, a hybridization complex is formed between a portion of the target sequence and a first portion of a capture extender probe, and an additional hybridization complex between a second portion of the capture extender probe and a portion of the capture probe Additional preferred embodiments utilize additional capture probes, thus forming a hybridization complex between a portion of the target sequence and a first portion of a second capture extender probe, and an additional hybridization complex between a second portion of the second capture extender probe and a second portion of the capture probe
Alternatively, the attachment of the target sequence to the electrode is done simultaneously with the other reactions
The method proceeds with the introduction of amplifier probes, if utilized In a preferred embodiment, the amplifier probe comprises a first probe sequence that is substantially complementary to a portion of the target sequence, and at least one amplification sequence
In one embodiment, the first probe sequence of the amplifier probe is hybridized to the target sequence, and any unhybπdized amplifier probe is removed This will generally be done as is known in the art, and depends on the type of assay When the target sequence is immobilized on a surface such as an electrode, the removal of excess reagents generally is done via one or more washing steps, as will be appreciated by those in the art In this embodiment, the target may be immobilized on any solid support When the target sequence is not immobilized on a surface, the removal of excess reagents such as the probes ot the invention may be done by adding beads (i e solid support particles) that contain complementary sequences to the probes, such that the excess probes bind to the beads The beads can then be removed, for example by centπfugation, filtration, the application of magnetic or electrostatic fields, etc
The reaction mixture is then subjected to conditions (temperature, high salt, changes in pH, etc ) under which the amplifier probe disassociates from the target sequence, and the amplifier probe is collected The amplifier probe may then be added to an electrode comprising capture probes for the amplifier probes, label probes added, and detection is achieved
In a preferred embodiment, a larger pool of probe is generated by adding more amplifier probe to the target sequence and the hybndization/disassociation reactions are repeated, to generate a larger pool of amplifier probe This pool of amplifier probe is then added to an electrode comprising amplifier capture probes, label probes added, and detection proceeds
In this embodiment, it is preferred that the target sequence be immobilized on a solid support, including an electrode, using the methods described herein, although as will be appreciated by those in the art, alternate solid support attachment technologies may be used, such as attachment to glass, polymers, etc It is possible to do the reaction on one solid support and then add the pooled amplifier probe to an electrode for detection
In a preferred embodiment, the amplifier probe comprises a multiplicity of amplification sequences
In one embodiment, the first probe sequence of the amplifier probe is hybridized to the target sequence, and any unhybndized amplifier probe is removed Again, preferred embodiments utilize immobilized target sequences, wherein the target sequences are immobilized by hybridization with capture probes that are attached to the electrode, or hybridization to capture extender probes that in turn hybridize with immobilized capture probes as is described herein Generally, in these embodiments, the capture probes and the detection probes are immobilized on the electrode, generally at the same "address"
In a preferred embodiment, the first probe sequence of the amplifier probe is hybridized to a first portion of at least one label extender probe, and a second portion of the label extender probe is hybridized to a portion of the target sequence Other preferred embodiments utilize more than one label extender probe
In a preferred embodiment, the amplification sequences of the amplifier probe are used directly for detection, by hybridizing at least one label probe sequence The invention thus provides assay complexes that minimally comprise a target sequence and a label probe "Assay complex" herein is meant the collection of hybridization complexes comprising nucleic acids, including probes and targets, that contains at least one ETM and thus allows detection The composition of the assay complex depends on the use of the different probe component outlined herein Thus, in Figures 16A, 16B and 16C, the assay complex comprises the capture probe and the target sequence The assay complexes may also include label probes, capture extender probes, label extender probes, and amplifier probes, as outlined herein, depending on the configuration used
The assays are generally run under stringency conditions which allows formation of the label probe hybridization complex only in the presence of target Stringency can be controlled by altering a step parameter that is a thermodynamic variable, including, but not limited to, temperature, formamide concentration, salt concentration, chaotropic salt concentration pH, organic solvent concentration, etc
These parameters may also be used to control non-specific binding, as is generally outlined in U S Patent No 5,681 ,697 Thus it may be desirable to perform certain steps at higher stringency conditions, for example, when an initial hybridization step is done between the target sequence and the label extender and capture extender probes Running this step at conditions which favor specific binding can allow the reduction of non-specific binding
In a preferred embodiment, when all of the components outlined herein are used, a preferred method is as follows Single-stranded target sequence is incubated under hybridization conditions with the capture extender probes and the label extender probes A preferred embodiment does this reaction in the presence of the electrode with immobilized capture probes, although this may also be done in two steps, with the initial incubation and the subsequent addition to the electrode Excess reagents are washed off, and amplifier probes are then added If preamplifier probes are used, they may be added either prior to the amplifier probes or simultaneously with the amplifier probes Excess reagents are washed off, and label probes are then added Excess reagents are washed off, and detection proceeds as outlined below
In one embodiment, a number of capture probes (or capture probes and capture extender probes) that are each substantially complementary to a different portion of the target sequence are used
Again, as outlined herein, when amplifier probes are used, the system is generally configured such that upon label probe binding, the recruitment linkers comprising the ETMs are placed in proximity to the monolayer surface Thus for example, when the ETMs are attached via "dendnmer" type structures as outlined herein, the length of the linkers from the nucleic acid point of attachment to the ETMs may vary, particularly with the length of the capture probe when capture extender probes are used That is, longer capture probes, with capture extenders, can result in the target sequences being "held" further away from the surface than for shorter capture probes Adding extra linking sequences between the probe nucleic acid and the ETMs can result in the ETMs being spatially closer to the surface, giving better results
In addition, if desirable, nucleic acids utilized in the invention may also be ligated together prior to detection, if applicable, by using standard molecular biology techniques such as the use of a gase Similarly, if desirable for stability, cross-linking agents may be added to hold the structures stable
The compositions of the invention are generally synthesized as outlined below, generally utilizing techniques well known in the art As will be appreciated by those in the art, many of the techniques outlined below are directed to nucleic acids containing a nbose-phosphate backbone However, as outlined above, many alternate nucleic acid analogs may be utilized, some of which may not contain either ribose or phosphate in the backbone In these embodiments, for attachment at positions other than the base, attachment is done as will be appreciated by those in the art, depending on the backbone Thus, for example, attachment can be made at the carbon atoms of the PNA backbone, as is described below, or at either terminus of the PNA
The compositions may be made in several ways A preferred method first synthesizes a conductive oligomer attached to a nucleoside, with addition of additional nucleosides to form the capture probe followed by attachment to the electrode Alternatively, the whole capture probe may be made and then the completed conductive oligomer added, followed by attachment to the electrode Alternatively, a monolayer of conductive oligomer (some of which have functional groups for attachment of capture probes) is attached to the electrode first, followed by attachment of the capture probe The latter two methods may be preferred when conductive oligomers are used which are not stable in the solvents and under the conditions used in traditional nucleic acid synthesis
In a preferred embodiment, the compositions of the invention are made by first forming the conductive oligomer covalently attached to the nucleoside, followed by the addition of additional nucleosides to form a capture probe nucleic acid, with the last step comprising the addition of the conductive oligomer to the electrode
The attachment of the conductive oligomer to the nucleoside may be done in several ways In a preferred embodiment, all or part of the conductive oligomer is synthesized first (generally with a functional group on the end for attachment to the electrode), which is then attached to the nucleoside
Additional nucleosides are then added as required, with the last step generally being attachment to the electrode Alternatively, oligomer units are added one at a time to the nucleoside, with addition of additional nucleosides and attachment to the electrode A number of representative syntheses are shown in the Figures of PCT US97/20014, expressly incorporated herein by reference
The conductive oligomer is then attached to a nucleoside that may contain one (or more) of the oligomer units, attached as depicted herein
In a preferred embodiment, attachment is to a ribose of the nbose-phosphate backbone Thus, attachment via amide and amine linkages are possible (see Figures 1 and 2 of CPT US97/20014) In a preferred embodiment, there is at least a methylene group or other short aliphatic alkyl groups (as a Z group) between the nitrogen attached to the ribose and the aromatic ring of the conductive oligomer
A representative synthesis is shown in Figure 16 of PCT US97/20014
Alternatively, attachment is via a phosphate of the nbose-phosphate backbone Examples of two synthetic schemes are shown in Figure 4 and Figure 5 of PCT US97/20014 Although both Figures show attachment at the 3' position of the ribose, attachment can also be made via the 2' position In
Figure 5, Z is an ethylene linker, although other linkers may be used as well, as will be appreciated by those in the art
In a preferred embodiment, attachment is via the base A general scheme is depicted in Figure 3 of PCT US97/20014, using undine as the nucleoside and a phenylene-acetylene conductive oligomer
As will be appreciated in the art, amide linkages are also possible, using techniques well known in the art In a preferred embodiment, protecting groups may be added to the base prior to addition of the conductive oligomers, as is generally outlined in Figures 10 and 11 of PCT US97/20014 In addition, the palladium cross-coupling reactions may be altered to prevent dimerization problems, i e two conductive oligomers dimeπzing, rather than coupling to the base
Alternatively, attachment to the base may be done by making the nucleoside with one unit of the oligomer, followed by the addition of others
Once the modified nucleosides are prepared, protected and activated, prior to attachment to the electrode, they may be incorporated into a growing oligonucleotide by standard synthetic techniques (Gait, Oligonucleotide Synthesis A Practical Approach, IRL Press, Oxford, UK 1984, Eckstein) in several ways
In one embodiment, one or more modified nucleosides are converted to the tπphosphate form and incorporated into a growing oligonucleotide chain by using standard molecular biology techniques such as with the use of the enzyme DNA polymerase I, T4 DNA polymerase, T7 DNA polymerase, Taq DNA polymerase, reverse transcπptase, and RNA polymerases For the incorporation of a 3' modified nucleoside to a nucleic acid, terminal deoxynucleotidyltransferase may be used (Ratliff, Terminal deoxynucleotidyltransferase In The Enzymes, Vol 14A P D Boyer ed pp 105-118 Academic Press, San Diego, CA 1981) Thus, the present invention provides deoxynbonucleoside tπphosphates comprising a covalently attached ETM Preferred embodiments utilize ETM attachment to the base or the backbone, such as the ribose (preferably in the 2' position), as is generally depicted below in Structures 42 and 43
Structure 42
0
Figure imgf000067_0001
Structui re 43
Figure imgf000067_0002
Thus, in some embodiments, it may be possible to generate the nucleic acids comprising ETMs in situ For example, a target sequence can hybridize to a capture probe (for example on the surface) in such a way that the terminus of the target sequence is exposed, i e unhybndized The addition of enzyme and tπphosphate nucleotides labelled with ETMs allows the in situ creation of the label Similarly, using labeled nucleotides recognized by polymerases can allow simultaneous PCR and detection, that is, the target sequences are generated in situ
In a preferred embodiment, the modified nucleoside is converted to the phosphoramidite or H- phosphonate form, which are then used in solid-phase or solution syntheses of ohgonucleotides In this way the modified nucleoside, either for attachment at the ribose (i e ammo- or thiol-modified nucleosides) or the base, is incorporated into the oligonucleotide at either an internal position or the 5' terminus This is generally done in one of two ways First, the 5' position of the ribose is protected with 4',4-dιmethoxytπtyl (DMT) followed by reaction with either 2-cyanoethoxy-bιs- diisopropylaminophosphme in the presence of diisopropylammonium tetrazohde, or by reaction with chlorodiisopropylammo 2'-cyanoethyoxyphosphιne, to give the phosphoramidite as is known in the art, although other techniques may be used as will be appreciated by those in the art See Gait, supra, Caruthers, Science 230 281 (1985), both of which are expressly incorporated herein by reference
For attachment of a group to the 3' terminus, a preferred method utilizes the attachment of the modified nucleoside (or the nucleoside replacement) to controlled pore glass (CPG) or other o gomeric supports In this embodiment, the modified nucleoside is protected at the 5' end with DMT, and then reacted with succinic anhydride with activation The resulting succmyl compound is attached to CPG or other ohgomeric supports as is known in the art Further phosphoramidite nucleosides are added, either modified or not, to the 5' end after deprotection Thus, the present invention provides conductive oligomers or insulators covalently attached to nucleosides attached to solid ohgomeric supports such as CPG, and phosphoramidite derivatives of the nucleosides of the invention
The invention further provides methods of making label probes with recruitment linkers comprising ETMs These synthetic reactions will depend on the character of the recruitment linker and the method of attachment of the ETM, as will be appreciated by those in the art For nucleic acid recruitment linkers, the label probes are generally made as outlined herein with the incorporation of ETMs at one or more positions When a transition metal complex is used as the ETM, synthesis may occur in several ways In a preferred embodiment, the lιgand(s) are added to a nucleoside, followed by the transition metal ion, and then the nucleoside with the transition metal complex attached is added to an oligonucleotide, i e by addition to the nucleic acid synthesizer Alternatively, the hgand(s) may be attached, followed by incorportation into a growing oligonucleotide chain, followed by the addition of the metal ion
In a preferred embodiment, ETMs are attached to a ribose of the nbose-phosphate backbone This is generally done as is outlined herein for conductive oligomers, as described herein, and in PCT publication WO 95/15971 , using ammo-modified or oxo-modified nucleosides, at either the 2' or 3' position of the ribose The ammo group may then be used either as a ligand, for example as a transition metal ligand for attachment of the metal ion, or as a chemically functional group that can be used for attachment of other ligands or organic ETMs, for example via amide linkages, as will be appreciated by those in the art For example, the examples describe the synthesis of nucleosides with a variety of ETMs attached via the ribose
In a preferred embodiment, ETMs are attached to a phosphate of the nbose-phosphate backbone As outlined herein, this may be done using phosphodiester analogs such as phosphoramidite bonds, see generally PCT publication WO 95/15971 , or can be done in a similar manner to that depicted in Figures 4 and 5 of PCT US97/20014, where the conductive oligomer is replaced by a transition metal ligand or complex or an organic ETM, as well as is outlined in the Examples
Attachment to alternate backbones, for example peptide nucleic acids or alternate phosphate linkages will be done as will be appreciated by those in the art
In a preferred embodiment, ETMs are attached to a base of the nucleoside This may be done in a variety of ways In one embodiment, ammo groups of the base, either naturally occurring or added as is described herein (see the fiigures, for example), are used either as ligands for transition metal complexes or as a chemically functional group that can be used to add other ligands, for example via an amide linkage, or organic ETMs This is done as will be appreciated by those in the art Alternatively, nucleosides containing halogen atoms attached to the heterocychc ring are commercially available Acetylene linked ligands may be added using the halogenated bases, as is generally known, see for example, Tzahs et al , Tetrahedron Lett 36(34) 6017-6020 (1995), Tzahs et al , Tetrahedron Lett 36(2) 3489-3490 (1995), and Tza s et al , Chem Communications (in press) 1996, all of which are hereby expressly incorporated by reference See also the figures and the examples, which describes the synthesis of metallocenes (in this case, ferrocene) attached via acetylene linkages to the bases
In one embodiment, the nucleosides are made with transition metal ligands, incorporated into a nucleic acid, and then the transition metal ion and any remaining necessary ligands are added as is known in the art In an alternative embodiment, the transition metal ion and additional ligands are added prior to incorporation into the nucleic acid
Once the nucleic acids of the invention are made, with a covalently attached attachment linker (i e either an insulator or a conductive oligomer), the attachment linker is attached to the electrode The method will vary depending on the type of electrode used As is described herein, the attachment linkers are generally made with a terminal "A" linker to facilitate attachment to the electrode For the purposes of this application, a sulfur-gold attachment is considered a covalent attachment
In a preferred embodiment, conductive oligomers, insulators, and attachment linkers are covalently attached via sulfur linkages to the electrode However, surprisingly, traditional protecting groups for use of attaching molecules to gold electrodes are generally not ideal for use in both synthesis of the compositions described herein and inclusion in oligonucleotide synthetic reactions Accordingly, the present invention provides novel methods for the attachment of conductive oligomers to gold electrodes, utilizing unusual protecting groups, including ethylpyπdine, and tπmethylsilylethyl as is depicted in the Figures However, as will be appreciated by those in the art, when the conductive oligomers do not contain nucleic acids, traditional protecting groups such as acetyl groups and others may be used See Greene et al , supra
This may be done in several ways In a preferred embodiment, the subunit of the conductive oligomer which contains the sulfur atom for attachment to the electrode is protected with an ethyl-pyπdme or tπmethylsiiylethyl group For the former, this is generally done by contacting the subunit containing the sulfur atom (preferably in the form of a sulfhydryl) with a vinyl pyridme group or vinyl tπmethylsilylethyl group under conditions whereby an ethylpyπdine group or tπmethylsilylethyl group is added to the sulfur atom
This subunit also generally contains a functional moiety for attachment of additional subunits, and thus additional subunits are attached to form the conductive oligomer The conductive oligomer is then attached to a nucleoside, and additional nucleosides attached The protecting group is then removed and the sulfur-gold covalent attachment is made Alternatively, all or part of the conductive oligomer is made, and then either a subunit containing a protected sulfur atom is added, or a sulfur atom is added and then protected The conductive oligomer is then attached to a nucleoside, and additional nucleosides attached Alternatively, the conductive oligomer attached to a nucleic acid is made, and then either a subunit containing a protected sulfur atom is added, or a sulfur atom is added and then protected Alternatively, the ethyl pyridme protecting group may be used as above, but removed after one or more steps and replaced with a standard protecting group like a disulfide Thus, the ethyl pyridme or tπmethylsilylethyl group may serve as the protecting group for some of the synthetic reactions, and then removed and replaced with a traditional protecting group
By "subunit" of a conductive polymer herein is meant at least the moiety of the conductive oligomer to which the sulfur atom is attached, although additional atoms may be present, including either functional groups which allow the addition of additional components of the conductive oligomer, or additional components of the conductive oligomer Thus, for example, when Structure 1 oligomers are used, a subunit comprises at least the first Y group
A preferred method comprises 1 ) adding an ethyl pyridme or tπmethylsilylethyl protecting group to a sulfur atom attached to a first subunit of a conductive oligomer, generally done by adding a vinyl pyridme or tπmethylsiiylethyl group to a sulfhydryl, 2) adding additional subunits to form the conductive oligomer, 3) adding at least a first nucleoside to the conductive oligomer, 4) adding additional nucleosides to the first nucleoside to form a nucleic acid, 5) attaching the conductive oligomer to the gold electrode This may also be done in the absence of nucleosides, as is described in the
Examples The above method may also be used to attach insulator molecules to a gold electrode
In a preferred embodiment, a monolayer comprising conductive oligomers (and optionally insulators) is added to the electrode Generally, the chemistry of addition is similar to or the same as the addition of conductive oligomers to the electrode, i e using a sulfur atom for attachment to a gold electrode, etc
Compositions comprising monolayers in addition to the conductive oligomers covalently attached to nucleic acids may be made in at least one of five ways (1 ) addition of the monolayer, followed by subsequent addition of the attachment linker-nucleic acid complex, (2) addition of theattachment linker-nucleic acid complex followed by addition of the monolayer, (3) simultaneous addition of the monolayer and attachment linker-nucleic acid complex, (4) formation of a monolayer (using any of 1 , 2 or 3) which includes attachment linkers which terminate in a functional moiety suitable for attachment of a completed nucleic acid, or (5) formation of a monolayer which includes attachment linkers which terminate in a functional moiety suitable for nucleic acid synthesis, i e the nucleic acid is synthesized on the surface of the monolayer as is known in the art Such suitable functional moieties include, but are not limited to, nucleosides, ammo groups, carboxyl groups, protected sulfur moieties, or hydroxy I groups for phosphoramidite additions The examples describe the formation of a monolayer on a gold electrode using the preferred method (1 )
In a preferred embodiment, the nucleic acid is a peptide nucleic acid or analog In this embodiment, the invention provides peptide nucleic acids with at least one covalently attached ETM or attachment linker In a preferred embodiment, these moieties are covalently attached to an monomeπc subunit of the PNA By "monomeπc subunit of PNA" herein is meant the -NH-CH2CH2-N(COCH2-Base)-CH2-CO- monomer, or derivatives (herein included within the definition of "nucleoside") of PNA For example, the number of carbon atoms in the PNA backbone may be altered, see generally Nielsen et al , Chem Soc Rev 1997 page 73, which discloses a number of PNA derivatives, herein expressly incorporated by reference Similarly, the amide bond linking the base to the backbone may be altered, phosphoramide and sulfuramide bonds may be used Alternatively, the moieties are attached to an internal monomenc subunit By "internal" herein is meant that the monomeπc subunit is not either the N-terminal monomenc subunit or the C-terminal monomenc subunit In this embodiment, the moieties can be attached either to a base or to the backbone of the monomenc subunit Attachment to the base is done as outlined herein or known in the literature In general, the moieties are added to a base which is then incorporated into a PNA as outlined herein The base may be either protected, as required for incorporation into the PNA synthetic reaction, or derivatized, to allow incorporation, either prior to the addition of the chemical substituent or afterwards Protection and deπvatization of the bases is shown in Figures 24-27 of PCT US97/20014 The bases can then be incorporated into monomenc subunits as shown in Figure 28 of PCT US97/20014 Figures 29 and 30 of PCT US97/20014 depict two different chemical substituents, an ETM and a conductive oligomer, attached at a base Figure 29 depicts a representative synthesis of a PNA monomenc subunit with a ferrocene attached to a uracil base Figure 30 depicts the synthesis of a three unit conductive oligomer attached to a uracil base
In a preferred embodiment, the moieties are covalently attached to the backbone of the PNA monomer The attachment is generally to one of the unsubstituted carbon atoms of the monomenc subunit, preferably the α-carbon of the backbone, as is depicted in Figures 31 and 32, although attachment at either of the carbon 1 or 2 positions, or the α-carbon of the amide bond linking the base to the backbone may be done In the case of PNA analogs, other carbons or atoms may be substituted as well In a preferred embodiment, moieties are added at the α-carbon atoms, either to a terminal monomenc subunit or an internal one
In this embodiment, a modified monomenc subunit is synthesized with an ETM or an attachment linker, or a functional group for its attachment, and then the base is added and the modified monomer can be incorporated into a growing PNA chain Figure 31 of PCT US97/20014 depicts the synthesis of a conductive oligomer covalently attached to the backbone of a PNA monomenc subunit, and Figure 32 of PCT US97/20014 depicts the synthesis of a ferrocene attached to the backbone of a monomenc subunit
Once generated, the monomenc subunits with covalently attached moieties are incorporated into a
PNA using the techniques outlined in Will et al , Tetrahedron 51 (44) 12069-12082 (1995), and Vanderlaan et al , Tett Let 38 2249-2252 (1997), both of which are hereby expressly incorporated in their entirety These procedures allow the addition of chemical substituents to peptide nucleic acids without destroying the chemical substituents
As will be appreciated by those in the art, electrodes may be made that have any combination of nucleic acids, conductive oligomers and insulators
The compositions of the invention may additionally contain one or more labels at any position By "label" herein is meant an element (e g an isotope) or chemical compound that is attached to enable the detection of the compound Preferred labels are radioactive isotopic labels, and colored or fluorescent dyes The labels may be incorporated into the compound at any position In addition, the compositions of the invention may also contain other moieties such as cross-linking agents to facilitate cross-linking of the target-probe complex See for example, Lukhtanov et al , Nucl Acids Res 24(4) 683 (1996) and Tabone et al , Biochem 33 375 (1994), both of which are expressly incorporated by reference Once made, the compositions find use in a number of applications, as described herein. In particular, the compositions of the invention find use in hybridization assays. As will be appreciated by those in the art, electrodes can be made that have a single species of nucleic acid, i.e. a single nucleic acid sequence, or multiple nucleic acid species.
In addition, as outlined herein, the use of a solid support such as an electrode enables the use of these gene probes in an array form. The use of oligonucleotide arrays are well known in the art. In addition, techniques are known for "addressing" locations within an electrode and for the surface modification of electrodes. Thus, in a preferred embodiment, arrays of different nucleic acids are laid down on the electrode, each of which are covalently attached to the electrode via a conductive linker.
In this embodiment, the number of different probe species of oligonucleotides may vary widely, from one to thousands, with from about 4 to about 100,000 being preferred, and from about 10 to about 10,000 being particularly preferred.
Once the assay complexes of the invention are made, that minimally comprise a target sequence and a label probe, detection proceeds with electronic initiation. Without being limited by the mechanism or theory, detection is based on the transfer of electrons from the ETM to the electrode.
Detection of electron transfer, i.e. the presence of the ETMs, is generally initiated electronically, with voltage being preferred. A potential is applied to the assay complex. Precise control and variations in the applied potential can be via a potentiostat and either a three electrode system (one reference, one sample (or working) and one counter electrode) or a two electrode system (one sample and one counter electrode). This allows matching of applied potential to peak potential of the system which depends in part on the choice of ETMs and in part on the conductive oligomer used, the composition and integrity of the monolayer, and what type of reference electrode is used. As described herein, ferrocene is a preferred ETM.
In a preferred embodiment, a co-reductant or co-oxidant (collectively, co-redoxant) is used, as an additional electron source or sink. See generally Sato et al., Bull. Chem. Soc. Jpn 66:1032 (1993); Uosaki et al., Electrochimica Acta 36:1799 (1991); and Alleman et al., J. Phys. Chem 100:17050
(1996); all of which are incorporated by reference.
In a preferred embodiment, an input electron source in solution is used in the initiation of electron transfer, preferably when initiation and detection are being done using DC current or at AC frequencies where diffusion is not limiting. In general, as will be appreciated by those in the art, preferred embodiments utilize monolayers that contain a minimum of "holes", such that short-circuiting of the system is avoided. This may be done in several general ways. In a preferred embodiment, an input electron source is used that has a lower or similar redox potential than the ETM of the label probe. Thus, at voltages above the redox potential of the input electron source, both the ETM and the input electron source are oxidized and can thus donate electrons; the ETM donates an electron to the electrode and the input source donates to the ETM. For example, ferrocene, as a ETM attached to the compositions of the invention as described in the examples, has a redox potential of roughly 200 mV in aqueous solution (which can change significantly depending on what the ferrocene is bound to, the manner of the linkage and the presence of any substitution groups). Ferrocyanide, an electron source, has a redox potential of roughly 200 mV as well (in aqueous solution). Accordingly, at or above voltages of roughly 200 mV, ferrocene is converted to ferricenium, which then transfers an electron to the electrode. Now the ferricyanide can be oxidized to transfer an electron to the ETM. In this way, the electron source (or co-reductant) serves to amplify the signal generated in the system, as the electron source molecules rapidly and repeatedly donate electrons to the ETM attached to the nucleic acid. The rate of electron donation or acceptance will be limited by the rate of diffusion of the co-reductant, the electron transfer between the co-reductant and the ETM, which in turn is affected by the concentration and size, etc.
Alternatively, input electron sources that have lower redox potentials than the ETM are used. At voltages less than the redox potential of the ETM, but higher than the redox potential of the electron source, the input source such as ferrocyanide is unable to be oxided and thus is unable to donate an electron to the ETM; i.e. no electron transfer occurs. Once ferrocene is oxidized, then there is a pathway for electron transfer.
In an alternate preferred embodiment, an input electron source is used that has a higher redox potential than the ETM of the label probe. For example, luminol, an electron source, has a redox potential of roughly 720 mV. At voltages higher than the redox potential of the ETM, but lower than the redox potential of the electron source, i.e. 200 - 720 mV, the ferrocene is oxided, and transfers a single electron to the electrode via the conductive oligomer. However, the ETM is unable to accept any electrons from the luminol electron source, since the voltages are less than the redox potential of the luminol. However, at or above the redox potential of luminol, the luminol then transfers an electron to the ETM, allowing rapid and repeated electron transfer. In this way, the electron source (or co-reductant) serves to amplify the signal generated in the system, as the electron source molecules rapidly and repeatedly donate electrons to the ETM of the label probe.
Luminol has the added benefit of becoming a chemiluminiscent species upon oxidation (see Jirka et al., Analytica Chimica Acta 284:345 (1993)), thus allowing photo-detection of electron transfer from the
ETM to the electrode. Thus, as long as the luminol is unable to contact the electrode directly, i.e. in the presence of the SAM such that there is no efficient electron transfer pathway to the electrode, luminol can only be oxidized by transferring an electron to the ETM on the label probe When the ETM is not present, i e when the target sequence is not hybridized to the composition of the invention, luminol is not significantly oxidized, resulting in a low photon emission and thus a low (if any) signal from the luminol In the presence of the target, a much larger signal is generated Thus, the measure of luminol oxidation by photon emission is an indirect measurement of the ability of the ETM to donate electrons to the electrode Furthermore, since photon detection is generally more sensitive than electronic detection, the sensitivity of the system may be increased Initial results suggest that luminescence may depend on hydrogen peroxide concentration, pH, and luminol concentration, the latter of which appears to be non-linear
Suitable electron source molecules are well known in the art, and include, but are not limited to, ferricyanide, and luminol
Alternatively, output electron acceptors or sinks could be used, i e the above reactions could be run in reverse, with the ETM such as a metallocene receiving an electron from the electrode, converting it to the metalhcenium, with the output electron acceptor then accepting the electron rapidly and repeatedly In this embodiment, cobalticenium is the preferred ETM
The presence of the ETMs at the surface of the monolayer can be detected in a variety of ways A variety of detection methods may be used, including, but not limited to, optical detection (as a result of spectral changes upon changes in redox states), which includes fluorescence, phosphorescence, luminiscence, chemiluminescence, electrochemiluminescence, and refractive index, and electronic detection, including, but not limited to, amperommetry, voltammetry, capacitance and impedence These methods include time or frequency dependent methods based on AC or DC currents, pulsed methods, lock-in techniques, filtering (high pass, low pass, band pass), and time-resolved techniques including time-resolved fiuoroscence
In one embodiment, the efficient transfer of electrons from the ETM to the electrode results in stereotyped changes in the redox state of the ETM With many ETMs including the complexes of ruthenium containing bipyndine, pyridme and imidazole rings, these changes in redox state are associated with changes in spectral properties Significant differences in absorbance are observed between reduced and oxidized states for these molecules See for example Fabbπzzi et al , Chem Soc Rev 1995 pp197-202) These differences can be monitored using a spectrophotometer or simple photomultipher tube device
In this embodiment, possible electron donors and acceptors include all the derivatives listed above for photoactivation or initiation Preferred electron donors and acceptors have characteristically large spectral changes upon oxidation and reduction resulting in highly sensitive monitoring of electron transfer Such examples include Ru(NH3)4py and Ru(bpy)2ιm as preferred examples It should be understood that only the donor or acceptor that is being monitored by absorbance need have ideal spectral characteristics
In a preferred embodiment, the electron transfer is detected fluorometπcally Numerous transition metal complexes, including those of ruthenium, have distinct fluorescence properties Therefore, the change in redox state of the electron donors and electron acceptors attached to the nucleic acid can be monitored very sensitively using fluorescence, for example with Ru(4,7-bιphenyl2-phenanthrohne)3 2+ The production of this compound can be easily measured using standard fluorescence assay techniques For example, laser induced fluorescence can be recorded in a standard single cell fluoπmeter, a flow through "on-line" fluoπmeter (such as those attached to a chromatography system) or a multi-sample "plate-reader" similar to those marketed for 96-well immuno assays
Alternatively, fluorescence can be measured using fiber optic sensors with nucleic acid probes in solution or attached to the fiber optic Fluorescence is monitored using a photomultipher tube or other light detection instrument attached to the fiber optic The advantage of this system is the extremely small volumes of sample that can be assayed
In addition, scanning fluorescence detectors such as the Fluorlmager sold by Molecular Dynamics are ideally suited to monitoring the fluorescence of modified nucleic acid molecules arrayed on solid surfaces The advantage of this system is the large number of electron transfer probes that can be scanned at once using chips covered with thousands of distinct nucleic acid probes
Many transition metal complexes display fluorescence with large Stokes shifts Suitable examples include bis- and trisphenanthrohne complexes and bis- and trisbipyπdyl complexes of transition metals such as ruthenium (see Juris, A , Balzani, V , et al Coord Chem Rev , V 84, p 85-277, 1988) Preferred examples display efficient fluorescence (reasonably high quantum yields) as well as low reorganization energies These include Ru(4,7-bιphenyl2-phenanthrohne)3 2+, Ru(4,4'-dιphenyl-2,2'- bιpyπdιne)3 2+ and platinum complexes (see Cummmgs et al , J Am Chem Soc 118 1949-1960
(1996), incorporated by reference) Alternatively, a reduction in fluorescence associated with hybridization can be measured using these systems
In a further embodiment, electrochemiluminescence is used as the basis of the electron transfer detection With some ETMs such as Ru2+(bpy)3, direct luminescence accompanies excited state decay Changes in this property are associated with nucleic acid hybridization and can be monitored with a simple photomultipher tube arrangement (see Blackburn, G F Clin Chem 37 1534-1539 (1991 ), and Juris et al , supra
In a preferred embodiment, electronic detection is used, including amperommetry, voltammetry, capacitance, and impedence Suitable techniques include, but are not limited to, electrogravimetry, coulometry (including controlled potential coulometry and constant current coulometry), voltametry (cyclic voltametry, pulse voltametry (normal pulse voltametry, square wave voltametry, differential pulse voltametry, Osteryoung square wave voltametry, and couiostatic pulse techniques), stripping analysis (aniodic stripping analysis, cathiodic stripping analysis, square wave stripping voltammetry), conductance measurements (electrolytic conductance, direct analysis), time-dependent electrochemical analyses (chronoamperometry, chronopotentiometry, cyclic chronopotentiometry and amperometry, AC polography, chronogalvametry, and chronocoulometry), AC impedance measurement, capacitance measurement, AC voltametry, and photoelectrochemistry
In a preferred embodiment, monitoring electron transfer is via amperometric detection This method of detection involves applying a potential (as compared to a separate reference electrode) between the nucleic acid-conjugated electrode and a reference (counter) electrode in the sample containing target genes of interest Electron transfer of differing efficiencies is induced in samples in the presence or absence of target nucleic acid, that is, the presence or absence of the target nucleic acid, and thus the label probe, can result in different currents
The device for measuring electron transfer amperometπcally involves sensitive current detection and includes a means of controlling the voltage potential, usually a potentiostat This voltage is optimized with reference to the potential of the electron donating complex on the label probe Possible electron donating complexes include those previously mentioned with complexes of iron, osmium, platinum, cobalt, rhenium and ruthenium being preferred and complexes of iron being most preferred
In a preferred embodiment, alternative electron detection modes are utilized For example, potentiometπc (or voltammetπc) measurements involve non-faradaic (no net current flow) processes and are utilized traditionally in pH and other ion detectors Similar sensors are used to monitor electron transfer between the ETM and the electrode In addition, other properties of insulators (such as resistance) and of conductors (such as conductivity, impedance and capi tance) could be used to monitor electron transfer between ETM and the electrode Finally, any system that generates a current (such as electron transfer) also generates a small magnetic field, which may be monitored in some embodiments It should be understood that one benefit of the fast rates of electron transfer observed in the compositions of the invention is that time resolution can greatly enhance the signal-to-noise results of monitors based on absorbance, fluorescence and electronic current The fast rates of electron transfer of the present invention result both in high signals and stereotyped delays between electron transfer initiation and completion By amplifying signals of particular delays, such as through the use of pulsed initiation of electron transfer and "lock-in" amplifiers of detection, and Fourier transforms
In a preferred embodiment, electron transfer is initiated using alternating current (AC) methods Without being bound by theory, it appears that ETMs, bound to an electrode, generally respond similarly to an AC voltage across a circuit containing resistors and capacitors Basically, any methods which enable the determination of the nature of these complexes, which act as a resistor and capacitor, can be used as the basis of detection Surprisingly, traditional electrochemical theory, such as exemplified in Laviron et al , J Electroanal Chem 97 135 (1979) and Laviron et al , J Electroanal Chem 105 35 (1979), both of which are incorporated by reference, do not accurately model the systems described herein, except for very small EAC (less than 10 mV) and relatively large numbers of molecules That is, the AC current (I) is not accurately described by Laviron's equation This may be due in part to the fact that this theory assumes an unlimited source and sink of electrons, which is not true in the present systems
Accordingly, alternate equations were developed, using the Nernst equation and first principles to develop a model which more closely simulates the results This was derived as follows The Nernst equation, Equation 1 below, describes the ratio of oxidized (O) to reduced (R) molecules (number of molecules = n) at any given voltage and temperature, since not every molecule gets oxidized at the same oxidation potential
Equation 1
Figure imgf000078_0001
EDC is the electrode potential, E0 is the formal potential of the metal complex, R is the gas constant, T is the temperature in degrees Kelvin, n is the number of electrons transferred, F is faraday's constant,
[O] is the concentration of oxidized molecules and [R] is the concentration of reduced molecules
The Nernst equation can be rearranged as shown in Equations 2 and 3 Equation 2
nF [R]
EDC is the DC component of the potential
Equation 3
exp - (EDC " Eθ) = M ( )
[R]
Equation 3 can be rearranged as follows, using normalization of the concentration to equal 1 for simplicity, as shown in Equations 4, 5 and 6 This requires the subsequent multiplication by the total number of molecules
Equation 4 [O] + [R] = 1 Equation 5 [O] = 1 - [R] Equation 6 [R] = 1 - [O]
Plugging Equation 5 and 6 into Equation 3, and the fact that nF/RT equals 38 9 V 1, for n=1 , gives Equations 7 and 8, which define [O] and [R], respectively
Equation 7
38 9(E -E0) [0] = -^P
38 9(E -E0)
1 + exp
Equation 8
[R] = - ( 5 )
38 9 (E - E.) ^ '
1 + exp °
Taking into consideration the generation of an AC faradaic current, the ratio of [0]/[R] at any given potential must be evaluated At a particular EDC with an applied EAC, as is generally described herein, at the apex of the EAC more molecules will be in the oxidized state, since the voltage on the surface is now (EDC + EAC), at the bottom, more will be reduced since the voltage is lower Therefore, the AC current at a given EDC will be dictated by both the AC and DC voltages, as well as the shape of the Nemstian curve Specifically, if the number of oxidized molecules at the bottom of the AC cycle is subtracted from the amount at the top of the AC cycle, the total change in a given AC cycle is obtained, as is generally described by Equation 9 Dividing by 2 then gives the AC amplitude
Equation 9
ιAC ≡ (electrons at fEπ + E_r ]) - (electrons at [Epr- 2
Equation 10 thus describes the AC current which should result Equation 10 iA = C0 Fω V_ ([O [OV - E. ) ( 6 )
As depicted in Equation 11 , the total AC current will be the number of redox molecules C), times faraday's constant (F), times the AC frequency (ω), times 0 5 (to take into account the AC amplitude), times the ratios derived above in Equation 7 The AC voltage is approximated by the average, EAC2/π
Equation 11
38 9 [EDC ♦ — £ - E„] 38 9 [EDC - _i£ - _?„]
_ Co exp π _ exp π lC 2 38 9 [EDC + — ^ - E„] 38 9 [EDC2E ^AC E
1 + exp π 1 + exp π
Using Equation 11 , simulations were generated using increasing overpotential (AC voltage) Figure
22A of PCT US97/20014 shows one of these simulations, while Figure 22B depicts a simulation based on traditional theory Figures 23A and 23B depicts actual experimental data using the Fc-wire of Example 7 of PCT US97/20014 plotted with the simulation, and shows that the model fits the experimental data very well In some cases the current is smaller than predicted, however this has been shown to be caused by ferrocene degradation which may be remedied in a number of ways
However, Equation 11 does not incorporate the effect of electron transfer rate nor of instrument factors Electron transfer rate is important when the rate is close to or lower than the applied frequency Thus, the true ιAC should be a function of all three, as depicted in Equation 12
Equation 12 ιAC = f(Nernst factors)f(kET)f(ιnstrument factors) These equations can be used to model and predict the expected AC currents in systems which use input signals comprising both AC and DC components As outlined above, traditional theory surprisingly does not model these systems at all, except for very low voltages
In general, non-specifically bound label probes/ETMs show differences in impedance (i e higher impedances) than when the label probes containing the ETMs are specifically bound in the correct orientation In a preferred embodiment, the non-specifically bound material is washed away, resulting in an effective impedance of infinity Thus, AC detection gives several advantages as is generally discussed below, including an increase in sensitivity, and the ability to "filter out" background noise In particular, changes in impedance (including, for example, bulk impedance) as between non-specific binding of ETM-contaming probes and target-specific assay complex formation may be monitored
Accordingly, when using AC initiation and detection methods, the frequency response of the system changes as a result of the presence of the ETM By "frequency response" herein is meant a modification of signals as a result of electron transfer between the electrode and the ETM This modification is different depending on signal frequency A frequency response includes AC currents at one or more frequencies, phase shifts, DC offset voltages, faradaic impedance, etc
Once the assay complex including the target sequence and label probe is made, a first input electrical signal is then applied to the system, preferably via at least the sample electrode (containing the complexes of the invention) and the counter electrode, to initiate electron transfer between the electrode and the ETM Three electrode systems may also be used, with the voltage applied to the reference and working electrodes The first input signal comprises at least an AC component The AC component may be of variable amplitude and frequency Generally, for use in the present methods, the AC amplitude ranges from about 1 mV to about 1 1 V, with from about 10 mV to about 800 mV being preferred, and from about 10 mV to about 500 mV being especially preferred The AC frequency ranges from about 0 01 Hz to about 100 MHz, with from about 10 Hz to about 10 MHz being preferred, and from about 100 Hz to about 20 MHz being especially preferred
The use of combinations of AC and DC signals gives a variety of advantages, including surprising sensitivity and signal maximization
In a preferred embodiment, the first input signal comprises a DC component and an AC component That is, a DC offset voltage between the sample and counter electrodes is swept through the electrochemical potential of the ETM (for example, when ferrocene is used, the sweep is generally from 0 to 500 mV) (or alternatively, the working electrode is grounded and the reference electrode is swept from 0 to -500 mV) The sweep is used to identify the DC voltage at which the maximum response of the system is seen This is generally at or about the electrochemical potential of the ETM Once this voltage is determined, either a sweep or one or more uniform DC offset voltages may be used DC offset voltages of from about -1 V to about +1 1 V are preferred, with from about -500 mV to about +800 mV being especially preferred, and from about -300 mV to about 500 mV being particularly preferred In a preferred embodiment, the DC offset voltage is not zero On top of the DC offset voltage, an AC signal component of variable amplitude and frequency is applied If the ETM is present, and can respond to the AC perturbation, an AC current will be produced due to electron transfer between the electrode and the ETM
For defined systems, it may be sufficient to apply a single input signal to differentiate between the presence and absence of the ETM (i e the presence of the target sequence) nucleic acid Alternatively, a plurality of input signals are applied As outlined herein, this may take a variety of forms, including using multiple frequencies, multiple DC offset voltages, or multiple AC amplitudes, or combinations of any or all of these
Thus, in a preferred embodiment, multiple DC offset voltages are used, although as outlined above, DC voltage sweeps are preferred This may be done at a single frequency, or at two or more frequencies
In a preferred embodiment, the AC amplitude is varied Without being bound by theory, it appears that increasing the amplitude increases the driving force Thus, higher amplitudes, which result in higher overpotentials give faster rates of electron transfer Thus, generally, the same system gives an improved response (i e higher output signals) at any single frequency through the use of higher overpotentials at that frequency Thus, the amplitude may be increased at high frequencies to increase the rate of electron transfer through the system, resulting in greater sensitivity In addition, this may be used, for example, to induce responses in slower systems such as those that do not possess optimal spacing configurations
In a preferred embodiment, measurements of the system are taken at at least two separate amplitudes or overpotentials, with measurements at a plurality of amplitudes being preferred As noted above, changes in response as a result of changes in amplitude may form the basis of identification, calibration and quantification of the system in addition, one or more AC frequencies can be used as well
In a preferred embodiment, the AC frequency is varied At different frequencies, different molecules respond in different ways As will be appreciated by those in the art, increasing the frequency generally increases the output current However, when the frequency is greater than the rate at which electrons may travel between the electrode and the ETM, higher frequencies result in a loss or decrease of output signal At some point, the frequency will be greater than the rate of electron transfer between the ETM and the electrode, and then the output signal will also drop
In one embodiment, detection utilizes a single measurement of output signal at a single frequency
That is, the frequency response of the system in the absence of target sequence, and thus the absence of label probe containing ETMs, can be previously determined to be very low at a particular high frequency Using this information, any response at a particular frequency, will show the presence of the assay complex That is, any response at a particular frequency is characteristic of the assay complex Thus, it may only be necessary to use a single input high frequency, and any changes in frequency response is an indication that the ETM is present, and thus that the target sequence is present
In addition, the use of AC techniques allows the significant reduction of background signals at any single frequency due to entities other than the ETMs, i e "locking out" or "filtering" unwanted signals
That is, the frequency response of a charge carrier or redox active molecule in solution will be limited by its diffusion coefficient and charge transfer coefficient Accordingly, at high frequencies, a charge carrier may not diffuse rapidly enough to transfer its charge to the electrode, and/or the charge transfer kinetics may not be fast enough This is particularly significant in embodiments that do not have good monolayers, i e have partial or insufficient monolayers, i e where the solvent is accessible to the electrode As outlined above, in DC techniques, the presence of "holes" where the electrode is accessible to the solvent can result in solvent charge carriers "short circuiting" the system, i e the reach the electrode and generate background signal However, using the present AC techniques, one or more frequencies can be chosen that prevent a frequency response of one or more charge carriers in solution, whether or not a monolayer is present This is particularly significant since many biological fluids such as blood contain significant amounts of redox active molecules which can interfere with amperometric detection methods
In a preferred embodiment, measurements of the system are taken at at least two separate frequencies, with measurements at a plurality of frequencies being preferred A plurality of frequencies includes a scan For example, measuring the output signal, e g , the AC current, at a low input frequency such as 1 - 20 Hz, and comparing the response to the output signal at high frequency such as 10 - 100 kHz will show a frequency response difference between the presence and absence of the ETM In a preferred embodiment, the frequency response is determined at at least two, preferably at least about five, and more preferably at least about ten frequencies After transmitting the input signal to initiate electron transfer, an output signal is received or detected The presence and magnitude of the output signal will depend on a number of factors, including the overpotential/amphtude of the input signal, the frequency of the input AC signal, the composition of the intervening medium, the DC offset, the environment of the system, the nature of the ETM, the solvent, and the type and concentration of salt At a given input signal, the presence and magnitude of the output signal will depend in general on the presence or absence of the ETM, the placement and distance of the ETM from the surface of the monolayer and the character of the input signal In some embodiments, it may be possible to distinguish between non-specific binding of label probes and the formation of target specific assay complexes containing label probes, on the basis of impedance
In a preferred embodiment, the output signal comprises an AC current As outlined above, the magnitude of the output current will depend on a number of parameters By varying these parameters, the system may be optimized in a number of ways
In general, AC currents generated in the present invention range from about 1 femptoamp to about 1 milhamp, with currents from about 50 femptoamps to about 100 microamps being preferred, and from about 1 picoamp to about 1 microamp being especially preferred
In a preferred embodiment, the output signal is phase shifted in the AC component relative to the input signal Without being bound by theory, it appears that the systems of the present invention may be sufficiently uniform to allow phase-shifting based detection That is, the complex biomolecules of the invention through which electron transfer occurs react to the AC input in a homogeneous manner, similar to standard electronic components, such that a phase shift can be determined This may serve as the basis of detection between the presence and absence of the ETM, and/or differences between the presence of target-specific assay complexes comprising label probes and non-specific binding of the label probes to the system components
The output signal is characteristic of the presence of the ETM, that is, the output signal is characteristic of the presence of the target-specific assay complex comprising label probes and ETMs In a preferred embodiment, the basis of the detection is a difference in the faradaic impedance of the system as a result of the formation of the assay complex Faradaic impedance is the impedance of the system between the electrode and the ETM Faradaic impedance is quite different from the bulk or dielectric impedance, which is the impedance of the bulk solution between the electrodes Many factors may change the faradaic impedance which may not effect the bulk impedance, and vice versa Thus, the assay complexes comprising the nucleic acids in this system have a certain faradaic impedance, that will depend on the distance between the ETM and the electrode, their electronic properties, and the composition of the intervening medium, among other things Of importance in the methods of the invention is that the faradaic impedance between the ETM and the electrode is signficantly different depending on whether the label probes containing the ETMs are specifically or non-specifically bound to the electrode
Accordingly, the present invention further provides apparatus for the detection of nucleic acids using AC detection methods The apparatus includes a test chamber which has at least a first measuring or sample electrode, and a second measuring or counter electrode Three electrode systems are also useful The first and second measuring electrodes are in contact with a test sample receiving region, such that in the presence of a liquid test sample, the two electrodes may be in electrical contact
In a preferred embodiment, the first measuring electrode comprises a single stranded nucleic acid capture probe covalently attached via an attachment linker, and a monolayer comprising conductive oligomers, such as are described herein
The apparatus further comprises an AC voltage source electrically connected to the test chamber, that is, to the measuring electrodes Preferably, the AC voltage source is capable of delivering DC offset voltage as well
In a preferred embodiment, the apparatus further comprises a processor capable of comparing the input signal and the output signal The processor is coupled to the electrodes and configured to receive an output signal, and thus detect the presence of the target nucleic acid
Thus, the compositions of the present invention may be used in a variety of research, clinical, quality control, or field testing settings
In a preferred embodiment, the probes are used in genetic diagnosis For example, probes can be made using the techniques disclosed herein to detect target sequences such as the gene for nonpolyposis colon cancer, the BRCA1 breast cancer gene, P53, which is a gene associated with a variety of cancers, the Apo E4 gene that indicates a greater risk of Alzheimer's disease, allowing for easy presymptomatic screening of patients, mutations in the cystic fibrosis gene, or any of the others well known in the art
In an additional embodiment, viral and bacterial detection is done using the complexes of the invention In this embodiment, probes are designed to detect target sequences from a variety of bacteria and viruses For example, current blood-screening techniques rely on the detection of anti-
HIV antibodies The methods disclosed herein allow for direct screening of clinical samples to detect HIV nucleic acid sequences, particularly highly conserved HIV sequences In addition, this allows direct monitoring of circulating virus within a patient as an improved method of assessing the efficacy of anti-viral therapies Similarly, viruses associated with leukemia, HTLV-I and HTLV-II, may be detected in this way Bacterial infections such as tuberculosis, clymidia and other sexually transmitted diseases, may also be detected, for example using πbosomal RNA (rRNA) as the target sequences
In a preferred embodiment, the nucleic acids of the invention find use as probes for toxic bacteria in the screening of water and food samples For example, samples may be treated to lyse the bacteria to release its nucleic acid (particularly rRNA), and then probes designed to recognize bacterial strains, including, but not limited to, such pathogenic strains as, Salmonella, Campylobacter, Vibrio cholerae, Leishmania, enterotoxic strains of E coli, and Legionnaire's disease bacteria Similarly, bioremediation strategies may be evaluated using the compositions of the invention
In a further embodiment, the probes are used for forensic "DNA fingerprinting" to match crime-scene DNA against samples taken from victims and suspects
In an additional embodiment, the probes in an array are used for sequencing by hybridization
Thus, the present invention provides for extremely specific and sensitive probes, which may, in some embodiments, detect target sequences without removal of unhybndized probe This will be useful in the generation of automated gene probe assays
Alternatively, the compositions of the invention are useful to detect successful gene amplification in PCR, thus allowing successful PCR reactions to be an indication of the presence or absence of a target sequence PCR may be used in this manner in several ways For example, in one embodiment, the PCR reaction is done as is known in the art, and then added to a composition of the invention comprising the target nucleic acid with a ETM, covalently attached to an electrode via a conductive oligomer with subsequent detection of the target sequence Alternatively, PCR is done using nucleotides labelled with a ETM, either in the presence of, or with subsequent addition to, an electrode with a conductive oligomer and a target nucleic acid Binding of the PCR product containing ETMs to the electrode composition will allow detection via electron transfer Finally, the nucleic acid attached to the electrode via a conductive polymer may be one PCR primer, with addition of a second primer labelled with an ETM Elongation results in double stranded nucleic acid with a ETM and electrode covalently attached In this way, the present invention is used for PCR detection of target sequences
In a preferred embodiment, the arrays are used for mRNA detection A preferred embodiment utilizes either capture probes or capture extender probes that hybridize close to the 3' polyadenylation tail of the mRNAs This allows the use of one species of target binding probe for detection, i e the probe contains a poly-T portion that will bind to the poly-A tail of the mRNA target Generally, the probe will contain a second portion, preferably non-poly-T, that will bind to the detection probe (or other probe) This allows one target-binding probe to be made, and thus decreases the amount of different probe synthesis that is done
In a preferred embodiment, the use of restriction enzymes and ligation methods allows the creation of "universal" arrays In this embodiment, monolayers comprising capture probes that comprise restriction endonuclease ends, as is generally depicted in Figure 7 of PCT US97/20014 By utilizing complementary portions of nucleic acid, while leaving "sticky ends", an array comprising any number of restriction endonuclease sites is made Treating a target sample with one or more of these restriction endonucleases allows the targets to bind to the array This can be done without knowing the sequence of the target The target sequences can be ligated, as desired, using standard methods such as hgases, and the target sequence detected, using either standard labels or the methods of the invention
The present invention provides methods which can result in sensitive detection of nucleic acids In a preferred embodiment, less than about 10 X 106 molecules are detected, with less than about 10 X 105 being preferred, less than 10 X 104 being particularly preferred, less than about 10 X 103 being especially preferred, and less than about 10 X 102 being most preferred As will be appreciated by those in the art, this assumes a 1 1 correlation between target sequences and reporter molecules, if more than one reporter molecule (i e electron transfer moeity) is used for each target sequence, the sensitivity will go up
While the limits of detection are currently being evaluated, based on the published electron transfer rate through DNA, which is roughly 1 X 10s electrons/sec/duplex for an 8 base pair separation (see Meade et al , Angw Chem Eng Ed , 34 352 (1995)) and high driving forces, AC frequencies of about 100 kHz should be possible As the preliminary results show, electron transfer through these systems is quite efficient, resulting in nearly 100 X 103 electrons/sec, resulting in potential femptoamp sensitivity for very few molecules
The following examples serve to more fully describe the manner of using the above-described invention, as well as to set forth the best modes contemplated for carrying out various aspects of the invention It is understood that these examples in no way serve to limit the true scope of this invention, but rather are presented for illustrative purposes All references cited herein are incorporated by reference in their entireity EXAMPLES
Example 1
Synthesis of nucleoside modified with ferrocene at the 2' position
The preparation of N6 is described
Compound N1 Ferrocene (20 g, 108 mmol) and 4-bromobutyl chloride (20 g, 108 mmol) were dissolved in 450 mL dichloromethane followed by the addition of AICI3 anhydrous (14 7 g, 11 mmol) The reaction mixture was stirred at room temperature for 1 hour and 40 minutes, then was quenched by addition of 600 mL ice The organic layer was separated and was washed with water until the aqueous layer was close to neutral (pH = 5) The organic layer was dried with Na2S04 and concentrated The crude product was purified by flash chromatography elutmg with 50/50 hexane/dichloromethane and later 30/70 hexane/dichloromethane on 300 g silica gel to afford 26 4 gm (73%) of the title product
Compound N2 Compound N1 (6 g, 18 mmol) was dissolved in 120 mL toluene in a round bottom flask zinc (35 9 g, 55 mmol), mercuric chloride (3 3g, 12 mmol) and water (100 mL) were added successively Then HCI solution (12 M, 80 mL) was added dropwise The reaction mixture was stirred at room temperature for 16 hours The organic layer was separated, and washed with water (2 x 100 mL) and concentrated Further purification by flash chromatography (hexane) on 270 gm of silica gel provided the desired product as a brown solid (3 3 g, 58%)
Compound N3 A mixture of 13 6 gm (51 mmol) of adenosine in 400 mL dry DMF was cooled in a ice-water bath for 10 minutes before the addition of 3 0 gm (76 mmol) of NaH (60%) The reaction mixture was stirred at 0 °C for one hour before addition of Compound N2 (16 4 g, 51 mmol) Then the temperature was slowly raised to 30 °C, and the reaction mixture was kept at this temperature for
4 hours before being quenched by 100 mL ice The solvents were removed in vacuo The resultant gum was dissolved in 300 mL water and 300 mL ethyl acetate The aqueous layer was extracted thoroughly (3 x 300 mL ethyl acetate) The combined organic extracts were concentrated, and the crude product was purified by flash chromatography on 270 g silica gel The column was eluted with
20%ethyl acetate/dichloromethane, 50 % ethyl acetate/dichloromethane, 70 % ethyl acetate/dichloromethane, ethyl acetate, 1 % methanol/ethyl acetate, 3 % methanol/ethyl acetate, and
5 % methanol/ethyl acetate The concentration of the desired fractions provide the final product (6 5 g, 25%)
Compound N4 Compound N3 (6 5 g, 12 8 mmol) was dissolved in 150 mL dry pyridme, followed by adding TMSCI (5 6 g, 51 2 mmol) The reaction mixture was stirred at room temperature for 1 5 hours Then phenoxyacetyl chloride (3 3 g, 19 2 mmol) was added at 0 °C The reaction was then stirred at room temperature for 4 hours and was quenched by the addition of 100 mL water at 0 °C The solvents were removed under reduced pressure, and the crude gum was further purified by flash chromatography on 90 g of silica gel (1 % methanol/dichloromethane) (2 3 g, 28%)
Compound N5. Compound N4 (2 2 g, 3 4 mmol) and DMAP (200 mg, 1 6 mmol) were dissolved in 150 mL dry pyridme, followed by the addition of DMTCI (1 4 g, 4 1 mmol) The reaction was stirred under argon at room temperature overnight The solvent was removed under reduced pressure, and the residue was dissolved in 250 mL dichloromethane The organic solution was washed by 5% NaHC03 solution (3 x 250 mL) , dried over Na2S04, and concentrated Further purification by flash chromatography on 55 g of silica gel (1 % TEA 50% hexane/dichloromethane ) provided the desired product (1 3 g, 41%)
Compound N6 To a solution of N5 ( 3 30 gm, 3 50 mmol) in 150 mL dichloromethane Diisopropylethylamine (4 87 mL, 8 0 eq ) and catalytic amount of DMAP (200 mg) were added The mixture was kept at 0 °C, and N, N-dnsopropylamino cyanoethyl phosphonamidic chloride (2 34 mL, 10 48 mmol) was added The reaction mixture was warmed up and stirred at room temperature overnight After dilution by adding 150 mL of dichloromethane and 250 mL of 5 % NaHC03 aqueous solution, the organic layer was separated, washed with 5% NaHC03 (250 mL), dried over Na2S04, and concentrated The crude product was purified on a flash column of 66 g of silica gel packed with
1 % TEA in hexane The elutmg solvents were 1 % TEA in hexane (500 mL), 1% TEA and 10% dichloromethane in hexane (500 mL), 1% TEA and 20% dichloromethane in hexane (500 mL) 1% TEA and 50% dichloromethane in hexane (500 mL) Fractions containing the desired products were collected and concentrated to afford the final product (3 gm, 75%)
Example 2 Synthesis of "Branched" nucleoside
The synthesis of N17 is described, as depicted in Figure 11 A
Synthesis of N14 To a solution of Tert-butyldimethylsily chloride (33 38 g, 0 22 mol) in 300 mL of dichloromethane was added imidazole (37 69 g, 0 55 mol) Immediately, large amount of precipitate was formed 2-Bromoethanol (27 68 g, 0 22 mol, ) was added slowly at room temperature The reaction mixture was stirred at this temperature for 3 hours The organic layer was washed with water (200 mL), 5% NaHC03 (2 x 250 mL), and water (200 mL) The removal of solvent afforded 52 52 g of the title product (99%) Synthesis of N15 To a suspension of adenosine (40 g, 0 15 mol) in 1 0 L of DMF at O °C, was added NaH (8 98 gm of 60% in mineral oil, 0 22 mol) The mixture was stirred at 0 °C for 1 hour, and N14 (35 79 gm, 0 15mol) was added The reaction was stirred at 30 °C overnight It was quenched by 100 mL ice-water The solvents were removed under high vaccum The resultant foam was dissolved in a mixture of 800 mL of ethyl acetate and 700 mL of water The aqueous layer was further extracted by ethyl acetate ( 3 x 200 mL) The combined organic layer was dried over Na2S04 and concentrated The crude product was further purified on a flash column of 300 g of silica gel packed with 1% TEA in dichloromethane The elutmg solvents were dichloromethane (500 mL), 3% MeOH in dichloromethane (500 mL), 5% MeOH in dichloromethane (500 mL), and 8% MeOH in dichloromethane (2000 mL) The desired fractions were collected and concentrated to afford 11 70 g of the title product (19%)
Synthesis of N16 To a solution of N15 (11 50 gm, 27 17 mmol) in 300 mL dry pyridme cooled at 0°C, was added tnmethylsily chloride (13 71 mL, 0 11 mol, 4 0) The mixture was stirred at 0 °C for 40 mm Phenoxyacetyl chloride (9 38 mL, 67 93 mmol) was added The reaction was stirred at 0 °C for
2 5 h The mixture was then transferred to a mixture of 700 mL of dichloromethane and 500 mL water The mixture was shaken well and organic layer was separated After washing twice with 5% NaHC03 (2 x 300 mL), dichloromethane was removed on a rotovapor Into the residue was added 200 mL of water, the resulting pyridme mixture was stirred at room temperature for 2 hours The solvents were then removed under high vacuum The gum product was co-evaporated with 100 mL of pyridme The residue was dissolved in 250 mL of dry pyridme at 0 °C, and 4, 4'-dιmethoxytrιtyl chloride (11 02 gm, 32 60 mmol) was added The reaction was stirred at room temperature overnight The solution was transferred to a mixture of 700 mL of dichloromethane and 500 mL of 5% NaHC03 After shaking well, the organic layer was separated, further washed with 5% NaHC03 (2 x 200 mL), and then concentrated The crude product was purified on a flash column of 270 gm of silica gel packed with
1 % TEA/30% CH2CI2/Hexane The elutmg solvents were 1 % TEA/ 50% CH2CI2/Hexane (1000 mL), and 1% TEA /CH2CI2 (2000 mL) The fractions containing the desired product were collected and concentrated to afford 10 0 g of the title product (43%)
Synthesis of N17 To asolution of N16 (10 0 gm, 11 60 mmol) in 300 mL dichloromethane
Diisopropylethylamine (16 2 mL) and catalytic amount of N, N-dιmethylamιnopyπdιne(200 mg) were added The mixture was cooled in an ice-water bath, and N, N-diisopropylamino cyanoethyl phosphonamidic chloride (7 78 mL, 34 82 mmol) was added The reaction was stirred at room temperature overnight The reaction mixture was diluted by adding 250 mL of dichloromethane and 250 mL of 5% NaHC03 After shaking well, the organic layer was separated and washed once more with the same amount of 5 % NaHC03 aqueous solution, dried over Na2S04, and concentrated The crude product was purified on a flash column of 120 gm of silica gel packed with 1% TEA and 10% dichloromethane in hexane The elutmg solvents were 1 % TEA and 10% dichloromethane in hexane (500 mL), 1 % TEA and 20% dichloromethane in hexane (500 mL), and 1% TEA and 40% dichloromethane in hexane (1500 mL) The right fractions were collected and concentrated to afford the final product (7 37gm, 60%)
The syntheses for two other nucleotides used for branching are shown in Figures 11 B and 11C, with the Lev protecting group These branching nucleotides branch from the phosphate, rather than the ribose (N17), and appear to give somewhat better results
Example 3
Synthesis of tπphosphate nucleotide containing an ETM
The synthesis of AFTP is described
N3 (1 00 g,1 97 mmol) was dissolved in 15 mL of tπethyl phosphate, followed by adding diisopropylethylamine (0 69 mL, 3 9 mmol) While the mixture was kept at 0 °C, and phospherous oxychloπde (0 45g, 2 93 mmol) was added The reaction mixture was stirred at 0 °C for 4 hours, then at 4 °C overnight Bιs(tπbutyl)ammonιum phosphate (3 24 g, 5 91 mmol ) was added, and the reaction mixture was stirred at 0 °C for six hours, and at 4 °C overnight The white precipitate produced in the reaction was removed by filtration The filtrate was treated with water (20 mL), and yellow precipitate was formed The precipitate was filtrated and was dried under high vacuum to afford 0 63 g of the title product as yellow solid
Example 4 Synthesis of nucleoside with ferrocene attached via a phosphate
The synthesis of Y63 is described
Synthesis of C102ι A reaction mixture consisting of 10 5gm (32 7 mmol) of N2, 16gm of potassium acetate and 350 ml of DMF was stirred at 100°C for 2 5hrs The reaction mixture was allowed to cool to room temperature and then poured into a mixture of 400ml of ether and 800ml of water The mixture was shaken and the organic layer was separated The aqueous layer was extracted twice with ether The combined ether extracts were dried over sodium sulfate and then concentrated for column chromatography Silica gel(160 gm) was packed with 1% TEA/Hexane The crude was loaded and the column was eluted with 1 % TEA/0-100 % CH2CI2/Hexane Fractions containing desired product were collected and concentrated to afford 5 8g (59 1 %) of C102 Synthesis of Y61 : To a flask containing 5 1gm (17 0 mmol) of C102 was added 30ml of Dioxane To this solution, small aliquots of 1 M NaOH was added over a period of 2 5 hours or until hydrolysis was complete After hydrolysis the product was extracted using hexane The combined extracts were dried over sodium sulfate and concentrated for chromatography Silica gel (100 gm) was packed in
10% EtOAc/ Hexane The crude product solution was loaded and the column was eluted with 10% to 50% EtOAc in hexane The fractions containing desired product were pooled and concentrated to afford 4 20 gm (96 1 %) of Y61
Synthesis of Y62: To a flask containing 4 10 gm (15 9 mmol) of Y61 was added 200ml of dichloromethane and 7 72 ml of DIPEA and 4 24 gm (15 9 mmol) of bιs(dιιsopropylamιno) chlorophosphme This reaction mixture was stirred under the presence of argon overnight After the reaction mixture was concentrated to 1/3 of its original volume, 200ml of hexane was added and then the reaction mixture was again concentrated to 1/3 is original volume This procedure was repeated once more The precipitated salts were filtered off and the solution was concentrated to afford 8 24gm of crude Y62 Without further purification, the product was used for next step
Synthesis of Y63: A reaction mixture of 1 0 gm (1 45 mmol) of N-PAC deoxy-adenosine, 1 77g of the crude Y62, and 125mg of N, N-dnsopropylammonium tetrazohde, and 100 ml of dichloromethane The reaction mixture was stirred at room temperature overnight The reaction mixture was then diluted by adding 100ml of CH2CI2 and 100 mL of 5% NaHC03 solution The organic phase was separated and dried over sodium sulfate The solution was then concentrated for column chromatography Silica gel (35 gm) was packed with 1 % TEA /Hexane The crude material was eluted with 1 % TEA /10-40% CH2CI2 / Hexane The fractions containing product were pooled and concentrated to afford 0 25 gm of the title product
Example 5 Synthesis of Ethylene Glycol Terminated Wire W71
Synthesis of W55: To a flask was added 7 5 gm (27 3 mmol) of ferf-butyldiphenylchlorosilane, 25 0 gm (166 5 mmol) of trι(ethylene glycol) and 50 ml of dry DMF under argon The mixture was stirred and cooled in an ice-water bath To the flask was added dropwise a clear solution of 5 1 gm (30 0 mmol) of AgN03 in 80 mL of DMF through an additional funnel After the completeness of addition, the mixture was allowed to warm up to room temperature and was stirred for additional 30 mm Brown AgCI precipitate was filtered out and washed with DMF(3 x 10 mL) The removal of solvent under reduced pressure resulted in formation of thick syrup-hke liquid product that was dissolved in about 80 ml of CH2CI2 The solution was washed with water (6 x 100 mL) in order to remove unreacted starting material, le, tns (ethylene glycol), then dried over Na2S04 Removal of CH2CI2 afforded ~ 10 5 g crude product, which was purified on a column containing 104 g of silica gel packed with 50 % CH2CI2/hexane The column was eluted with 3-5% MeOH/ CH2CI2 The fractions containing the desired product were pooled and concentrated to afford 8 01 gm (75 5 %) of the pure title product
Synthesis of W68: To a flask containing 8 01 gm (20 6 0 mmol) of W55 was added 8 56 gm (25 8 mmol) of CBr4 and 60 ml of CH2CI2 The mixture was stirred in an ice-water bath To the solution was slowly added 8 11 gm (31 0 mmol) of PPh3 in 15 ml CH2CI2 The mixture was stirred for about 35 mm at 0 °C , and allowed to warm to room temperature The volume of the mixture was reduced to about 10 0 ml and 75 ml of ether was added The precipitate was filtered out and washed with 2x75 of ether Removal of ether gave about 15 gm of crude product that was used for purification Silica gel (105 gm) was packed with hexane Upon loading the sample solution, the column was eluted with 50 % CH2CI2/hexane and then CH2CI2 The desired fractions were pooled and concentrated to give 8 56gm (72 0 %) of pure title product
Synthesis of W69: A solution of 5 2 gm (23 6 mmol)of 4-ιodophenol in 50 ml of dry DMF was cooled in an ice-water bath under Ar To the mixture was added 1 0 gm of NaH (60% in mineral oil, 25 0 mmol) portion by portion The mixture was stirred at the same temperature for about 35 mm and at room temperature for 30 mm A solution of 8 68 gm (19 2 mmol) of W68 in 20 ml of DMF was added to the flask under argon The mixture was stirred at 50 °C for 12 hr with the flask covered with aluminum foil DMF was removed under reduced pressure The residue was dissolved in 300 ml of ethyl acetate, and the solution was washed with H20 (6 x 50 mL) Ethyl acetate was removed under reduced pressure and the residue was loaded into a 100 g silica gel column packed with 30 % CH2CI2/hexane for the purification The column was eluted with 30-100% CH2CI2/hexane The fractions containing the desired product were pooled and concentrated to afford 9 5 gm (84 0 %) of the title product
Synthesis of W70: To a 100 ml round bottom flask containing 6 89 gm (11 6 mmol) of W69 was added 30 ml of 1 M TBAF THF solution The solution was stirred at room temperature for 5h THF was removed and the residue was dissolved 150 ml of CH2CI2 The solution was washed with H20 (4 x
25 mL) Removal of solvent gave 10 5 gm of semi-solid Silica gel (65 gm) was packed with 50 % CH2CI2/hexane, upon loading the sample solution, the column was eluted with 0-3 % CH3OH/CH2CI2 The fractions were identified by TLC (CH3OH CH2CI2 = 5 95) The fractions containing the desired product were collected and concentrated to afford 4 10 gm (99 0% ) of the title product
Synthesis of W71 : To a flask was added 1 12 gm (3 18 mmol) of W70, 0 23 g (0 88 mmol) of PPh3, 110 mg (0 19 mmol) of Pd(dba)2, 110 mg (0 57 mmol) of Cul and 0 75g (3 2 mmol) of Y4 (one unit wire) The flask was flushed with argon and then 65 ml of dry DMF was introduced, followed by 25 ml of dnsopropylamine The mixture was stirred at 55 °C for 2 5 h All tsolvents were removed under reduced pressure The residue was dissolved in 100 ml of CH2CI2, and the solution was thoroughly washed with the saturated EDTA solution (2 x 100 mL) The Removal of CH2CI2 gave 2 3 g of crude product Silica gel (30 gm) was packed with 50 % CH2CI2/hexane, upon loading the sample solution, the column was eluted with 10 % ethyl acetate/CH2CI2 The concentration of the fractions containing the desired product gavel 35 gm (2 94 mmol) of the title product, which was further purified by recrystalhzation from hot hexane solution as colorless crystals
Example 6
Synthesis of nucleoside attached to an insulator
Synthesis of C108 To a flask was added 2 Ogm (3 67 mmol) of 2'-amιno-5'-0-DMT undine, 1 63gm (3 81 mmol) of C44, 5ml of TEA and 100ml of dichloromethane This reaction mixture was stirred at room temperature over for 72hrs The solvent was removed and dissolved in a small volume of
CH2CI2 Silica gel (35 gm) was packed with 2% CH3OH/1 % TEA/CH2CI2, upon loading the sample solution, the column was eluted with the same solvent system The fractions containing the desired product were pooled and concentrated to afford 2 5gm ( 80 4 %) of the title product
Synthesis of C109 To a flask was added 24gm ( 2 80 mmol) of C108, 4ml of dnsopropylethylamine and 80ml of CH2CI2 under presence of argon The reaction mixture was cooled in an ice-water bath Once cooled, 2 10 gm (8 83 mmol) of 2-cyanoethyl dnsopropylchloro-phosphoramidite was added The mixture was then stirred overnight The reaction mixture was diluted by adding 10ml of methanol and 150ml of CH2CI2 This mixture was washed with a 5% NaHC03 solution, dried over sodium sulfate and then concentrated for column chromatography A 65gm-sιlιca gel column was packed in 1 % TEA and Hexane The crude product was loaded and the column was eluted with 1 % TEA/ 0-20 % CH2CI2/Hexane The fractions containing the desired product were pooled and concentrated to afford 2 69gm (90 9 %) of the title product
Example 7
Comparison of Different ETM Attachments
A variety of different ETM attachments as depicted in Figure 1 were compared As shown in Table 1 , a detection probe was attached to the electrode surface (the sequence containing the wire in the table) Positive (i e probes complementary to the detection probe) and negative (i e probes not complementary to the detection probe) control label probes were added Electrodes containing the different compositions of the invention were made and used in AC detection methods The experiments were run as follows A DC offset voltage between the working (sample) electrode and the reference electrode was swept through the electrochemical potential of the ferrocene, typically from 0 to 500 mV On top of the DC offset, an AC signal of variable amplitude and frequency was applied The AC current at the excitation frequency was plotted versus the DC offset
The results are shown in Table 2, with the Y63, VI and IV compounds showing the best results
Figure imgf000095_0001
Not clear There is no difference between positive control and negative control
ND Not determined
Table of the Oligonucleotides Containing Different Metal Complexes
Figure imgf000095_0002
Figure imgf000096_0001
Example 8 Preferred Embodiments of the Invention
A variety of systems have been run and shown to work well, as outlined below. All compounds are referenced in Figure 19. Generally, the systems were run as follows. The surfaces were made, comprising the electrode, the capture probe attached via an attachment linker, the conductive oligomers, and the insulators, as outlined above. The other components of the system, including the target sequences, the capture extender probes, and the label probes, were mixed and generally annealed at 90°C for 5 minutes, and allowed to cool to room temperature for an hour The mixtures were then added to the electrodes, and AC detection was done
Use of a capture probe, a capture extender probe, an unlabeled target sequence and a label probe A capture probe D112, comprising a 25 base sequence, was mixed with the Y5 conductive oligomer and the
M44 insulator at a ratio of 2 2 1 using the methods of Example 16 A capture extender probe D179, comprising a 24 base sequence perfectly complementary to the D112 capture probe, and a 24 base sequence perfectly complementary to the 2tar target, separated by a single base, was added, with the 2tar target The D179 molecule carries a ferrocene (using a C15 linkage to the base) at the end that is closest to the electrode When the attachment linkers are conductive oligomers, the use of an ETM at or near this position allows verification that the D179 molecule is present A ferrocene at this position has a different redox potential than the ETMs used for detection A label probe D309 (dendnmer) was added, comprising a 18 base sequence perfectly complementary to a portion of the target sequence, a 13 base sequence linker and four ferrocenes attached using a branching configuration A representative scan is shown in Figure 20A When the 2tar target was not added, a representative scan is shown in Figure 20B
Use of a capture probe and a labeled target sequence
Example A A capture probe D94 was added with the Y5 and M44 conductive oligomer at a 2 2 1 ratio with the total thiol concentration being 833 μM on the electrode surface, as outlined above A target sequence (D336) comprising a 15 base sequence perfectly complementary to the D94 capture probe, a 14 base linker sequence, and 6 ferrocenes linked via the N6 compound was used A representative scan is shown in Figure 20C The use of a different capture probe, D109, that does not have homology with the target sequence, served as the negative control, a representative scan is shown in Figure 20D
Example B A capture probe D94 was added with the Y5 and M44 conductive oligomer at a 2 2 1 ratio with the total thiol concentration being 833 μM on the electrode surface, as outlined above A target sequence (D429) comprising a 15 base sequence perfectly complementary to the D94 capture probe, a C131 ethylene glycol linker hooked to 6 ferrocenes linked via the N6 compound was used A representative scan is shown in Figure 20E The use of a different capture probe, D109, that does not have homology with the target sequence, served as the negative control, a representative scan is shown in Figure 20F
Use of a capture probe, a capture extender probe, an unlabeled target sequence and two label probes with long linkers between the target binding sequence and the ETMs
The capture probe D112, Y5 conductive oligomer, the M44 insulator, and capture extender probe D179 were as outlined above Two label probes were added D295 comprising an 18 base sequence perfectly complementary to a portion of the target sequence, a 15 base sequence linker and six ferrocenes attached using the N6 linkage depicted in Figure 23 D297 is the same, except that it's 18 base sequence hybridizes to a different portion of the target sequence A representative scan is shown in Figure 20G When the 2tar target was not added, a representative scan is shown in Figure 20H
Use of a capture probe, a capture extender probe, an unlabeled target sequence and two label probes with short linkers between the target binding sequence and the ETMs
The capture probe D112, Y5 conductive oligomer, the M44 insulator, and capture extender probe D179 were as outlined above Two label probes were added D296 comprising an 18 base sequence perfectly complementary to a portion of the target sequence, a 5 base sequence linker and six ferrocenes attached using the N6 linkage depicted in Figure 23 D298 is the same, except that it's 18 base sequence hybridizes to a different portion of the target sequence A representative scan is shown in Figure 201 When the 2tar target was not added, a representative scan is shown in Figure 20J
Use of two capture probes, two capture capture extender probes, an unlabeled large target sequence and two label probes with long linkers between the target binding sequence and the ETMs This test was directed to the detection of rRNA The Y5 conductive oligomer, the M44 insulator, and one surface probe D350 that was complementary to 2 capture sequences D417 and EU1 were used as outlined herein The D350, Y5 and M44 was added at a 0.5:4.5:1 ratio Two capture extender probes were used, D417 that has 16 bases complementary to the D350 capture probe and 21 bases complementary to the target sequence, and EU1 that has 16 bases complementary to the D350 capture probe and 23 bases complementary to a different portion of the target sequence Two label probes were added D468 comprising a 30 base sequence perfectly complementary to a portion of the target sequence, a linker comprising three glen linkers as shown in Figure 42 (comprising polyethylene glycol) and six ferrocenes attached using the N6 linkage depicted in Figure 23 D449 is the same, except that it's 28 base sequence hybridizes to a different portion of the target sequence, and the polyethylene glycol linker used (C131) is shorter A representative scan is shown in Figure 20K
Use of a capture probe, an unlabeled target, and a label probe
These two examples are shown in Figures 26A and 26B
Example A A capture probe D112, Y5 conductive oligomer and the M44 insulator were put on the electrode at 2 2 1 ratio with the total thiol concentration being 833 μM A target sequence MT1 was added, that comprises a sequence complementary to D112 and a 20 base sequence complementary to the label probe D358 were combined, in this case, the label probe D358 was added to the target sequence prior to the introduction to the electrode The label probe contains si ferrocenes attached using the N6 linkages depicted in Figure 23 A representative scan is shown in Figure 20L The replacment of MT1 with NC112 which is not complementary to the capture probe resulted in no signal, similarly, the removal of MT1 resulted in no signal Example B A capture probe D334, Y5 conductive oligomer and the M44 insulator were put on the electrode at 2 2 1 ratio with the total thiol concentration being 833 μM A target sequence LP280 was added, that comprises a sequence complementary to the capture probe and a 20 base sequence complementary to the label probe D335 were combined, in this case, the label probe D335 was added to the target prior to introduction to the electrode The label probe contains six ferrocenes attached using the N6 linkages depicted in Figure 23 A representative scan is shown in Figure 20M Replacing LP280 with the LN280 probe (which is complementary to the label probe but not the capture probe) resulted in no signal
Example 9 Monitoring of PCR reactions using the invention
Monitoring of PCR reactions was done using an HIV sequence as the target sequence Multiple reactions were run and stopped at 0 to 30 or 50 cycles In this case, the sense primer contained the ETMs (using the N6 linkage described herein), although as will be appreciated by those in the art, tπphosphate nucleotides containing ETMs could be used to label non-primer sequences The surface probe was designed to hybridize to 16 nucleotides of non-primer sequences, immediately adjacent to the primer sequence, that is, the labeled primer sequence will not bind to the surface probe Thus, only if amplification has occured, such that the amplified sequence will bind to the surface probe, will the detection of the adjacent ETMs proceed
The target sequence in this case was the plasmid pBKBHIOS (NIH AIDS Research and Reference Reagent program - McKesson Bioservices, Rockville MD) which contains an 8 9 kb Sstl fragment of pBH10-R3 dervied from the HXB2 clone which contains the entire HIV-1 genome and has the Genbank accession code K03455 or M38432) inserted into the Sstl site on pBluescπpt ll-KS(+) The insert is oriented such that transcription from the T7 promoter produces sense RNA
The "sense" primer, D353, was as follows 5'-(N6)A(N6)AGGGCTGTTGGAAATGTGG-3' The "antisense" primer, D351, was as follows 5'-TGTTGGCTCTGGTCTGCTCTGA-3' The following is the expected PCR product of the reaction, comprising 140 bp
5'-(N6)A(N6)AGGGCTGTTGGAAATGTGGAAAGGAAGGACACCAAATGAAGATTGTACTGAGAGACAGGCT 3'-TTTTTCCCGACMCCTTTACACCTTTCCTTCCTGTGGTTTACTTTCTAACATGACTCTCTGTCCGA
AAI I I I I lAGGGAAGATCTGGCCTTCCTACAAGGGAAGGCCAGGGAATTTTCTTCAGAGCAGACCAGAGC TTAAAAAATCCCTTCTAGACCGGAAGGATGTTCCCTTCCGGTCCCTTAAAAGAAGTCTCGTCTGGTCTCG
CAACA-3'
GTTTG-5' The surface capture probe (without any overlap to the sense primer) D459 was as follows 5'- TTGGTGTCCTTCCTTU-4 unit wιre(C11)-3'
PCR reaction conditions were standard TAQ polymerase at TAQ 10X buffer 1 μM of the primers was added to either 6 X 103, 6X 106 or 6 X 107 molecules of template The reaction conditions were 90°C for 30 sec, 57°C for 30 sec, and 70°C for 1 minute
The electrodes were prepared by melting 0 127 mm diamter pure gold wire on one end to form a ball The electrodes were dipped in aqua regia for 20 seconds and tehn rinse with water The SAM was deposited by dipping the electrode into a deposition solution of 1 34 0 7 D459 H6 M44 in 37 39 24 THF ACN water at 1 mM total thiol which was heated at 50°C for five minutes prior to the introduction of the electrodes The electrodes were added and then removed immediately to room temperature to sit for 15 minutes Electrodes were then transferred to M44 (in 37 39 24 THF ACN water at 400 μM total thiol concentration) The electrodes sat in M44 at room tern for 5 minutes, then the following heat cycling was applied 70°C for 1 minute, followed by 55°C for 30 sec, repeating this cycle 2 more times followed by a 0 3 °C ramp down to RT with soaking at RT for 10 minutes The electrodes were taken out of M44 solution, rinsed in 2XSSC, and hybridized as follows The PCR products were adjusted to 6XSSC (no FCS) The control was also adjusted to 6XSSC Hybridization was carried out at RT after rinsing twice in 6XSSC for at least 1 5 hours ACV conditions were as follows Ag/AgCI reference electrode and Pt auxiliary electrodes were used, and NaCI04 was used as the electrolyte solution ACV measurements were carried out as follows v=10 Hz, e=25 mV, scan range -100 mV to 500 mV The data is shown in Figure 27
Example 10 Ligation on an Electrode Surface
The design of the experiment is shown in Figure 21 , for the detection of an HIV sequence Basically, a surface probe D368 (5'-(H2)CCTTCCTTTCCACAU-4 unit wιre(C11)-3') was attached to an electrode comprising M44 and H6 (H6 is a two unit wire terminating in an acetylene bond) at a ratio of D368 H6:M44 of 1 4 1 with a total thiol concentration of 833 μM A ligation probe HIVLIG (5'-CCACCAGATCTTCCCTAA AAAATTAGCCTGTCTCTCAGTACAATCTTTCATTTGGTGT-3') and the target sequence HIVCOMP (5'-
ATGTGGAAAGAAAGGACACC TTGAMGATTGTACTGAGAGACAGGCTAATTTTTTAGGGAAGATCTGG- 3') was added, with hgase and the reaction allowed to proceed The reaction conditions were as follows 10 μM of HIVLIG annealed to HIVCOMP were hybridized to the electrode surface (in 6XSSC) for 80 m The surface was rinsed in gase buffer The gase (T4) and buffer were added and incubated for 2 hours at RT Triton X at 10"4 M was added at 70°C to allow the denaturation of the newly formed hybridization complex, resulting in the newly formed long surface probe (comprising D368 ligated to the HIVLIG probe) The addition of the D456 signalling probe (5'-(N6)G(N6)CT(N60C(N60G(N6)C(N6)TTCTGCACCGTAAGCCA TCAAAGATTGTACTGAG-3') allowed detection (results not shown) The D456 probe was designed such that it hybridizes to the HIVLIG probe, that is, a surface probe that was not ligated would not allow detection
Example 11 Use of capture probes comprising ethylene glycol linkers
The capture probe for a rRNA assay containing 0, 4 and 8 ethylene glycol units was tested on four separate electrode surfaces Surface 1 contained 2 1 ratio of H6 M44, with a total thiol concentration of 500 μM Surface 2 contained a 2 2 1 ratio of D568/H6/M44 with a total thiol concentration of 833 μM Surface 3 contained a 2 2 1 ratio of D570/H6/M44 with a total thiol concentration of 833 μM D568 was a capture probe comprising 5'-GTC AAT GAG CAA AGG TAT TAA (P282)-3' P282 was a thiol D569 was a capture probe comprising 4 ethylene glycol units 5'-GTC AAT GAG CAA AGG TAT TAA (C131) (P282)-3' D570 was a capture probe comprising 8 ethylene glycol units 5'-GTC AAT GAG CAA AGG TAT TAA (C131) (C131) (P282)-3' The H6 (in the protected form) was as follows (CH3)3SI-(CH2)2-S-(C6H5)-CΞC-(C6H5)-C5CH M44 is the same as M43 and was as follows HS-(CH2)I (0CH2CH3)3-0H The D483 label probe hybridizes to a second portion of the rRNA target, and was as follows 5'-(N6)C(N6) G(N6C (N6)GG CCT (N6)C(N6) G(N6)C (N6)(C131 )(C131) (C131 )(C131 )T TAA TAC CTT TGC TC-3' The D495 is a negative control and was as follows 5'-GAC CAG CTA GGG ATC GTC GCC TAG GTGAG(C131) (C131)(C131 )(C131) (N6)G(N6) CT(N6) C(N6)G (N6)C(N6)-3' The results were as follows
Surface 1 D483 ~0 (no capture probe present)
D495 0
Surface 2 D483 126 nA
D495 1 29 nA
Surface 3 D483 19 39 nA
D495 1 51 nA
Surface 4 D483 84 nA
D495 1 97 nA
As is shown, the system is working well
Example 12 Detection of rRNA and a Comparison of Different Amounts of ETMs
The most sensitive rRNA detection to date used D350/H6/M44 surfaces mixed in a ration of 1 3 5 1 5 deposited at a 833 μM total thiol concentration D350 is a 4 unit wire with a 15mer DNA, H6 is a 2 unit wire, and M44 is an ethylene glycol terminated alkane chain Better detection hmites are seen when the target molecule is tethered to the sensor surface at more than one place To date, two tether points have been used A D417 tether sequence (42mer) and a EU1 capture sequence (62mer) bound the 16S rRNA to the D350 on the surface A series of 9 label probes (D449, D469, D489, D490, D491, D476, D475 and D477) pre- annealed to the rRNA gave the electrochemical signal These label probes (signalling molecules) have 6 or 8 N6 or Y63 type ferrocenes The label probes that flank the tack-down regions were replaced (one end at a time) with label probes containing either 20 or 40 ferrocenes Additionally, a label probe that binds to a region in the middle of the tack-down regions was replaced with label probes containing either 20 or 40 ferrocenes When 2 6-ferrocene containing label probes were replaced by 2 40-ferrocene containing label probes, there was a 12-fold increase in the positive signal The non-specific signal went up as well, exhibiting a 1 5 increase in the signal to noise ratio Currently the best system utilizes tacking down the rRNA in two places and used a 40-ferrocene label probe to flank the 3' tack down point and bind the remaining face of the rRNA molecule with
6-ferrocene containing label probes Additional tack down points, and a plurality of label probes, is contemplated
A typical experimental protocol is as follows
Surface deπvatization 20 μL of deposition solution (1 3 5 1 5 of D350 H6 M44 at total thiol concentration of 833 μM in 43 2% THF, 45 9% ACN, 10 9 % H20) was heated in a closed half milliliter eppendorf tube at 50°C for 5 minutes A meited gold bail electrode was inserted into the solution and then moved immediately to room temperature to incubate for 15 minutes The electrode was then transferred into ~200 μL of 400 μM M44 in 37% TH, 39% ACN, 24% H20, where it incubated for 5 minutes at room temperature, 2 minutes at 40°C, 2 minutes at 30°C, and then an additional 15 minutes at room temperature The electrode was then briefly dipped in 2X SSC (aqueous buffered salt solution) and hybridized as below
Hybridization solutions were annealed by heating at 70°C for 30 seconds and then cooling to 22°C over ~ 38 seconds The molecules were all in 4X SSC at twice the targeted concentrations, with the rRNA at 35 U S C § μM, the capture sequence at 1 0 μM, and the label probes at 3 μM After annealing, the solution was diluted 1 1 with fetal calf serum, halving the concentrations and changing the solvent to 2X SSC with 50% FCS It should be noted that a recent experiment with model compounds suggest that a dilution by 1 2 with bovine serum albumin may be desirable the reduction in non-specific binding was the same, but the sample concentration is not diluted and the positive signal was enhanced by a factor of 1 5 This was not done using the rRNA target, however Solutions were a quotted into 20 μL volumes for hybridization
Hybridization was done as follows After the 2X SSC dip described above, the derivatized electrode was placed into an eppendorf tube with 20 μL hybridization solution It was allowed to hybridize at room temperature for 10 minutes Immediately before measurement, the electrode was briefly dipped in room temperature 2X SSC It was then transferred into the 1 M NaCI04 electrolyte and an alternating current voltammogram was taken with an applied alternating current of 10 Hz frequency and a 25 mV center-to-peak amplitude
10 basic experiments were run (system components in parentheses)
System 1 rRNA is tacked down at only one point (D449 + D417(EU2) + D468
System 2 rRNA is tacked down at two points
System 3 two point tack down plus two label probes comprising 20 ferrocenes each directed to a flanking region of the second tack down point
System 4 two point tack down plus two label probes comprising 40 ferrocenes each directed to a flanking region of the second tack down point
System 5 two point tack down plus two label probes comprising 20 ferrocenes each directed to a flanking region of the first tack down point
System 6 two point tack down plus two label probes comprising 40 ferrocenes each directed to a flanking region of the first tack down point
System 7 two point tack down plus a label probe comprising 25 bases that binds to the middle region (i e the region between the two tack down points) containing 20 ferrocenes
System 8 two point tack down plus a label probe comprising 25 bases that binds to the middle region (i e the region between the two tack down points) containing 40 ferrocenes
System 9 two point tack down plus a label probe comprising 40 bases that binds to the middle region (i e the region between the two tack down points) containing 20 ferrocenes
System 10 two point tack down plus a label probe comprising 40 bases that binds to the middle region (i e the region between the two tack down points) containing 40 ferrocenes
The results are shown in Figure 23 It is clear from the results that multipoint tethering of large targets is better than single point tethering More ETMs give larger signals, but require more binding energy, 35 bases of recognition to the target Example 13 Direct Comparison of Different Configurations of Ferrocenes
A comparison of different configurations of ferrocene was done, as is generally depicted in Figure 24 Figures 24A, 24B, 24C and 24D schematically depict the orientation of several label probes D94 was as follows 5'-
ACC ATG CAC ACA GA(C11 )-3' D109 was as follows 5'-CTG CGG TTA TTA AC(C11)-3' The "+" surface was a 2 2 1 ratio of D94:H6:M44, with a total thiol concentration of 833 μM The "-" surface was a 2 2 1 ratio of D109:H6:M44, with a total thiol concentration of 833 μM The D548 structure was as follows 5'- (N38)(N38)(N38) (N38)(N38)(N38) (N38)(N38)(N38) ATC TGT GTC CAT GGT-3' On each N38 was a 5'- (H2)(C23)-3' *WHAT IS H2 AND C23? The D549 structure was as follows 5'-(N38)(N38)(N38)
(N38)(N38)(N38) (N38)(N38)(N38) ATC TGT GTC CAT GGT-3' On each N38 was a 5'-(H2)(C23nC23)-3' The D550 structure was as follows 5'-(N38)(N38)(N38) (N38) AT CTG TGT CCA TGG T-3' On each N38 was a 5'-(H2)(C23)(C23)-3' The D551 structure was as follows 5'-(n38)(N38)(N38) (N38)ATCTG TGT CAA TGG T-3' On each N38 was a 5'-(H2)(C23)(C23)(C23)(C23)-3' A 5' N38 has two sites for secondary modification A representative schematic is shown in Figure 24E
The results, shown in Figure 24F, show that the D551 label probes gave the highest signals, with excellent signal-to-noise ratios
Example 17
Ferrocene polymers as both recruitment linker and ETM
This system is shown in Figure 25 D405 has the structure 5'-(C23)(C23)(C23) (C23)(C23)(C23) (C23)(C23)(C23) (C23)AT CTG TGT CCA TGG T-3' The system was run with two surfaces the "+" surface was a 2 2 1 ratio of D94:H6:M44, with a total thiol concentration of 833 μM The "-" surface was a 2 2 1 ratio of D109:H6:M44, with a total thiol concentration of 833 μM The results, shown in Figure 25B, show that the system gave a good signal in the presence of a complementary capture probe

Claims

CLAIMS We claim
1 A composition comprising a) an electrode comprising i) a monolayer comprising conductive oligomers, and n) a capture probe, b) a target sequence comprising a first portion that is capable of hybridizing to said capture probe, and a second portion that does not hybridize to said capture probe and comprises at least one covalently attached electron transfer moiety
2 A composition comprising a) an electrode comprising i) a monolayer comprising conductive oligomers, and II) a capture probe, b) a label probe comprising a first portion that is capable of hybridizing to a component of an assay complex, and a second portion comprising a recruitment linker that does not hybridize to a component of an assay complex and comprises at least one covalently attached electron transfer moiety
3 A composition according to claim 2 wherein said ETM is ferrocene
4 A composition according to claim 2 wherein said label probe comprises a plurality of ETMs
5 A composition according to claim 2 wherein said first portion of said label probe further comprises a covalently attached ETM
6 A composition according to claim 2 wherein said assay complex comprises an amplifier probe
7 A composition according to claim 2 wherein said assay complex comprises a capture extender probe
8 A composition according to claim 2 wherein said monolayer further comprises insulators
9 A composition according to claim 2 wherein said capture probe is attached to said electrode via a conductive oligomer
10 A composition according to claim 2 wherein said capture probe is attached to said electrode via an insulator 11 A nucleic acid analog having a backbone comprising at least one metallocene
12 A first nucleic acid covalently attached to a second nucleic acid via a metallocene
13 A substituted metallocene comprising two aromatic rings, wherein the first aromatic ring has a first nucleic acid subtituent group and the second aromatic r g has a second nucleic acid substitutent group
14 A composition comprising a phosphoramidite electron transfer moiety having the formula
PG o
-AROMATJC RING
M
Z AROMATIC RING
O
H ,CH -
NCH 2CH 2C - -N -
-CH
\.
CH CH ,
H3C ./ V CH , wherein
PG is a protecting group,
Z is a linker,
M is a metal ion
15 A composition according to claim 14 wherein said ETM is a metallocene
16 A composition according to claim 15 having the formula
Figure imgf000106_0001
17 A deoxyπbonucleoside tπphosphate comprising a covalently attached ETM 18 A deoxynbonucleoside tnphosphate according to claim 17 wherein said ETM is covalently attached to the base
19 A deoxynbonucleoside tnphosphate according to claim 17 having the formula
Figure imgf000107_0001
wherein
Z is a linker, and
ETM is an electron transfer moiety
20 A deoxynbonucleoside tnphosphate according to claim 19 wherein said base is selected from the group consisting of adenine, uracil, thymine, cytosme, guanine, inosine, xathanine, hypoxathanine, isocytosine and isoguanme
21 A deoxynbonucleoside tnphosphate according to claim 17 wherein said ETM is covalently attached to the ribose
22 A deoxynbonucleoside tnphosphate according to claim 21 having the formula
Figure imgf000107_0002
wherein
Z is a linker, and
ETM is an electron transfer moiety
23 A deoxynbonucleoside tnphosphate according to claim 17 wherein said ETM is ferrocene
24 A nucleic acid comprising a) at least one ETM, and b) at eaεt one branch point
25 A nucleic acid comprising a) an ETM polymer, and b) at least one branch point
26 A nucleic acid according to claim 25 wherein said ETM polymer is a metallocene polymer
27 A nucleic acid according to claim 25 wherein said ETM polymer is a ferrocene polymer
28 A method of detecting a target nucleic acid sequence in a test sample comprising a) attaching said target sequence to an electrode comprising a monolayer of conductive oligomers, b) directly or indirectly attaching at least one label probe to said target sequence to form an assay complex, wherein said label probe comprises a first portion capable of hybridizing to a component of said assay complex, and a second portion comprising a recruitment linker that does not hybridize to a component of said assay complex and comprises at least one covalently attached ETM, and c) detecting the presence of said ETM using said electrode
29 A method according to claim 28 wherein said label probe comprises a plurality of ETMs
30 A method according to claim 28 wherein said plurality comprises a metallocene polymer
31 A method according to claim 28 wherein said label probe comprises a branch point
32 A method according to claim 28 wherein said target sequence is attached to said electrode by hybridization to a capture probe
33 A method according to claim 28 wherein said target sequence is attached to said electrode by hybridizing a first portion of said target sequence to a first capture extender probe, and hybridizing a second portion of said first capture extender probe to a capture probe on the electrode
34 A method according to claim 28 wherein said target sequence is attached to said electrode by a) hybridizing a first portion of said target sequence to a first portion of a first capture extender probe, b) hybridizing a second portion of said first capture extender probe to a first portion of an capture probe on the electrode, c) hybridizing a second portion of said target sequence to a first portion of a second capture extender probe, and d) hybridizing a second portion of said second capture extender probe to a second portion of said capture probe
35 A method according to claim 28 wherein said label probe is attached to said target sequence by hybridizing said first portion of said label probe to a first portion of said target sequence
36 A method according to claim 28 wherein said label probe is attached to said target sequence by a) hybridizing a first portion of an amplifier probe to a first portion of said target sequence, and b) hybridizing at least one amplication sequence of said amplifier probe to said first portion of at least one label probe
37 A method according to claim 28 wherein said label probe is attached to said target sequence by a) hybridizing a first portion of a first label extender probe to a first portion of a target sequence, b) hybridizing a second portion of said first label extender probe to a first portion of an amplifier probe, c) hybridizing at least one amplication sequence of said amplifier probe to said first portion of at least one label probe
38 A method according to claim 28 wherein said label probe is attached to said target sequence by a) hybridizing a first portion of a first label extender probe to a first portion of a target sequence, b) hybridizing a second portion of said first label extender probe to a first portion of an amplifier probe, c) hybridizing a first portion of a second label extender probe to a second portion of a target sequence, d) hybridizing a second portion of said second label extender probe to a first portion of an amplifier probe, e) hybridizing at least one amplication sequence of said amplifier probe to said first portion of at least one label probe
PCT/US1999/001703 1998-05-06 1999-01-27 Electronic detection of nucleic acids using monolayers WO1999057319A1 (en)

Priority Applications (5)

Application Number Priority Date Filing Date Title
JP2000547270A JP2002513592A (en) 1998-05-06 1999-01-27 Electronic detection of nucleic acids using a monolayer
AU24735/99A AU765597B2 (en) 1998-05-06 1999-01-27 Electronic detection of nucleic acids using monolayers
EP99904314A EP1075541A1 (en) 1998-05-06 1999-01-27 Electronic detection of nucleic acids using monolayers
CA002327525A CA2327525A1 (en) 1998-05-06 1999-01-27 Electronic detection of nucleic acids using monolayers
AU2003271352A AU2003271352A1 (en) 1998-05-06 2003-12-24 Electronic detection of nucleic acids using monolayers

Applications Claiming Priority (6)

Application Number Priority Date Filing Date Title
US8442598P 1998-05-06 1998-05-06
US8450998P 1998-05-06 1998-05-06
US60/084,425 1998-05-06
US60/084,509 1998-05-06
US13518398A 1998-08-17 1998-08-17
US09/135,183 1998-08-17

Publications (1)

Publication Number Publication Date
WO1999057319A1 true WO1999057319A1 (en) 1999-11-11

Family

ID=27374777

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1999/001703 WO1999057319A1 (en) 1998-05-06 1999-01-27 Electronic detection of nucleic acids using monolayers

Country Status (5)

Country Link
EP (1) EP1075541A1 (en)
JP (1) JP2002513592A (en)
AU (1) AU765597B2 (en)
CA (1) CA2327525A1 (en)
WO (1) WO1999057319A1 (en)

Cited By (21)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001007665A2 (en) * 1999-07-26 2001-02-01 Clinical Micro Sensors, Inc. Sequence determination of nucleic acids using electronic detection
WO2001035100A2 (en) * 1999-11-12 2001-05-17 Clinical Micro Sensors, Inc. Binding acceleration techniques for the detection of analytes
WO2001042508A2 (en) * 1999-12-09 2001-06-14 Motorola, Inc. Methods and compositions relating to electrical detection of nucleic acid reactions
WO2002020838A2 (en) * 2000-09-04 2002-03-14 Yissum Research Development Company Of The Hebrew University Of Jerusalem Method and system for detecting nucleic acids
US6495323B1 (en) 1996-11-05 2002-12-17 Clinical Micro Sensors, Inc. AC methods for the detection of nucleic acids
US6518024B2 (en) 1999-12-13 2003-02-11 Motorola, Inc. Electrochemical detection of single base extension
US6528266B2 (en) 1993-12-10 2003-03-04 California Institute Of Technology Nucleic acid mediated electron transfer
WO2003018834A2 (en) 2001-08-25 2003-03-06 Friz Biochem Gmbh Displacement assay for the detection of nucleic acid oligomer hybridization events
WO2003019194A2 (en) * 2001-08-25 2003-03-06 Friz Biochem Gmbh Displacement assay for detecting ligate-ligand association events
US6600026B1 (en) 1998-05-06 2003-07-29 Clinical Micro Sensors, Inc. Electronic methods for the detection of analytes utilizing monolayers
US6740518B1 (en) 1998-09-17 2004-05-25 Clinical Micro Sensors, Inc. Signal detection techniques for the detection of analytes
WO2004050231A2 (en) * 2002-11-29 2004-06-17 Aarhus Universitet (bio) organic oligomers for the preparation of macromolecules
US6753143B2 (en) 2000-05-01 2004-06-22 Clinical Micro Sensors, Inc. Target analyte detection using asymmetrical self-assembled monolayers
US6824669B1 (en) 2000-02-17 2004-11-30 Motorola, Inc. Protein and peptide sensors using electrical detection methods
EP1527194A2 (en) * 2001-04-03 2005-05-04 Clinical Micro Sensors, Inc. Nucleic acid reactions using labels with different redox potentials
JP2005517709A (en) * 2002-02-14 2005-06-16 ベーイーオー・メリュー Bifunctional metallocene, process for its production and use in the labeling of biological molecules
US8012743B2 (en) 1998-10-27 2011-09-06 Osmetech Technology Inc. Detection of target analytes using particles and electrodes
US8329011B2 (en) 2006-06-20 2012-12-11 Canon Kabushiki Kaisha Polymerase-immobilized electrode
WO2014066704A1 (en) 2012-10-24 2014-05-01 Genmark Diagnostics, Inc. Integrated multiplex target analysis
US9127308B2 (en) 2002-03-07 2015-09-08 Atlas Genetics Limited Nucleic acid probes, their synthesis and use
US12005074B2 (en) 2023-05-03 2024-06-11 Alnylam Pharmaceuticals, Inc. Extrahepatic delivery

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2006182757A (en) * 2004-10-06 2006-07-13 Japan Science & Technology Agency METHOD OF DETECTING COMPLEMENTARY STRAND NUCLEIC ACID MOLECULE SEQUENCE AND METHOD OF DETECTING SNP USING pi-CONJUGATION TYPE ELECTROCHEMICALLY ACTIVE NONNATURAL NUCLEOSIDE
JP4942192B2 (en) * 2006-06-20 2012-05-30 キヤノン株式会社 Polymerase immobilized electrode
JP7158969B2 (en) * 2018-09-18 2022-10-24 株式会社東芝 Organic probes and molecular detectors

Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1986005815A1 (en) * 1985-03-25 1986-10-09 Genetics International Inc. Nucleic acid sequences attached to materials sensitive to magnetic fields, and methods of assay and apparatus using such attached sequences.
WO1993022678A2 (en) * 1992-04-23 1993-11-11 Massachusetts Institute Of Technology Optical and electrical methods and apparatus for molecule detection
WO1997009337A1 (en) * 1995-09-07 1997-03-13 Deutsches Krebsforschungszentrum Stiftung des öffentlichen Rechts Metallocene-phosphoramidite conjugates, process for their preparation and their use
JPH09288080A (en) * 1996-04-24 1997-11-04 Shinnitsuka Kankyo Eng:Kk Electrochemical detection method of gene and apparatus therefor
WO1998020162A2 (en) * 1996-11-05 1998-05-14 Clinical Micro Sensors Electrodes linked via conductive oligomers to nucleic acids
WO1998031839A2 (en) * 1997-01-21 1998-07-23 President And Fellows Of Harvard College Electronic-property probing of biological molecules at surfaces

Patent Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1986005815A1 (en) * 1985-03-25 1986-10-09 Genetics International Inc. Nucleic acid sequences attached to materials sensitive to magnetic fields, and methods of assay and apparatus using such attached sequences.
WO1993022678A2 (en) * 1992-04-23 1993-11-11 Massachusetts Institute Of Technology Optical and electrical methods and apparatus for molecule detection
WO1997009337A1 (en) * 1995-09-07 1997-03-13 Deutsches Krebsforschungszentrum Stiftung des öffentlichen Rechts Metallocene-phosphoramidite conjugates, process for their preparation and their use
JPH09288080A (en) * 1996-04-24 1997-11-04 Shinnitsuka Kankyo Eng:Kk Electrochemical detection method of gene and apparatus therefor
WO1998020162A2 (en) * 1996-11-05 1998-05-14 Clinical Micro Sensors Electrodes linked via conductive oligomers to nucleic acids
WO1998031839A2 (en) * 1997-01-21 1998-07-23 President And Fellows Of Harvard College Electronic-property probing of biological molecules at surfaces

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
BROWN G. ET AL.,: "Metallorganic labels for DNA sequencing and mapping", NEW J. CHEM., vol. 18, - 1994, pages 317 - 326, XP002106965 *
DATABASE WPI Section Ch Week 9803, Derwent World Patents Index; Class B04, AN 98-029208, XP002106967 *
UTO Y. ET AL.,: "Electrochemical analysis of DNA amplified by the polymerase chain reaction with a ferrocenylated oligonucleotide", ANALYTICAL BIOCHEMISTRY, vol. 250, - 1997, pages 122 - 124, XP002106964 *
YU C.J. ET AL.,: "Uridine-conjugated-ferrocene DNA oligonucleotides for electronic detection of nucleic acids", ABSTRACT OF PAPERS OF THE AMERICAN CHEMICAL SOCIETY, vol. 217, no. 1, - 21 March 1999 (1999-03-21), pages 076carb, XP002106966 *

Cited By (35)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6528266B2 (en) 1993-12-10 2003-03-04 California Institute Of Technology Nucleic acid mediated electron transfer
US6495323B1 (en) 1996-11-05 2002-12-17 Clinical Micro Sensors, Inc. AC methods for the detection of nucleic acids
US6600026B1 (en) 1998-05-06 2003-07-29 Clinical Micro Sensors, Inc. Electronic methods for the detection of analytes utilizing monolayers
US6740518B1 (en) 1998-09-17 2004-05-25 Clinical Micro Sensors, Inc. Signal detection techniques for the detection of analytes
US9874542B2 (en) 1998-09-17 2018-01-23 Clinical Micro Sensors, Inc. Signal detection techniques for the detection of analytes
US8012743B2 (en) 1998-10-27 2011-09-06 Osmetech Technology Inc. Detection of target analytes using particles and electrodes
WO2001007665A3 (en) * 1999-07-26 2002-05-02 Clinical Micro Sensors Inc Sequence determination of nucleic acids using electronic detection
WO2001007665A2 (en) * 1999-07-26 2001-02-01 Clinical Micro Sensors, Inc. Sequence determination of nucleic acids using electronic detection
WO2001035100A3 (en) * 1999-11-12 2002-01-03 Clinical Micro Sensors Inc Binding acceleration techniques for the detection of analytes
AU778556B2 (en) * 1999-11-12 2004-12-09 Clinical Micro Sensors, Inc. Binding acceleration techniques for the detection of analytes
WO2001035100A2 (en) * 1999-11-12 2001-05-17 Clinical Micro Sensors, Inc. Binding acceleration techniques for the detection of analytes
WO2001042508A3 (en) * 1999-12-09 2002-03-14 Motorola Inc Methods and compositions relating to electrical detection of nucleic acid reactions
WO2001042508A2 (en) * 1999-12-09 2001-06-14 Motorola, Inc. Methods and compositions relating to electrical detection of nucleic acid reactions
US6518024B2 (en) 1999-12-13 2003-02-11 Motorola, Inc. Electrochemical detection of single base extension
US6824669B1 (en) 2000-02-17 2004-11-30 Motorola, Inc. Protein and peptide sensors using electrical detection methods
US6753143B2 (en) 2000-05-01 2004-06-22 Clinical Micro Sensors, Inc. Target analyte detection using asymmetrical self-assembled monolayers
WO2002020838A2 (en) * 2000-09-04 2002-03-14 Yissum Research Development Company Of The Hebrew University Of Jerusalem Method and system for detecting nucleic acids
WO2002020838A3 (en) * 2000-09-04 2003-10-23 Yissum Res Dev Co Method and system for detecting nucleic acids
EP1527194A4 (en) * 2001-04-03 2005-07-20 Clinical Micro Sensors Inc Nucleic acid reactions using labels with different redox potentials
EP1527194A2 (en) * 2001-04-03 2005-05-04 Clinical Micro Sensors, Inc. Nucleic acid reactions using labels with different redox potentials
WO2003019194A3 (en) * 2001-08-25 2004-01-29 Friz Biochem Gmbh Displacement assay for detecting ligate-ligand association events
WO2003018834A3 (en) * 2001-08-25 2003-09-12 Friz Biochem Gmbh Displacement assay for the detection of nucleic acid oligomer hybridization events
WO2003019194A2 (en) * 2001-08-25 2003-03-06 Friz Biochem Gmbh Displacement assay for detecting ligate-ligand association events
WO2003018834A2 (en) 2001-08-25 2003-03-06 Friz Biochem Gmbh Displacement assay for the detection of nucleic acid oligomer hybridization events
JP2005517709A (en) * 2002-02-14 2005-06-16 ベーイーオー・メリュー Bifunctional metallocene, process for its production and use in the labeling of biological molecules
US9127308B2 (en) 2002-03-07 2015-09-08 Atlas Genetics Limited Nucleic acid probes, their synthesis and use
US10094800B2 (en) 2002-03-07 2018-10-09 Atlas Genetics Limited Assays and apparatus for detecting electrochemical active markers in an electric field
WO2004050231A3 (en) * 2002-11-29 2004-09-16 Univ Aarhus (bio) organic oligomers for the preparation of macromolecules
WO2004050231A2 (en) * 2002-11-29 2004-06-17 Aarhus Universitet (bio) organic oligomers for the preparation of macromolecules
US8329011B2 (en) 2006-06-20 2012-12-11 Canon Kabushiki Kaisha Polymerase-immobilized electrode
WO2014066704A1 (en) 2012-10-24 2014-05-01 Genmark Diagnostics, Inc. Integrated multiplex target analysis
EP2965817A1 (en) 2012-10-24 2016-01-13 Genmark Diagnostics Inc. Integrated multiplex target analysis
EP3427830A1 (en) 2012-10-24 2019-01-16 Genmark Diagnostics Inc. Integrated multiplex target analysis
EP3919174A2 (en) 2012-10-24 2021-12-08 Genmark Diagnostics Inc. Integrated multiplex target analysis
US12005074B2 (en) 2023-05-03 2024-06-11 Alnylam Pharmaceuticals, Inc. Extrahepatic delivery

Also Published As

Publication number Publication date
EP1075541A1 (en) 2001-02-14
JP2002513592A (en) 2002-05-14
CA2327525A1 (en) 1999-11-11
AU2473599A (en) 1999-11-23
AU765597B2 (en) 2003-09-25

Similar Documents

Publication Publication Date Title
AU764926B2 (en) Amplification of nucleic acids with electronic detection
US6686150B1 (en) Amplification of nucleic acids with electronic detection
AU763494B2 (en) Electronic methods for the detection of analytes utilizing monolayers
AU765597B2 (en) Electronic detection of nucleic acids using monolayers
US6753143B2 (en) Target analyte detection using asymmetrical self-assembled monolayers
US7393645B2 (en) Compositions for the electronic detection of analytes utilizing monolayers
US6063573A (en) Cycling probe technology using electron transfer detection
US7160678B1 (en) Compositions for the electronic detection of analytes utilizing monolayers
US6090933A (en) Methods of attaching conductive oligomers to electrodes
US6290839B1 (en) Systems for electrophoretic transport and detection of analytes
US7384749B2 (en) Electrodes linked via conductive oligomers to nucleic acids
EP1218541B1 (en) Sequence determination of nucleic acids using electronic detection
US20030087228A1 (en) Electronic detection of nucleic acids using monolayers
WO1998020162A2 (en) Electrodes linked via conductive oligomers to nucleic acids
WO2001006016A9 (en) Amplification of nucleic acids with electronic detection
US20050053962A1 (en) Amplification of nucleic acids with electronic detection
AU2003271352A1 (en) Electronic detection of nucleic acids using monolayers
AU780739B2 (en) Electrodes linked via conductive oligomers to nucleic acids

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AL AM AT AU AZ BA BB BG BR BY CA CH CN CU CZ DE DK EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT UA UG US UZ VN YU ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW SD SZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
WWE Wipo information: entry into national phase

Ref document number: 1999904314

Country of ref document: EP

Ref document number: 24735/99

Country of ref document: AU

ENP Entry into the national phase

Ref document number: 2000 547270

Country of ref document: JP

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 2327525

Country of ref document: CA

Kind code of ref document: A

Ref document number: 2327525

Country of ref document: CA

NENP Non-entry into the national phase

Ref country code: KR

WWP Wipo information: published in national office

Ref document number: 1999904314

Country of ref document: EP

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

WWG Wipo information: grant in national office

Ref document number: 24735/99

Country of ref document: AU