JP2002513592A - Electronic detection of nucleic acids using a monolayer - Google Patents

Abstract

  (57) [Summary] The present invention relates to electronic detection of nucleic acids using a self-assembled monolayer.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001] The present invention relates to US patent application Ser. No. 60 / 084,509, filed May 6, 1998.
It is a continuation-in-part application of 60 / 084,425 dated May 6, 1998 and 09 / 135,183 dated August 17, 1998.

FIELD OF THE INVENTION [0002] The present invention relates to methods and compositions for electronically detecting nucleic acids using a self-assembled monolayer with electronically exposed terminals.

BACKGROUND OF THE INVENTION [0003] The detection of specific nucleic acids is an important tool for diagnostic medicine and molecular biology research. Genetic probe assays have recently been used to identify infectious organisms such as bacteria and viruses, search for expression of genes and identify mutated genes such as oncogenes, examine tissues suitable for performing tissue transplantation, forensic tissues or blood. It plays a role in sample matching and in searching for homology between genes of different species.

[0004] Ideally, gene probe assays are sensitive, specific, and can be easily automated (as reviewed by Nickerson, Current Opinion in Biotechnology
4: 48-51 (1993)). The required sensitivity (i.e., lower detection limit) is dependent on the development of the polymerase chain reaction (PCR) and other amplification techniques that allow researchers to exponentially amplify a particular nucleic acid sequence prior to analysis, as outlined below. Was very solved.

[0005] Conversely, specificity remains a problem in many currently available gene probe assays. The degree of molecular complementarity between the probe and the target determines the specificity of the interaction. Changing the concentration of the probe, target and salt in the hybridization medium, reaction temperature, and length of the probe can alter or affect the specificity of the probe / target interaction.

[0006] In some limited circumstances, it may be possible to distinguish between targets with perfect complementarity and targets with mismatches, but this is not the case when using classical techniques. Are generally very difficult, since minor changes in the hybridization can alter the hybridization. New experimental techniques for detecting mismatches using standard probes include DNA ligation assays where one point mismatch prevents ligation and probe digestion assays where the mismatch provides a probe cleavage site.

[0007] Ultimately, the automation of gene probe assays remains an area where current technologies lack. Such assays generally rely on the hybridization of a labeled probe to a target sequence, followed by the separation of unhybridized free probe. This separation is generally done by gel electrophoresis or solid phase capture and washing of the target DNA, and is generally quite difficult to automate easily.

The time-consuming nature of these separation steps has led to two separate development tools. One is the development of high speed, high throughput automated electrophoresis and other separation techniques.
Another is a non-separable homogeneous gene probe assay.

[0009] Several techniques are being developed that are useful for signal amplification techniques for nucleic acid detection. “Branched DNA” signal amplification relies on the synthesis of branched nucleic acids, including the diversity of nucleic acid “arms” that function to increase the amount of label that can be attached to a probe. This technique is generally described in U.S. Patent Nos. 5,681,702, 5,597,909, 5,545,
730, 5,594,117, 5,591,584, 5,571,670,5
580,731,5,571,670,5,591,584,5,624,80
2,5,635,352,5,594,118,5,359,100,5,12
Nos. 4,246 and 5,681,697, all of which are incorporated by reference into this document.

Similarly, dendrimers of nucleic acids use another composition, but a similar concept, and serve to greatly increase the amount of label that can be added to a single molecule. This technique is disclosed in U.S. Patent No. 5,175,270 and Nilsen et al., J. Theor. Bio.
l. 187: 273 (1997), both of which are incorporated by reference into this document.

[0011] PCT applications WO95 / 15971, PCT / US96 / 09969, PCT /
US 97/09739, WO 96/40712, and WO 98/20162 describe novel nucleic acid-containing compounds containing an electron transfer unit, including electrodes, which can provide a novel method for detecting nucleic acid hybridization.

SUMMARY OF THE INVENTION In accordance with the objects outlined above, the present invention provides a composition comprising an electrode consisting of a monolayer containing a conductive oligomer and a capture probe. The composition further includes a target sequence that includes a first portion capable of hybridizing to the capture probe and a second portion that does not hybridize to the capture probe, and includes at least one covalently attached electron transfer moiety. I have.

[0013] In an additional aspect, the invention provides a composition comprising a monolayer comprising a conductive oligomer and an electrode comprising a capture probe. The composition further comprises a labeled probe comprising a first portion capable of hybridizing to the assay complex component and a second portion comprising a recruitment linker that does not hybridize to the assay complex component, and at least one covalent bond. And an electron transfer portion attached thereto.

[0014] In a further aspect, the invention provides a method of detecting a target nucleic acid sequence in a test sample, the method comprising attaching the target sequence to an electrode comprising a monolayer of a conductive oligomer. The labeled probe attaches directly or indirectly to the label sequence to form an assay complex, wherein the labeled probe does not hybridize to a first portion capable of hybridizing to a component of the assay complex and to a component of the assay complex. A second portion comprising a recruitment linker, and at least one
It contains an electron transfer moiety attached by two covalent bonds. The method further comprises the E
It consists of detecting electron transfer between the TM and the electrode.

[0015] In a further aspect, the method comprises attaching a target sequence to the electrode and attaching, directly or indirectly, a first portion of at least one labeled probe comprising at least one ETM. The method further includes detecting electron transfer between the ETM and the electrode. The target sequence is (1) hybridized to the capture probe by (2) hybridizing the first portion of the target sequence to the first capture extension probe, and then to the capture probe on the electrode to the second of the first capture extension probe. (3) hybridizing the first portion of the target sequence to the first portion of the first capture extension probe and hybridizing the second portion of the first capture extension probe to the first portion of the capture probe on the electrode. Attach to the electrode by soybean, hybridizing the second portion of the target sequence to the first portion of the second capture extension probe, and hybridizing the second portion of the second capture extension probe to the second portion of the capture probe. Let it.

[0016] Labeled probes can be attached to a target sequence by a variety of methods, including, for example,
(1) hybridizing the first portion of the labeled probe to the first portion of the target sequence; (2) hybridizing the first portion of the amplification probe to the first portion of the target sequence; and the first portion of at least one labeled probe. (3) hybridizing the first portion of the first labeled extension probe to the first portion of the target sequence, and hybridizing the first portion of the first labeled extension probe to the first portion of the amplification sequence. Hybridizing the two portions and hybridizing at least one amplification sequence of the amplification probe to a first portion of the at least one labeled probe; (4) hybridizing a first portion of the first labeled extension probe to a first portion of the target sequence. Soy and hybridize the second part of the first labeled extension probe to the first part of the amplification probe Hybridizing a first portion of a second labeled extension probe to a second portion of the target sequence, hybridizing a second portion of the second labeled extension probe to a first portion of the amplification probe, and a first portion of the at least one labeled probe. Hybridizing at least one amplification sequence of the amplification probe.

[0017] Kits and devices comprising the compositions of the invention are also provided.

DETAILED DESCRIPTION OF THE INVENTION The field of nucleic acid detection, especially in the array format, is expanding rapidly with the most common fluorescence-based detection systems. In addition, recent new research uses electron transfer-based detection. See USP 5,591,578. In this electron transfer detection, electron transfer proceeds via stacked π orbitals (“π-paths”) of heterocyclic bases of double-stranded (hybridized) nucleic acids, thereby providing single-stranded and double-stranded nucleic acids. It is based on the finding that it is possible to discriminate between them. Thus, a nucleic acid is prepared to contain an ETM attached covalently, but when it hybridizes to a complementary strand, electron transfer through the "π-way" occurs between the ETMs, resulting in a target sequence Can be detected. A further improvement on this system is PCT / US97
/ 22014, this system allows the attachment of nucleic acids to conductive oligomers, ie, electrodes using chemical "wires", so that ET
The formation of a double-stranded nucleic acid containing M allows electron transfer to proceed between the ETM and the electrode, thus enabling electron detection of the target nucleic acid. This previous work reported that the use of a self-assembled monolayer (SAM) electronically shielded the electrode from solution components and significantly reduced the amount of non-specific binding to the electrode.

The present invention is directed to the discovery that the presence or absence of an ETM can be directly detected using conductive oligomers;
It is not necessary to move in the stacked π orbits to generate a signal. Alternatively, the presence of ETMs on the SAM surface, including conductive oligomers, can be detected directly. Thus, hybridization of the target sequence can result in a labeled probe containing ETMs on its surface and ETM detection can proceed, but by estimation,
This proceeds to the electrode via the conductive oligomer. In essence, the role of the SAM containing the conductive oligomer is to "excit" the electronic surface of the electrode, while still providing the benefit of shielding the electrode from solution components and providing non- The purpose is to reduce the amount of specific binding. According to different views, the role of nucleic acids is
To provide recruitment specificity, in which case they can be detected by conductive oligomers with electronically exposed terminals.

Accordingly, the present invention provides methods and compositions useful for detecting nucleic acids. As those skilled in the art will appreciate, the compositions of the present invention can take a variety of configurations, as generally outlined in the drawings. As outlined in more detail below, the preferred system of the present invention operates as follows. The target nucleic acid sequence is attached (via hybridization) to an electrode consisting of a monolayer containing conductive oligomers. This attachment occurs directly to the capture probe on the surface or indirectly using a capture extension probe. The labeled probe is then added to form an assay complex, wherein the complex has a first portion capable of hybridizing to the assay complex component, a second portion that does not hybridize to the assay complex component, and It comprises at least one covalently attached ETM. The attachment of the labeled probe can be direct (ie, hybridize to a portion of the label sequence) or indirect (ie, hybridize to an amplification probe that hybridizes to the target probe), All of the nucleic acids that form the assay complex. As a result of hybridization of the first portion of the labeled probe, the second portion of the ETM-containing labeled probe ("recruitment linker") is transported to a spatially proximate location of the conductive oligomer surface on the electrode, and then the presence of the ETM is electronically determined. Can be detected.

Thus, in a preferred embodiment, the composition comprises an electrode comprising a single layer. As used herein, an “electrode” senses a current or charge when connected to an electronic device.
, A construct capable of converting it to a signal. Alternatively, an electrode is
May impart a potential to the species and / or transfer electrons to or from the species
It can be defined as a constituent. Thus, an electrode is an ETM as described herein. Good
Suitable electrodes are known in the art and include, but are not limited to, certain types of gold.
Metal and its oxides, for example, gold, platinum, palladium, silicon, aluminum
A metal oxide electrode, for example, platinum oxide, titanium oxide, tin oxide, tin oxide indium
, Palladium oxide, silicon oxide, aluminum oxide, molybdenum oxide (Mo _Two O₆), Tungsten oxide (WO_Three) And ruthenium oxide; and carbon
Electrode, graphite and carbon paste). Suitable electrodes are gold,
For example, silicon, carbon and metal oxide electrodes, with gold being particularly preferred.

Although the electrodes described herein are shown as flat surfaces, this is one possible shape of the electrodes and is for illustration purposes only. The shape of the electrodes depends on the detection method used. For example, planar electrodes are suitable for photodetection, or for preparing linked nucleic acids that require a position that can be processed for synthesis and detection. Alternatively, in the case of a SAM comprising a conductive oligomer and a nucleic acid bound to an inner surface, the electrodes can be in the form of a tube for single probe analysis. This makes it possible to maximize the surface area of the nucleic acids to be exposed to small volumes of sample.

The detection electrode includes a monolayer containing a conductive oligomer. As used herein, "monolayer" or "self-assembled monolayer" or "SAM" refers to a relatively ordered collection of molecules that automatically chemisorb on a surface, where the molecules are mutually attached. It is oriented substantially parallel and roughly perpendicular to the surface. Each molecule contains a functional group, which adheres to the surface and some interacts with adjacent molecules in the monolayer to form a relatively ordered arrangement. A "mixed" monolayer consists of a heterogeneous monolayer, i.e., where at least two different molecules make up the monolayer. The SAM may be a conductive oligomer alone or a mixture of a conductive oligomer and an insulator. As outlined herein, the efficiency of oligonucleotide hybridization increases when the analyte is slightly away from the electrode. Similarly,
Non-specific binding of biomolecules, including nucleic acids, to electrodes is generally reduced when a monolayer is present. Thus, the monolayer facilitates the maintenance of nucleic acids away from the electrode surface. Further, the monolayer helps to retain charged species away from the electrode surface. Thus, this layer serves to prevent electrical contact between the electrode and the ETM or between the electrode and the charged species in the solvent. Such contact can lead to a direct "short circuit" or an indirect short circuit via charged species that may be present in the sample. Thus, the monolayer preferably packs tightly into a uniform layer on the electrode surface, minimizing the presence of "holes". Thus, the monolayer acts as a physical barrier that blocks solvent access to the electrodes.

[0024] In a preferred embodiment, the monolayer comprises a conductive oligomer. As used herein, "conductive oligomer" means a substantially conductive oligomer, preferably linear, and in one embodiment is referred to in the literature as a "molecular beam." As used herein, "substantially conductive" means that the oligomer can transfer electrons at 100 Hz. Generally, conductive oligomers have substantially overlapping π-orbitals, ie, conjugated π-orbitals, such as between the monomer units of the conductive oligomer, whereas conductive oligomers have one or more sigma (σ). Also includes binding. In addition, conductive oligomers can also be functionally defined by their ability to inject or accept electrons from the associated ETM. In addition, conductive oligomers are more conductive than insulators as defined herein. Further, the conductive oligomers of the present invention are to be distinguished from electroactive polymers, which are capable of donating or accepting electrons by themselves.

In a preferred embodiment, the conductive oligomer has a conductivity S of about 10 ⁻⁶ to 10 ⁴ Ω ⁻¹ cm ⁻¹ , preferably about 10 ⁻⁵ to 10 ³ Ω ⁻¹ cm ^−1. Thus, these S values are calculated from molecules in the range of about 20 ° to about 200 °. As described below, the insulator has a conductivity S of about 10 ⁻⁷ Ω ⁻¹ cm ⁻¹ or less, preferably less than 10 ⁻⁸ Ω ⁻¹ cm ⁻¹ . In general, Gardner et al., Sensors and Actuat
ors A51 (1995) 57-66 (incorporated herein by reference).

The desired properties of the conductive oligomer include high conductivity, sufficient solubility in organic solvents and / or water for the synthesis and use of the compositions of the present invention, and good chemical resistance to the reaction. However, the reaction occurs only in 1) nucleic acid synthesis (ie,
When the nucleoside containing the conductive oligomer is added to the nucleic acid synthesizer in the synthesis of the composition of the present invention), 2) when the conductive oligomer is attached to the electrode, or 3).
During the hybridization assay. Further, conductive oligomers that promote the formation of a self-assembled monolayer are preferred.

[0027] The oligomer of the invention comprises at least two monomeric subunits, as described herein. As described in detail below, oligomers include homo- and hetero-oligomers, and also include polymers.

In a preferred embodiment, the conductive oligomer has the structure shown in Structure 1: Structure 1

Embedded image As will be appreciated by those skilled in the art, any of the structures shown herein may have additional atoms or structures. That is, the conductive oligomer of structure 1 can be bound to electrodes, transition metal complexes, organic ETMs, and ETMs such as metallocenes, and to nucleic acids, or to some of these. Unless otherwise specified, the conductive oligomers shown here are:
The left side is connected to the electrode. That is, in the case of the structure 13, "Y" on the left side is connected to the electrode described in this specification. When attaching the conductive oligomer to the binding ligand, the "Y" on the right, if present, is attached to the nucleic acid, either directly or using a linker according to the invention.

In this embodiment, Y is an aromatic group, n is an integer from 1 to 50, and g is 1
Or e, e is an integer from 0 to 10, and m is 0 or 1. When g is 1, BD is a bond that can be conjugated to an adjacent bond (referred to as “conjugate bond” in this specification), and is preferably acetylene (BD is preferably selected from acetylene. Covalent bond), alkene, substituted alkene, amide, azo, -C = N- (including -N = C-, -CR = N- and -N = CR-), -Si =
Si- and -Si = C- (including -C = Si-, -Si = CR- and -CR = Si-). When g is 0, e is preferably 1, and D is preferably a carbonyl or a heteroatom moiety, wherein the heteroatom is selected from oxygen, sulfur, nitrogen, silicon or phosphorus. Thus, suitable heteroatoms include -NH and -NR, where R is as defined herein; substituted sulfur; sulfonyl
(-SO ₂ -) sulfoxide (-SO-); phosphine oxide (-PO- and -RPO
-); And thiophosphines (-PS- and -RPS-), but are not limited thereto. However, as outlined below, sulfur derivatives are not preferred when a conductive oligomer is bound to a gold electrode.

An “aromatic group” or equivalent thereof, as used herein, refers to an aromatic monocyclic or polycyclic hydrocarbon moiety generally containing from 5 to 14 carbon atoms (to make larger polycyclic ring structures). And carbocyclic ketone or thioketone derivatives thereof, wherein the carbon atom with its free valence is a member of an aromatic ring. The aromatic ring includes an arylene group and an aromatic group excluding two or more atoms. For the purposes of this application, aromatics include heterocycles. “Heterocycle” or “heteroaryl” refers to the replacement of one to five specified carbon atoms with a heteroatom selected from nitrogen, oxygen, sulfur, phosphorus, boron and silicon, and estimating the free valency thereof. Aromatic groups whose atoms are members of an aromatic ring, and their heterocyclic ketone and thioketone derivatives are meant. Thus, heterocycles include thienyl, furyl, pyrrolyl, pyrimidinyl, oxalyl, indolyl, purinyl, quinolyl, isoquinolyl, thiazolyl,
Imidosyl and the like.

What is important is that the Y-aromatic groups of the conductive oligomer can be different, that is, the conductive oligomer can be a hetero-oligomer. That is, the conductive oligomer may include an oligomer of a single type of Y group or a plurality of types of Y groups.

An aromatic group can be substituted with a substituent generally represented by R herein. The R group can optionally be added to affect the packing of the conductive oligomer, ie,
The R group can be used to alter the association of oligomers in a monolayer. R groups can also be added to 1) alter the solubility of the oligomer or composition containing the oligomer; 2) alter the conjugation or electrochemical potential of the system; and 3) alter the charge or properties of the monolayer surface.

In a preferred embodiment, when the conductive oligomer is larger than three subunits, the R groups are preferred to enhance solubility when performing solution synthesis. However, the R groups and their locations are chosen to minimize the effect on the packing of the conductive oligomer on the surface, especially within a monolayer, as described below. Generally, only small R groups are used in a monolayer, and large R groups are generally on the surface of the monolayer. for that reason,
For example, it is preferable to add a methyl group to the portion of the conductive oligomer in the monolayer to increase the solubility. For example, it is preferable to attach a longer alkoxy group from C3 to C10 on the monolayer surface. In general, in the systems described herein, this generally means that the sterically important R group depends on the average length of the molecules forming the monolayer, but on the first two or three oligomeric subunits. It means not binding to any.

Suitable R groups include hydrogen, alkyl, alcohol, aromatic, amino, amide, nitro, ether, ester, aldehyde, sulfonyl, silicon, halogen, sulfur containing, phosphorus containing, and ethylene glycol. But not limited to them. In the structures shown herein, R is hydrogen if that position is not substituted. At certain positions, two substituents, R and R ', are possible, in which case the R and R' groups may either be the same or different.

“Alkyl group” or its equivalent means a straight-chain or branched alkyl group, with a straight-chain alkyl group being preferred. If it is branched, it is branched at one or more places, unless otherwise specified. The alkyl group has from about 1 to about 30 carbon atoms
(C1-C30), and in a preferred embodiment utilizes from about 1 to about 20 carbon atoms (C1-C20), with about C1 to about C12 to C15 being preferred;
Although 1 to C5 are particularly preferred, in some embodiments, the alkyl group can be larger. Also included within the definition of alkyl group are cycloalkyl groups, such as C5 and C6 rings, and heterocyclic rings having nitrogen, oxygen, sulfur, or phosphorus. Alkyl also includes heteroalkyl, preferably having sulfur, oxygen, nitrogen and silicon heteroatoms. Alkyl also includes substituted alkyl groups. “Substituted alkyl group” refers to an alkyl group that also contains one or more substituent “R” as defined above.

“Amino group” or its equivalents refers to the groups —NH ₂ , —NHR and —NR ₂ , where R is as defined herein.

“Nitro group” refers to the group —NO ₂ .

“Sulfur-containing moiety” means a compound containing a sulfur atom, and includes thia-, thio- and sulfo-compounds, thiols (—SH and —SR), sulfides (—RSR—)
, Sulfoxide (—R—SO—R—), sulfone (—R—SO ₂ —R—), disulfide (—R—S—S—R—) and sulfonyl ester (—R—SO ₂ —O—R
-), But are not limited to these. "Phosphorus-containing moiety" means a compound that contains phosphorus and includes, but is not limited to, phosphines and phosphates. “Silicon-containing part” means a silicon-containing compound.

“Ether” refers to the group —O—R—. Preferred ethers are alkoxy _{groups, -O- (CH 2) 2 CH} 3 and -O- (CH _{2) 4} CH ₃ being preferred.

“Ester” refers to the group —COOR.

“Halogen” refers to bromine, iodine, chlorine or fluorine. Preferred substituted alkyls are partially or fully halogenated alkyls, such as CF ₃
And so on.

“Aldehyde” refers to a —RCOH group.

“Alcohol” means an —OH group and an alkyl alcohol —ROH.

“Amido” refers to the group —RCONH— or RCONR—.

“Ethylene glycol” or “(poly) ethylene glycol” refers to — (O—
CH_Two-CH_Two)_nGroup, but each carbon atom of an ethylene group may be single or double.
May be heavily substituted, ie,-(O-CR_Two-CR_Two)_n-, Where R is as defined above
It may be justice. Ethylene with another heteroatom at the oxygen position
Glycol derivatives (i.e.,-(N-CH_Two-CH_Two)_n-Or-(S-CH_Two-CH_Two) _n -Or having a substituent).

Preferred substituents include alkoxy groups such as methyl, ethyl, propyl, —O— (CH ₂ ) ₂ CH ₃ and —O— (CH ₂ ) ₄ CH ₃ and ethylene glycol and derivatives thereof. However, the present invention is not limited to these.

Preferred aromatic groups include, but are not limited to, phenyl, naphthyl, naphthalene, anthracene, phenanthroline, pyrrole, pyridine, thiophene, porphyrin and their respective derivatives, including fused ring derivatives.

In the conductive oligomers shown herein, when g is 1, BD is a bond connecting two atoms or chemical moieties. In a preferred embodiment, BD is a conjugated bond containing overlapping or conjugated orbitals.

Preferred BD bonds are acetylene (—C≡C—, also called alkyne or ethyne), alkene (—CH ＝ CH—, also called ethylene), substituted alkene (
-CR = CR-, -CH = CR- and -CR = CH-), amide (-NH-CO
-And -NR-CO- or -CO-NH- and -CO-NR-), azo (-
N = N-), esters and thioesters (-CO-O-, -O-CO-, CS-
O- and -O-CS-) and other conjugated bonds (-CH = N-, -CR = N-,-
N = CH- and -N = CR-), (-SiH = SiH-, -SiR = SiH-, -S
iH = SiR- and SiR = SiR-), (-SiH = CH-, -SiR = CH-,
-SiH = CR-, -SiR = CR-, -CH = SiH-, -CR = SiH-, -C
H = SiR- and -CR = SiR-). Particularly preferred BD
The linkages are acetylene, alkenes, amides and these three substituted derivatives and azo. Particularly preferred BD bonds are acetylene, alkenes and amides. The oligomer component attached to the double bond may be in the trans or cis configuration, or in a mixed form. As such, either B or D can include carbon, nitrogen or silicon. The substituents are as defined for R above.

When g = 0 in the Structure 1 conductive oligomer, e is preferably 1, and the D moiety can be a carbonyl or heteroatom moiety as defined above.

As in the Y ring above, within any single conductive oligomer, a BD bond (or g =
D part when 0) may be all the same or at least one may be different. For example, when m is 0, the terminal BD bond can be an amide bond and the remaining BD bonds can be acetylene bonds. Generally, when an amide bond is present, it is preferred that the amide bond be as small as possible, but in some embodiments, all BD bonds are amide bonds. Thus, as outlined above for the Y ring, one type of BD bond can exist in the conductive oligomer in the monolayer and another type of BD bond on the monolayer level, When nucleic acids are linked via conductive oligomers, greater flexibility can be imparted to nucleic acid hybridization.

In the structures shown herein, n is an integer from 1 to 50, but longer oligomers can also be used (eg, Schumm et al., Angew. Chem. Int. Ed. Engl. 19
94 33 (13): 1360). Without being bound by theory, for efficient nucleic acid hybridization on a surface, it is likely that the hybridization occurs at a distance from the surface, ie, the hybridization rate is, in particular, 200 to 300
For longer base pair oligonucleotides, it will increase as a function of distance from the surface. Thus, when a nucleic acid is bound via a conductive oligomer, as described in more detail below, the length of the conductive oligomer is such that the nearest nucleotide of the nucleic acid is from about 6 ° to about 100 ° from the electrode surface (provided that (A distance of up to 500 ° can be used), preferably about 15 ° to about 60 °, and more preferably about 25 ° to about 60 °. Thus, n varies depending on the size of the aromatic group, but is generally from about 1 to about 20, preferably from about 2 to about 15, and from about 3 to about 1
0 is particularly preferred.

In the structures shown herein, m is either 0 or 1. That is, m is 0
At the end of the conductive oligomer, there is a BD bond or a D moiety at the end,
The D atom is attached to the nucleic acid either directly or via a linker.
In certain embodiments, for example, when the conductive oligomer is attached to the phosphate of the ribose-phosphate backbone of the nucleic acid, there may be another atom such as a linker attached between the conductive oligomer and the nucleic acid. Further, as outlined below,
The D atom can be a nitrogen atom of an amino-modified ribose. Alternatively, when m is 1, the terminal of the conductive oligomer has Y and an aromatic group, that is, the aromatic group is bonded to a nucleic acid or a linker.

As will be apparent to those skilled in the art, a number of conductive oligomers are available. These include, for example, fused aromatic rings or-(CF ₂ ) _n -,-(CHF) _n- and-(CFR
) _N - as with ^Teflon other known in the art such as compounds comprising like oligomeric conductive oligomer such as, including conductive oligomers falling within the scope of Structure 1 or Structure 8 formulas. For example, Schumm et al., Angew. Chem. Int. Ed. Engl. 33:
1361 (1994); Grosshenny et al., Platinum Metals Rev. 40 (1): 26-35 (199
6); Tour, Chem. Rev. 96: 537-553 (1996); Hsung et al., Organometallics 1
4: 4808-4815 (1995); and references cited therein, all of which are expressly incorporated herein by reference.

Particularly preferred conductive oligomers of this embodiment are: Structure 2

Embedded image Structure 2 is structure 1 when g is 1. Preferred embodiments of Structure 2 include e
E is 0, Y is pyrrole or substituted pyrrole; e is 0, Y is thiophene or substituted thiophene; e is 0, Y is furan or substituted furan; e is 0 E is 0, Y is pyridine or substituted pyridine; e is 1, BD is acetylene, Y is phenyl or substituted phenyl some stuff(
For example, there is structure 4 below). A preferred embodiment of Structure 2 is also that wherein e is 1 as shown in Structure 3 below:

Structure 3

Embedded image A preferred embodiment of structure 3 is where Y is phenyl or substituted phenyl and B-
D is azo; Y is phenyl or substituted phenyl; BD is acetylene; Y is phenyl or substituted phenyl and BD is alkene; Y is pyridine or substituted pyridine Y is thiophene or substituted thiophene and BD is acetylene; Y is furan or substituted furan, and BD is acetylene; Y is thiophene or substituted thiophene;
Is thiophene or furan (or substituted thiophene or furan), and BD
Is an alternate bond of alkene and acetylene.

Most of the structures shown herein utilize a conductive oligomer of Structure 3. However, any of the Structure 3 oligomers can be substituted with other structures herein, ie, Structure 1 or 8 oligomers, or other conductive oligomers, and the use of such Structure 3 is meant to limit the scope of the invention. do not have.

Particularly preferred embodiments of Structure 3 include Structures 4, 5, 6 and 7 below: Structure 4

Embedded image Particularly preferred embodiments of Structure 4 are those wherein n is 2, m is 1 and R is hydrogen; n is 3 and m is 0 and R is hydrogen; There is the use of R groups to enhance

Structure 5

Embedded image When the BD bond is an amide bond, as in Structure 5, the conductive oligomer is a pseudo-peptide oligomer. The amide bond in Structure 5 is shown with the carbonyl on the left, ie, CONH—, but vice versa, ie, —NHCO—. Structure 17
Particularly preferred embodiments of are those wherein n is 2, m is 1 and R is hydrogen; n is 3, m is 0 and R is hydrogen (in this embodiment , The terminal nitrogen (D atom) can be the nitrogen of the amino-modified ribose), and the use of R groups to increase solubility.

Structure 6

Embedded image In a preferred embodiment of Structure 6, the first n is 2 and the second n is 1.
There are those where m is 0 and all R groups are hydrogen, or the use of R groups to increase solubility.

Structure 7

Embedded image Preferred embodiments of Structure 7 include those wherein the first n is 3, the second n is 1-3, m is either 0 or 1, and the R group for increasing solubility. There is use.

In a preferred embodiment, the conductive oligomer has the structure shown in Structure 8: Structure 8

Embedded image In this embodiment, C is a carbon atom, n is an integer from 1 to 50, m is 0 or 1, and J is selected from the group consisting of oxygen, nitrogen, silicon, phosphorus, sulfur, carbonyl or sulfoxide. G is a bond selected from an alkane, alkene or acetylene, and together with two carbon atoms, a C—G—C group is an alkene (—CH ＝ CH—), a substituted alkene (-CR = CR-) or a mixture thereof (-CH = CR or -CR = CH-), acetylene (-C≡
C-) or alkane (-CR ₂ -CR ₂ -, R is as hydrogen or is any substituent described herein). The G bond of each subunit may be the same or different from the G bond of the other subunits, ie, oligomers having alternating alkene and acetylene bonds can be used. However, when G is an alkane bond, the number of alkane bonds in the oligomer should be kept to a minimum, with about 6 or less sigma bonds per conductive oligomer being preferred. Alkene bonds are preferred,
Although shown generally herein, the alkane and acetylene linkages can be substituted for any of the structures or embodiments described herein, as will be apparent to those skilled in the art.

In some embodiments, for example, in the absence of ETM, if m = 0, at least one G bond is an alkane bond.

In a preferred embodiment, m in Structure 8 is 0. In a particularly preferred embodiment,
As shown in Structure 9, m is 0 and G is an alkene bond: Structure 9

Embedded image The alkene oligomers of structure 9 and others shown herein are generally shown in the preferred trans configuration, but cis or mixed trans and cis oligomers can also be used. As described above, R groups can be added to alter the packing of the composition on the electrode, the hydrophilic or hydrophobic nature of the oligomer, and the flexibility of the oligomer, ie, rotation, twist, or longitudinal flexibility. . n is as defined above.

In a preferred embodiment, R is hydrogen, but R may be an alkyl group and polyethylene glycol or a derivative.

In another embodiment, the conductive oligomer may be a different type of oligomer, for example, a mixture of structures 1 and 8.

In addition, the monolayer contains a conductive oligomer, at least some of the ends of the conductive oligomer in the monolayer are electronically exposed. By "electronically exposed" herein is meant that when the ETM is placed close to the terminus and after proper signal initiation, a signal dependent on the presence of the ETM can be detected.
The conductive oligomer may or may not have a terminal group. Thus, in a preferred embodiment, there are no extra end groups, and the conductive oligomer exhibits structures 1 to 9 whose ends end in one of the groups, such as a BD bond, such as an acetylene bond. Alternatively, in a preferred embodiment, a terminal group, often referred to herein as "Q", is added. The end group may be altered for several reasons, for example to improve the electronic availability of the conductive oligomer for the detection of ETMs, or by other reasons, such as to prevent non-specific binding of the surface of the SAM. Can be used for For example, they are negative at the termini, when the nucleic acid is DNA or RNA, to form a negatively charged surface, to repel or prevent pulling the nucleic acid below the surface, to promote hybridization, to promote hybridization. May be a charged group. Preferred passivating agents terminal groups, -NH _2, -OH, -COOH, alkyl group of -CH _3, etc., and includes a (poly) alkyl oxides such as (poly) ethylene glycol, -OCH ₂ CH _{2 OH, - (OCH 2 CH 2} O) 2 H, - (OCH 2 CH 2 O) 3 H, and _{- (OCH 2 CH 2 O)} 4 H being preferred.

In one embodiment, it is possible to use a mixture of conductive oligomers having different types of end groups. Thus, for example, some end groups may facilitate detection and some may prevent non-specific binding.

It will be appreciated that the monolayer may include different conductive oligomer species, but it is preferable to select different species so that reasonably identical SAMs can be formed.
Thus, for example, when a nucleic acid is covalently attached to an electrode using a conductive oligomer,
It is possible to bind nucleic acids using one type of conductive oligomer and detect ETMs by another type of function. Similarly, it is desirable to have a mixture of conductive oligomers of different lengths in a monolayer to facilitate the reduction of non-specific signals. Thus, for example, preferred embodiments utilize conductive oligomers that terminate below the surface of the remainder of the monolayer, ie, if used, under an insulating layer or under a particular fraction of other conductive oligomers. Similarly, different conductive oligomers can be used to facilitate the formation of a monolayer or to create a monolayer with different properties.

In a preferred embodiment, the monolayer may further include an insulating part. As used herein, "insulator" means a substantially non-conductive oligomer, preferably linear. As used herein, "substantially non-conductive" means that the insulator does not transmit electrons at 100 Hz. The rate of electron transfer through the insulator is preferably slower than the rate through the conductive oligomers described herein.

In a preferred embodiment, the insulator has a conductivity S of less than or equal to about 10 −7 Ω−1 cm −1, preferably less than about 10 −8 Ω−1 cm −1. Generally, Gardner et a
l. See above.

Typically, the insulator is an alkyl or heteroalkyl oligomer or moiety having a sigma bond, but any particular insulator molecule may include an aromatic group or one or more conjugated bonds. As used herein, “heteroalkyl” refers to at least one
An alkyl group having two heteroatoms, ie, nitrogen, oxygen, sulfur, phosphorus, silicon or boron contained in the chain. Alternatively, the insulator may be very similar to a conductive oligomer, preferably with the addition of one or more heteroatoms or bonds that substantially inhibit or retard electron transfer.

Suitable insulators are known to those skilled in the art and include-(CH2) n-,-(CRH) n- and-(CR2) n-, ethylene glycol or other heteroatoms instead of oxygen, ie nitrogen Or a derivative using sulfur (a sulfur derivative is not preferable when the electrode is gold), but is not limited thereto.

For conductive oligomers, the insulator can be substituted with an R group as defined herein, the packing of the moiety or conductive oligomer at the electrode, the hydrophilic or hydrophobic nature of the insulator, and the flexibility of the insulator. Gender, ie, rotational, torsional or longitudinal flexibility. For example, a branched alkyl group may be used. Similarly, as outlined above, the insulator may include end groups that act specifically on the surface of the monolayer.

The length of the species from which the monolayer is made will vary as needed. As outlined above, binding of target analytes (eg, nucleic acid hybridization) appears to be more effective off the surface. The species to which the nucleic acid binds (which can be either an insulator or a conductive oligomer, as outlined below) is essentially the same length or longer than the species forming the monolayer, and the It is more accessible to solvents for hybridization. In some embodiments, the conductive oligomer to which the nucleic acid binds is shorter than a monolayer.

As will be apparent to those skilled in the art, the actual combinations and ratios of the different species that make up the monolayer can vary widely. In general, a three component system is preferred, wherein the first species is a species-containing nucleic acid (ie, a capture probe that can bind to an electrode via either an insulator or a conductive oligomer, as described in more detail below). )including. The second species is a conductive oligomer and the third species is an insulator. In this embodiment, the first
May comprise from about 90% to about 1%, preferably from about 20% to about 40%, more preferably from about 30% to about 40% for short oligonucleotide targets, about 10%
To about 20% is preferred for long targets. The second species may include about 1% to about 90%,
About 20% to about 90% is preferred, and about 40% to about 60% is particularly preferred. Third
May comprise from about 1% to about 90%, preferably from about 20% to about 40%, with about 15%
% To about 30% is particularly preferred. Preferred ratios of the 1: 1: 2: 3 species are 2: 2: 1 for short targets and 1: 3: 1 for long targets, with total thiol concentrations ranging from 500 μM to 1 mM and 833 μM. preferable.

In a preferred embodiment, a two-component system comprising the first and second species is used. In this embodiment, the first species may comprise about 1% to about 90%, and about 10%
To about 40%, with about 10% to about 40% being particularly preferred. The second species may comprise from about 1% to about 90%, with about 10% to about 60% being preferred, and about 20% to about 40% being particularly preferred.

The covalent bond between the conductive oligomer and the insulator can be achieved in various ways and depends on the electrode used and the composition of the insulator and the conductive oligomer. In a preferred embodiment, the binding linker covalently linked to the nucleoside or nucleic acid described herein comprises:
Covalently bonded to the electrode. For example, one end or end of a binding linker binds to a nucleoside or nucleic acid and the other binds to an electrode. In some embodiments, the linking linker binds at a position other than the terminus, or additionally, a branched linking linker binds to the electrode at one terminus and to two or more nucleosides at the other terminus. Although desirable, this is not preferred. Similarly, a binding linker may be attached to the electrode at two sites, as generally described in Structures 11-13. Generally, certain types of linkers are used, as shown below in Structure 10 as A. Structure 1
At 0, "X" is a conductive oligomer, "I" is an insulator, and the shaded surface is an electrode:

[0079]

Embedded image

In this embodiment, A is a linker or an atom. The choice of "A" depends in part on the characteristics of the electrode. Therefore, for example, A is a sulfur part when a gold electrode is used. Alternatively, when using a metal oxide electrode, A is a silicon (silane) moiety bonded to the oxygen of the oxide (eg, Chen et al., Langmuir 10: 3332-3337).
(1994); Lenhard et al., J. Electroanal.Chem. 78: 195-201 (1977);
Both are hereby incorporated by reference). When using a carbon-based electrode, A is an amino moiety (preferably a primary amine; for example, Deinhammer et al.
l., Langmuir 10: 1306-1313 (1994)). Thus, preferred A parts include, but are not limited to, a silane moiety, a sulfur moiety (including an alkyl sulfur moiety) and an amino moiety. In a preferred embodiment, no epoxide-type linkage with a redox polymer as known in the art is used.

Although described herein as only one part, the insulator and the conductive oligomer may be associated with the electrode at one or more “A” parts; the “A” parts may be the same or different. obtain. Thus, for example, when the electrode is a gold electrode and “A” is a sulfur atom or moiety, a plurality of sulfur atoms generally couple the conductive oligomer to the electrode, as described in Structures 11, 12 and 13 below. Can be used to As will be appreciated by those skilled in the art, such other structures can be manufactured. In structures 11, 12 and 13, the A portion is only a sulfur atom, but substituted sulfur moieties may be used.

[0082]

Embedded image

[0083]

Embedded image

[0084]

Embedded image

It should also be noted that, like Structure 13, it is possible to have a conductive oligomer where the three sulfur moieties terminate at one carbon atom attached to the electrode. Further, although not necessarily described herein, conductive oligomers and insulators may also be referred to as "
It may include a Q "end group.

In a preferred embodiment, the electrode is a gold electrode and the bond is through a sulfur bond as is known in the art, ie, part A is a sulfur atom or moiety. Although the exact nature of the gold-sulfur bond is not known, this bond is considered a covalent bond for the purposes of the present invention. Exemplary structures are described in Structure 14 using the conductive oligomer of Structure 3, but for all structures described herein, any conductive oligomer or combination of conductive oligomers may be used. Similarly, any conductive oligomer or insulator may include the end groups described herein. Structure 14 describes that the “A” linker contains only sulfur atoms, but other atoms may be present (ie, a linker from sulfur to a conductive oligomer or to a substituent). Further, Structure 1
4 represents a sulfur atom bonded to the Y aromatic group, and as apparent to those skilled in the art, B-
The D group (ie, acetylene) can be similarly attached.

[0087]

Embedded image

In a preferred embodiment, the electrode is a carbon electrode, ie, a glassy carbon electrode, and the bond is through the nitrogen atom of the amine group. A representative structure is shown in Structure 15. Yet another atom may be present, ie, a Z-type linker and an X or end group.

[0089]

Embedded image

[0090]

Embedded image

In structure 16, the oxygen atoms are derived from the oxide of the metal oxide electrode. The Si atom can include other atoms, ie, can be a silicon moiety that includes a substituent. SA
Other couplings of M to other electrodes are known to those skilled in the art. Reference, for example, Napi
er et al., Langmuir, 1997. For binding to indium tin oxide electrodes and also for chemisorption of phosphates on indium tin oxide electrodes (H. Holden Tho
rpe, CHI conference, May 4-5, 1998).

[0092] In a preferred embodiment, the electrode comprising a monolayer comprising a conductive oligomer further comprises a nucleic acid and a capture probe. As used herein, the term "nucleic acid" or "oligonucleotide" or equivalents means at least two nucleotides covalently linked together. The nucleic acids of the invention generally contain phosphodiester linkages, but optionally include nucleic acid analogs that may have alternating backbones, as outlined below, such as phosphoramides (Beaucage et al., Tetrahedoron 4).
9 (10): 1925 (1993) and references described therein, Letsinge.
r, J. Org. Chem. 35: 3800 (1970); Sprinzl et al., Eur. J. Biochem.
81: 579 (1977); Letsinger et al., Nucl. Acids Res. 14: 3487.
(1986); Sawai et al., Chem. Lett. 805 (1984); Letsinger et al.
Am. Chem. Soc. 110: 4470 (1988), and Pauwels et al., Chemica Sc.
ripta 26: 141 91986)), phosphorothioate (Mag et al., Nucleic Ac).
ids Res. 19: 1437 (1991), and U.S. Patent No. 5,644,048).
, Phosphorodithioates (Briu et al., J. Am. Chem. Soc. 111: 2321 (19
89), O-methyl phosphoramidite chain (Eckstein, Oligonucleotides and
Analogues: A Practical Approach, see Oxford University Press), and peptide nucleic acid backbones and linkages (Egholm, J. Am. Chem.
Soc. 114: 1895 (1992); Meier et al., Chem. Int. Ed. Engl., 31.
: 1008 (1992), Nielsen, Nature, 365: 566 (1993), Car
Isson et al., Nature 380: 207 (1996), all of which are incorporated herein by reference). Other similar nucleic acids include a positive backbone (Denpcy et al.,
Proc. Natl. Acad. Sci. USA, 92: 6097 (1995)), non-ionic backbone (US Pat. No. 5,386,023, 5637684, 5602240, 521).
6141 and 446963, Kiedrowshi et al., Angew. Chem. Intl. Ed. Eng.
lish, 30: 423 (1991); Letsinger et al., J. Am. Chem. Soc., 110:
4470 (1988); Letsinger et al., Nucleoside & Nucleotide, 13: 159.
7 (1994), Chapters 2 and 3, ASC Symposium Series 580, "Carboh
ydrate Modifications in Antisense Research ”, YS Sanghui and P. Dan C
ook, Mesmaeker et al., Bioorganic & Medicinal Chem. Lett., 4: 395 (19
94), Jeffs et al., J. Biomolecular NMR, 34:17 (1994), Tetrahedro.
n Lett. 37: 743 (1996)) and with a non-ribose backbone, for example, US Pat.
Chapter, ASC Symposium Series 580, “Carbohydrate Modifications in An
tisense Research ", edited by YS Sanghui and P. Dan Cook. Nucleic acids containing one or more carbocyclic saccharides are also included in the definition of nucleic acid (
Jenkins et al., Chem. Soc. Rev. (1995) pp. 169-176). Some nucleic acid analogs are reported in Rawls, C & E News, June 2, 1997, page 35. All of these references are specifically incorporated by reference. Adding these modifications to the ribose-phosphate backbone simplifies the addition of ETMs,
Alternatively, the stability and half-life of the molecule in a physiological environment may be increased.

As will be appreciated by those skilled in the art, all of these nucleic acid analogs can be used in the present invention. In addition, mixtures of naturally occurring nucleic acids and analogs can be produced. For example, analogous structures may be used at the transmitting oligomer or ETM binding site. Alternatively, a mixture of different nucleic acid analogs, and a mixture of naturally occurring nucleic acids and analogs can be produced.

[0094] Particularly preferred are peptide nucleic acids (PNA), including peptide nucleic acid analogs. In contrast to the highly charged phosphodiester backbones of naturally occurring nucleic acids, these backbones are substantially non-ionic under neutral conditions. by this,
Two advantages are obtained. First, the PNA backbone exhibits improved hybridization kinetics. PNA has a greater change in melting temperature (Tm) at mismatched versus perfectly matched base pairs. DNA and RNA typically exhibit a 2-4 ° C drop in Tm in case of internal mismatch. For a non-ionic PNA backbone, the drop is close to 7-9 ° C. This makes it easier to detect a mismatch. Similarly, due to their non-ionic nature, hybridization of bases attached to these backbones is relatively insensitive to salt concentration. This is particularly advantageous in the system of the present invention because the reduced salt hybridization solution has a lower Faraday current (in the 150 mM range) than the physiological salt solution.

The nucleic acids may be single or double stranded, as specified, or may include portions of both double stranded or single stranded sequence. The nucleic acid can be DNA, both genomic and cDNA, RNA or hybrid, where the nucleic acid is any combination of deoxyribo- and ribo-nucleotides, and uracil, adenine, thymine, cytosine, guanine, inosine, xanthine, hypo Includes any combination of bases including xanthine, isocytosine, isoguanine, and the like. A preferred embodiment is a nucleic acid designed to be complementary to other probes rather than the target sequence to reduce non-specific hybridization, as described generally in US Pat. No. 5,681,702. Use isocytosine and isoguanine.
As used herein, the term "nucleoside" includes nucleotides and nucleosides and nucleotide analogs, as well as modified nucleosides, such as amino-modified nucleosides. Further, "nucleoside" includes non-naturally occurring analogous structures. That is, individual units of a peptide nucleic acid, for example, each containing a base, are referred to herein as a nucleoside.

[0096] The capture probe nucleic acid is covalently attached to the electrode. This attachment may be through a conductive oligomer or through an insulator. As used herein, "capture probe" or "anchor probe" refers to a component of an assay complex as defined herein, which allows a target sequence to be attached to an electrode for detection purposes. .
As outlined in more detail below, the attachment of the target sequence to the capture probe can be direct (ie, the label sequence hybridizes to the capture probe) or indirect (ie, one or more capture extension probes are Used). As used herein, “covalently attached” means that the two moieties are attached by at least one bond, and includes sigma bonds, pi bonds, and coordination bonds. Further, as outlined in more detail below, the capture probe may have both a nucleic acid portion and a non-nucleic acid portion. Thus, for example, a flexible linker, such as an alkyl group including a polyethylene glycol linker, may be used to keep the nucleic acid portion of the capture probe away from the electrode surface. This is particularly useful when the target sequence is large, for example, when genomic DNA or rRNA is the target. An example of the use of a capture probe consisting of a flexible ethylene glycol linker is shown in Example 13.

[0097] The capture probe nucleic acid is covalently linked to the electrode via an "attachment linker" (conductive oligomer or insulator). Thus, one end of the binding linker binds to the nucleic acid and the other end (which will be apparent to those skilled in the art, but need not be the exact terminus at either) binds to the electrode. Thus, any of the structures described herein further include:
It may effectively include a nucleic acid as a terminal group. Therefore, the present invention generally relates to the following structure 2
A composition comprising a nucleic acid covalently linked to an electrode as described in item 9.

[0098]

Embedded image

In the structure 17, the hatched symbols on the left represent electrodes. X is a conductive oligomer, and I is an insulator, as defined herein. F1 is a bond that results in a covalent bond between the electrode and the conductive oligomer or insulator, and includes a bond, atom or linker as described herein, for example, as defined below as "A". F2 is a bond that covalently attaches the conductive oligomer or insulator to the nucleic acid, and may be a bond, an atom, or a bond as described herein. F2 can be part of a conductive oligomer, part of an insulator, part of a nucleic acid, or for example, "Z" herein.
Can be exogenous to both as defined for

[0100] In a preferred embodiment, the capture probe nucleic acid is covalently linked to the electrode via a conductive oligomer. Covalent attachment of the nucleic acid to the conductive oligomer can be achieved in several ways. In a preferred embodiment, the linkage is via linkage to the base of the nucleoside, via linkage to the backbone of the nucleic acid (either to ribose, phosphate or a similar group of the nucleic acid analog backbone), or Via a transition metal ligand as shown in FIG. Although the techniques outlined below generally describe naturally occurring nucleic acids, similar techniques will be used with nucleic acid analogs, as will be apparent to those skilled in the art.

In a preferred embodiment, the conductive oligomer is attached to the nucleoside base of the nucleic acid. This is done in several ways by the oligomer, as described below. In one embodiment, the oligomer is a terminal nucleoside, ie, 3 'of the nucleic acid.
Or linked to either the 5 'nucleoside. Alternatively, a conductive oligomer is attached to an internal nucleoside.

The point of attachment to a base varies with the base. Usually, it can be connected to any position. In some embodiments, for example, when a probe containing an ETM is used for hybridization, it is preferred to bind to a position that does not participate in hydrogen bonding with a complementary base. Thus, for example, it is generally attached at the 5- or 6-position of pyrimidines such as uridine, cytosine and thymine. In the case of purines such as adenine and guanine, they are preferably linked at the 8-position. It is preferable to bind to a non-standard base at a substantial position.

In one embodiment, the bond is direct, ie, no atoms are sandwiched between the conductive oligomer and the base. In this embodiment, for example, a conductive oligomer having a terminal acetylene linkage is directly attached to the base. Structure 18 is an example of this linkage, using uridine as the base and the conductive oligomer of structure 3, but other bases and conductive oligomers can be used, as will be apparent to those skilled in the art:

[0104]

Embedded image

It should be noted that other groups such as hydrogen, hydroxy, phosphate or amino groups are attached to the pentose structures shown herein. Further, the pentose and nucleoside structures depicted herein are non-conventionally shown as mirror images of the usual expression. In addition, the pentose and nucleoside structures can also contain new groups at any position, for example, as needed during synthesis, such as protecting groups.

In addition, the base may optionally contain further modifications, as described, for example, in FIG. 18A of PCT / US97 / 20014, ie to alter or protect the carbonyl or amine group. You can also. This may be required to prevent significant dimerization of the conductive oligomer as well as coupling to the iodinated base. Furthermore, changing the components of the palladium reaction is also preferred. The R groups are preferably on long conductive oligomers to increase solubility.

In another embodiment, the linkage is generally through a number of different Z-linkers, including amide and amine linkages, as shown in Structure 19 using uridine as the base and an oligomer of Structure 3:

[0108]

Embedded image

[0109] In this embodiment, Z is a linker. Preferably, Z is a short linker of about 1 to about 10 atoms, preferably 1 to 5 atoms, which may or may not contain a bond such as an alkene, alkynyl, amine, amide, azo, imine and the like. Good. Linkers are known in the art, for example, as is well known, are homo- or heterobifunctional linkers (1994 Pierce Chemical Company catalog,
technical section on cross-linker, pages 155-200, incorporated herein by reference). Preferred Z linkers include, but are not limited to, alkyl groups (including substituted alkyl groups and alkyl groups containing a heteroatom moiety), and are preferably short alkyl groups, esters, amides, amines, epoxy groups. And ethylene glycol and derivatives, particularly preferred are propyl,
Acetylene and C2 alkenes. Z may also be a sulfone group,
A sulfonamide bond is formed as described below.

In a preferred embodiment, attachment of the nucleic acid to the conductive oligomer is via attachment to the nucleic acid backbone. This can be accomplished in a number of ways, including binding the ribose-phosphate backbone to ribose or the backbone to phosphate, or to other groups of the similar backbone.

As a preliminary matter, it should be understood that the binding site in this embodiment is the 3 ′ or 5 ′ terminal nucleotide, or an internal nucleotide, as described more fully below.

In a preferred embodiment, the conductive oligomer is attached to the ribose of the ribose-phosphate backbone. This can be implemented in several ways. As is known in the art, nucleosides modified at either the 2 'or 3' position of ribose with an amino, sulfur, silicon, phosphorus, or oxo group can be made (Imazawa et al.
., J. Org. Chem., 44: 2039 (1979); Hobbs et al., J. Org. Chem. 42 (4): 7
14 (1977); Verheyden et al., J. Org.Chem. 36 (2): 250 (1971); McGee et
al., J. Org.Chem. 61: 781-785 (199); Mikhailopulo et al., Liebigs. Ann.
Chem. 513-519 (1993); McGee et al., Nucleosides & Nucleotides 14 (6): 1
329 (1995), all of which are incorporated herein by reference). These modified nucleosides are then used to add conductive oligomers.

A preferred embodiment utilizes amino-modified nucleosides. At this time, these amino-modified ribose can be used to form an amide or amine bond to the conductive oligomer. In a preferred embodiment, the amino group is attached directly to the ribose, but as will be apparent to those skilled in the art, a short linker as described for "Z" can be provided between the amino group and the ribose.

In a preferred embodiment, an amide bond is used to attach to ribose.
Preferably, if a conductive oligomer having a structure 1 to 3 is used, since m is 0, the terminal of the conductive oligomer is an amide bond. In this embodiment, the nitrogen of the amino group of the amino-modified ribose is the "D" atom of the conductive oligomer. Therefore,
A preferred linkage of this embodiment is shown in Structure 20 (using a conductive oligomer of Structure 3).

[0115]

Embedded image

As will be apparent to those skilled in the art, Structure 20 has terminal bonds fixed as amide bonds.

In a preferred embodiment, a heteroatom bond is used, ie, oxo, amine, sulfur, and the like. A preferred embodiment utilizes an amine linkage. Also, as outlined above for the amide bond, the amine of amino-modified ribose may be the "D" atom of the conductive oligomer when a conductive oligomer of structure 3 is used for the amine bond as well. Thus, for example, structures 21 and 22 show nucleosides with conductive oligomers of structures 3 and 9, respectively, using nitrogen as a heteroatom, but other heteroatoms can be used:

[0118]

Embedded image

In structure 21, preferably neither m nor t is 0. Preferred Z here is a methylene group or other aliphatic alkyl linker. One, two or three carbons in this position are particularly useful during synthesis (PCT / US97 / 20014).

[0120]

Embedded image

In Structure 22, Z is as defined above. Suitable linkers include methylene and ethylene.

[0122] In another embodiment, the conductive oligomer is a ribose-phosphate backbone of the nucleic acid.
(Or an analog) to the nucleic acid via a phosphate. In this embodiment, the linkage is direct or utilizes a linker or amide linkage. Structure 23 shows a direct bond and structure 24 shows a bond via an amide bond (
Both utilize conductive oligomers of structure 3, but conductive oligomers of structure 8 are also possible). Structures 23 and 24 show the conductive oligomer at the 3 'position, but the 5' position is also possible. Further, while structures 23 and 24 both show natural phosphodiester linkages, non-standard analogs of phosphodiester linkages can be used, as will be apparent to those skilled in the art.

[0123]

Embedded image

In structure 23, when Y exists at the terminal (ie, m = 1), Z does not exist (ie,
t = 0) is preferable. If Y is not present at the end, Z is preferably present.

Structure 24 illustrates a preferred embodiment wherein the terminal BD bond is an amide bond, there is no terminal Y, and Z is a linker as defined above.

[0126]

Embedded image

In a preferred embodiment, the conductive oligomer is covalently linked to the nucleic acid via a transition metal ligand. In this embodiment, the conductive oligomer is covalently linked to a ligand that provides one or more coordination atoms to the transition metal. In one embodiment, a nucleic acid is also attached to the ligand to which the conductive oligomer is attached, as shown generally in Structure 25 below. Alternatively, the conductive oligomer is attached to one ligand and the nucleic acid is attached to another ligand, as shown generally in Structure 26 below. Thus, the conductive oligomer is covalently bound to the nucleic acid in the presence of the transition metal. Each of these structures shows the conductive oligomer of Structure 3, but other oligomers can be used. Structures 25 and 26 show two representative structures:

[0128]

Embedded image

[0129]

Embedded image

[0130] In the structures described herein, M is a metal atom, preferably a transition metal. Transition metals suitable for use in the present invention are cadmium (Cd), copper (Cu), cobalt (C
o), palladium (Pd), zinc (Zn), iron (Fe), ruthenium (Ru),
Rhodium (Rh), osmium (Os), rhenium (Re), platinum (Pt), scandium (Sc), titanium (Ti), vanadium (V), chromium (Cr)
, Manganese (Mn), nickel (Ni), molybdenum (Mo), technetium (
Tc), tungsten (W), iridium (Ir), and the like, but are not limited thereto. That is, the first series of transition metals, the platinum group (Ru
, Rh, Pd, Os, Ir and Pt) and Fe, Re, W, Mo and Tc
Is preferred. Particularly preferred are ruthenium, rhenium, osmium, platinum, cobalt and iron.

L is an ancillary ligand that provides a coordination atom for metal ion binding. As those skilled in the art will recognize, the number and nature of the auxiliary ligands will depend on the coordination number of the metal ion. The monodentate, bidentate or polydentate auxiliary ligand may be used at any position. So, for example,
If the metal has a coordination number of 6, L from the end of the conductive oligomer, L provided from the nucleic acid, and r are added up to 6. Therefore, when the metal has six coordination numbers, r is 0.
(When all coordinating atoms are provided by the other two ligands) to 4 (when all ancillary ligands are monodentate). Thus, in general, r will be between 0 and 8, depending on the coordination number of the metal ion and the choice of other ligands.

In certain embodiments, the metal ion has a coordination number of 6, and the ligand attached to the conductive oligomer and the ligand attached to the nucleic acid are both at least dimers; That is, r is preferably 0, 1 (ie, the remaining auxiliary ligand is a dimer) or 2 (two monodentate auxiliary ligands are used).

As recognized in the art, the auxiliary ligands can be the same or different. Suitable ligands fall into two categories: nitrogen, oxygen, sulfur, carbon or phosphorus as coordinating atoms (generally referred to in the literature as sigma (σ) donors). Ligands using atoms; and organometallic ligands such as metallocene ligands (generally referred to as pi (π) donors in the literature and are denoted by L _m in this specification). Suitable nitrogen donating ligands are well known in the art, the following is not intended to be limited to these include _{those: NH 2; NHR; NRR '} ; pyridine; pyrazine; isonicotinamide; imidazole; bipyridine and Substituted derivatives of bipyridine;
Terpyridine and substituted derivatives; phenanthroline, especially 1,10-phenanthroline (abbreviated as phen) and substituted derivatives of phenanthroline, for example 4,
7-dimethylphenanthroline and dipyrido [3,2-a: 2 ′, 3′-c] phenazine (abbreviated as dppz); dipyridophenazine; 1,4,5,8,9,12
-Hexaazatriphenylene (abbreviated as hat); 9,10-phenanthrenequinone diimine (abbreviated as phi); 1,4,5,8-tetraazaphenanthrene (
tap); 1,4,8,11-tetra-azacyclotetradecane (cyc
lam)), EDTA, EGTA and isocyanides. Substituted derivatives, including fused derivatives, can also be used. In some embodiments, porphyrins and substituted derivatives of the porphyrin family may be used. For example, Compre
hensive Coordination Chemistry, Ed. Wilkinson et al., Pergammon Press, 1
987, Chapters 13.2 (pp 73-98), 21.1 (pp 813-898) and 21.3 (pp 915-957). The entirety of this document is specifically incorporated herein by reference.

Suitable sigma donating ligands using carbon, oxygen, sulfur and phosphorus are known in the art. For example, a suitable sigma carbon donor is available from Cotton and Wilkenson, Advanced O
rganic Chemistry, 5th Edition, John Wiley & Sons, 1988, which is incorporated herein by reference; see, eg, page 38. Similarly, suitable oxygen ligands include crown ethers, water, and others known in the art. Phosphine and substituted phosphines are also suitable; Cotton and Wilkenson's 3
See page 8.

Oxygen, sulfur, phosphorus and nitrogen-donating ligands are attached in such a way that the heteroatom acts as a coordinating atom.

In a preferred embodiment, an organometallic ligand is used. In addition to pure organic compounds used as redox moieties, and various transition metal coordination complexes with δ-bonded organic ligands having donor atoms as heterocyclic or exocyclic substituents, π-bonded organic ligands A variety of transition metal organometallic compounds are available (Advanced Inorg
anic Chemistry, 5th Ed., Cotton & Wilkinson, John Wiley & Sons, 1988, Ch
apter 26; Organometallics, A Concise Introduction, Elschenbroich et al.,
2nd Ed., 1992, VCH; and Comprehensive Organometallic Chemistry II, A
Review of the Literature 1982-1994, Abel et al. Ed., Vol. 7, Chapters 7,
8, 10 & 11, Pergamon Press, specifically incorporated herein by reference). Such organometallic ligands, cyclopentadienide ion _{[C 5 H 5 (-1)} ] cyclic aromatic compounds and various ring substituted and ring fused derivatives, such as, for example, Indenirido (
-1) ions and the like, a group of bis (cyclopentadienyl) metal compounds (
Ie, metallocenes); see, for example, Robins et al., J. Am. Chem. So
c., 104: 1882-1893 (1982); and Gassman et al., J. Am. Chem. Soc., 108:
4228-4229 (1986); which are incorporated herein by reference.
Of these, ferrocene [(C ₅ H ₅ ) ₂ Fe] and its derivatives have been incorporated herein by various chemicals (Connelly et al., Chem. Rev. 96: 877-910 (1996), incorporated by reference). And electrochemical (Geiger et al., Advances in Organomet
allic Chemistry 23: 1-93; and Geiger et al., Advances in Organometalli
c Chemistry 24:87, incorporated herein by reference) Examples of prototypes used in electron transfer or "redox" reactions. Various first,
Metallocene derivatives of the second and third row transition metals are strong candidates as redox moieties covalently attached to either the ribose ring or the nucleoside base of nucleic acids. Other potentially suitable organometallic ligands, including cyclic allenes such as benzene, produce bis (arene) metal compounds and their ring-substituted and fused derivatives, where the bis (benzene) chromium is It is an example of a prototype. Other acyclic π-bonded ligands such as the allyl (-1) ion or butadiene potentially produce suitable organometallic compounds, all such ligands containing other π-bonds and δ
Cooperate with the binding ligands to form a general class of organometallic compounds having metal-carbon bonds. Electrochemical studies of various dimers and oligomers of such compounds, with bridged organic ligands and additional non-bridged ligands, as well as with and without metal-metal bonds, are promising in nucleic acid analysis. It is a candidate redox part.

When the one or more ancillary ligands is an organometallic ligand, the ligand will generally be attached via one of the carbon atoms of the organometallic ligand, provided that the attachment is heterocyclic It may be via another atom to the ligand. Suitable organometallic ligands include substituted derivatives and metallocene ligands, including metallocene ophane (see Cotton and
See Wilkenson, p. 1174). For example, a metallocene ligand derivative such as methylcyclopentadienyl, preferably pentamethylcyclopentadienyl having a plurality of methyl groups, may be used to increase the stability of the metallocene. In a preferred embodiment, only one of the two metallocene ligands of the metallocene is derivatized.

[0138] As described herein, any combination of ligands may be used. Preferred combinations are: a) all ligands are nitrogen donating ligands; b) all ligands are organometallic ligands; and c) terminal ligands of the conductive oligomer are metallocene coordination ligands. And the ligand provided by the nucleic acid is a nitrogen-administering ligand, including a nitrogen-administering ligand, if necessary, together with another ligand, which may be a nitrogen-donating ligand or a metallocene ligand or a ligand thereof. It is a mixture. These combinations are described in Representative Examples Using Conducting Oligomers of Structure 3 and include structures 27 (using phenanthroline and amino as representative ligands), 28 (using ferrocene as a metal-ligand combination). ) And 29 (using cyclopentadienyl and amino as representative ligands). Structure 27

Embedded image Structure 28

Embedded image Structure 29

Embedded image

In a preferred embodiment, the ligands used in the present invention exhibit different fluorescent properties, depending on the redox state of the chelated metal ion. As described below, this therefore acts as another mode of detection of electron transfer between the ETM and the electrodes.

In a preferred embodiment, as shown in more detail below, the ligand attached to the nucleic acid is an amino group attached at the 2 'or 3' position of the ribose of the ribose-phosphate backbone. This ligand forms a polydentate ligand that binds to the metal ion,
It may contain many amino groups. Other preferred ligands include cyclopentadiene and phenanthroline.

The use of metal ions to bind nucleic acids serves as an internal control or measurement of the system, allowing the number of available nucleic acids on the surface to be determined. However, as will be apparent to those skilled in the art, when metal ions are used to link nucleic acids to conductive oligomers, a redox potential different from the redox potential of the ETM used in the rest of the system will be applied to this metal, as described below. It is usually desirable that the ionic complex has. This is commonly done so that the presence of the capture probe can be distinguished from the presence of the target sequence. This is useful for identification, measurement and / or quantification. Thus, by comparing the amount of capture probe at the electrode with the amount of hybridized double-stranded nucleic acid, the amount of target sequence in the sample can be quantified. This is very important to function as a sensor or internal control of the system. This allows for the measurement of the same molecule used for detection, either before or after adding the target, rather than relying on a similar but different control system. Thus, the actual molecule used for detection can be quantified prior to any experiment. This is a significant advantage over previous methods.

[0142] In a preferred embodiment, the capture probe nucleic acid is covalently attached to the electrode via an insulator. The binding of nucleic acids to insulators, such as alkyl groups, is well known and binds to the base or backbone containing ribose or phosphate of the backbone containing these moieties, or to another backbone of a nucleic acid analog.

In preferred embodiments, one or more different capture probe species may be present on the surface, as generally depicted in the figures. In some embodiments, as described in more detail below, there may be one type of capture probe or one type of capture probe extender. Alternatively, different capture probes, or one capture probe with a variety of different capture extension probes, may be used. Similarly, it may be desirable to use an auxiliary capture probe that includes a relatively short probe sequence, which may be used to connect a component of the system, eg, a recruitment linker to “
"Erase", the ETM concentration on the surface can be increased.

Thus, the present invention comprises a monolayer comprising a conductive oligomer and a capture probe,
An electrode useful for a nucleic acid detection system is provided. In a preferred embodiment, the composition further comprises a labeled probe. Labeled probes are nucleic acids, generally single-stranded, but may include double-stranded portions, as outlined in more detail below. The labeled probe comprises a first portion capable of hybridizing to an assay complex component as defined below and a second portion that does not hybridize to the assay complex component, and includes at least one covalently attached ETM.

Thus, a labeled probe having an ETM attached by a covalent bond is provided. As used herein, "electron donor moiety", "electron acceptor moiety", and "ET
The term M "(ETM) or grammatical equivalent refers to a molecule capable of electron transfer under certain conditions. It is to be understood that the acceptability of electron donors and acceptors is relative. That is, a molecule that loses electrons under certain experimental conditions can accept electrons under different experimental conditions, the number of possible electron donor and electron acceptor moieties is very large, and It should also be understood that those skilled in the art of electron transfer compounds will be able to utilize many compounds in the present invention.
Suitable ETMs include, but are not limited to, transition metal complexes, organic ETMs, and electrodes.

In a preferred embodiment, the ETM is a transition metal complex. Transition metals are those whose atoms have a partial or complete d-shell of electrons. Suitable transition metals for use in the present invention are listed above. The transition metal forms a complex with the various ligands L defined above, resulting in a suitable transition metal complex known in the art.

In addition to transition metal complexes, other organic electron donors and acceptors may be used in the present invention.
May be covalently attached to the nucleic acid. These organic molecules are
Bottle, xanthene dye, azine dye, acridine orange, N, N'-dimethyl
-2,7-diazapyrenium dichloride (DAP²⁺), Methyl viologen,
Ethidium bromide, quinones such as N, N'-dimethylanthra (2,1,9
-Def. 6,5,10-d'e'f ') diisoquinoline dichloride (ADIQ ²⁺ ); Porphyrin ([meso-tetrakis (N-methyl-x-pyridinium)
Luffyrin tetrachloride]), berramine blue B hydrochloride, bindshed
Bindschedler green; 2,6-dichloroindophenol, 2,6-
Dibromophenol indophenol; Brilliant Crest Blue (chloride 3
-Amino-9-dimethylamino-10-methylphenoxyazine), methylene butyl
Lou; Nile Blue A (Aminoaphthodiethylaminophenoxazine sulfate)
, Indigo-5,5 ', 7,7'-tetrasulfonic acid, indigo-5,5', 7-
Trisulfonic acid; phenosafranine, indigo-5-monosulfonic acid; safrani
Bis (dimethylglyoximato) iron (II) chloride; indulin scare
, Neutral red, anthracene, coronene, pyrene, 9-phenyla
Anthracene, rubrene, binaphthyl, DPA, phenothiazine, fluoranthene
, Phenanthrene, chrysene, 1,8-diphenyl-1,3,5,7-octate
Toracene, naphthalene, acenaphthalene, perylene, TMPD and their compounds
Analogs and substituted derivatives, but are not limited to these.

[0148] In one embodiment, the electron donor and acceptor are redox proteins known in the art. However, in many embodiments, redox proteins are not preferred.

The choice of a specific ETM is influenced by the type of electron transfer detection used, as outlined generally below. A preferred ETM is metallocene, with ferrocene being particularly preferred.

In a preferred embodiment, multiple ETMs are used. As described in the Examples, the use of multiple ETMs provides amplification of the signal, thereby allowing for more sensitive detection limits. As described below, the use of multiple ETM on nucleic acids that hybridize to complementary strands, the number of attachment, whereas to cause the T _m decreased hybridization complexes depending site, and the space between the plurality ETM, ETM is When on the recruiting linker, this is not a factor, as it does not hybridize to the complementary sequence. Thus, multiple ETMs are preferred, with at least about 2 ETMs per supplemental linker being preferred, at least about 10 being particularly preferred, and at least about 20 to 50 being particularly preferred. In some cases, a very large number of ETMs (100-1000) can be used.

As the skilled artisan will appreciate, is the portion of the label probe (or in some embodiments the target) comprising the ETM (referred to herein as a "recruitment linker" or "signal carrier") a nucleic acid? Alternatively, it may be a non-nucleic acid linker that connects the first hybridizable portion of the label probe to the ETM.
That is, since this part of the label probe does not require hybridization,
It is not necessary that it be a nucleic acid, even if it can be easily synthesized. In certain embodiments, as described in more detail below, the recruitment linker can comprise a double-stranded moiety. Thus, as the skilled artisan will appreciate, there are a variety of configurations that can be used. In a preferred embodiment, the recruitment linker is a nucleic acid (including analogs) and attachment of the ETM is possible via: (1) base; (2) ribose,
A backbone containing a structure comparable to a phosphate ester or a nucleic acid analog; (3)
The following nucleoside substitution products; or (4) the following metallocene polymers. In a preferred embodiment, the recruitment linker is non-nucleic acid and is either a metallocene polymer or an alkyl-type polymer containing ETM substituents (including heteroalkyl, as described in more detail below). These options are generally illustrated in the figures.

[0152] In a preferred embodiment, the recruiting linker is a nucleic acid, comprising a covalently attached ETM. ETMs may be attached to nucleosides in nucleic acids at various locations. Preferred embodiments include (1) attachment to nucleoside bases, (2) attachment of ETMs as base substitutes, (3) analogous structures to the ribose or phosphate moieties of the ribose-phosphate backbone, or nucleic acid analogs. And (4) attachment via a metallocene polymer, the latter being preferred, but not limited thereto.

Further, when the recruitment linker is a nucleic acid, as described below, it is desirable to use a second label probe, which probe hybridizes to a portion of the first label probe as defined herein. And a second portion comprising a recruitment linker. This is generally illustrated in FIG. 16H; this is similar to the use of an amplifier probe, except where both the first and second label probes comprise an ETM.

In a preferred embodiment, for the attachment of the conductive oligomer, it is attached to the base of the nucleoside as generally outlined above. Attachment is to an internal or terminal nucleoside.

[0155] Covalent attachment to a base depends on the moiety on the ETM chosen, but is generally similar to the attachment of a conductive oligomer to a base, as described above.
Attachment may generally be at any site on the base. In a preferred embodiment, E
TM is a transition metal complex, and thus attachment of the appropriate metal ligand to the base leads to covalent attachment of the ETM. Alternatively, as the skilled artisan will appreciate, a similar type of linkage may be used for attaching the organic ETM.

In one embodiment, the C4 attached amino group of cytosine, the C6 attached amino group of adenine, or the C2 attached amino group of guanine may be used as a transition metal ligand.

A ligand containing an aromatic group can be attached via an acetylene bond as is known in the art (Comprehensive Organic Synthesis, Trost et al., Ed., Perg.
amon Press, Chapter 2.4; Coupling Reactions Between sp ² and sp Carbon Ce
nters, Sonogashira, pp 521-549, and pp 950-953; incorporated herein by reference). Structure 30 illustrates a representative structure in the presence of a metal ion and other necessary ligands; although structure 30 illustrates uridine, other bases can be used throughout this specification. is there.

[0158]

Embedded image L _a is a ligand, including nitrogen, oxygen, organometallic ligands such as sulfur or phosphorus donating ligands or metallocene ligands. Suitable ligand L _a is phenanthroline, imidazole, etc. bpy and terpy, but not limited thereto. L _r and M are as defined above. Again, as the skilled artisan will appreciate, a linker ("Z") is included between the nucleoside and the ETM.

Similarly, for conductive oligomers, the linkage is made using a linker, which can utilize an amide bond (generally Telser et al., J.
Am. Chem. Soc. 111: 7221-7226 (1989); Telser et al., J. Am. Chem. Soc.
111: 7226-7232 (1989); both references are specifically incorporated herein by reference). These structures are shown generally in Structure 31 below. Again, uridine is used here as a base, but other bases can be used as described above.

Embedded image

In this embodiment, L is a ligand as defined above, and like L, M is as defined above. Preferably, L is amino, phen, byp and terpy
It is.

In a preferred embodiment, the ETM attached to the nucleoside is a metallocene; that is, L and Lr of Structure 31 are both metallocene ligands, and are L _{m '} as described above. Structure 32 illustrates a preferred embodiment, where the metallocene is ferrocene and the base is uridine, although other bases can be used.

Embedded image

Preliminary data suggests that Structure 32 is cyclizable, with the secondary acetylene carbon atom attacking the carbonyl oxygen to form a furan-like structure. Suitable metallocenes include ferrocene, cobaltene and osmium oxene.

In a preferred embodiment, the ETM is attached to ribose at any position on the ribose-phosphate backbone of the nucleic acid, ie, at the 5 ′ or 3 ′ end or at any internal nucleoside. Ribose in this case includes a ribose analog. As is known in the art, nucleosides modified at either the 2 'or 3' position of ribose may be made possible by nitrogen, oxygen, sulfur and phosphorus-containing modifications. Amino-modified and oxygen-modified ribose are preferred. Generally, PC
See T Publication WO 95/15971, which is incorporated herein by reference. These modifying groups can be used as transition metal ligands, or as chemically functional moieties for attachment of other transition metal and organometallic ligands, or as organic electron donor moieties known to those skilled in the art. In this aspect,
A linker as illustrated herein as "Z" can be used as well, or a conductive oligomer between ribose and ETM. Preferred embodiments utilize attachment at the 2 'or 3' position of ribose, with the 2 'position being preferred. Thus, for example, the conductive oligomer illustrated in Structures 13, 14 and 15 can be replaced by an ETM; alternatively, the ETM may be added to the free end of the conductive oligomer.

In a preferred embodiment, the metallocene acts as an ETM and is attached via an amide bond as illustrated in Structure 33 below. The examples outline the synthesis of suitable compounds where the metallocene is ferrocene.

Embedded image

In a preferred embodiment, an amine linkage is used as shown generally in Structure 34.

Embedded image Z is a linker as defined herein, preferably having 1 to 16 atoms,
Two to four atoms are particularly preferred. t is 1 or 0.

In a preferred embodiment, an oxo bond is used as shown generally in Structure 35.

Embedded image In structure 35, Z is a linker as defined herein, and t is 1 or 0. Suitable Z linkers include alkyl groups including heteroalkyl groups such as (CH ₂ ) _n and (CH ₂ CH ₂ O) _n , where n is preferably 1 to 10,
n = 1 to 4 are particularly preferred, and n = 4 is particularly preferred.

[0167] Bonds utilizing other heteroatoms are also possible.

In a preferred embodiment, the ETM is attached to the phosphate at any position on the ribose-phosphate backbone of the nucleic acid. This can be done in various ways. In one embodiment, a phosphodiester bond analog, such as a phosphoramide or phosphoramidite bond, may be incorporated into the nucleic acid, where the heteroatom (ie, nitrogen) acts as a transition metal ligand (PCT Publication WO95 / 15971
See; incorporated herein by reference). Alternatively, the conductive oligomer illustrated in structures 23 and 24 may be replaced by ETM. In a preferred embodiment, the composition has the structure shown in Structure 36.

Embedded image

In structure 36, the ETM is attached via a phosphate bond, generally by using a linker Z. Suitable Z linkers are (CH ₂ ) _n , (CH ₂
CH ₂ O) _n , including an alkyl group including a heteroalkyl group, wherein n is 1 to 1
0 is preferred, n = 1 to 4 is particularly preferred, and n = 4 is particularly preferred.

If the ETM is attached to the base or backbone of the nucleoside, it is possible to attach the ETM via a “dendritic” structure, as outlined in more detail below. As shown generally in the figures, alkyl-based linkers can be used to create multiple branched structures comprising one or more ETMs at the end of each branch.
(Although the internal ETM could be used as well). Generally, this is accomplished by creating a branch point that contains a large number of hydroxy groups, which can be used to add additional branch points. The terminal hydroxy group is then used for the phosphoramidite reaction and can be added to the ETM as generally performed below for nucleoside substitution and metallocene polymer reactions. The branch point may be internal or terminal, and may be a chemical branch point or a nucleoside branch point.

In a preferred embodiment, an ETM such as a metallocene is used as a “nucleoside substituent” to operate as an ETM. For example, the distance between two cyclopentadiene rings of ferrocene is similar to the orthogonal distance between two bases in a double-stranded nucleic acid. In addition to ferrocene, other metallocenes may be used, for example, air-stable metallocenes such as those containing cobalt or ruthenium.
Thus, the metallocene moiety may be incorporated into the nucleic acid backbone, as generally illustrated in structure 37 (nucleic acid with a ribose-phosphate backbone) and structure 38 (peptide nucleic acid backbone). While structures 37 and 38 illustrate ferrocene, other metallocenes may be used as well, as those skilled in the art will recognize. In general, air-stable metallocenes are preferred, including metallocenes utilizing ruthenium and cobalt as metals.

[0172]

Embedded image In structure 37, Z is a linker as defined above, generally having a short alkyl group and preferably containing a heteroatom such as oxygen. In general, what is important is the length of the linker, as will be described in more detail below, such that minimal perturbation of the double-stranded nucleic acid is effected. Thus, methylene, ethylene,
Ethylene glycol, propylene and butylene are all preferred, and ethylene and ethylene glycol are particularly preferred. Further, each Z linker may be the same or different. Although structure 37 represents a ribose-phosphate backbone, as those skilled in the art will recognize, nucleic acid analogs such as ribose analogs and phosphate ester bond analogs may be used.

[0173]

Embedded image In Structure 38, suitable Z groups are as described above, but again, each Z linker may be the same or different. As mentioned above, other nucleic acid analogs may be used as well.

Further, while the above structures and discussions depict metallocenes, especially ferrocenes, using the same general idea, as described below, as a substituent of a nucleoside in addition to a metallocene, or in a polymer embodiment, ETM can be added.
Thus, for example, in the case of a transition metal complex other than a metallocene comprising one, two or three (or more) ligands, the ligand is functionalized as described for ferrocene and the phosphoramidite group Addition can be possible. In particular, preferred in this aspect are at least two rings (eg,
Aryl and substituted aryl) ligands, wherein:
Each ligand comprises a functional group for attachment by phosphoramidite chemistry. As the skilled artisan will appreciate, this type of reaction creates a polymer of the ETM as part of the nucleic acid backbone or as a "side group" of the nucleic acid to allow amplification of the signal generated here, It can be performed with virtually any ETM that can be functionalized to include the correct chemical groups.

Thus, nucleic acid analogs are prepared by inserting a metallocene such as ferrocene (or other ETM) into the backbone of a nucleic acid; that is, the present invention provides a backbone comprising at least one metallocene. A nucleic acid having the formula:
This is distinguished from metallocene-bearing nucleic acids attached to the backbone, ie, via ribose, phosphate esters, and the like. That is, each of two nucleic acids made from a traditional nucleic acid or analog, where the nucleic acid comprises a single nucleoside, can be covalently attached to each other via a metallocene. In a different aspect, a metallocene derivative or substituted metallocene is provided, wherein each of the two aromatic rings of the metallocene has a nucleic acid substituent.

Furthermore, as described in more detail below, it is possible to incorporate more than one metallocene into the backbone with nucleotides in between and / or with adjacent metallocenes. When an adjacent metallocene is added to the backbone, this is the same as the process described below as a "metallocene polymer"; that is, there are regions of the metallocene polymer within the backbone.

In addition to nucleic acid substituents, in some cases, it may be desirable to add additional substituents to one or both of the aromatic rings of the metallocene (or ETM). For example, because these nucleoside substitutions are generally a portion of a substantially complementary nucleic acid, e.g., a probe sequence to be hybridized to a target sequence or another probe sequence, a substituent is added to the metallocene ring to form the opposite strand. It is possible to facilitate hydrogen bond formation with one or more bases above. These may be added at any position on the metallocene ring. Suitable substituents include, but are not limited to, amide groups, amine groups, carboxylic acids, and alcohols, including substituted alcohols.
Furthermore, these substituents can be attached via a linker as well,
Generally not preferred.

Further, a substituent may be added to the ETM, particularly a metallocene such as ferrocene to form
The redox properties of M may be changed. Thus, for example, in some embodiments, as described in more detail below, different attached differently (ie, base or ribose attached), on different probes, or for different purposes (eg, as a calibration or internal reference) It is desirable to have an ETM. Thus, adding a substituent on the metallocene allows for the discrimination of two different ETMs.

Intermediate components are also provided to generate these metallocene-backbone nucleic acid analogs. Thus, in a preferred embodiment, the present invention provides a phosphoramidite metallocene, as generally depicted in Structure 39.

Embedded image

In Structure 39, PG is a protecting group, generally a group suitable for nucleic acid synthesis, with DMT, MMT, TMT, and the like all being suitable. The aromatic ring can be a metallocene ring or an aromatic ring of a transition metal complex or other ligand for an organic ETM. The aromatic rings can be the same or different and can be substituted as discussed herein.

Structure 40 illustrates a ferrocene derivative:

Embedded image

[0182] These phosphoramidite analogs can be added to standard oligonucleotide synthesis known in the art.

Structure 41 illustrates a ferrocene peptide nucleic acid (PNA) monomer, which can be added to the synthesis of PNA known in the art, and is shown in the figures and examples.

Embedded image In Structure 41, the PG protecting group is suitable for use in peptide nucleic acid synthesis, with MMT, boc, Fmoc and the like being preferred.

These same intermediate compounds can be used to form ETM or metallocene polymers, which are added to nucleic acids rather than as backbone substitutes, as described in more detail below.

In a preferred embodiment, the ETM is a polymer, for example, a metallocene polymer, as described in this specification and US Pat. No. 5,124,246. In a "branched" configuration, the modified functionalized nucleotide is attached using. The general idea is as follows. A modified phosphoramidite nucleotide is produced, which can ultimately contain a free hydroxy group that can be used for attachment of a phosphoramidite ETM such as a metallocene. The free hydroxy group can be on a base or backbone, such as ribose or phosphate ester (although those skilled in the art will recognize, nucleic acid analogs containing other structures can also be used). The modified nucleotide is incorporated into the nucleic acid and the hydroxy protecting group is removed, yielding free hydroxy. An ETM, such as a metallocene ETM, is added based on the addition of a phosphoramidite ETM, such as a metallocene, as described above in structures 39 and 40. Additional phosphoramidite ETMs such as metallocenes can be added to form "ETM polymers", including the "metallocene polymers" depicted herein for ferrocene, in particular. In addition, in some embodiments, the solubility of the polymer is increased by adding a “capping” group to a terminal ETM in the polymer, eg, a final phosphate group to the metallocene, as generally depicted in FIG. Desirably. Other suitable solubility-enhancing "capping" groups will be recognized by those skilled in the art. Note that these solubility-enhancing groups can be added to the polymer at the ligand ring, eg, at other positions of the metallocenes discussed herein.

A preferred embodiment of this general idea is outlined in the drawings. In this embodiment, the 2 'position of the ribose of the phosphoramidite nucleotide is first functionalized to include a hydroxy group protected in this case via an oxo bond, but with regard to the number of linkers, Any number may be used as generally described in the textbook. The protected modified nucleotide is then incorporated into the growing nucleic acid by standard phosphoramidite chemistry. The protecting group is removed and the phosphoramidite metallocene, such as ferrocene, is added using the free hydroxy group and again using standard phosphoramidite chemistry. Similar reactions are possible with nucleic acid analogs. For example, a peptide nucleic acid structure containing a metallocene polymer could be generated using the peptide nucleic acid shown in Structure 41 and a metallocene monomer.

Thus, the present invention provides a recruitment linker for nucleic acids comprising a “branch” of a metallocene polymer, as generally illustrated in FIGS. 12 and 13. In a preferred embodiment, the length of the metallocene is from 1 to about 50, preferably from about 5 to about 20
And particularly preferably about 5 to about 10 metallocene polymers are utilized.

Further, when the recruitment linker is a nucleic acid, a combination of ETMs is made. In a preferred embodiment, the recruitment linker is not a nucleic acid, but may instead be any type of linker or polymer. As those skilled in the art will recognize, ETM
General linkers or polymers that can be modified to include In general, the polymer or linker should be reasonably soluble and should contain appropriate functionalities for ETM addition.

[0189] As used herein, a "recruiting polymer" is at least 2 or 3
Subunits and are covalently attached. At least some of the monomer subunits contain functional groups for covalent attachment of the ETM. In some embodiments, the coupling moiety is used to covalently link the subunit and the ETM. Suitable functional groups for attachment are amino, carboxy,
Amino groups are particularly preferred, such as oxo and thiol groups. As the skilled artisan will appreciate, a variety of recruiting polymers are possible.

Suitable linkers include, but are not limited to, alkyl linkers (including heteroalkyl (including (poly) ethylene glycol type structures), substituted alkyl, arylalkyl linkers). For polymers, as described above, the linker comprises one or more functional groups for ETM attachment, and attachment is accomplished using art-recognized, for example, well-known homo- or hetero-bifunctional linkers. (See Pierce Chemical Company's 1994 catalog, section on techniques for crosslinkers, pages 155 to 200, which is hereby incorporated by reference).

Suitable recruiting polymers include, but are not limited to, functionalized styrenes, such as aminostyrene, functionalized dextran, and polyamino acids. Suitable polymers include polyamino acids such as polylysine (both poly-D-amino acids and poly-L-amino acids), and polymers containing lysine and other amino acids that are particularly preferred. Other suitable polyamino acids are polyglutamic acid, polyaspartic acid, copolymers of lysine with glutamic acid or aspartic acid, copolymers of lysine with alanine, tyrosine, phenylalanine, serine, tryptophan, and / or proline. is there.

In a preferred embodiment, the recruitment linker comprises a metallocene polymer as described above. The attachment of the recruiting linker to the first part of the label probe depends on the composition of the recruiting linker, as will be appreciated by those skilled in the art. When the recruiting linker is a nucleic acid, it generally has the required incorporation of the ETM-containing nucleoside,
It is formed during the synthesis of the first part of the label probe. Alternatively, the first portion of the label probe and the recruitment linker may be made separately and then attached. For example, there may be overlapping overlapping sections that form sections of double-stranded nucleic acid that can be chemically cross-linked, for example, by using psoralens known in the art. When using a non-nucleic acid recruiting linker, the linker / polymer attachment of the recruiting linker is generally performed using standard chemistry techniques as will be recognized by those skilled in the art.
For example, when using an alkyl-based linker, attachment is similar to insulator attachment to nucleic acids.

In addition, the recruitment linker, which is a mixture of nucleic acids and non-nucleic acids, may be in a linear form (ie, where the nucleic acid segments are attached with an alkyl linker) or in a branched form (including ETMs and further branched). (A nucleic acid having an alkyl "branch").

In a preferred embodiment, it is the target sequence itself that carries the ETM, rather than the recruitment linker of the labeled probe. For example, as described in more detail below, nucleotide triphosphates containing each ETM of the invention can be enzymatically added to growing nucleic acids, for example, during the polymerase chain reaction (PCR). As the skilled artisan will appreciate, some enzymes have been shown to be generally tolerant to modified nucleotides, but some of the modified nucleotides of the invention, e.g., "nucleoside substitutions" And possibly some phosphate ester attachment may or may not be recognized by enzymes that allow incorporation into growing nucleic acids. Thus, the preferred attachment in this embodiment is to a nucleotide base or ribose.

Thus, for example, as is well known to those of skill in the art, PCR amplification of a target sequence will result in the target sequence comprising an ETM that is generally randomly incorporated into the sequence. The system of the present invention can be configured to be detectable using these ETMs, as generally depicted in FIGS. 16A, 16B and 16D.

Alternatively, as described in more detail below, nucleotides comprising an ETM can be enzymatically added to the end of a nucleic acid, eg, to a target nucleic acid. In this embodiment, an effective "recruiting linker" can be added to the end of the target sequence and used for detection. Thus, the present invention provides a composition utilizing an electrode comprising a monolayer of a conductive oligomer and a capture probe, and a first portion capable of hybridizing to components of an assay complex; A target sequence which does not hybridize to the component and comprises a second moiety comprising at least one covalently attached electron transfer moiety. Also provided are methods of utilizing these compositions.

It is also possible to obtain an ETM linked to a probe sequence, ie, a sequence designed to hybridize to a complementary sequence. Thus, ETMs can be added to non-recruiting linkers as well. For example, there may be a label probe fragment that hybridizes to a component of the assay complex, eg, an ETM added to the first portion or to the target sequence described above. These ETMs may be used in some embodiments for electronic movement detection, or cannot be used depending on their location and system. For example, in one embodiment, for example, FIG.
As shown in A, when a target sequence containing a randomly incorporated ETM directly hybridizes to a capture probe, the ETM is present in the portion that hybridizes to the capture probe. If a capture probe attaches to an electrode using a conductive oligomer, these ETMs can be used to detect electron transfer as previously described. Alternatively, these ETMs may not be specifically detectable.

Similarly, in some embodiments, when the recruitment linker is a nucleic acid, it is desirable in some instances that some or all of the recruitment linker is double-stranded.
In one embodiment, there may be a second recruitment linker, which is substantially complementary to the first recruitment linker and capable of hybridizing to the first recruitment linker. In a preferred embodiment, the first recruitment linker comprises an ETM covalently attached. In another embodiment, the second recruitment linker comprises an ETM and no first recruitment linker, and the ETM is collected on its surface by the second recruitment linker hybridizing to the first. In yet another embodiment, both the first and second recruitment linkers are ET
M. It should be noted that, as noted above, nucleic acids comprising large numbers of ETMs do not hybridize as well, ie, the _Tm may be reduced depending on the attachment site and properties of the ETM. Thus, generally, when multiple ETMs are used for strand hybridization, they will generally be less than about 5, preferably less than about 3. Alternatively, the ETM should have sufficient spatial distance so that the intervening nucleotides hybridize sufficiently to allow good reaction rates.

In one embodiment, non-covalently attached ETMs may be used. In one aspect, the ETM is an indicator of hybridization. Indices of hybridization, as in the method of Milan et al., Are usually reversed, and ETs preferentially associate with double-stranded nucleic acids.
Activated when M is added (Millan et al., Anal. Chem. 65: 2317-2323 (
1993); Millan et al., Anal. Chem. 66: 2943-2948 (1994); both references are specifically incorporated herein by reference). In this embodiment, a local increase in ETM concentration due to the association of the double-stranded nucleic acid at the surface with an indicator of ETM hybridization can be monitored using a monolayer comprising a conductive oligomer. Indicators of hybridization include the intercalating agent and the minor and / or major groove binding portions. In a preferred embodiment, an intercalating agent may be used; since the insertion generally only occurs in the presence of double-stranded nucleic acid, the ETM concentrates only in the presence of double-stranded nucleic acid. Insertion of the transition metal complex ETM is known in the art. Similarly, a major or minor groove binding portion, eg, methylene blue, may be used in this embodiment.

Similarly, the systems of the present invention may utilize non-covalently attached ETMs, which are generally described by Napier et al., Bioconj. Chem. 8: 906 (1997) (particularly by reference herein. In the book). In this embodiment, a change in the redox state of a molecule as a result of the presence of DNA (ie, guanine oxidation by a ruthenium complex) can be detected using a SAM that also comprises a conductive oligomer.

Thus, the present invention provides an electrode comprising a conductive oligomer and generally comprising a capture probe and a monolayer comprising a target sequence or a recruitment linker containing an ETM and a labeled probe. In a preferred embodiment, the compositions of the invention are used to detect a target sequence in a sample. As used herein, the term "target sequence" or grammatical equivalent refers to a nucleic acid sequence on a single-stranded nucleic acid. The target sequence is
It may be a part of a gene, a regulatory sequence, genomic DNA, cDNA, RNA including mRNA and rRNA, and others. It is understood that the length is arbitrary, but longer sequences are more specific. As the skilled artisan will appreciate, the complementary target sequence can take many forms. For example, it may be contained within a larger nucleic acid sequence, ie, inter alia, all or part of a gene or mRNA, a plasmid or a restriction fragment of genomic DNA. As outlined in more detail below,
Probes are prepared to hybridize to the target sequence and determine the presence or absence of the target sequence in the sample. Generally, this term is understood by those skilled in the art. The target sequences may be comprised of different target domains; for example, a first target domain of a sample target sequence may hybridize to a portion of a capture probe or a capture extension probe, and a second target domain may comprise a portion of an amplification probe. In part, it may hybridize to a labeled probe, or a different capture or capture extension probe. The target domains may be adjacent or separate. The terms "first" and "second" are not meant to confer sequence orientation with respect to the 5'-3 'orientation of the target sequence. For example, assuming a 5'-3 'orientation of the complementary target sequence, the first target domain may be located 5' to the second domain, or may be located 3 'to the second domain. Good.

If desired, the target sequence is prepared using known techniques. For example, the sample is treated with a known lysis buffer, electroporation or the like for cell lysis, and if necessary, purification and / or amplification such as PCR is performed, as will be recognized by those skilled in the art.

The probes of the present invention are designed to be complementary to the target sequence (as described below, relative to the target sequence or other probe sequences in the sample), so that the target sequence and the probe of the present invention are Hybridization occurs. As outlined below, this complementarity need not be perfect; there may be a significant number of base pair mismatches that inhibit hybridization between the target sequence and the single stranded nucleic acid of the invention. However, if the number of mutations is too large to allow hybridization to occur under minimally stringent hybridization conditions, the sequence is not a complementary target sequence. Thus, "substantially complementary" as used herein means that the probe is sufficiently complementary to the target sequence to hybridize under normal reaction conditions.

Generally, the nucleic acid compositions of the present invention are useful as oligonucleotide probes. As the skilled artisan will appreciate, the length of the probe will vary with the length of the target sequence and hybridization and washing conditions. Generally, oligonucleotide probes range from about 8 to about 50 nucleotides, preferably from about 10 to about 30, and most preferably from about 12 to about 25. In some cases, very long probes may be used, for example, 50 to 200 to 300 nucleotides in length. Thus, in the structures depicted herein, nucleosides can replace nucleic acids.

A variety of hybridization conditions can be used in the present invention, including high, moderate and low stringency conditions; for example, Maniatis et al., Molecular C
loning: A Laboratory Manual, 2nd Edition, 1989, and Short Protocols in M
See olecular Biology, ed. Ausubel, et al. (herein incorporated by reference). Hybridization conditions can also be varied using a non-ionic backbone, ie, PNA, as is known in the art. In addition, a cross-linking agent may be added to cross-link, ie, attach covalently, the double-stranded hybridization complex following target binding.

As will be appreciated by those skilled in the art, the system of the present invention may take many different forms, as generally depicted in the drawings. In general, there are three types of systems that can be used: (1) systems where the target sequence itself is labeled with ETM (FIG. 1).
6A, 16B and 16D); (2) a system in which the labeled probe hybridizes directly to the target sequence (see FIGS. 16C and 16H); (3) the labeled probe indirectly binds to the target sequence, eg, via an amplification probe. Hybridizing system (see FIGS. 16E, 16F and 16G).

In all three of these systems, in a preferred embodiment, this is not required, but the target sequence is immobilized on the surface of the electrode. This is preferably performed using a capture probe, optionally using one or more capture extension probes. If only capture probes are used, it is necessary to obtain a unique capture probe for each target sequence; that is, its surface must be designed to contain the unique capture probe. Alternatively, a capture extension probe can be used,
It allows for a "universal" surface, ie, a surface that contains a single type of capture probe that can be used to detect the target sequence. Figure 1 shows the “Capture Extender” probe
5, generally with a first portion that hybridizes to all or a portion of the capture probe and a second portion that hybridizes to a first portion of the target sequence. This then allows for the generation of designed soluble probes, which, as the skilled artisan will appreciate, is generally simpler and less expensive. As shown herein (eg, FIG. 15C), two capture extension probes can be used. This is generally done to stabilize the assay complex, for example, when the target sequence is large, or when using large amplifier probes, especially branched or dendritic probes.

In a preferred embodiment, the nucleic acid is added after the formation of the SAMs discussed below ((4) above). This may be implemented in various ways, as will be appreciated by those skilled in the art. In one embodiment, the conductive oligomer having terminal functional groups is prepared by a preferred embodiment utilizing an activated carboxylic acid ester and an isothiocyanate ester, wherein the ester uses an activated carboxylic acid ester. Reacts with the primary amine attached to the nucleic acid, as shown generally in FIG. These two reagents have the advantage of being stable in aqueous solution and further react with primary alkylamines. However, the primary aromatic amine of the base and the secondary and tertiary amines do not react, thereby allowing the nucleic acid to be site-specifically added to its surface. This allows spotting of probes (either capture probes or detection probes, or both) by known methods (inkjet, spotting, etc.) on its surface.

In addition, there are many non-nucleic acid methods that can be used to immobilize nucleic acids on a surface.
For example, a binding partner pair may be utilized; that is, one binding partner is attached to the end of the conductive oligomer and the other is attached to the nucleic acid end. This can also be done without using a nucleic acid capture probe; that is, one binding partner acts as a capture probe and the other attaches to either the target sequence or the capture extension probe. That is, either the target sequence contains a binding partner or the capture extension probe that hybridizes to the target sequence contains a binding partner.
Suitable binding partner pairs include hapten pairs such as biotin / streptavidin,
Antigen / antibody, NTA / histidine tag, etc., but are not limited thereto. In general, smaller binding partners are preferred, so that electrons can pass from the nucleic acid to the conductive oligomer and allow for detection.

In a preferred embodiment, where the target sequence itself is modified to include a binding partner, the binding partner is modified via a modified nucleotide that can be enzymatically attached to the target sequence.
For example, it attaches during the PCR target amplification step. Alternatively, the binding partner readily attaches to the target sequence.

Alternatively, a capture extension probe having a nucleic acid moiety for binding to a target and a binding partner may be utilized (eg, the capture extension probe may be a non-binding moiety such as an alkyl linker used to attach to the binding partner). A nucleic acid moiety). In this embodiment, it is desirable to crosslink the target double-stranded nucleic acid and the capture extension probe using, for example, a psoralen known in the art for stability.

In one embodiment, the target does not bind to the electrode surface using a capture probe. What is important in this embodiment is that for all assays herein, the excess label probe should be removed prior to detection and the assay complex (supplementary linker) should be close to the surface. As one skilled in the art will recognize, this may be implemented in other ways. For example, the assay complex may be on beads that are added to an electrode comprising a monolayer. Supplemental linkers containing ETMs can be conducted using techniques well known in the art, such as gravity settling of beads onto a surface, electrostatic or magnetic interactions between bead components and a surface, and using the binding partner attachment described above. Can be placed close to the surface of the hydrophilic oligomer. Alternatively, after removal of excess reagents, such as excess label probe, the assay complex can be pumped to the surface, for example, by pulsed delivery to a system with sufficient voltage to push the assay complex to the surface. It is possible.

However, a preferred embodiment utilizes an assay complex attached via a nucleic acid capture probe.

[0214] In a preferred embodiment, the target sequence itself comprises an ETM. As discussed above, this can be done with target sequences having an ETM incorporated at a significant number of positions, as outlined above. Representative examples are depicted in FIGS. 16A, 16B and 16D. In this embodiment, for the rest of the system, the 3′-5 ′ orientation of the probe and target is such that the ETM-containing structure (ie, the recruitment linker or target sequence) is as close as possible to the surface of the monolayer, and , Are selected to have the correct orientation. This can be accomplished by deposition via insulators or conductive oligomers, as generally shown in the figures. Further, as will be appreciated by those skilled in the art, the multiple capture probes may be in the shape depicted in FIG. 16D when the capture probes have different 5′-3 ′ orientations, or when multiple capture probes are used. Can be used where the target "loop" is created.

[0215] In a preferred embodiment, the labeled probe is, as generally depicted in FIG. 16C,
Hybridizes directly to the target sequence. In these embodiments, the target sequence is preferably, but not necessarily, fixed to the surface by a capture probe, including a capture extension probe. Next, an ETM is brought near the surface of the conductive oligomer monolayer using a labeled probe. In a preferred embodiment, a plurality of labeled probes are used; that is, the labeled probes are designed such that the portion that hybridizes to the target sequence (labeled 141 in the figure) can be different for a number of different labeled probes; Amplification of the signal occurs because multiple labeled probes can bind to each labeled sequence. Thus, as depicted in the figure, n
Is an integer of at least 1. Depending on the desired sensitivity, the length of the target sequence and the number of ETMs per labeled probe, a suitable range for n is from 1 to 50, particularly preferably from about 1 to about 20, and particularly preferred from about 2 to about 5. In addition, if "generic" labeled probes are desired, labeled extension probes can be used, as described generally below for the use of amplification probes.

As noted above, in this embodiment, generally, the geometry of the system and the labeling probe are designed so that the ETMs gather as close as possible to the monolayer surface. In a preferred embodiment, the labeled probe hybridizes indirectly to the target sequence. That is, while the present invention finds a novel combination of signal amplification technology on an electrode and electron transfer detection, it is particularly useful for sandwich hybridization assays, as depicted generally in FIG. is there. In these embodiments, the amplification probes of the invention bind directly or indirectly to a target sequence in a sample. Since the amplification probe preferably contains a relatively large number of amplification sequences available for binding of the labeled probe, the detectable signal can be significantly increased and the detection limit of the target can be significantly improved. These labels and amplification probes, and the detection methods described herein, can be used in any manner by essentially known nucleic acid hybridization, for example, by directly binding the target to a solid phase, or by using one target. It can be used in sandwich hybridization assays that bind to the above nucleic acids, which in turn bind to a solid phase.

In general, these aspects can be described as follows. Amplification probes hybridize directly to the target sequence (eg, FIG. 16E) or through the use of labeled extension probes (eg, FIGS. 16F and 16G), which allows for the preparation of “generic” amplification probes. . The target sequence is preferably, but not necessarily, immobilized on the electrode using a capture probe. Preferably, the amplification probe comprises a variety of amplification sequences, but in certain embodiments, as described below, the amplification probe comprises only one amplification sequence. Amplification probes can take many different forms; for example, branched, dendritic, or linear "strings" of amplified sequences.
Using these amplified sequences, a hybridization complex with a labeled probe can be formed, and ETM can be detected using an electrode.

Thus, the present invention provides an assay complex consisting of at least one amplification probe. As used herein, "amplification probe" or "nucleic acid multimer" or "
By "amplification multimer" or grammatical equivalent is meant a nucleic acid probe used to facilitate signal amplification.
It contains one single-stranded nucleic acid probe sequence and at least one single-stranded nucleic acid amplification sequence, preferably a variety of amplification sequences.

[0219] The amplification probe contains a first probe sequence that is used, directly or indirectly, to hybridize to a labeled sequence. That is, the amplification probe itself may have a first probe sequence that is substantially complementary to the target sequence (eg, FIG. 16E) or a first probe sequence that is substantially complementary to a portion of an additional probe. With a probe sequence, the additional probe, in this case called a labeled extension probe, has a first portion that is substantially complementary to the target sequence (eg, FIG. 16F). In a preferred embodiment, the first probe sequence of the amplification probe is substantially complementary to the target sequence, which is generally depicted in FIG. 16E.

Generally, for all probes herein, the first probe sequence is of sufficient length to provide specificity and stability. Thus, in general, a probe sequence of the invention designed to hybridize to another nucleic acid (ie, a probe sequence, an amplification sequence, a portion or domain of a larger probe) will have a length of at least about 5 nucleosides. , Preferably at least about 10, and particularly preferably at least about 15.

In a preferred embodiment, as depicted in FIG. 14, either the amplification probe or other probes of the invention may form a hairpin base-loop structure in the absence of their target. The length of the base duplex sequence is chosen such that the hairpin structure is not advantageous in the presence of the target. The use of these types of probes in the system of the present invention, or in any nucleic acid detection system, significantly reduces non-specific binding, resulting in an increased signal-to-noise ratio.

In general, these hairpin structures include four components. The first component is a target binding sequence, ie, a region complementary to the target (which may be a sample target sequence or other probe sequence for which binding is desired) and comprises about 10 nucleotides , Preferably about 15. The second component is a loop sequence, which can facilitate formation of a nucleic acid loop. Particularly preferred in this regard are GTC repeats, which have been identified as forming bends in Fragile X Syndrome. (If a PNA analog is used, the bend preferably contains a proline residue). Generally, three to five repetitions are used, with four to five being preferred. The third component is a self-complementary region, which has a first portion that is complementary to a portion of the target sequence region and a second portion that includes a first portion of the labeled probe binding sequence. The fourth component is substantially complementary to a labeled probe (or, optionally, another probe). The fourth component further includes "sticky ends", ie, portions that do not hybridize to other portions of the probe, and preferably include most, but not all, of the ETM. The general structure is depicted in FIG. As the skilled artisan will appreciate, any or all of the probes described herein form a hairpin in the absence of their target, including amplification, capture, capture extension, label, and labeled extension probes. It can be arranged as follows.

In a preferred embodiment, several different growth probes are used, each with a first probe sequence that hybridizes to a different portion of the target sequence. That is, there is more than one amplification level; amplification probes amplify the signal by multiple labeling events, and several different amplification probes, each with a different label, are used for each target sequence. Thus, the preferred embodiment utilizes a pool of at least two different amplification probes, each pool having a different probe sequence for hybridizing to a different portion of the target sequence; The only practical limitation would be the length of the target sequence initially. Furthermore, it is possible, but not generally preferred, that different amplification probes include different amplification sequences.

In a preferred embodiment, the amplification probe does not hybridize directly to the target sequence of the sample, but instead hybridizes to the first portion of the labeled extension probe, as generally depicted in FIG. 16F. This is the "common" amplification probe,
It is particularly useful to allow the use of amplification probes that can be used with a variety of different targets. This is desirable because some of the amplification probes require special synthesis techniques. Thus, it is preferable to add a relatively short probe as the label extension probe. Thus, the first probe sequence of the amplification probe is substantially complementary to the first portion or domain of the first labeled extended single-stranded nucleic acid probe. The label extension probe also includes a second portion or domain that is substantially complementary to a portion of the label sequence. Both of these moieties are preferably at least about 10 to about 50 nucleosides in length, preferably about 15 to about 3
It is in the range of 0. The terms "first" and "second" are not meant to confer sequence orientation with respect to the 5'-3 'orientation of the target or probe sequence. For example, assuming a 5'-3 'orientation of the complementary target sequence, the first portion may be located 5' to the second portion, or may be located 3 'to the second portion. In the present specification, for convenience, the order of the probe sequences is generally shown from left to right.

In a preferred embodiment, one or more labeled extension probe-amplification probe pairs are used, ie, n is 1 or more. That is, multiple labeled extension probes are used, each with a portion that is substantially complementary to a different portion of the target sequence; this can serve as another level of amplification. Thus, the preferred embodiment utilizes a pool of at least two labeled extension probes, the upper limit being determined by the length of the target sequence.

In a preferred embodiment, one or more labels are depicted in FIG. 16G and as generally outlined in US Pat. No. 5,681,697 (hereby incorporated by reference). An extension probe is used with a single amplification probe to reduce non-specific binding. In this embodiment, a first portion of the first labeled extension probe hybridizes to a first portion of the target sequence, and a second portion of the first labeled extension probe hybridizes to a first probe sequence of the amplification probe. A first portion of the second labeled extension probe hybridizes to a second portion of the target sequence, and a second portion of the second labeled extension probe hybridizes to a second probe sequence of the amplification probe. These geometries are sometimes referred to as “cross-shaped” structures or geometries, and are generally implemented to provide stability when using large branched or dendritic amplification probes.

Further, as will be appreciated by those skilled in the art, the labeled extension probe is as follows:
It may interact with the pre-amplification probe rather than the direct amplification probe. Similarly, as outlined above, the preferred embodiment utilizes several different amplification probes, each with a first probe sequence that hybridizes to a different portion of the labeled extension probe. Furthermore, as outlined above, although this is not generally preferred, it is also possible that different amplification probes include different amplification sequences.

[0228] In addition to the first probe sequence, the amplification probe also includes at least one amplification sequence. As used herein, "amplified sequence" or "amplified segment" or grammatical equivalents means a sequence used directly or indirectly to bind to a first portion of a labeled probe, as described in more detail below. I do. Preferably, the amplification probe contains a variety of amplification sequences, preferably from about 3 to about 100
0, particularly preferably about 10 to about 100, and especially preferred is about 50. In some cases, for example, when a linear amplification probe is used, 1 to about 20 is preferred, and about 5 to about 10 is particularly preferred.

Amplification sequences can be linked together in various ways, as will be appreciated by those skilled in the art. These may be directly linked to each other by covalent bonds, or via a nucleic acid bond such as a phosphodiester bond, a PNA bond, or via an insert binder such as an amino acid, carbohydrate or polyol bridge, or other crosslinker or bond Via a partner, it may be attached to an intervening sequence or chemical moiety. The binding site may be at the end of the segment and / or at an internal nucleotide in one or more chains. In a preferred embodiment, the amplification sequence is attached via a nucleic acid bond.

In a preferred embodiment, branched amplification sequences are used, as generally described in US Pat. No. 5,124,246 (hereby incorporated by reference).
Branched amplification sequences can adopt a "fork-like" or "comb-like" conformation. "Fork-like" branched amplification sequences generally have three or more oligonucleotide segments emanating from an origin forming a branched structure. An origin is another nucleotide segment or multifunctional molecule to which at least three segments can be covalently or tightly linked. A "comb-like" branched amplification sequence has a linear spine from which a number of side-chain oligonucleotides extend. In either conformation, the overhanging segment will usually depend on the modified nucleotide or other organic moiety with appropriate functionalities for oligonucleotide attachment. In addition, in any conformation, a large number of amplification sequences may be available for direct or indirect binding to a detection probe. In general, these structures use modified multifunctional nucleotides, particularly those described in US Pat.
Prepared as known in the art, as described in 5,352 and 5,124,246.

In a preferred embodiment, dendritic amplification probes are used as described in US Pat. No. 5,175,270 (hereby incorporated by reference). Dendritic amplification probes have amplification sequences that attach via hybridization and, as a result, have a portion of double-stranded nucleic acid as a component of their structure. The outer surface of the dendritic amplification probe has various amplification sequences.

In a preferred embodiment, a linear amplification probe is used, which has sequences where the individual amplification sequences are linked end-to-end directly or with short intervening sequences to form a polymer. As in other amplification configurations, there may be additional sequences or portions between the amplification sequences. Further, as outlined herein, the linear amplification probe may form a hairpin base-loop structure, as depicted in FIG.

In one embodiment, the linear amplification probe has a single amplification sequence. This may be the case if a hybridization / dissociation cycle occurs to form a pool of amplified probes, which hybridizes to the target, and is then removed to allow more probes to bind, or to remove large amounts of ETMs. It is useful when used for each probe. However, in a preferred embodiment, the linear amplification probe contains various amplification sequences.

In addition, the amplification probe may be wholly linear, wholly branched, wholly dendritic, or a combination thereof. The amplification sequence of the amplification probe is used, directly or indirectly, to bind to a labeled probe that allows detection. In a preferred embodiment, the amplification sequence of the amplification probe is substantially complementary to the first portion of the labeled probe. Alternatively, an amplification extension probe is used, which has a first portion that binds to the amplification sequence and a second portion that binds to the first portion of the labeled probe.

In addition, the compositions of the present invention may include a “pre-amplification” molecule, which serves as a bridge between the label extension molecule and the amplification probe. In this way, more amplification factor, and thus more ETM, is ultimately bound to the detection probe. The pre-amplified molecule may be linear or branched, typically about 3
It contains nucleotides in the range of 0-3000.

The reactions outlined below can be performed in various ways, as will be appreciated by those skilled in the art. The reactants may be added simultaneously or in any order, but the preferred embodiments are as outlined below. In addition, the reaction may include various other reagents that may be included in the assay. These include reagents such as salts, buffers, neutral proteins, eg, albumin, detergents, etc., to facilitate optimal hybridization and detection and / or to be used to reduce non-specific or background interactions. Can be. As reagents that improve assay efficiency under other conditions, for example, protease inhibitors, nuclease inhibitors, antimicrobial agents, etc. may be used depending on the sample preparation method and the purity of the target.

Generally, the method is as follows. In a preferred embodiment, the target is first fixed or attached to the electrode. In one embodiment, this is performed by forming a hybridization complex between the capture probe and a portion of the target sequence.
A preferred embodiment utilizes a capture extension probe; in this embodiment, a hybridization complex is formed between a portion of the target sequence and a first portion of the capture extension probe, and a further hybridization complex is formed between the capture extension probe and the probe. Formed between the second portion and a portion of the capture probe. A further preferred embodiment utilizes an additional capture probe, thus capturing the hybridization complex between a portion of the target sequence and the first portion of the second capture extension probe, and capturing the hybridization complex with the second portion of the second capture extension probe. An additional hybridization complex is formed with the second portion of the probe.

Alternatively, attachment of the target sequence to the electrode is performed simultaneously with other reactions. The method starts with the introduction of an amplification probe, if used. In a preferred embodiment, the amplification probe comprises a first probe sequence substantially complementary to a portion of the target sequence and at least one amplification sequence.

In one embodiment, the first probe sequence of the amplification probe hybridizes to the target sequence and the unhybridized amplification probe is excluded. This is performed as known in the art, but depends on the type of assay. Once the target sequence is immobilized on a surface, such as an electrode, removal of excess reagents will generally be appreciated by those skilled in the art,
It is performed by one or more washing steps. In this embodiment, the target may be immobilized on a solid support. If the target sequence is not immobilized on the surface, removal of excess reagent, such as the probe of the present invention, can be performed by adding beads (ie, solid support particles) containing a sequence complementary to the probe. However, in that case, the excess probe binds to the beads. The beads can then be removed, for example, by centrifugation, filtration, application of a magnetic or electrostatic field, and the like.

Next, the reaction mixture is subjected to conditions under which the amplification probe dissociates from the target sequence (temperature, high concentration salt, pH change, etc.) to obtain an amplification probe. The amplification probe is then added to an electrode consisting of a capture probe for the amplification probe, a labeled probe is added, and detection is performed.

In a preferred embodiment, the addition of an amplification probe to the target sequence produces a larger probe pool, and the hybridization / dissociation reaction is repeated, producing a larger pool of amplification probes. This pool of amplification probes is then added to the electrode consisting of the amplification capture probe, the labeled probe is added, and detection is started.

In this embodiment, it is preferred to immobilize the target sequence on a solid support containing the electrodes using the methods described herein; as will be appreciated by those skilled in the art, alternative solid support attachments Techniques, for example, techniques for deposition on glass, polymers, etc. may be used. It is also possible to carry out the reaction on one solid support and then add the pooled amplification probes to the electrodes for detection.

[0243] In a preferred embodiment, the amplification probes include a variety of amplification sequences. In one embodiment, the first probe sequence of the amplification probe hybridizes to the target sequence, removing the non-hybridized amplification probe. Again, the preferred embodiment utilizes an immobilized target sequence, wherein it is immobilized by hybridization with a capture probe attached to an electrode or hybridized to a capture extension probe, which is then described herein. The immobilization is performed by hybridizing with the immobilized capture probe as described. Generally, in these embodiments, the capture and detection probes are immobilized on an electrode, typically at the same "address."

In a preferred embodiment, the first probe sequence of the amplification probe hybridizes to the first portion of at least one labeled extension probe, and the second portion of the labeled extension probe hybridizes to a portion of the target sequence. Other preferred embodiments utilize more than one labeled extension probe. In a preferred embodiment, the amplification sequence of the amplification probe is used for direct detection by hybridizing to at least one labeled probe sequence.

The present invention thus provides an assay complex that minimally includes a target sequence and a labeled probe. As used herein, "assay complex" refers to a collection of hybridization complexes consisting of a nucleic acid comprising a probe and a target, which comprises at least one ETM, and thus allows for detection. The composition of the assay complex will depend on the use of the different probe components outlined herein. Thus, FIG.
, 16B and 16C, the assay complex comprises a capture probe and a target sequence. Assay complexes also include labeled probes, capture extension probes, labeled extension probes, and amplification probes, depending on the shape used, as outlined herein.

Assays are generally performed under stringent conditions that allow formation of labeled probe hybridization complexes only in the presence of the target. Stringency can be controlled by changing process parameters, which are thermodynamic variations. The parameters include, but are not limited to, temperature, formamide concentration, salt concentration, chaotropic salt concentration pH, organic solvent concentration, and the like.

[0247] These parameters can also be used to control non-specific binding, as generally outlined in US Pat. No. 5,681,697. Thus, it is desirable to perform certain steps under high stringency conditions; for example, when the first hybridization step is performed between the target sequence and the labeled extender and capture extension probe. Performing this step under conditions that prioritize particular binding allows for a reduction in non-specific binding.

In a preferred embodiment, when using all of the components outlined herein, a preferred method is as follows. The single-stranded target sequence is incubated with the capture extension probe and the labeled extension probe under hybridization conditions. In a preferred embodiment, the reaction is performed with an immobilized capture probe in the presence of an electrode, but the reaction may be performed in two steps by initial incubation and subsequent application to the electrode. Excess reagent is washed off and then the amplification probe is added. If preamplification probes are used, they may be added before or simultaneously with the amplification probes. Excess reagent is washed off and the labeled probe is then added. Excess reagent is washed off and detection is begun as outlined below.

In one embodiment, a number of capture probes (or capture and capture extension probes) are used, each of which is substantially complementary to a different portion of the target sequence. Again, as outlined herein, when using an amplification probe, the system is generally positioned such that the recruitment linker containing the ETM is located proximal to the monolayer surface upon label probe binding. . Thus, for example, when the ETMs are attached via a “dendritic” type structure, as outlined herein, the length of the linker from the point of attachment of the nucleic acid to the ETMs, in particular, can affect the capture extension probe. When used, it can vary with the length of the capture probe. That is, a longer capture probe has a capture extender, resulting in a target sequence being "retained" further away from the surface than in a shorter capture probe. Adding an extra linking sequence between the probe nucleic acid and the ETM will bring the ETM into spatial proximity to the surface and give better results.

In addition, if desired, the nucleic acids utilized in the present invention can be attached prior to detection, if applicable, by using standard molecular biology techniques, such as using ligase. Similarly, if stability is desired, it is possible to add a crosslinking agent to stabilize the structure.

The compositions of the present invention are generally synthesized using methods generally known in the art, as outlined below. As will be appreciated by those skilled in the art, many of the methods outlined below
It relates to a nucleic acid comprising a ribose-phosphate backbone. However, as outlined above, many other nucleic acid analogs may be used, some of which do not contain ribose or phosphate in the backbone. In these embodiments, for conjugation at positions other than the base, conjugation is performed as recognized by those skilled in the art depending on the backbone. Thus, for example, the bond may be at a carbon atom of the PNA backbone, as described below, or
At either end.

The composition may be manufactured in several ways. A preferred method is to synthesize a conductive oligomer that is first attached to a nucleoside by adding more nucleosides to form a capture probe and then attaching it to an electrode. Alternatively, a full capture probe is made, then the complete conductive oligomer is added, followed by binding to the electrode. Alternatively, monolayers of conductive oligomers, some of which have functional groups for capture probe attachment, are first attached to the electrode, followed by attachment of the capture probe. The latter two methods may be preferred when the conductive oligomer used is not stable in solvents and under conditions of conventional nucleic acid synthesis.

In a preferred embodiment, the compositions of the present invention first form a conductive oligomer covalently linked to a nucleoside, followed by the addition of additional nucleosides to form a capture probe nucleic acid, and the conductive oligomer Manufactured by a final step that includes adding to the electrodes.

[0254] The attachment of the conductive oligomer to the nucleoside can be accomplished in several ways. In a preferred embodiment, all or some of the conductive oligomer is first synthesized (
Generally, it has a functional group at the end for binding to the electrode), which is then bound to the nucleoside. Then, further nucleosides are added as needed, and in the last step generally coupled to the electrode. Alternatively, the oligomer unit is added to the nucleoside at one time, and then the nucleoside is added and bound to the electrode. Many representative syntheses are shown in the drawings of PCT US97 / 20014, which are hereby incorporated by reference.

The conductive oligomer is then attached to a nucleoside, which may comprise one (or more) oligomer units, attached as described herein.

In a preferred embodiment, the linkage is to the ribose of the ribose-phosphate backbone. Thus, linkage via amide and amine bonds is possible (see, P.
Figures 1 and 2 of CT US97 / 20014). In a preferred embodiment, there is at least one methylene group or other short aliphatic alkyl group (as a Z group) between the nitrogen attached to the ribose and the aromatic ring of the conductive oligomer. A representative synthesis is shown in FIG. 16 of PCT US97 / 20014.

Alternatively, the linkage is through the phosphate of the ribose-phosphate backbone.
Examples of two synthetic schemes are shown in FIGS. 4 and 5 of PCT US97 / 20014. Although both figures show a linkage at the 3 'position of ribose, the linkage can also be made through the 2' position. In FIG. 5, Z is an ethylene linker, but other linkers may be used as well, as will be appreciated by those skilled in the art.

In a preferred embodiment, the attachment is via a base. The general scheme is described in FIG. 3 of PCT US97 / 20014 using uridine as the nucleoside and phenylene-acetylene conductive oligomer. As will be appreciated by those skilled in the art, amide linkages are also possible using methods known in the art. In a preferred embodiment, the protecting group is attached to PCT US97 / 20014 FIGS. 10 and 1.
One may add to the base prior to the addition of the conductive oligomer, as generally outlined in 1. In addition, the palladium cross-linking reaction can be altered to prevent the dimerization problem; that is, the two conductive oligomers do not bind to the base but rather dimerize.

Alternatively, conjugation to a base can be achieved by making a nucleoside having one unit of oligomer, followed by the addition of another.

Once the modified nucleosides have been prepared, protected and activated, prior to attachment to the electrode, standard synthetic methods (Gait, Oligonucleotide Synthesis: A Practical Approach, IRL Pres
s, Oxford, UK 1984; Eckstein)
They can be included in several ways.

In one embodiment, one or more modified nucleosides are transformed into a triphosphate form, and the growing oligonucleotide strand contains the enzymes DNA polymerase I, T4 DNA polymerase, T7 DNA polymerase, Taq DNA polymerase, reverse transcriptase. And using standard molecular biology techniques, such as using RNA polymerase. For inclusion of the 3 'modified nucleoside in the nucleic acid, a terminal deoxynucleotidyl transferase may be used. (Ratliff, Terminal deoxy
nucleotidyltransferase.In The Enzymes, Vol. 14A.PD Boyer ed.pp 105-
118. Academic Press, San Diego, CA 1981). Accordingly, the present invention provides a deoxyribonucleoside triphosphate comprising a covalently linked ETM. Preferred embodiments utilize ETM binding to a base or backbone, such as ribose (preferably at the 2 'position), as generally shown in structures 42 and 43 below.

[0262]

Embedded image

[0263]

Embedded image

Thus, in some embodiments, nucleic acids comprising ETMs can be produced in situ. For example, a target sequence can hybridize to a capture probe (eg, on a surface) such that the ends of the target sequence are exposed, ie, non-hybridized. The addition of the enzyme and ETM-labeled triphosphate nucleotides allows for the production of the label in situ. Similarly, with labeled nucleotides recognized by the polymerase, PCR and detection can occur simultaneously; that is, the target sequence is generated in situ.

In a preferred embodiment, the modified nucleoside is phosphoramidate or H
-Converted to the phosphonate form, which is then used for solid-phase or solution synthesis of oligonucleotide synthesis. In this way, the modified nucleotide is included in the oligonucleotide at an internal position or at the 5 'end for attachment at the ribose (ie, amino- or thiol-modified nucleoside) or at the base. This is generally done in one of two ways. First, the 5'-position of ribose is 4 ', 4-dimethoxytrityl (
DMT), followed by reaction with 2-cyanoethoxy-bis-diisopropylaminophosphine in the presence of diisopropylammonium tetrazolide or with 2'-cyanoethoxyphosphine chlorodiisopropylamino,
Obtain phosphoramidates as known in the art; however, other methods may be used as will be appreciated by those skilled in the art. Gait supra; Caruthers, Science 230: 281
(1985), both of which are incorporated herein by reference.

For attachment of a group to the 3 'end, a preferred method uses attachment of a modified nucleoside (or nucleoside substitute) to a controlled pore glass (CPG) or other oligomeric support. In this embodiment, the modified nucleoside is protected at the 5 'end with DMT and then reacted with succinic anhydride with activation. The resulting succinyl compound is attached to CPG or another oligomer support known in the art. In addition, phosphoramidate nucleosides, with or without modification, are attached to the 5 'end after deprotection. Accordingly, the present invention provides conductive oligomers or insulators covalently linked to nucleosides attached to a solid oligomer support such as CPG, and phosphoramidate derivatives of the nucleosides of the present invention.

The present invention further provides a method for producing a labeled probe having a supplemental linker comprising ETM. As will be apparent to those skilled in the art, these synthetic reactions depend on the characteristics of the supplemental linker and the manner in which the ETMs are coupled. For nucleic acid replenishment linkers, the labeled probe is
As outlined herein, it is generally made to include an ETM at one or more positions. When a transition metal complex is used as the ETM, the synthesis is performed in several ways. In a preferred embodiment, the ligand is added to the nucleoside followed by the transition metal ion, and then the nucleoside to which the transition metal complex is attached is added to the oligonucleotide, ie, to the nucleic acid synthesizer. Alternatively, the ligand is bound and subsequently incorporated into the growing oligonucleotide chain, and a metal ion is added.

In a preferred embodiment, the ETM is attached to the ribose of the ribose-phosphate backbone. This is normally done as outlined herein for conductive oligomers and, as described herein and in PCT Publication WO 95/15971, uses amino- or oxo-modified nucleosides to form the ribose 2 Perform 'or 3' position. Then, as a ligand, for example as a transition metal ligand for the binding of a metal ion, or, for example, via an amide bond, another ligand or an organic E
As a chemical functional group that can be used to attach the TM, an amino group can be used, as is recognized in the art. For example, by way of example, various ETMs linked via ribose
The synthesis of a nucleoside having the formula:

In a preferred embodiment, the ETM binds to the phosphate of the ribose-phosphate backbone. As outlined herein, this is done using phosphodiester analogs such as phosphoramidate linkages (generally described in PCT Publication WO9
5/15971) or in a manner similar to that described in FIGS. 4 and 5 of PCT US 97/2002, wherein the conductive oligomer is a transition metal ligand as outlined in the Examples. Or by a complex or organic ETM.

Linkage to another backbone, for example, a peptide nucleic acid or another phosphate bond, is performed as will be appreciated by those skilled in the art.

In a preferred embodiment, the ETM binds to a nucleoside base. This can be done in various ways. In one embodiment, the amino group of a base, either naturally occurring or added as described herein (e.g., see the figure), as a ligand of the transition metal complex or, for example, via an amide bond Other ligand or organic ET
Used as a chemical functional group that can be used to add M. This is done as will be appreciated by those skilled in the art. Alternatively, nucleosides containing a halogen atom attached to the heterocyclic ring are commercially available. The acetylene binding ligand may be added using a halogenated base, as is generally known; see, for example, Tzalis et al., T.
etrahedron Lett. 36 (34): 6017-6020 (1995); Tzalis et al., Tetrahedron Le
tt.36 (2): 3489-3490 (1995); and Tzalis et al., Chem. Communications (
(Submitted) 1996, all incorporated herein by reference. See also the Figures and Examples which describe the synthesis of metallocenes (in this case ferrocenes) linked via an acetylene bond to the base.

In one embodiment, the nucleoside is prepared with a transition metal ligand incorporated into the nucleic acid, and then the transition metal ion and the remaining required ligand are added as is known in the art. I do. In another embodiment, the transition metal ion and additional ligand are added prior to inclusion in the nucleic acid.

A nucleic acid of the invention is prepared having a covalently attached linker (ie, either an insulator or a conductive oligomer), and the linker is attached to an electrode. The method depends on the type of electrode used. As described herein, binding linkers are generally made with a terminal "A" linker to facilitate binding to an electrode. For the purposes of this application, a sulfur-gold bond is considered a covalent bond.

In a preferred embodiment, the conductive oligomer, insulator and binding linker are covalently attached to the electrode via a sulfur bond. However, surprisingly, conventional protecting groups used to attach molecules to gold electrodes are generally ideal for use in both the synthesis of the compositions described herein and their inclusion in oligonucleotide synthesis reactions. Not a target. Thus, the present invention provides a novel method of coupling conductive oligomers to gold electrodes using unusual protective protecting groups, including ethylpyridine and trimethylsilylethyl as illustrated. However, as will be appreciated by those skilled in the art, when the conductive oligomer is free of nucleic acids, conventional protecting groups such as acetyl groups may be used. See Greene et al., Supra.

This can be done in several ways. In a preferred embodiment, the conductive oligomer subunit containing a sulfur atom is protected with an ethyl-pyridine or trimethylsilylethyl group for attachment to an electrode. With respect to the former, this generally involves substituting a sulfur atom (preferably in the form of sulfhydryl) with a vinylpyridine or vinyltrimethylsilylethyl group and under conditions such that an ethylpyridine or trimethylsilylethyl group is added to the sulfur atom. This is done by contact.

The subunit also generally contains a functional moiety for attachment of the additional subunit, so that the additional subunits combine to form a conductive oligomer.
The conductive oligomer is then attached to the nucleoside, and additional nucleosides are attached. The protecting group is then removed and a covalent sulfur-gold bond is performed. Alternatively, all or part of the conductive oligomer is prepared and then protected by adding a subunit containing a protected sulfur atom or by adding a sulfur atom. The conductive oligomer is then attached to the nucleoside and additional nucleotides are attached. Alternatively, a conductive oligomer attached to the nucleic acid is prepared and then protected by adding a subunit containing a protected sulfur atom or by adding a sulfur atom. Alternatively, the ethylpyridine protecting group may be used as described above, but is removed after one or more steps and replaced with a standard protecting group such as disulfide. Thus, an ethylpyridine or trimethylsilylethyl group can act as a protecting group in some of the synthetic reactions, and is then removed and replaced with a conventional protecting group.

A “subunit” of a conductive polymer herein refers to at least a portion of a conductive oligomer to which a sulfur atom is attached, but a functional group that allows for the addition of additional components of the conductive oligomer, Alternatively, additional atoms may be present, including additional components of the conductive oligomer. Thus, for example, when using an oligomer of structure 1, the subunit contains at least a first Y group.

A preferred method is 1) the addition of an ethylpyridine or trimethylsilylethyl protecting group to the sulfur atom attached to the first subunit of the conductive oligomer, generally by adding a vinylpyridine or trimethylsilylethyl group to the sulfhydryl 2) addition of additional subunits for the formation of conductive oligomers; 3) addition of at least a first nucleoside to the conductive oligomer; 4) addition of additional nucleosides to the first nucleoside to form a nucleic acid. 4) including binding of the conductive oligomer to the gold electrode. This can also be done in the absence of nucleosides, as described in the examples.

The above method can also be used to attach insulating molecules to gold electrodes.

In a preferred embodiment, a monolayer containing a conductive oligomer (and optionally an insulator) is added to the electrode. Generally, the chemistry of the addition is similar or the same as the addition of the conductive oligomer to the electrode, ie, using a sulfur atom for attachment to the gold electrode. In addition to conductive oligomers covalently linked to nucleic acids, compositions comprising a monolayer can be accomplished in one of at least five ways: (1) the addition of a monolayer, followed by the sequential addition of a binding linker-nucleic acid complex; (2) Addition of binding linker-nucleic acid complex followed by addition of monolayer; (3)
Simultaneous addition of monolayer and binding linker-nucleic acid complex; (4) Formation of monolayer containing binding linker terminated with a functional moiety suitable for complete nucleic acid binding (any of 1, 2 or 3 was used. Or) (5) Formation of a monolayer containing a binding linker terminated with a functional moiety suitable for nucleic acid synthesis, ie, nucleic acids are synthesized on a monolayer surface as is known in the art. Such suitable functionalities include, but are not limited to, nucleosides for phosphoramidate addition, amino groups, carboxyl groups, protected sulfur moieties, or hydroxyl groups. As an example, the formation of a single layer on a gold electrode using the preferred method (1) is described.

In a preferred embodiment, the nucleic acids are peptide nucleic acids or analogs. In this embodiment, the invention provides a peptide nucleic acid having at least one covalently linked ETM or linking linker. In a preferred embodiment, these moieties are covalently linked to the monomeric subunit of PNA. The “monomer subunit of PNA” herein is —NH—CH ₂ CH ₂ —N (COCH ₂ —base) —CH ₂ —CO
-Monomers or derivatives of PNA (herein included within the definition of "nucleoside")
Means For example, the number of carbon atoms in the PNA backbone can be varied; generally, see Nielsen et al., Chem. Soc. Rev. 1997, page 73, which describes the number of PNA derivatives, incorporated herein by reference. I do. Similarly, the amide bond attaching the base to the backbone can be changed; phosphoramide and sulfamide linkages can be used. Alternatively, the moiety is linked to an internal monomer subunit. As used herein, "internal" means that the monomer subunit is not an N-terminal monomer subunit or a C-terminal monomer subunit. In this embodiment, the moiety can be attached to the base or backbone of the monomer subunit. The coupling of the bases is performed as outlined herein or as known from the literature. Generally, a moiety is added to the base, which is then included in the PNA as outlined herein. The base is added to the P before or after the addition of the chemical substituent.
Protected as necessary for inclusion in the NA synthesis reaction or derivatized to be included. Base protection and derivatization are described in PCT US97 / 20014.
FIGS. 24-27 of FIG. The base can then be included in the monomer subunit, as shown in FIG. 28 of PCT US97 / 20014. PCT US97 / 20014
Figures 29 and 30 show conductive oligomers attached with two different chemical substituents, ETM and base. FIG. 29 shows P with ferrocene attached to uracil base.
1 shows a representative synthesis of the NA monomer subunit. FIG. 30 describes the synthesis of a three-unit conductive oligomer attached to a uracil base.

In a preferred embodiment, the moiety is covalently linked to the backbone of the PNA monomer. The bond is generally at one of the unsubstituted carbon atoms of the monomer subunit, preferably at the α of the backbone.
Performed on carbon (as described in FIGS. 31 and 32), but at the 1- or 2-position carbon,
Alternatively, the bond at the α-carbon of the amide bond for connecting the base to the main chain may be formed. PN
For A analogs, other carbons or atoms may be similarly substituted. In a preferred embodiment, a moiety is added to the terminal monomeric subunit at the α-carbon atom or to an internal terminal monomeric subunit.

In this embodiment, the modified monomer subunit is synthesized with an ETM, a linking linker or a functional group for its attachment, and then a base is added to attach the modified monomer to the growing PNA chain. May be included. FIG. 31 of PCT US97 / 20014,
The synthesis of conductive oligomers covalently attached to the backbone of the PNA monomer subunit is described, and FIG. 32 of PCT US97 / 20014 describes the synthesis of ferrocene attached to the backbone of the monomer subunit.

The prepared monomeric subunit having a covalent moiety was prepared according to Will et al., Tetrahe
dron 51 (44): 12069-12082 (1995) and Vanderlaan et al., Tett. Let.38: 2
249-2252 (1987) (both are hereby incorporated by reference in their entirety)
The PNA is incorporated using methods as outlined in These methods allow the addition of chemical substituents to peptide nucleic acids without destroying the chemical substituents.

As will be appreciated by those skilled in the art, electrodes may be manufactured to have any combination of nucleic acids, conductive oligomers and insulators.

The compositions of the present invention may further include one or more labels at any location. As used herein, “label” refers to an element (eg, an isotope) or a chemical compound that has been attached to allow detection of the compound. Preferred labels are radioactive isotope labels,
It is a colored or fluorescent dye. The label can be included in the compound at any position. In addition, the compositions of the present invention may also include other moieties, such as a cross-linking agent, to promote cross-linking of the target-probe complex. For example, Lukhtanov et al., Nucl. Acids. Res. 24 (4): 683 (
1996) and Tabone et al., Biochem. 33: 375 (1994), both of which are hereby incorporated by reference.

Once manufactured, the compositions are used in many applications, as described herein. In particular, the compositions of the invention are used in hybridization assays. As will be apparent to those skilled in the art, the electrodes can be made to have a single species of nucleic acid, ie, a single nucleic acid sequence or multiple nucleic acid species.

In addition, as outlined herein, the use of a solid support such as an electrode allows for the use of these gene probes in an array. The use of oligonucleotide sequences is known in the art. In addition, methods for "addressing" locations within electrodes and for surface modification of electrodes are known. Thus, in a preferred embodiment, different nucleic acid sequences are placed beneath the electrodes, each of which is covalently linked to the electrode via a conductive linker. In this embodiment, probes of many different species of oligonucleotides can vary widely from one to several thousand, preferably from about 4 to about 100,000, and particularly preferably from about 10 to about 10,000.

Once the assay complex of the invention (minimally contains the target sequence and the labeled probe)
Is prepared, detection proceeds by electronic initiation. Without intending to be limited by mechanism or theory, detection is based on electron transfer from the ETM to the electrodes.

Detection of electron transfer, ie, in the presence of an ETM, is initiated electronically at a generally preferred voltage. An electric potential is applied to the assay complex. Tight control and variation in applied potential is based on the potential and the three-electrode system (one control, one sample (i.e. actuation), one reverse electrode) or two-electrode system (one sample, one sample).
Through two opposite electrodes). This matches the applied potential to the peak electron transfer potential of the system. This system relies in part on the choice of ETM, in part on the conductive oligomer used, the composition and integrity of the monolayer, and the type of use for the control electrode. As noted, ferrocene is the preferred ETM.

In a preferred embodiment, a co-reducing or co-oxidizing agent (together a co-redox agent) is used as an additional electron source (see Sato et al., Bull. Chem.
Soc. Jpn 66: 1032 (1993); Uosaki et al., Electrochimica Acta 36: 1799 (199
1); and Alleman et al., J. Phys. Chem 100: 17050 (1996), which is hereby incorporated by reference.

In a preferred embodiment, an input source in solution is used to initiate electron transfer.
Preferably when initiation and detection is carried out using a DC current or at an AC frequency where diffusion is not limited. Generally, as will be appreciated by those skilled in the art, short circuits in the system can be avoided by using a "hole" containing monolayer in a preferred embodiment. This can be done in several general ways. In a preferred embodiment, the input electrode source has a redox potential that is less than or equal to the ETM of the labeled probe.
Thus, at voltages above the redox potential of the input electron source, the ETM and the input electron source can be oxidized to provide electrons. The ETM provides electrons to the electrodes and the input source is E
Give to TM. For example, as an ETM bound to the compositions of the invention described in the examples, ferrocene has a redox potential of approximately 200 mV in aqueous solution (depending on the method of binding and the presence of any substituents, even when ferrocene is bound). Very variable). The electron source ferrocyanide also has a redox potential of about 200 mV. Thus, at voltages of about 200 mV or more, ferrocene replaces ferricenium and transfers electrons to the electrodes. The ferricyanide can be oxidized to transfer electrons to the ETM. In this method, the electron source (or co-reducing agent) serves to amplify the signal generated in the system, and the electron source molecules rapidly and repeatedly transfer electrons to the ETM bound to the nucleic acid. The rate at which electrons are donated and accepted is limited by the rate of diffusion of the co-reducing agent, ie, electron transfer between the co-reducing agent and the ETM. Electron transfer is affected by density and size.

On the other hand, an input electron source having a redox potential lower than ETM is used. E
At a voltage lower than the redox potential of the TM, but higher than the redox of the electron source, an input source such as ferrocyanide cannot be oxidized and cannot provide electrons to the ETM.
That is, electron transfer does not occur. When ferrocene is oxidized, an electron transfer pathway is created.

In another preferred embodiment, the input electron source has a higher redox potential than the labeled probe ETM. For example, luminol, an electron source, has a redox potential of approximately 720 mV. A voltage lower than the redox potential of the ETM, ie, 20
At 0-720 mV, the ETM cannot accept electrons from the luminol electron source because the voltage is lower than the luminol redox potential. However, at or above the luminol redox potential, luminol transfers electrons to the ETM,
Enables quick and repetitive electron transfer. In this method, the electron source (or co-reducing agent) serves to amplify the signal generated in the system, and the electron source molecules donate electrons quickly and repeatedly to the ETM of the labeled probe.

Luminol also has the additional advantage of becoming a chemiluminescent species upon oxidation (see Ji.
rka et al., Analytica Chemica Acta 284: 345 (1993)), which allows optical detection of electron transfer from the ETM to the electrode. As long as luminol does not directly contact the electrode, ie, in the presence of an ETM where there is no efficient electron transfer path to the electrode, luminol is oxidized only by transferring electrons to the ETM on the assay complex.
In the absence of ETM (ie, when the target sequence does not hybridize the composition of the invention), luminal is not significantly oxidized, resulting in low photon emission from luminol and low (if any) signal emission. . Very large signals occur in the presence of the target. Thus, measuring luminol oxidation by photon emission is an indirect measure of the ETM's ability to donate electrons to the electrodes. In addition, photon detection is generally more sensitive than electronic detection, thus increasing the sensitivity of the system. Initial results suggest that luminescence is dependent on hydrogen peroxide concentration, pH and luminol concentration, which is not linear.

Suitable source molecules are well known and include ferricyanide and luminol,
It is not limited to these.

On the other hand, an output electron acceptor can be used. That is, the above reaction is performed in reverse.
ETM such as metallocene which receives electrons from the electrodes is used. An output electron acceptor that rapidly and repeatedly receives electrons converts metallocene to metallisenium. In this embodiment, cobalt isenium is the preferred ETM.

The presence of ETM on the surface of the monolayer can be detected by various methods. Optical detection includes, but is not limited to, for example, fluorescein,
There are phosphorescens, luminescens, chemirminsens, electroluminescens and refractive indexes. Electronic detection includes, but is not limited to, amperometry, voltammetry, capacitance, and impedance. These methods include time- and frequency-dependent methods based on AC or DC current, pulse methods, lock-in methods, filter methods (high-pass, low-pass, bandpass) and time-resolved methods such as time-resolved fluoresence. is there.

In one embodiment, efficient transfer of electrons from the ETM to the electrode
In the redox state. With many ETMs, including ruthenium complexes containing bipyridine, pyridine, and imidazole rings, these changes in the redox state are related to changes in the spectrum. Significant differences in absorption are seen between the reduced and oxidized states for these molecules. For example, reference, Fabbri
zzi et al., Chem. Soc. Rev. 1995 pp192-202. These differences can be monitored using a molecular photometer or a photomultiplier.

In this embodiment, the electron donor and acceptor include all derivatives described above for optical activation or initiation. Preferred electron donors and acceptors are characterized by large spectral changes in redox that allow for sensitive monitoring of electron transfer. Preferred examples include Ru (NH ₃ ) ₄ py and Ru (bpy) zim. It should be understood that only the donor or receiver monitored by absorption has ideal spectral properties.

[0301] In a preferred embodiment, electron transfer is detected by fluorimetry. Many transition metal complexes, such as ruthenium, have apparent fluorescence. Therefore, the redox state of the electron donor bound to the nucleic acid and the receptor charge, Ru (4,7-biphenyl ₂ -
Phenanthroline) ₃ ²⁺ using fluorescence due, can be monitored sensitively. The formation of this compound can be easily measured by standard fluorescence detection methods. For example, laser-induced fluorescence is recorded on a standard cell fluorimeter, on-line fluorimeter flow (eg, coupled to chromatography), or on a multi-sample “plate reader” similar to those commercially available for 96-well immunoassays. can do.

On the other hand, fluorescence can be measured using an optical binding sensor with a binding ligand in solution or a nucleic acid probe bound to an optical fiber. Fluorescence can be monitored using an optical intensifier or other photodetector coupled to the optical fiber. The advantage of this is that the amount of sample used for detection can be very small.

Further, scanning fluorescence detectors, such as Fluorlmager, available from Molecular Dynamic, are well suited for monitoring the fluorescence of modified nucleic acid molecules lined up on solid surfaces.
The advantage of this system is that multiple electron transfer probes can be scanned at once using a chip covered with thousands of different nucleic acid probes.

Many transition metal complexes fluoresce with large Stokes shifts. Suitable examples include bis and trisphenanthroline complexes of transition metals such as ruthenium,
And bis and tribipyridine complexes (see Juris, A., Balzani, V.
, et al. Coord. Chem. Rev., V.84, p.85-277, 1988). Preferred examples show efficient fluorescence (reasonably high quantum yield) and low reconstruction energy. These include, Ru (4,7-biphenyl ₂ - phenanthroline) ₃ ^2+, Ru (4,4'-
There are diphenyl 2,2'-bipyridine) ₃ ²⁺ and platinum complexes (see, Cumming
s et al., J. Am. Chem. Soc. 118: 1949-1960 (1996), which is hereby incorporated by reference). On the other hand, the decrease in fluorescence associated with hybridization can be measured using these systems.

In another embodiment, electrochemiluminescence is used as the basis for electron transfer detection. Some ETMs, such as Ru ²⁺ (bpy) ₃ , have reduced excited states in direct luminescence.
This change in property is related to nucleic acid hybridization and can be monitored with a simple optical intensifier. (See, Blackburn, GF Clin. Chem. 37: 1534-
1539 (1991); and Juris et al., Supra).

In a preferred embodiment, amperometry, voltammetry, capacitance and impedance, etc. are used for electron detection. Preferred techniques include, but are not limited to, electrogravimetric analysis, coulometry (including controlled potential coulometry and constant current coulometry), voltammetry (cycle voltammetry, pulse voltammetry (normal pulse voltammetry, square wave voltametry). Measurement, differential pulse voltammetry, osteo wing
Square wave voltammetry, electrostatic pulse method), stripping analysis (anion stripping, cation stripping, square wave stripping voltammetry), conduction analysis (electronic conduction, direct analysis), time-dependent electrochemical analysis (chronoan (Perometry, chronopotentiometry, cycle chronoamperometry, cycle chronopotentiometry, ac porography, chronogalvometry, chronochromometry), ac impedance method, capacitance method, ac voltammetry, opto-electrochemical method.

In a preferred embodiment, monitoring of electron transfer is performed with amperometric detection. In this detection method, the potential (as compared to an isolated control electrode) between a nucleic acid binding electrode and a control (reverse) electrode in a sample containing the desired target gene is utilized. Different efficiencies of electron transfer result from the presence or absence of the target nucleic acid. That is, the presence or absence of the target nucleic acid, and thus the labeled probe, produces different currents.

Instruments for measuring electron transfer with amperometry include sensitive current sensing,
Means for controlling the voltage potential, always including a potentiostat. This voltage is optimized by reference to the potential of the electron donor complex on the label probe. Electron-donating complexes include those described above for complexes of iron, osmium, platinum, cobalt, rhenium, and ruthenium, with iron complexes being most preferred.

In a preferred embodiment, other electron detection methods are used. For example, potentiometry (ie, voltammetry) includes the non-Faraday method (no net current).
And are commonly used in pH and other ion detectors. Similar sensors are used to monitor the electron transfer between the ETM and the electrodes. In addition, insulators (
Other properties such as resistance (such as resistance) and conductors (conductivity, impedance, capacitance) are used to monitor electron transfer between the ETM and the electrodes. Also, any system that produces a current (such as electron transfer) produces a small magnetic field and can be monitored in certain embodiments.

One advantage provided by the fast rate of electron transfer found in the compositions of the present invention is that time resolution can generally enhance signal-to-noise results in monitors such as absorption, fluorescence or electron flow. The high speed of electron transfer of the present invention results in a high signal and a typical delay between electron transfer onset and completion. By amplifying the signal of a particular delay, pulse initiation of electron transfer and "lock-in" amplification detection and Fourier transformation occur.

[0311] In a preferred embodiment, electron transfer is initiated using an alternating current (AC) method. Without being bound by theory, the ETM coupled to the electrode responds similarly to the alternating voltage flowing through the connected resistor and capacitor. Basically, any method by which the properties of the complex acting as these resistors and capacitors can be measured can be the basis of detection. Surprisingly, conventional electrochemical theory, such as Laviron et a
l., J. Electroanal. Chem. 97: 135 (1979) and Laviron et al., J. Electro.
anal. Chem. 105: 35 (1979) (hereby incorporated by reference), except for a very small E _AC (<10 mV) and a relatively large number of molecules, the system described herein. Does not become a model. That is, the alternating current (I) is not accurately described in Laviron's equation. This stems in part from the theory assuming an unlimited source and sink of electrons, which is not the case for the system of the present invention.

Thus, using the Nernst equation and the first principles, another equation was created to develop a model that closely fits the results. This is as follows. The Nernst equation, Equation 1 below, indicates that not all molecules are oxidized at the same oxidation potential, so the ratio of oxidized molecules (O) to reduced molecules (R) at a given voltage and temperature (number of molecules = n
). Equation 1

(Equation 1) (1) E _DO is the electrode potential, E ₀ is the formal potential of the metal complex, R is the gas constant, T is the temperature in Kelvin degrees, n is the number of transmitted electrons, F is the Faraday constant, [O] Is the temperature of the oxidized molecule and [R] is the concentration of the reduced molecule.

The Nernst expression can be rewritten as Expressions 2 and 3. Equation 2

(Equation 2) (2) E _DO is an electric potential DC element. Equation 3

(Equation 3) (3)

Equation 3 can be rewritten in Equations 4, 5, and 6 by normalizing to a concentration equal to 1 for simplicity. Next we need to multiply the total number of molecules. Formula 4 [O] + [R] = 1 Formula 5 [O] = 1- [R] Formula 6 [R] = 1- [O]

Inserting Equations 5 and 6 into Equation 3, nF / RT is equal to 38.9 V ⁻¹ , so n
Assuming = 1, Equations 7 and 8, which define [O] and [R], respectively, are as follows: Equation 7

(Equation 4) (4) Equation 8

(Equation 5) (5)

[0316] Considering the occurrence of AC Faraday current, the [O] / [R] ratio at a given potential must be tested. The particular E _DC with the applied E _AC is, as described generally herein, at the maximum value of E _AC , where the surface voltage is E _DC + E _AC , so more molecules are in the oxidation state , And at the minimum value of E _AC , the voltage is reduced, so that it is further reduced. Thus, the alternating current (AC) at a given E _DC is detected by both AC and DC voltages, similar to the Nernst curve. Specifically, when the number of oxidized molecules at the minimum AC cycle is subtracted from the value at the maximum AC cycle, the total change in the AC cycle is obtained as shown in Equation 9. Then divide by 2 to get the AC amplitude. Equation 9

(Equation 6) Equation 10 gives an alternating current. Equation 10

(Equation 7) (6)

As shown in Equation 11, the total AC current is represented by the number of redox molecules C), Faraday constant (F), AC frequency (ω), 0.5 (to take into account AC amplitude), and Equation 7 Derived from the ratio. The AC voltage is approximately the average amplitude E _AC 2 / π. Equation 11

(Equation 8) (7)

Using Equation 11, the simulation was performed with the overpotential (AC voltage) increased.
FIG. 22A of PCT US97 / 20014 shows one of its simulations
. FIG. 22B shows a simulation based on the conventional theory. Figures 23A and 23B
Is a simulation, Ec-w of Example 7 of PCT US97 / 2002.
ire is plotted to represent actual experimental data.
It can be seen that the results match well. In some cases the current is smaller than expected,
It turns out to be mostly due to ferrocene modification which can be improved. However,
Neither the effect of the child transmission speed nor the instrumental factor is incorporated into Equation 11. Electronic transmission
Speed is important when it is near or below the application frequency. Thus true i _AC Is a function of three factors as shown in Equation 12 below. Equation 12 i_AC= F (Nernst factor) f (k_ET) f (Equipment factor)

These equations can model and predict expected AC current in systems utilizing input signals including AC and DC elements. As noted above, surprisingly, conventional theory does not model these systems at all except at very low voltages.

In general, non-specifically bound labeled probes / ETMs exhibit a difference in impedance (ie, higher impedance) than when the labeled probe containing the ETMs specifically bound in the correct direction. In a preferred embodiment, washing off non-specific binding substances results in an infinite effective impedance. Thus, alternating current detection has several advantages, generally described below, including increased sensitivity and the ability to eliminate background noise. In particular, changes in impedance (including, for example, bulk impedance) can be monitored as the difference between non-specific binding of the ETM-containing probe and target-specific assay complex formation.

Thus, using the AC initiation and detection method, the frequency response of the system is ETM
It changes as a result of being. "Frequency response" means the signal modification as a result of electron transfer between the electrode and the ETM. This modification differs according to the signal frequency. The frequency response includes AC current, phase shift, DC offset voltage, Faraday impedance, etc. at one or more frequencies.

Once an assay complex comprising a target sequence and a labeled probe has been created, the first input electronic signal is used in the system, preferably via at least a sample electrode (including the complex of the invention) and a counter electrode. , And electron transfer between the electrode and the ETM is started. Electrode systems are also used at the voltages applied to the control and working electrodes. The first input signal includes at least one AC element. AC elements are of variable amplitude and frequency. Generally, for use in the method of the present invention, the AC amplitude is about 1 mV-1.1 V, preferably about 10 mV-800 mV, especially about 10-500 mV. The AC frequency is about 0.01 Hz to 100 KHz, preferably about 10 Hz to 10 MHz, and particularly preferably about 100 Hz to 20 MHz.

The combined use of AC and DC signals has various advantages, including surprising sensitivity and signal maximization.

[0324] In a preferred embodiment, the first input signal comprises an AC element and a DC element. That is, the DC offset voltage of the sample and the reverse electrode is the ETM (eg, with ferrocene, the sweep is typically 0 to 500 mV) (or, when the working electrode is grounded, the control electrode is swept from 0 to -500 mV). Swept through the chemical potential. This sweep is used to identify the DC voltage at which the maximum response of the system is seen. This is generally at or near the electrochemical potential of the ETM.
Once this voltage is measured, a sweep or one or more uniform DC onset voltages are used. The DC onset voltage is about -1V to + 1.1V, and about -500V.
mV to +800 mV is desirable, and about -300 to 500 mV is particularly desirable.
In a preferred embodiment, the DC onset voltage is not zero. At the top of the DC onset voltage, a signal AC element of variable amplitude and frequency is applied. If the ETM is present and can respond to an AC perturbation, the transfer of electrons between the electrode and the ETM will produce an AC current.

In established systems, a single input signal is sufficient to identify the presence or absence of an ETM (ie, the presence of a target sequence) nucleic acid. On the other hand, multiple input signals are also adapted. There are many types, multiple frequencies, multiple AC amplitudes, or combinations thereof.

Thus, in a preferred embodiment, using multiple DC onset voltages,
DC voltage sweep is preferred. This can be done at a single frequency or at two or more frequencies.

In a preferred embodiment, the AC amplitude can be varied. Without being bound by theory, increasing the amplitude seems to increase propulsion. A high amplitude results in a high overpotential, giving a fast speed of electron transfer. Generally, the same system improves response at a single frequency through the use of a high overpotential at that frequency (ie, a faster output signal). As the amplitude increases at higher frequencies, the speed of electron transfer through the system increases and sensitivity increases. Further, for example, this may be used to elicit a response in a slow system that does not have an arrangement with adequate space.

In a preferred embodiment, measurements of the system are made at at least two isolated amplitudes or overpotentials. Multiple amplitudes are preferred. As mentioned above, changes in response as a result of amplitude changes form the basis for system identification, calibration and quantification. Furthermore, one or more AC frequencies can be used as well.

In a preferred embodiment, the alternating frequency is variable. At different frequencies, different molecules respond in different ways. As those skilled in the art will appreciate, the output current generally increases with increasing frequency. However, when the frequency is higher than the speed at which electrons travel to and from the electrode and the ETM, the higher frequency results in a loss or reduction of the output signal. At some point, the frequency will be greater than the speed of electron transfer between the ETM and the electrode, and the output signal will also decrease.

In one embodiment, a single measurement of the output signal at a single frequency is used for detection. That is, the frequency response of the system in the absence of the target sequence and thus the absence of the labeled probe containing the ETM can be pre-measured and is very low at certain high frequencies. With this information, a particular frequency response indicates the presence of the assay complex. That is, all responses at a particular frequency characterize the assay complex. It is only necessary to use a single input high frequency, and any change in all frequency responses is indicative of the presence of the analyte and the presence of the target sequence.

Further, using the alternating current technique results in a significant reduction in the background signal at all single frequencies by substances other than ETM. That is, "closing out" or "filtration" of unwanted signals. The frequency response of a charge carrier or redox active molecule in solution is limited by its diffusion coefficient and charge transfer coefficient. Thus, at high frequencies, the charge carrier cannot diffuse fast enough to transfer its charge to the electrodes, and / or the rate of charge transfer is not fast enough. This is especially true if no suitable monolayer is used or if a partial or incomplete monolayer is used, ie no solvent can reach the electrode. As already outlined,
In direct current techniques, the presence of "holes" through which the solvent can reach the electrodes depends on the "
Short-circuiting "may result in solvent charge carriers: reaching the electrodes and generating a background signal. However, using current alternating current techniques, one or more frequencies may be chosen to prevent the presence of a monolayer. Prevents the frequency response of one or more charge carriers in solution, whether or not present, which means that many biological fluids, such as blood, contain significant amounts of redox-active molecules that can interfere with amperometric detection. So it's especially meaningful.

In a preferred embodiment, measurements of the system are made at at least two isolated frequencies, with measurements at multiple frequencies being preferred. There are scans at multiple frequencies.
For example, an alternating current is 10-100 kHz at a low input frequency such as 1-20 Hz.
When compared to the response to an output signal at a higher frequency, such as the presence or absence of ETM, the difference in frequency response is shown. In a preferred embodiment, the frequency is measured at at least 2, preferably about 5, and more preferably at least about 10 frequencies.

After conducting the input signal to initiate electron transfer, the output signal is received, ie, detected. The presence and increase of the output signal depends on many factors. Input signal overpotential / amplitude; input AC signal frequency; intervening medium composition; DC onset; system environment; ETM properties; For a given input signal, the presence and enhancement of the output signal generally depends on the presence or absence of the ETM, the location and distance of the ETM from the monolayer surface, and the nature of the input signal. In some embodiments, it is possible to discriminate, based on impedance, the difference between the non-specific binding of the labeled probe and the formation of a target-specific assay complex containing the labeled probe.

[0334] In a preferred embodiment, the output signal comprises an alternating current. As described above, the magnitude of the output current depends on the number of parameters. Varying these parameters will optimize the system in number.

The alternating current produced by the present invention is generally at about 1 femptoamp to about 1 milliamp,
About 50 femptoamps to about 100 microamps are preferred, and about 1 picoamp to about 1 microamp are particularly preferred.

[0336] In a preferred embodiment, the output signal is a phase shifted by the AC element as compared to the input signal. Without being bound by theory, it appears that making the system of the present invention sufficiently uniform allows for phase shift detection. That is, the biocomposite in which the electron transfer of the present invention occurs uniformly reacts with the AC input, which is the same as a standard electronic device, and the phase shift can be measured. This means that ETM
Serve as the basis for the detection of the presence or absence of, and / or the difference between the presence of a target-specific assay complex containing a labeled probe and the non-specific binding of a substance to a system component.

The output signal is characterized by the presence of ETM. That is, the output signal is characterized by the presence of a target-specific assay complex comprising the labeled probe and the ETM. In a preferred embodiment, the basis for detection is the difference in the Faraday impedance of the system as a result of the formation of the assay complex. Faraday impedance is the impedance of the electrode and ETM system. Faraday impedance is quite different from bulk or two-electron impedance, and bulk impedance is the impedance of the bulk solution between the electrodes. Many factors can change the Faraday impedance that does not affect the bulk impedance, and vice versa.
Thus, the assay complex of the present system containing nucleic acids has a certain Faraday impedance, which depends on the distance between the ETM and the electrode, its electronic properties, the composition of the intervening medium, and the like. What is important in the method of the present invention is that the Faraday impedance between the ETM and the electrode is very different depending on whether the labeled probe containing the ETM binds specifically or non-specifically to the electrode.

Thus, the present invention further provides an apparatus for nucleic acid detection using an alternating current detection method. The apparatus includes a test chamber having at least a first measurement or sample electrode and a second measurement or counter electrode. A three electrode system is also used. The first and second electrodes contact the test sample receiving area, and in the presence of a liquid test sample, the two electrodes can make electronic contact.

In a preferred embodiment, the first measurement electrode comprises a mounting linker and a single-stranded nucleic acid capture probe covalently linked via a monolayer containing a conductive oligomer as described above.

The device includes an alternating voltage source electrically connected to the test room or measurement electrode. Preferably, the AC voltage source may emit the offset voltage as well.

In a preferred embodiment, the device further comprises a processor capable of comparing the input signal with the output signal. A processor is coupled to the electrode and positioned to receive the output signal and detects the presence of a surface nucleoside. Therefore, the composition of the present invention is used for various researches, clinical studies, quality control, field tests, and the like.

In a preferred embodiment, these probes are used for genetic diagnosis. For example, using the techniques disclosed herein, probes can be used to probe, for example, non-mushroom colon oncogenes, BRCA1 breast oncogenes, various cancer-related genes, P53, and Apo, a maximum risk index for Alzheimer's disease. It can be prepared to detect a target sequence, such as the E4 gene, to facilitate prodromal screening of patients, systemic fibrosis gene mutations, or anything else well known in the art.

In another embodiment, detection of viruses and bacteria can be performed using the complexes of the present invention. In this embodiment, probes are designed to detect target sequences from various viruses and bacteria. For example, current blood screenings rely on the detection of anti-HIV antibodies. The method disclosed herein comprises:
It allows direct screening for the detection of HIV nucleic acid sequences, especially highly conserved HIV sequences, in clinical samples. In addition, this allows direct monitoring of the virus circulating in the patient's body as an improved method of assessing the efficacy of antiviral therapy. Similarly, leukemia-related viruses, HLTV-I and HLTV-II
Can be detected in this way. Bacterial infections, such as tuberculosis, Crimidia and other sexually transmitted diseases, may also be used, for example, as ribosomal RNA (r
RNA).

In certain preferred embodiments, each nucleic acid of the present invention is also used as a probe for toxic bacteria in screening water or food samples. For example,
For each sample, the bacteria are lysed to release their nucleic acids (particularly rRNA), and then the probe is designed to recognize the bacterial strain. However, the bacteria include, but are not limited to, pathogenic strains such as Salmonella, Campylobacter, Vibrio cholerae, Leishmania, enterotoxic E. Coli strains, and Legionaire's disease bacteria. Similarly, biohealing tactics using the compositions of the present invention,
Can be evaluated.

In a further embodiment, samples taken from victims or suspects are used in a forensic "forensic" DNA fingerprinting test.

In a further embodiment, probes of an array sequence are used for sequencing by hybridization.

Thus, the present invention, in one embodiment, provides extremely specific and sensitive probes that can detect a target sequence without removing unhybridized probes. This is useful for forming automated gene probe assays.

Alternatively, the compositions of the present invention are useful for detecting successful gene amplification in PCR, and thus a successful PCR reaction can be an indicator of the presence or absence of a target sequence. PCR is used in several ways in this manner.
For example, in one embodiment, the PCR reaction is performed as is known in the art, and then added to a composition of the invention comprising a target nucleic acid and an ETM, and via a conductive oligomer to an electrode. Covalent binding followed by detection of the target sequence. Alternatively, PCR is performed with a conductive oligomer and a target nucleic acid, using nucleotides labeled with ETM, either in the presence of an electrode or subsequently adding an electrode. Binding of the ETM-containing PCR product to the electrode composition is detected by electron transfer. Finally, the nucleic acid bound to the electrode via the conductive polymer is
The addition of a second primer labeled with will result in one of the PCR primers. Upon extension, a double-stranded nucleic acid having an ETM and a covalently bonded electrode is generated. In this way, the invention is used for PCR detection of each target sequence.

In certain preferred embodiments, these sequences are used for mRNA detection. One preferred embodiment utilizes either a capture probe or a capture extension probe that hybridizes near the 3 'polyadenylation end of these mRNAs. This allows one type of target binding probe to be used for the target, ie, a probe containing a poly-T moiety that binds to the poly-A end of the mRNA target. Generally, the probe is preferably non-poly-T and contains a second moiety that binds to the detection probe (or other probe). This makes it possible to prepare one type of target binding probe and reduce the amount of heterologous probe synthesis.

In certain preferred embodiments, the use of restriction enzymes and ligation techniques allow the creation of “universal” array sequences. In this embodiment, a monolayer comprising a capture probe comprising a restriction endonuclease terminus, shown generally in FIG. 7 of PCT US97 / 2002. By utilizing the complementary portion of the nucleic acid, an array sequence is prepared that includes all of the restriction endonuclease sites, while leaving "sticky ends". Treating a target sample with one or more of these restriction endonucleases allows those targets to bind to the array sequence. This can be done without knowing the sequence of the target. The targets can be ligated, if desired, using standard techniques, such as ligase, and the target sequence can be detected using either standard labels or the methods of the invention.

The present invention provides a method capable of detecting nucleic acids with high sensitivity. In a preferred embodiment, up to about 10 × 10 ⁶ , preferably up to about 10 × 10 ⁵ , more preferably up to about 10 × 10 ⁴ , particularly preferably up to about 10 × 10 ³ , most preferably up to about 10 × 10 ^2. Of molecules are detected. This infers a 1: 1 correlation between the target sequence and the reporter molecule, and should be more sensitive if more than one reporter molecule (ie, electron transfer molecule) is used for each target sequence. Will be apparent to those skilled in the art.

At present, the limit of detection has been estimated based on published electron transfer rates through DNA, which is roughly 1 × 10 ⁶ electrons / sec / duplex per 8 base pair separations. Yes (Meade et al., Angw. Chem. Eng. Ed., 34: 352
(1995)), enabling high propulsion and AC frequencies of about 100 kHz. Preliminary results show that electron transfer through these systems is extremely efficient, reaching nearly 100 × 10 ³ electrons / sec, and is a powerful and femto Brings the amplifier sensitivity.

The following examples are intended to describe the methods of use of the present invention in more detail, and to describe the methods believed to be the best for carrying out the various aspects of the present invention. It is to be understood that these examples are not intended to limit the true scope of the invention in any way and are set forth for illustrative purposes. All references cited herein are hereby incorporated by reference in their entirety.

EXAMPLES Example 1 Synthesis of Nucleosides Modified at the 2 'Position with Ferrocene

The preparation of N6 is described.

Compound N6. Ferrocene (20 g, 108 mmol) and 4-bromo-butyl chloride (20 g, 108 mmol) was dissolved in dichloromethane 450 mL, then added anhydrous AlCl ₃ (14.7g, 11mmol). The reaction mixture is stirred at room temperature for 1 hour and 40 minutes, then quenched by adding 600 mL of ice. Separate the organic layer and wash with water until the aqueous layer is near neutral (pH = 5). The organic layer is dried over Na ₂ SO ₄ and concentrated. The crude product is treated with 50/50 hexane / dichloromethane followed by 30/7
Purify by flash chromatography, eluting with 0 hexane / dichloromethane / over 300 gm of silica gel to give 26.4 gm (73%) of the title compound.

Compound N2. Compound N1 (6 g, 18 mmol) was added to toluene 12 in a round bottom flask.
Dissolve in 0 mL. Zinc (35.9 g, 55 mmol), mercury chloride (3.3 g, 12
mmol) and water (100 mL) are added sequentially. Then the HCl solution (12M, 8
0 mL) is added dropwise. The reaction mixture is stirred for 16 hours at room temperature. Separate the organic layer,
Wash with water (2 × 100 mL) and concentrate. Further purification by flash chromatography (hexane) on 270 gm of silica gel gives the desired compound as a brown solid (3.3 g, 58%).

Compound N3. Adenosine 13.6 gm (51 mmol) in 400 mL of dry DMF
Was cooled in an ice-water bath for 10 minutes and then 3.0 gm of NaH (60%)
(76 mmol) are added. The reaction mixture was stirred at 0 ° C. for 1 hour before compound N2 (
16.4 g, 51 mmol) are added. Next, the temperature was gradually increased to 30 ° C.
The reaction mixture is kept at this temperature for 4 hours and then quenched with 100 ml of ice. Evaporate the solvent in vacuo. The obtained gum is dissolved in 300 mL of water and 300 mL of ethyl acetate. Completely extract the aqueous layer (ethyl acetate 3 × 300 mL). The combined organic extracts are concentrated and the crude product is purified by flash chromatography on 270 g of silica gel. The column was washed with 20% ethyl acetate / dichloromethane, 50%
Elute with 70% ethyl acetate / dichloromethane, 70% ethyl acetate / dichloromethane, ethyl acetate, 1% methanol / ethyl acetate, 3% methanol / ethyl acetate, and 5% methanol / ethyl acetate. The desired fraction is concentrated to give the desired compound (6.5 g).
, 25%).

Compound N4. Compound N3 (6.5 g, 12.8 mmol) was dried in 150 ml of pyridine.
Dissolve in L and add TMSCl (5.6 g, 51.2 mmol). The reaction mixture is stirred at room temperature for 1.5 hours. Then, phenoxyacetyl chloride (3.3 g,
19.2 mmol) at 0 ° C. The reaction mixture was then stirred at room temperature for 4 hours,
Quench at 100C with 100 mL of water. The solvent is removed under reduced pressure and the crude gum is flash chromatographed on a further 90 g of silica gel. (1% methanol / dichloromethane) (2.3 g, 28%)

Compound N5. Compound N4 (2.2 g, 3.4 mmol) and DMAP (200 m
g, 1.6 mmol) in 150 mL of dry pyridine and DMTCl (1.4 g).
, 4.1 mmol). The reaction mixture is stirred at room temperature overnight in a stream of argon. The solvent is removed under reduced pressure and the residue is dissolved in 250 ml of dichloromethane. Wash the organic solution with a 5% NaHCO ₃ solution (3 × 250 mL), dry over Na ₂ SO ₄ and then concentrate. Further purification by flash chromatography (1% TEA / 50% hexane / dichloromethane) on 55 g of silica gel gives the desired compound (1.3 g, 41%).

Compound N6. N5 (3.30 gm, 3.50 mm
ol) in a solution containing diisopropylethylamine (4.87 mL, 8.0).
eq.) and a catalytic amount of DMAP (200 mg). Keep the mixture at 0 ° C.,
N-diisopropylamino cyanoethyl phosphonamidic acid chloride (
2.34 mL, 10.48 mmol). The reaction mixture is warmed and stirred at room temperature overnight. After dilution by adding 150 mL of dichloromethane and 250 mL of 5% aqueous NaHCO ₃ , the organic layer is separated, washed with 5% NaHCO ₃ (250 mL), dried over Na ₂ SO ₄ and then concentrated. The crude product is purified on a flash column packed with 66 g of silica gel using a 1% solution of TEA in hexane. The elution solvent was 1% TEA in hexane (500 mL), 1% TEA and 10% dichloromethane in hexane (500 mL), 1% TEA and 20% dichloromethane in hexane (500 mL), 1% TEA and 50% dichloromethane in hexane. Solution (500 mL). The fraction containing the target compound is collected, concentrated,
This gives the desired compound (3 gm, 75%).

Example 2 Synthesis of “Branched” Nucleosides

The production of N17, shown in FIG. 11A, is described.

Synthesis of Compound N14. Tertiary butyldimethylsilyl chloride (33.38 g,
0.22 mol) of imidazole (37.6) in a 300 mL solution of dichloromethane.
9 g, 0.55 mol). A large amount of precipitate forms immediately. 2-Bromoethanol (27.68 g, 0.22 mol) is added slowly at room temperature. The reaction mixture is stirred at this temperature for 3 hours. The organic layer was washed with water (200 mL), 5% NaHCO ₃ (2
× 250 mL) and water (200 mL). Removal of the solvent gives 52.52 g of the title compound (99%).

Synthesis of Compound N15. Adenosine (40 g, 0.15 mol) in 1.0 L of DMF
Was dispersed at a temperature of 0 ° C. in NaH (a mineral oil solution at 60% in 8.98 gm, 0.2
2 mol) are added. The mixture was stirred at 0 ° C. for 1 hour and N14 (35.79 gm, 0
. 15 mol). The reaction mixture is stirred at 30 ° C. overnight. Add 100 mL of ice water and quench. The solvent is removed under high vacuum. The remaining foam is dissolved in a mixture of 800 ml of ethyl acetate and 700 ml of water. The aqueous layer was further extracted with ethyl acetate (3 ×
200 mL). The combined organic layers were dried over Na ₂ SO _4, and concentrated. The crude product is purified on a flash column packed with 300 g of silica gel with 1% TEA in hexane. The elution solvent is dichloromethane (500 mL), 3
% MeOH in dichloromethane (500 mL), 5% MeOH in dichloromethane (500 mL), and 8% MeOH in dichloromethane (2000 mL).
The desired fractions are collected and concentrated to give 11.70 g (19%) of the title compound.

Synthesis of Compound N16. N15 cooled to 0 ° C. (11.50 gm, 27.17 mm
ol) in a 300 mL solution of dry pyridine in trimethylsilyl chloride (13.7).
1 mL, 0.11 mol, 4.0). The mixture is stirred at 0 ° C. for 40 minutes.
Add phenoxyacetyl chloride (9.38 mL, 67.93 mmol). reaction
The mixture is stirred at 0 ° C. for 2.5 hours. The mixture is then 700 mL of dichloromethane
And a mixture of 100 mL of water. Shake the mixture well and separate the organic layer. 5
% NaHCO_Three(2 x 300 mL), then wash with dichloromethane
Remove with tvapor. 200 mL of water was added to the residue, and the resulting pyridine mixture was
Stir at room temperature for 2 hours. Then the solvent is removed under high vacuum. Rubbery product
Co-evaporate with 100 mL of lysine. Residue in 250 mL dry pyridine
The solution was dissolved at 0 ° C. and 4,4′-dimethoxytrityl chloride (11.02 gm, 3
2.60 mmol). The reaction is stirred overnight at room temperature. Solution in dichloromethane
700 mL and 5% NaHCO_ThreeTransfer to a mixture with 500 mL. Shake well
Then, the organic layer was separated, and 5% NaHCO_Three(2 x 200 mL), then
And concentrate. The crude product was washed with 270 g of silica gel in 1% TEA / 30% CH. _Two Cl_TwoPurify on a flash column packed with a / hexane solution. Elution solvent
Is 1% TEA / 50% CH_TwoCl_Two/ Hexane (1000 mL), 1% TEA /
CH_TwoCl_Two(2000 mL). The fractions containing the desired product are collected, concentrated and
To give 10.0 g (43%) of the title compound.

Synthesis of Compound N17. To a solution of N16 (10.0 gm, 11.60 mmol) in 300 mL of dichloromethane is added diisopropylethylamine (16.2 mL) and a catalytic amount of N, N-dimethylaminopyridine (200 mg). The mixture is cooled in an ice-water bath and N, N-diisopropylamino cyanoethylphosphonamidic acid chloride (7.78 mL, 34.82 mmol) is added. The reaction mixture is stirred overnight at room temperature. 250 mL of dichloromethane and 5% NaHC were added to the reaction mixture.
Dilute by adding 250 mL of O ₃ . After shaking well, the organic layer is separated, washed once more with an equal volume of 5% aqueous NaHCO ₃ , dried over Na ₂ SO ₄ and concentrated.
The crude product is purified on a flash column packed with 120 g of silica gel using a solution of 1% TEA and 10% dichloromethane in hexane. Elution solvent is 1%
TEA and 10% dichloromethane in hexane (500 mL), 1% TEA
And 20% dichloromethane in hexane (500 mL), and 1% TE
A and 40% dichloromethane in hexane (1500 mL). The relevant fractions are collected and concentrated to give the final product (7.37 gm, 60%).

The synthesis of the other two nucleotides used for branching is shown in FIGS. 11B and 11C when using the Lev protecting group. These branched nucleotides appear to branch off from the phosphate rather than ribose (N17) and produce somewhat better results.

Example 3 Synthesis of Triphosphate Nucleotides Containing ETM

The synthesis of AFTP is described.

Dissolve N3 (1.00 g, 1.97 mmol) in 15 mL of triethyl phosphate and add diisopropylethylamine (0.69 mL, 3.9 mmol).
While maintaining the mixture at 0 ° C., phosphorous oxychloride (0.45 g, 2.
93 mmol) are added. The reaction mixture is stirred at 0 ° C. for 4 hours and then at 4 ° C. overnight. Bis (tributyl) ammonium phosphate (3.24 g, 5.91 mmol) is added and the reaction mixture is stirred at 0 ° C. for 6 hours and then at 4 ° C. overnight. The white precipitate formed in the reaction solution is filtered off. Treatment of the filtrate with water (20 mL) produces a yellow precipitate. The precipitate is collected by filtration and dried under high vacuum to give 0.63 g of the title compound as a yellow solid.

Example 4 Synthesis of Nucleosides Linking Ferrocene via Phosphate

The synthesis of Y63 is described.

Synthesis of C102: A reaction mixture consisting of 10.5 gm (32.7 mmol) of N 2, 16 gm of potassium acetate and 350 ml of DMF is stirred at 100 ° C. for 2.5 hours. The reaction mixture was allowed to cool to room temperature, then 400 ml of ether and 800
Pour into a mixture of ml of water. Shake the mixture and separate the organic layer. The aqueous layer is extracted twice with ether. The ether extracts are combined, dried over sodium sulfate and then concentrated for column chromatography. Silica gel (160 gm
) With 1% TEA / hexane. Load the crude and load the column with 1% T
Eluting with _{EA / 0-100% CH 2 Cl 2} / hexane. The fractions containing the desired product are collected and concentrated to obtain 5.8 g (59.1%) of C102.

Synthesis of Y61: To a flask containing 5.1 gm (17.0 mmol) of C102 is added 30 ml of dioxane. To this solution is added a small amount of 1 M NaOH over 2.5 hours or until hydrolysis is complete. After hydrolysis, the product is extracted with hexane. The combined extracts are dried over sodium sulfate and concentrated for chromatography. Fill silica gel (100 gm) with 10% EtOAc / hexane. Load the crude solution and elute the column with 10% to 50% EtOAc in hexane. The fraction containing the desired product was collected and concentrated to give Y61 4.20.
gm (96.1%).

Synthesis of Y62: In a flask containing 4.10 gm (15.9 mmol) of Y61,
200 ml of dichloromethane, 7.72 ml of DIPEA, and 4.24 gm (
15.9 mmol) of bis (diisopropylamino) chlorophosphine are added.
The reaction mixture is stirred overnight in the presence of argon. After concentrating the reaction mixture to one third of its original volume, 200 ml of hexane are added and the reaction mixture is again concentrated to one third of its original volume. Repeat this operation again. The precipitated salt is filtered off and the solution is concentrated to give 8.24 gm of crude Y62. This product is used for the next step without further purification.

Synthesis of Y63: N-PAC deoxy-adenosine 1.0 gm (1.45 mmol)
A reaction mixture containing 1.77 g of crude Y62, and 125 mg of N, N-diisopropylammonium tetrazolide, and 100 ml of dichloromethane. The reaction mixture is stirred overnight at room temperature. The reaction mixture is then added to 100 ml
With CH ₂ Cl ₂ and 100 m of a 5% NaHCO ₃ solution. Separate the organic phase and dry over sodium sulfate. The solution is then concentrated for column chromatography. Fill silica gel (35 gm) with 10% TEA / hexane. The crude product eluting with _{1% TEA / 10-40% CH 2} Cl 2 / hexane.
The fractions containing the product are collected and concentrated to give 0.25 gm of the title product.

Example 5 Synthesis of ethylene glycol-terminated wire W71

Synthesis of W55: 7.5 gm of tertiary butyldiphenylchlorosilane in a flask
(27.3 mmol), 25.0 gm of tri (ethylene glycol) (166.5 mmol)
), And 50 ml of dry DMF are added under an argon atmosphere. Stir the mixture,
Cool in an ice-water bath. 5.1 gm (30.0 mmol) from another funnel was added to the flask.
A) A clear solution of AgNO ₃ in 80 ml of DMF is added dropwise. After the addition is complete, the mixture is allowed to warm to room temperature and is stirred for a further 30 minutes. Brown AgCl
The precipitate is collected by filtration and washed with DMF (3 × 10 mL). Removal of the solvent under reduced pressure gives a viscous syrup-like liquid product, which is dissolved in about 80 mL of CH ₂ Cl ₂ . The solution is washed with water (6 × 100 mL) to remove unreacted starting material, ie, tris (ethylene glycol), and then dried over Na ₂ SO ₄ . CH ₂
Removal of Cl _2, the crude product ~10.5g is obtained, the ones 50% CH ₂ C
Purify on a column containing 104 g of silica gel packed with l ₂ / hexane. The column is eluted with _{3-5% MeOH / CH 2 Cl 2} . The fractions containing the desired product are collected and concentrated to obtain 8.01 gm (75.5%) of the purified title product.

Synthesis of W68: To a flask containing 8.01 gm (20.60 mmol) of W55, add 8.56 gm (25.8 mmol) of CBr ₄ and 60 ml of CH ₂ Cl ₂ . The mixture is stirred in an ice water bath. 8.11 gm (31
. Add CH ₂ Cl ₂ 15 ml solution containing PPh ₃ of 0 mmol). The mixture is stirred at 0 ° C. for about 35 minutes and left to warm to room temperature. Mix volume of about 10.
Reduce to 0 ml and add 75 ml of ether. The precipitate is collected by filtration, and ether 2 × 7
Wash with 5. The ether is distilled off to obtain about 15 g of a crude product, which is used for purification. Fill silica gel (105 gm) with hexane. After loading the sample solution, the column is eluted with 50% CH ₂ Cl ₂ / hexane and then with CH ₂ Cl ₂ . The desired fraction was collected, concentrated and purified to 8.56 gm of the title product (7.
2.0%).

Synthesis of W69: A solution of 5.2 gm (23.6 mmol) of 4-iodophenol in 50 ml of dry DMF is cooled in an ice-water bath under Ar. 1.0 to this mixture
gm of NaH (60% in mineral oil, 25.5 mmol) are added in portions. The mixture is stirred at the same temperature for about 5 minutes and further at room temperature for 30 minutes. 8.68 gm (19.
A solution of 2 mmol) of W68 in 20 ml of DMF is added to the flask under an argon atmosphere. The flask is covered with aluminum foil and the mixture is stirred at 50 ° C. for 12 hours. DMF is removed under reduced pressure. The residue is dissolved in 300 ml of ethyl acetate and the solution is washed with water (6 × 50 ml). The ethyl acetate is removed under reduced pressure and the residue is loaded for purification into a 100 g silica gel column packed with 30% CH ₂ Cl ₂ / hexane. The column eluting with 30-100% CH ₂ Cl ₂ / hexane. The fractions containing the desired product were collected and concentrated to give 9.5 gm of the title product (84.0
%).

Synthesis of W70: 100 ml containing 6.89 gm (11.6 mmol) of W69
To a volume round bottom flask, add 30 ml of the TBAF THF solution. Solution at room temperature 5
Stir for hours. The THF was removed and the residue was CH_TwoCl_TwoDissolve in 150 ml. solution
To H_TwoWash with O (4 × 25 mL). 10.5 gm semi-solid after removing solvent
Is obtained. 50% CH_TwoCl_Two/ Silica gel (65 gm) using hexane
Refill. After loading the sample solution, the column was set to 0-3% CH._ThreeOH / CH_TwoCl _Two Elute at Each fraction was subjected to TLC (CH_ThreeOH: CH_TwoCl_Two= 5: 95)
. The fractions containing the desired product were collected and concentrated to give 4.10 gm of the title product (99.
0%).

Synthesis of W71: 1.12 gm (3.18 mmol) of W70, 0.23 g (0.8
8 mmol) PPh_Three, 110 mg (0.19 mmol) of Pd (dba)_Two, 110m
g (0.57 mmol) of Cul and 0.75 g (3.2 mmol) of Y4 (1 unit)
Wire) to the flask. Flush the flask with argon,
Then 65 ml of dry DMF and subsequently 25 ml of diisopropylamine are introduced.
The mixture is stirred at 55 ° C. for 2.5 hours. All solvents are removed under reduced pressure. CH for residue _Two Cl_TwoDissolve in 100 ml and complete the solution with saturated EDTA solution (2 × 100 mL)
Wash. CH_TwoCl_TwoIs removed to give 2.3 g of crude product. 50% CH_Two
Cl_TwoSilica gel (30 gm) is filled with hexane / hexane and the sample solution is
After loading, the column was loaded with 10% ethyl acetate / CH_TwoCl_TwoElute at The desired product
Concentrate the containing fractions to give 1.35 gm (2.94 mmol) of the title product. this
The product is further recrystallized from a hot hexane solution and purified to be colorless crystals.

Example 6 Synthesis of Insulator-Bound Nucleosides

Synthesis of C108: In a flask, 2′-amino-5′-O-DMT uridine
0 gm (3.67 mmol), 1.63 gm (3.81 mmol) of C44, TEA 5 m
1 and 100 ml of dichloromethane. The reaction mixture is stirred at room temperature for 72 hours. Remove the solvent and dissolve in a small amount of CH ₂ Cl ₂ . 2% CH ₃ OH / 1
After filling silica gel (35 gm) with% TEA / CH ₂ Cl ₂ and loading the sample solution, the column is eluted with the same solvent system. Collect the fraction containing the target substance,
Concentrate to give 2.5 gm (80.4%) of the title product.

Synthesis of C109: To a flask are added 2.4 gm (2.80 mmol) of C108, 4 ml of diisopropylethylamine, and 80 ml of CH ₂ Cl _{2 in} the presence of argon. The reaction mixture is cooled in an ice water bath. After cooling once, 2.10 gm (8.83 mmol) of 2-cyanoethyldiisopropylchloro-phosphoramide is added. The mixture is then stirred overnight. The reaction mixture is diluted by adding 10 ml of methanol and 150 ml of CH ₂ Cl ₂ . The mixture is washed with a 5% NHCO ₃ solution, dried over sodium sulfate and then concentrated for column chromatography. Pack 65 gm of silica gel with 1% TEA and hexane. The crude was loaded to elute the column with _{1% TEA / 0-20% CH 2} Cl 2 / hexane. The fractions containing the desired product were collected and concentrated to give 2.69 gm (90%) of the title product.
. 9%).

Example 7 Comparison of Various ETM Conjugates

The various ETM conjugates shown in FIG. 1 were compared. As shown in Table 1, the detection probe was bonded to the electrode surface (array including wires in the table). Positive (ie, a probe complementary to the detection probe) and Negative (ie, a probe not complementary to the detection probe) control label probes were added.

Electrodes containing the various compositions of the present invention were prepared and used for AC detection. The experiment was a run as follows. D between working (sample) electrode and reference electrode
When the C offset voltage was erased with the electrochemical potential of ferrocene, it was typically 0 to 500 mV. At the top of the DC offset, a variable amplitude and frequency AC signal was applied. The AC current at the excitation frequency was plotted against the DC offset.

The results are shown in Table 2, where the Y63, VI and IV compounds showed the best results.

[0391]

[Table 1] Unknown: no difference between positive and negative controls.
ND: Not measured.

Table of oligonucleotides containing different metal complexes

[Table 2]

Example 8 A preferred embodiment of the present invention

A variety of systems were tested and all were successfully implemented as outlined below.
All compounds were referenced in FIG. In general, these systems were performed as follows. As described above, each surface was prepared, including the electrodes, the capture probe attached via the binding linker, the conductive oligomer, and the insulator. Other components of the system, including target sequences, capture extension probes, and labeled probes, were incorporated and annealed, typically at 90 ° C. for 5 minutes, and then allowed to cool to room temperature in 1 hour. The mixture was then added to the electrodes and AC detection was performed.

Capture Probe, Capture Extension Probe, Unlabeled Target Sequence, and Labeled Probe : Using the method of Example 16, capture probe D112 containing a 25 base sequence was
It was mixed with the conductive oligomers Y5 and M44 insulator at a ratio of 2: 2: 1. 2
A single base-separated capture extension probe D179 containing a 4-base sequence and completely complementary to the D112 capture probe and containing a 24-base sequence and completely complementary to the 2tar target is added along with the 2tar target. This D179 molecule retains ferrocene at the end closest to the electrode (using a C15 linkage to the base).
Where the linking linker is a conductive oligomer, the use of an ETM at or near this position allows for the demonstration of the presence of the D179 molecule. Ferrocene at this position has a different redox potential from each ETM used for detection. A labeled probe D309 (dendrimer) is added that contains an 18 base sequence that is completely complementary to a portion of the target sequence, a 13 base sequence linker, and four ferrocenes linked using a branched coordination. A representative scan is shown in FIG. 20A. If no 2tar target was added, a representative scan is shown in FIG. 20B.

Use of Capture Probes and Labeled Target Sequences Example A : As described above, capture probe D94 was used with Y5 and M44 conductive oligomers in a ratio of 2: 2: 1 at a total thiol concentration of 833 μM at the electrode. Add on top. A target sequence (D336) was used that contained a 15 base sequence completely complementary to the D94 capture probe, a 14 base linker sequence, and six ferrocenes linked via an N6 compound. A representative scan is shown in FIG. 20C. The use of a different capture probe, D109, which has no homology with the target sequence, serves as a negative control: a representative scan is shown in FIG. 20D.

Example B : As described above, capture probe D94 is applied on electrodes with Y5 and M44 conductive oligomer at a ratio of 2: 2: 1 at a total thiol concentration of 833 μM. A target sequence (D429) containing a 15 base sequence completely complementary to the D94 capture probe, a C131 ethylene glycol linker hooked to six ferrocenes linked via an N6 compound was used. A representative scan is shown in FIG. 20E. A different capture probe, D1, which has no homology with the target sequence
Use of 09 serves as a negative control: a representative scan is shown in FIG.
Shown in F.

Use of a capture probe, a capture extension probe, an unlabeled target sequence, and two labeled probes with a long linker between the target binding sequence and each ETM. As described above, capture probe D112, Y5 conductivity The oligomer, M44 insulator, and capture extension probe D179 are used. D2 including two labeled probes: an 18 base sequence that is completely complementary to a portion of the target sequence, a 15 base sequence linker, and six ferrocenes linked using an N6 linkage as shown in FIG.
95. D297 is identical except that its 18 base sequence hybridizes to the rest of the target sequence. A representative scan is shown in FIG. 20G.
If no 2tar target was added, a representative scan is shown in FIG. 20H.

Use of a capture probe, a capture extension probe, an unlabeled target sequence, and two labeled probes with a short linker between the target binding sequence and each ETM. As described above, capture probe D112, Y5 conductivity The oligomer, M44 insulator, and capture extension probe D179 are used. Two labeled probes: an 18-base sequence that is completely complementary to a portion of the target sequence, a 5-base sequence linker, and FIG.
D29 comprising six ferrocenes linked using an N6 linkage as shown in FIG.
Add 6. D298 is identical except that its 18 base sequence hybridizes to the rest of the target sequence. A representative scan is shown in FIG. 2
If no tar target was added, a representative scan is shown in FIG. 20J.

[0400] Two capture probes, two capture extender probes, unlabeled large target sequence, and this test the use of two labeled probes having a long linker between the target binding sequence and each ETM is, rRNA For detection purposes. As described above, a Y5 conductive oligomer, an M44 insulator, and one surface probe, D350, complementary to the two capture sequences, D417 and EU1, were used. D350, Y5 and M44 have a
Added at a ratio of 5: 4.5: 1. Two capture extension probes: D417 with 16 bases complementary to the D350 capture probe and 21 bases complementary to the target sequence;
And EU1, which has 16 bases complementary to the D350 capture probe and 23 bases complementary to the rest of the target sequence. Two labeled probes: a 30 base sequence completely complementary to a portion of the target sequence, FIG.
D468, which includes a linker (including polyethylene glycol) containing 3 Glen (GLEN) shown in Figure 2, and six ferrocenes linked using N6 as shown in Figure 23. D449 is identical except that its 28-base sequence hybridizes to the rest of the target sequence, and the polyethylene glycol linker (C131) used is shorter. A representative scan is shown in FIG. 20K.

Use of Capture Probes, Unlabeled Targets, and Labeled Probes Example A : Capture probe D112, Y5 conductive oligomer, and M44 insulator with a total thiol concentration of 833 μM in a 2: 2: 1 ratio. And put on the electrode. A target sequence MT1 containing a sequence complementary to D112 was added and a 20 base sequence complementary to the labeled probe D358 was combined: in this case, labeled probe D35
8 was added to the target sequence before introduction to the electrode. This labeled probe contains six ferrocenes linked using an N6 linkage, as shown in FIG. A representative scan is shown in FIG. 20L. MT1 is expressed as NC11 that is not complementary to the capture probe.
If replaced by 2, no signal is generated. Similarly, no clutter occurs except for MT1.

Example B : The capture probe D334, Y5 conductive oligomer, and M44 insulator are placed on the electrodes in a 2: 2: 1 ratio at a total thiol concentration of 833 μM. A target sequence LP280 containing a sequence complementary to the capture probe was added and the 20 base sequence complementary to labeled probe D335 was combined: in this case, labeled probe D335 was added to the target before introduction to the electrode. This labeled probe is shown in FIG.
Contains six ferrocenes linked using an N6 linkage. A representative scan is shown in FIG. 20M. Replacing LP280 with an LN280 probe (complementary to the labeled probe but not to the capture probe)
No signal is generated.

Example 9: Tracking PCR Reactions Using the Present Invention PCR reactions were performed using HIV sequences as target sequences. Multi-step reactions were performed and stopped at O-30 or 50 cycles. In this case, as will be appreciated by those skilled in the art, the sense primer is ETM (using the N6 linkage described herein).
And triphosphate nucleotides including ETMs can be used to label non-primer sequences. The surface probe was constructed to hybridize to the 16 nucleotides of the non-primer sequence immediately adjacent to the primer sequence. That is, the labeled primer sequence does not bind to the surface probe. For this reason, detection of adjacent ETMs is performed only when amplification occurs such that the amplified sequence binds to the surface probe.

The target sequence in this case comprises the complete HIV-1 genome, pBluescript Il-KS
Genbank accession number K03455 or M3 inserted at the Sstl site on (+)
Plasmid pBKBH10S containing the 8.9 kb Sstl fragment of pBH10-R3 derived from the HXB2 clone with 8432 (NIH AIDS Research and Reference Regent Program-McKesson Bioservices, Rockville MD). This insertion is T
Transcription from the 7 promoter is directed to produce sense RNA.

The “sense” primer, D353, is as follows: 5 ′-(N6) A (N6) AGGGCT
GTTGGAAATGTGG-3 '. The “antisense” primer, D351, is as follows: 5′-TGTTGGCTCTGGTCTGCTCTGA-3 ′). The following are a expected PCR product of the reaction, which includes a 140 bp; 5 '- (N6) A (N6) AGGGCTGTTGGAAATGTGGAAAGGAAGGACACCAAATGAAGATTGTACTGAGAGACAG GCT 3'-TTTTTCCCGACAACCTTTACACCTTTCCTTCCTGTGGTTTACTTTCTAACATGACTCTCTGTCCGA AATTTTTTAGGGAAGATCTGGCCTTCCTACAAGGGAAGGCCAGGGAATTTTCTTCAGAGCAGACCAGAGC TTAAAAAATCCCTTCTAGACCGGAAGGATGTTCCCTTCCGGTCCCTTAAAAGAAGTCTCGTCTGGTCTCG CAACA-3' GTTTG-5 '.

The surface capture probe, D459 (which does not overlap the sense primer at all)
As follows: 5'-TTGGTGTCCTTCCTTU-4 unit wire (C11) -3 '.

The PCR reaction conditions were standard: TAQ polymerase in TAQ 10X buffer. Primers (1 μM) were added to 6 × 10 ³ , 6 × 10 ⁶ or 6 × 10 ⁷ molecules of template.
The reaction conditions were 90 ° C. for 30 seconds, 57 ° C. for 30 seconds, 57 ° C. for 30 seconds and 70 ° C. for 1 minute.

The electrode was prepared by fusing one end of a pure gold wire having a diameter of 0.127 mm to form a sphere. The electrodes were immersed in aqua regia and the tehn was rinsed with water. SAMs were stored in a stock solution heated at 50 ° C. for 5 minutes (37: 39: 2) before introducing the electrodes.
Precipitated by immersing the electrodes in 1.3: 4.0: 7D459: H6: M44 (1 mM total thiol in 4THF: ACN: water). Add the electrode, then immediately bring it to room temperature, 15
Placed for minutes. The electrode was then treated with M44 (total thiol concentration 400 μM, 37:39:24 THF: A
CN: underwater). The electrode was placed in M44 for 5 minutes at room temperature and the following heating cycle was applied: 1 minute at 70 ° C., followed by 30 seconds at 55 ° C., repeating this cycle twice more,
A 0.3 ° C. gradient was applied and the temperature was lowered to room temperature for 10 minutes while immersing at room temperature. The electrodes were removed from the M44 solution, rinsed with 2XSSC, and hybridized as follows. 6X PCR product
Adjusted to SSC (no FCS). Controls were also adjusted to 6XSSC. Hybridization was performed at room temperature for at least 1.5 hours after rinsing twice with 6XSSC. The ACV conditions were as follows: NaCIO ₄ was used as the electrolyte using an Ag / AgCI reference electrode and a Pt auxiliary electrode. ACV measurements were performed as follows: v = 10 Hz, e = 25 mV, scan range -100 mV to 500 mV. The data is shown in FIG.

Example 10: Ligation on electrode surface For the search for HIV sequences, the experimental design is shown in FIG. Basically, the surface probe D368 (5 '-(H2) CCTTCCTTTCCACAU unit wire (C11) -4) was used at a ratio of D4: H6: M44 of 1: 4: 1 using a total thiol concentration of 833 μM. And H6 containing electrodes. The ligation probe HIVLIG (5'-CCACCAGATCTTC
CCTAAAAAATTAGCCTGTCTCTCTCAGTACAATCTTTCATTTGGTGT-3 ') and target sequence HIVCOM
P (5'-ATGTGGAAAGAAAGGACACCAATTGAAAGATTGTACTGAGAGACAGGCTAATTTTTTAGGGAAGAT
CTGG-3 ') was added along with the ligase to start the reaction. The reaction conditions were as follows: HIVVLIG (10 μM) annealed to HIVCOMP was hybridized to the electrode surface (at 6 × SSC) for 80 minutes. The surface was rinsed in ligase buffer. Ligase (T4) and buffer were added and incubated for 2 hours at room temperature. Triton X (10-4 M) is added at 70 ° C. to denature the newly formed hybridization complex and generate a newly formed long surface probe (including D368 ligated to the HIV LIG probe). Signaling probe for D456 (5 '-(N6)
The addition of G (N6) CT (N60C (N60G (N6) C (N6) TTCTGCACCGTAAGCCATCAAAGATTGTACTGAG-3 ′) was detected. The D456 probe was designed to hybridize to the HIVLIG probe; this was an unbound surface No probe is detected.

Example 11 Use of a Capture Probe Containing an Ethylene Glycol Linker A Capture Probe for an rRNA Assay Containing 0, 4, and 8 Ethylene Glycol Units
The tubes were tested on four separate electrode surfaces. Surface 1 contains a 2: 1 ratio of H6: M44
As a result, the total thiol concentration was 500 μM. Surface 2 has a D568 ratio of 2: 2: 1
/ H6 / M44, with a total thiol concentration of 833 μM. Surface 3 is 2: 2
: 1 ratio D570 / H6 / M44 with a total thiol concentration of 833 μM.
Was. D568 is a capture probe containing 5'-GTC AAT GAG CAA AGG TAT TAA (P282) -3 '
Was. P282 was a thiol. D569 has four ethylene glycol
Unit: 5'-GTC AAT GAG CAA AGG TAT TAA (C131) (P282) -3 '
It was D570 is 8 ethylene glycol units: 5'-GTC AAT GAG CAA AG
It was a capture probe containing G TAT TAA (C131) (C131) (P282) -3 '. H6 (protection
Form) was as follows: (CH_Three)_ThreeSi- (CH_Two)_Two-S- (C₆H_Five) -C = C- (C₆H_Five) -C=CH. M44 is the same as M43 and is as follows:
: HS- (CH_Two)_{1 1}− (OCH_TwoCH_Three)_Three-OH. D483 labeled probe is r
Hybridized with the second portion of the RNA target and was as follows: 5 '-(N6) C (N6
) G (N6C (N6) GG CCT (N6) C (N6) G (N6) C (N6) (C131) (C131) (C131) (C131) T TAA T
AC CTT TGC TC-3 '. D495 is a negative control, as follows:
Yes: 5'-GAC CAG CTA GGG ATC GTC GCC TAG GTGAG (C131) (C131) (C131) (C13
1) (N6) G (N6) CT (N6) C (N6) G (N6) C (N6) -3 '. The results were as follows:

Surface 1: D483-0 (no capture probe present) D4950 Surface 2: D483 126nA D495 1.29nA Surface 3: D483 19.39nA D495 1.51nA Surface 4: D483 84nA D495 1.97nA In addition, the system works well.

Example 12 Detection of rRNA and Comparison of Different Amounts of ETMs The most sensitive rRNA detections to date are mixed in a ratio of 1: 3.5: 1.5 and deposited at 833 μM total thiol concentration. Use a D350 / H6 / M44 surface. D350 is a 4 unit wire of 15-mer DNA; H6 is a 2 unit wire; and M44 is an ethylene glycol terminated alkali chain. When the target molecule is constrained at one or more locations on the sensor surface, good detection limits are seen. To date, two constraint points have been used. The D417 restriction sequence (42mer) and the EU1 capture sequence (62mer) bound 16S rRNA to D350 on the surface. A series of nine labeled probes (D449, D469, D489) previously annealed to rRNA
, D490, D491, D476, D475 and D477) provided electrochemical signals. These labeled probes (signaling molecules) have 6 or 8 N
6 or Y63 type ferrocene. The labeled probe flanking the tack-down area was replaced with a labeled probe containing 20 or 40 ferrocene (simultaneously one end). In addition, the labeled probe that bound to the central region of the mounting area was replaced with a labeled probe containing 20 or 40 ferrocene. Two 6-
When the labeled probe containing ferrocene was replaced with two labeled probes containing 40-ferrocene, the positive signal increased 12-fold. Non-specific signals also increased, indicating a 1.5-fold increase in signal to noise ratio. The best system currently in use mounts rRNA at two locations and 40-
Using a ferrocene-labeled probe, the remaining face of the rRNA molecule was bound to a 6-ferrocene-containing labeled probe. Additional attachment points and label probe multiplicity are contemplated.

A typical experimental protocol is as follows: Surface derivatization: 20 μL of deposition solution (43.2% THF, 45.9% ACN, 10 μL)
1: 3.5: 1.5 D350: H6 at 833 μM total thiol concentration in 2.9% H ₂ O.
: M44) was heated in a sealed 0.5 ml Eppendorf test tube at 50 ° C. for 5 minutes. The dissolved gold ball electrode was inserted into the solution, then immediately moved to room temperature and incubated for 15 minutes. The electrodes were then 37% TH, 39% ACN, 24
Transferred to 200 μL of 400 μM M44 in% H ₂ O and incubated at room temperature for 5 minutes, 40 ° C. for 2 minutes, 2 minutes 30 ° C., and then another 15 minutes at room temperature. The electrodes were then briefly immersed in 2 × SSC (aqueous buffered salt solution) and hybridized as described below.

The hybridization solution is heated at 70 ° C. for 30 seconds and then at 22 ° C. for ３3
Annealed by cooling for 8 seconds. All molecules are twice the target concentration,
35 USC § μM rRNA, in 4 × SSC containing 1.0 μM capture sequence and 3 μM labeled probe. After annealing, the solution was diluted with fetal bovine serum 1:
Diluted to 1, halved the concentration, and changed the solvent to 2 × SSC with 50% FCS. It should be noted that recent experiments with model compounds have indicated that a dilution of 1.2 in bovine serum albumin may be desirable: the reduction of non-specific binding is similar, The sample concentration was not diluted and a positive signal was promoted by a factor of 1.5. This did not happen, however, using the rRNA target. The solution was aliquoted into 20 μL volumes for hybridization.

Hybridization was performed as follows: After immersion in 2 × SSC as described above, the derivatized electrode was placed in an Eppendorf tube containing 20 μL hybridization solution. Hybridized at room temperature for 10 minutes.

[0416] Immediately before the measurement, the electrodes were briefly immersed in 2xSSC at room temperature. Then it is added to 1M Na
Transfer to ClO ₄ electrolyte and change the current voltammogram at 10 Hz frequency and 2 Hz.
It was taken adaptively while changing the peak amplitude current from the center of 5 mV.

[0417] Ten basic experiments were performed (system components in parentheses): System 1. rRNA was attached to only one point (D449 + D417 (EU2)
+ D468 System 2. rRNA attached at two points System 3. Two 20 ferrocene-containing labeled probe systems each pointing to the lateral area of the second attachment point in addition to the two attachment points 4. The second attachment in addition to the two attachment points Two 40-ferrocene-containing labeled probe systems 5, each pointing to the side area of the mounting point 5. Two 20-ferrocene-containing labeled probe systems 6, each pointing to the side area of the first mounting point in addition to the two-point mounting. Two 40-ferrocene-containing labeling probe systems, each pointing to the side area of the first mounting point in addition to the two mounting points 7. The two-point mounting plus the 20 ferrocene-containing central area (i.e., two mounting points) Labeled probe system containing 25 bases that binds to the region between the 8. A two point attachment plus a 40 ferrocene containing central region (ie, Labeled probe system containing 25 bases that binds to the region between the two mounting points 9. The 40 base containing binding to the 20 ferrocene-containing central region (ie, the region between the two mounting points) in addition to the two-point mounting Labeled Probe System 10. Labeled probe containing 40 bases that binds to the central region containing 40 ferrocenes (ie, the region between the two attachment points) in addition to the two points of attachment. The results are shown in FIG. The results show that the multi-point constraint for the large target is better than the one-point constraint. Many ETMs produce larger signals but require more binding energy; recognition of 35 bases for the target.

Example 13 Direct Comparison of Different Configurations of Ferrocene A comparison of different configurations of ferrocene was performed as outlined in FIG. FIG. 24A,
24B, 24C and 24D schematically describe the orientation of several labeled probes.
D94 was as follows: 5'-ACC ATG CAC ACA GA (C11) -3 '. D109 was as follows: 5'-CTG CGG TTA TTA AC (C11) -3 '. “+” Surface is D94
: H6: M44 at a ratio of 2: 2: 1, and the total thiol concentration was 833 μM. The "-" surface had a D109: H6: M44 ratio of 2: 2: 1 and a total thiol concentration of 833 [mu] M. The D548 structure was as follows: 5 '-(N38) (
N38) (N38) (N38) (N38) (N38) (N38) (N38) (N38) ATC TGT GTC CAT GGT-3 '. Each N
38 was 5 '-(H2) (C23) -3'. ^* H2 and C23? The D549 structure was as follows: 5 '-(N38) (N38) (N38) (N38) (N38) (N38) (N38) (N38) (N38) ATC TGT
GTC CAT GGT-3 '. Each N38 was 5 '-(H2) (C23) (C23) -3'. The D550 structure was as follows: 5 '-(N38) (N38) (N38) (N38) AT CTG TGT CCA TGG T-3'
. Each N38 was 5 '-(H2) (C23) (C23) -3'. The D551 structure was as follows: 5 '-(n38) (N38) (N38) (N38) ATCTG TGT CAA TGG T-3'. Each N38 is 5 '-(H
2) (C23) (C23) (C23) (C23) -3 ′. 5 'N38 has two sites for the second modification. A representative schematic diagram is shown in FIG. 24E. The results, shown in FIG. 24F, show that the D551 labeled probe provides the best signal with excellent signal to noise ratio.

Example 17 Ferrocene polymer as both linker and ETM supplemented The system is shown in FIG. D405: 5 '-(C23) (C23) (C23) (C23) (C23) (C
23) (C23) (C23) (C23) (C23) had the structure of AT CTG TGT CCA TGG T-3 ′. The system was run on two surfaces: the "+" surface was in a 2: 2: 1 ratio of D94: H6: M44 with a total thiol concentration of 833 μM. "-" Surface is D109: H6: M4
4 in a 2: 2: 1 ratio, for a total thiol concentration of 833 μM. The results shown in FIG. 25B indicate that the system provides good signal in the presence of a complementary capture probe.

[0420]

[Sequence list]

 SEQUENCE LISTING <110> Clinical Micro sensors <120> Electronic Detection of Nucleic Acids Using Monolayers <130> FP67652-PC / RMS <140> PCT / US99 / 01703 <141> 1999-01-27 <150> 60 / 084,425 <151 > 1998-05-06 <150> 60 / 084,509 <151> 1998-05-06 <150> 09 / 135,183 <151> 1998-08-17 <160> 83 <170> PatentIn Ver. 2.0 <210> 1 < 211> 10 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic <400> 1 gctcgaggct 10 <210> 2 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic <400> 2 ggaattcaag gatccgaatg cc 22 <210> 3 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic <400> 3 cgagctccga ccttaagttc ctaggcttac ggc 33 <210> 4 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic <400> 4 gctcgaggct ggaattcaag gatccgaatg cc 32 <210> 5 <211> 12 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence : synthetic <400> 5 gctcgaggct gg 12 <210> 6 <211> 16 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic <400> 6 cgagctccga ccttaa 16 <210> 7 < 211> 32 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic <400> 7 cgagctccga ccttaagttc ctaggcttac gg 32 <210> 8 <211> 49 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic <400> 8 acctggtctt gacatccacg gaaggcgtgg aaatacgtat tcgtgccta 49 <210> 9 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic <400> 9 catggttaac gtcaattgct gcggttatta a 31 <210> 10 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic <400> 10 gctcgcccca tggttagact gaattgctgc ggttattaa 39 <210 > 11 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic <400> 11 gctcgctatg ctcttgatgg tgctgtggaa atctactgg 39 <210> 12 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic <400> 12 gctcgcatgg tgctgtggaa atctactgg 29 <210> 13 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic <400> 13 gctcgctgac tgaattgctg cggttattaa 30 <210> 14 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Description of Combined DNA / RNA Molecule: synthetic <220> <223> Description of Artificial Sequence: synthetic <400> 14 cttccgtgga tgtcaagacc aggau 25 <210> 15 <211> 15 <212> DNA <213> Artificial Sequence <220> <223> Description of Combined DNA / RNA Molecule: synthetic <220> <223> Description of Artificial Sequence: synthetic <400> 15 accatggaca cagau 15 <210> 16 <211> 15 <212> DNA <213> Artificial Sequence <220> <223 > Description of Combined DNA / RNA Molecule: synthetic <220> <223> Description of Artificial Sequence: synthetic <400> 16 ctgcggttat taacu 15 <210> 17 <211> 86 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic <400> 17 taggcacgaa tacgtatttc cacgataaat ataattaata accgcagcaa ttgacgtata 60 aagctatccc agtagatttc cacagc 86 <210> 18 <211> 47 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic <400> 18 acgtgtccat ggtagtagct tatcgtggaa atacgtattc gtgccta 47 <210> 19 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic <400> 19 gctcgcccca tggttagact gaattgctgc ggttattaa 39 <210> 20 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic <400> 20 gctcgcccca tggttagact ggctgtggaa atctactgg 39 <210> 21 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic <400> 21 gctcgccttt actcccttcc tccccgctga aagtac 36 <210> 22 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic <400> 22 cggagttagc cggtgcttct tctgcggggc tg t 33 <210> 23 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic <400> 23 ctttactccc ttcctccccg ctgaaagtac tttacaaccc 40 <210> 24 <211> 62 <212 > DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic <400> 24 atcctggtct tgacatccac ggaagatctc cctacagtct ccatcaggca gtttcccaga 60 ca 62 <210> 25 <211> 57 <212> DNA <213> Artificial Sequence < 220> <223> Description of Artificial Sequence: synthetic <400> 25 tctacatgcc gtacatacgg aacgtacgga gcatcctggt cttgacatcc acggaag 57 <210> 26 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic <400> 26 gctcgcccgt atgtacggca tgtaga 26 <210> 27 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Combined DNA / RNA Molecule: synthetic <220> <223> Description of Artificial Sequence: synthetic <400> 27 gctactacca tggacacaga u 21 <210> 28 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic <400> 28 acagacatca gagtaatcgc cgtctggt 28 <210> 29 <211> 41 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic <400> 29 gattactctg atgtctgtcc atctgtgtcc atggtagtag c 41 <210> 30 <211> 41 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic <400> 30 gattactctg atgtctgtcc tagtacgagt cagtctctcc a 41 <210> 31 <211> 57 < 212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic <400> 31 tctacatgcc gtacatacgg aacgtacgga gcgattcgac tgacagtcgt aacctca 57 <210> 32 <211> 35 <212> DNA <213> Artificial Sequence <220 > <223> Description of Artificial Sequence: synthetic <400> 32 gctcgcgcga caactgtacc atctgtgtcc atggt 35 <210> 33 <211> 15 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic <400 > 33 atctgtgtcc atggt 15 <210> 34 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Description of Artifici al Sequence: synthetic <400> 34 gctcgcatct gtgtccatgg tagtagc 27 <210> 35 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic <400> 35 gctcgcttct gcaccgtagc catgaaagat tgtactgag 39 <210> 36 <211> 15 <212> DNA <213> Artificial Sequence <220> <223> Description of Combined DNA / RNA Molecule: synthetic <220> <223> Description of Artificial Sequence: synthetic <400> 36 ccttcctttc cacau 15 <210> 37 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic <400> 37 atgtggaaag gaaggacacc aaatgaaaga ttgtactgag agacaggcta attttttagg 60 gaagatctgg 70 <210> 38 <211> 55 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic <400> 38 ccagatcttc cctaaaaaat tagcctgtct ctcagtacaa tctttcattt ggtgt 55 <210> 39 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic <400> 39 gctactacca tggacacaga t 21 <210> 40 <211> 41 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic <400> 40 gattactctg atgtctgtcc atctgtgtcc atggatgtag c 41 <210> 41 <211> 28 <212> DNA <213> Artificial Sequence <220> <223 > Description of Artificial Sequence: synthetic <400> 41 acagacatca gagtaatcgc cgtctggt 28 <210> 42 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic <400> 42 cttccgtgga tgtcaagacc aggat 25 <210> 43 <211> 57 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic <400> 43 tctacatgcc gtacatacgg aacgtacgga gcatcctggt cttgacatcc acggaag 57 <210> 44 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic <400> 44 agatgcatgg catgtatgcc cgctcg 26 <210> 45 <211> 13 <212> DNA <213> Artificial Sequence <220> < 223> Description of Artificial Sequence: synthetic <400> 45 acgagtccat ggt 13 <210> 46 <211> 13 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic <400> 46 agcctagctg gtg 13 <210> 47 <211> 13 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic <400> 47 acgagtccat ggt 13 < 210> 48 <211> 13 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic <400> 48 agcctagctg gtg 13 <210> 49 <211> 15 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic <400> 49 aacagagtcc atggt 15 <210> 50 <211> 15 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic <400> 50 atgtcctagc tggtg 15 <210> 51 <211> 13 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic <400> 51 acgagtccat ggt 13 <210> 52 <211> 13 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic <400> 52 agcctagctg gtg 13 <210> 53 <211> 13 <212> DNA <213> Artificial Sequence <220> < 223> Description of Arti ficial Sequence: synthetic <400> 53 acgagtccat ggt 13 <210> 54 <211> 13 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic <400> 54 agcctagctg gtg 13 <210> 55 <211> 14 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic <400> 55 acagagtcca tggt 14 <210> 56 <211> 14 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic <400> 56 agtcctagct ggtg 14 <210> 57 <211> 13 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic <400 > 57 aagagtccat ggt 13 <210> 58 <211> 13 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic <400> 58 atcctagctg gtg 13 <210> 59 <211> 13 < 212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic <400> 59 acgagtccat ggt 13 <210> 60 <211> 13 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synth etic <400> 60 agcctagctg gtg 13 <210> 61 <211> 13 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic <400> 61 acgagtccat ggt 13 <210> 62 <211 > 13 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic <400> 62 agcctagctg gtg 13 <210> 63 <211> 15 <212> DNA <213> Artificial Sequence <220> <223> Description of Combined DNA / RNA Molecule: synthetic <220> <223> Description of Artificial Sequence: synthetic <400> 63 accatggact ctgtu 15 <210> 64 <211> 15 <212> DNA <213> Artificial Sequence <220 > <223> Description of Combined DNA / RNA Molecule: synthetic <220> <223> Description of Artificial Sequence: synthetic <400> 64 accatggact cagau 15 <210> 65 <211> 20 <212> DNA <213> Artificial Sequence < 220> <223> Description of Artificial Sequence: synthetic <400> 65 aagggctgtt ggaaatgtgg 20 <210> 66 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic <400> 66 tgttggctct ggtctgctct ga 22 <210> 67 <211> 137 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic <400> 67 aagggctgtt ggaaatgtgg aaaggaagga caccaaatga agattgtact gagagacagg 60 ctaatttttt agggatagcctagcctagcctagcctagcctagcctaga gcagaccaga gccaaca 137 <210> 68 <211> 141 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic <400> 68 gtttggctct ggtctgctct gaagaaaatt ccctggcctt cccttgtagg aaggccagat 60 cttccctt aggtcctcctattgccattgcc acatttccaa cagccctttt t 141 <210> 69 <211> 16 <212> DNA <213> Artificial Sequence <220> <223> Description of Combined DNA / RNA Molecule: synthetic <220> <223> Description of Artificial Sequence: synthetic <400 > 69 ttggtgtcct tccttu 16 <210> 70 <211> 15 <212> DNA <213> Artificial Sequence <220> <223> Description of Combined DNA / RNA Molecule: synthetic <220> <223> Description of Artificial Sequence: synthetic < 400> 70 ccttcctttc cacau 15 <210> 71 <211> 58 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic <400> 71 ccaccagatc ttccctaaaa aattagcctg tctctcagta caatctttca tttggtgt 58 <210> 72 <211> 70 < 212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic <400> 72 atgtggaaag aaaggacacc aattgaaaga ttgtactgag agacaggcta attttttagg 60 gaagatctgg 70 <210> 73 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic <400> 73 gctcgcttct gcaccgtaag ccatcaaaga ttgtactgag 40 <210> 74 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic <400> 74 gtcaatgagc aaaggtatta a 21 <210> 75 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic <400> 75 cgcggcctcg cttaatacct ttgctc 26 <210> 76 < 211> 35 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic <400> 76 gaccagctag gg atcgtcgc ctaggtgagg ctcgc 35 <210> 77 <211> 14 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic <400> 77 accatgcaca caga 14 <210> 78 <211> 14 <212 > DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic <400> 78 ctgcggttat taac 14 <210> 79 <211> 15 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic <400> 79 atctgtgtcc atggt 15 <210> 80 <211> 14 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic <400> 80 atctgtgtca tggt 14 <210 > 81 <211> 15 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic <400> 81 atctgtgtcc atggt 15 <210> 82 <211> 15 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic <400> 82 atctgtgtca atggt 15 <210> 83 <211> 15 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: synthetic < 400> 83 atct gtgtcc atggt 15

[Brief description of the drawings]

1A-1O show a number of various compositions of the present invention. The results are shown in Examples 1 and 2. FIG. 1A shows I, also referred to as P290. FIG. 1B shows II, also referred to as P291. FIG. 1C shows III, also referred to as W31. FIG. 1D shows IV, also referred to as N6.
FIG. 1E shows V, also referred to as P292. FIG. 1F shows II, also referred to as C23. FIG. 1G shows VII, also referred to as C15. FIG. 1H shows VIII, also referred to as C95. FIG. 1I shows Y63. FIG. 1J shows another compound of the present invention. FIG. 1K shows N11. FIG. 1L shows C131 with a phosphoramidite group and a DMT protecting group. FIG. 1M
Figure 5 shows W38 also having a phosphoramidite group and a DMT protecting group. FIG. 1N shows commercially available components that, when incorporated into an extended oligonucleotide chain, result in the addition of DMT-protected oxygen at both positions and can result in “branching”.
FIG. 10 shows glen also having a phosphoramidite group and a DMT protecting group that serve as non-nucleic acid linkers. FIGS. 1A to 1G and 1J show without readily added phosphoramidite and protecting groups (ie, DMT).

FIG. 2 shows the preferred scheme for ferrocene to a nucleoside (in the case of adenosine) by ETM via an oxo linkage to ribose, forming an N6 compound of the invention.

FIG. 3 is similar to FIG. However, the nucleoside is cytidine and forms the W38 compound of the present invention.

FIG. 4 is a synthetic scheme of a preferred linkage to a nucleoside via phosphate by ETM in this case of ferrocene, forming a Y63 compound of the invention.

FIG. 5 is a scheme for the synthesis of triphosphate nucleotides in the case of this adenosine, and in the case of this ferrocene ET to ribose via an oxo linkage.
With the coupling of M.

FIG. 6 shows the use of activated carboxylic acids for the addition of nucleic acids functionalized with a primary amine to a preformed SAM.

FIG. 7 shows a “universal” utilizing restriction endonuclease sites.
1 shows a scheme of using a type gene chip.

FIGS. 8A and 8B show two phosphate linkages of a conductive oligomer that can be used for addition of a conductive oligomer at the 5 ′ position or at any position.

FIG. 9 shows an insulator for ribose of a nucleoside for binding to an electrode.
3 shows the synthesis of (C109).

FIG. 10 shows a synthesis scheme for an ethylene glycol-terminated conductive oligomer.

FIGS. 11A, 11B and 11C show the synthesis of three "branch" points (in each case using adenosine as the base) to which ETM polymers can be added. FIG.
A shows the synthesis of the N17 compound of the present invention. FIG. 11B shows the synthesis of the W90 compound, and FIG. 11C shows the synthesis of the N38 compound.

FIG. 12 is a synthetic scheme for simultaneous incorporation of multiple ETMs into nucleic acids using N17 “branched” point nucleosides.

FIG. 13 shows that when using three branch points known in the art (two branch points are also possible; see, eg, FIG. 1N), a “branch” point phosphoramidite can be used to provide multiple Figure 3 shows an alternative scheme for co-donation of ETMs to nucleic acids.

FIG. 14 shows a typical hairpin structure. 500 is a target binding sequence, 510 is a loop sequence, and 520 is a self-complementary region.
530 is substantially complementary to the detection probe, and 530 is a "sticky end", ie, the portion containing the ETM that does not hybridize to any other portion of the probe. is there.

FIGS. 15A, 15B and 15C show three preferred embodiments of a target sequence binding to an electrode. FIG. 15A shows a target sequence 120 that hybridizes to a capture probe 100 linked via a binding linker 106. It can be either a conductive oligomer or an insulator, as outlined herein. Electrode 1
05 comprises a monolayer of passivator 107, which is a conductive oligomer (shown herein as 108) and / or an insulator (shown herein as 109).
). As will be apparent to those skilled in the art as to all embodiments shown in the figures, n is an integer that is at least 1 and is usually not preferred, but the system cannot be used as a capture probe at all (ie, n is 0 Is). The upper limit for n depends on the length of the target sequence and the required sensitivity. FIG. 15B illustrates the use of a single capture extension probe 110 having a first portion 111 that hybridizes to a first portion of the target sequence 120 and a second portion that hybridizes to the capture probe 100. FIG. 15C shows the use of two capture extension probes 110 and 130. First capture extension probe 110 has a first portion 111 that hybridizes to a first portion of target sequence 120 and a second portion 112 that hybridizes to first portion 102 of capture probe 100. The second capture extension probe 130 includes a first portion 132 that hybridizes to a second portion of the target sequence 120 and a second portion 1 of the capture probe 100.
It has a second portion 131 that hybridizes to 01. As will be apparent to those skilled in the art,
Any of these coupling arrangements may be used with any other system, including the embodiment of FIG.

FIG. 16A, 16B, 16C, 16D, 16E, 16F and 1
6G illustrates some aspects of the invention. As discussed herein, both may be used in different proportions, and the insulator may be completely deleted,
In all the monolayers shown herein, conductive oligomer 108 and insulator 107
Are shown to be present in approximately a 1: 1 ratio. In addition, as will be apparent to those skilled in the art, any of these structures may repeat a particular target sequence, ie, in the case of long target sequences, there may be multiple assay complexes formed. In addition, any of the electrode coupling aspects of FIG. 15 can be used in any of these systems. FIGS. 16A, 16B and 16D have a target sequence 120 that includes ETM135, which, as discussed herein, may be added enzymatically, for example, during a PCR reaction using ETM modified nucleotides. , Are incorporated substantially randomly throughout the target sequence or are added to the end of the target sequence. FIG. 16C shows two capture probes 100 that hybridize to various portions of the target sequence 120.
And the use of 100 '. As will be apparent to those skilled in the art, the 5'-3 'orientation of the two capture probes in this embodiment is different. FIG. 16C shows the use of a labeled probe 145 that hybridizes directly to the target sequence 120. FIG. 16C illustrates the use of a labeled probe 145 that includes a first portion 141 that hybridizes to a portion of the target sequence 120, a second portion 142 that includes ETM 135. 16E, 16F, and 16G do not hybridize directly to the target, but rather, the labeled probe 145 that hybridizes directly (FIG. 16E) or indirectly (FIGS. 16F and 16G) to the amplification probe that hybridizes to the target sequence. 1 shows a system using. FIG. 16E using an amplification probe 150 has a first portion 151 that hybridizes to the target sequence 120 and at least one second portion 152 that hybridizes to the first portion 141 of the labeled probe, ie, the amplification sequence.
FIG. 16F is the same. However, the first portion 1 that hybridizes to the target sequence 120
A first labeled extension probe 160 comprising a second portion 162 that hybridizes to 61 and a first portion 151 of the amplification probe 150 is used. The second portion 152 of the amplification probe 150 hybridizes to the first portion 141 of the labeled probe 140, which also includes a supplemental linker 142 that includes an ETM 135. FIG. 16G shows the first portion 1 which adds the second labeled extension probe 170 and hybridizes to the portion of the target sequence 120.
71 and a second portion that hybridizes to the portion of the amplification probe. FIG. 16H shows a system utilizing a multi-labeled probe. Label probe 140
May hybridize to all or a portion of the supplemental linker 142.

FIGS. 17A, 17B, 17D and 17E show various possible configurations of labeled probes and binding of ETMs. In FIGS. 17A-C, the supplemental linker is a nucleic acid; in FIGS. 17D and 17E, it is not. A = nucleotide substitution; B = binding to base; C = binding to ribose; D = binding to phosphate; E = base;
Metallocene polymer linked to ribose or phosphate (or other backbone analog) (also as described in the present invention, this may be a polymer of another ETM)
F = dendrimer structure linked through a base, ribose or phosphate (or other backbone); G = linkage through a base, ribose or phosphate (another backbone analog) through a “branched” structure; H = Metallocene (or other E
TM) Attachment of polymer; I = Attachment via dendrimer structure; J = Attachment using standard linker.

FIG. 18 shows an improvement using a stem loop probe. This is desirable because it creates a torsional strain on the surface-bound probe, which shows an increase in binding efficiency and, in some cases, thermodynamic stability. In this case, the surface binding probe includes the capture probe 100, a first stem loop sequence 550, a target binding sequence 560, and a second stem loop sequence 570 that is substantially complementary to the first stem loop sequence. Addition of the target sequence 120, which may include the ETM 135, either directly or indirectly using the labeled probe 145, increases the effective concentration of the surface target.

FIGS. 19A-19AA show some sequences used in Example 1. FIG.

FIGS. 20A-20O show typical scans of the experiment shown in Example 1. FIGS.
You. Unless otherwise specified, all scans were performed with a starting voltage of -0.11V and a final voltage of 0.5V.
With points every 10mV, amplitude of 0.025, frequency of 10Hz, sample
The time is 1 second and the standing time is 2 seconds. FIG. 20A shows a peak potential of 0.160V.
, Peak current 1.092 × 10^-8A, and peak A 7.563 × 10^-TenVA
Having. FIG. 20C shows a peak potential of 0.190 V and a peak current of 2.04.
6 × 10^-7A and peak area 2.046 × 10^-8Has VA. FIG.
Peak potential 0.190V, peak current 3.552 × 10^-8A and P
A3.568 × 10^-9Has VA. FIG. 20E shows a peak potential of 0.1.
90V, peak current 2.3762 × 10^-7A and peak area 2.594 × 10 ^-8 A. FIG. 20F shows a peak potential of 0.180 V and a peak current of 2.80 V.
992 × 10^-8A and peak area 2.709 × 10^-9Has VA. FIG. 20G
Is a peak potential of 0.150 V and a peak current of 1.494 × 10^-7A and
Peak area 1.1 × 10^-8Has VA. FIG. 20H shows the peak potential of 0.
160V, peak current 1.967 × 10^-8A and peak area 1.443 × 10 ^-9 Has VA. FIG. 20I shows a peak potential of 0.150 V and a peak current of 8 V.
. 031 × 10^-8A and peak area 6.033 × 10^-9Has VA. FIG.
J indicates a peak potential of 0.150 V and a peak current of 8.871 × 10^-9A and
And peak area 5.51 × 10^-TenHas VA. FIG. 20L shows the peak potential.
0.140V, peak current 2.449 × 10^-8A and peak area 1.706
× 10^-9Has VA. FIG. 20M shows a peak potential of 0.150 V and a peak.
Current 6.637 × 10^-8A and peak area 7.335 × 10^-9Has VA.
FIG. 20N shows a peak potential of 0.140 V and a peak current of 2.877 × 10^-9 A and peak area 2.056 × 10^-TenA.

FIG. 21 shows a ligation strand reaction (LCR) experiment of Example 13.

FIGS. 22A and 22B show the results of Example 12. FIGS. "Hybrid code" refers to the system number, and + and-refer to the presence or absence of the rRNA target.

FIG. 23A, 23B, 23C, 23D, 23E and 23F
13 shows the composition and result of Example 13.

FIG. 24A and FIG. 24B show the composition of Example 13 and the results.

FIGS. 25A and 25B show the setup of two experiments of Example 8. FIGS.

FIG. 26 shows the results of a PCR experiment described in Example 9.

──────────────────────────────────────────────────続 き Continued on the front page (51) Int.Cl. ⁷ Identification symbol FI Theme coat ゛ (Reference) G01N 27/327 C12N 15/00 ZNAA 27/416 G01N 27/30 351 33/53 27/46 336G (31) Priority claim number 09 / 135,183 (32) Priority date August 17, 1998 (August 17, 1998) (33) Priority claim country United States (US) (81) Designated country EP (AT, BE, CH, CY, DE, DK, ES, FI, FR, GB, GR, IE, IT, LU, MC, NL, PT, SE), OA (BF, BJ, CF, CG, CI, CM, GA, GN, GW, ML, MR, NE, SN, TD, TG), AP (GH, GM, KE, LS, MW, SD, SZ, UG, ZW), EA (AM, AZ, BY, KG, KZ) , MD , RU, TJ, TM), AL, AM, AT, AU, AZ, BA, BB, BG, BR, BY, CA, CH, CN, CU, CZ, DE, DK, EE, ES, FI, GB , GD, GE, GH, GM, HR, HU, ID, IL, IN, IS, JP, KE, KG, KP, KR, KZ, LC, LK, LR, LS, LT, LU, LV, MD, MG, MK, MN, MW, MX, NO, NZ, PL, PT, RO, RU, SD, SE, SG, SI, SK, SL, TJ, TM, TR, TT, UA, UG, US, uz , VN, YU, ZW (72) Inventor Yu Chang-jun, United States 91107 South Berkeley Avenue, Pasadena, California 118 F-term (reference) 4B024 AA01 AA11 AA12 AA13 AA14 CA01 CA04 CA09 CA11 CA12 CA20 DA05 HA08 HA11 HA12 HA14 4B063 QA01 QA13 QA17 QA19 QQ03 QQ06 QQ10 QQ42 QQ52 QQ53 QQ54 QQ58 QR08 QR14 QR31 QR35 QR41 QR42 QR55 QR56 QR63 QR84 QS25 QS34 QS39 QX04 4B064 AF23 CA02 CA12 DA01 DA13 DA14 DA15 4H050 AB99 WB11 WB21

Claims (38)

[Claims] 1. a) an electrode, i.e., i) a monolayer comprising a conductive oligomer; and ii) a capture probe; b) a target sequence, which is capable of hybridizing to the capture probe and the capture. A composition comprising: a second moiety that does not hybridize to the probe; and at least one covalently attached electron transport moiety. 2. a) an electrode, i.e., i) a monolayer containing a conductive oligomer; and ii) a capture probe; b) a labeled probe, which is capable of hybridizing to an assay complex component; A second portion comprising a recruiting linker that does not hybridize to an assay complex component, and comprising at least one covalently attached electron transporting portion. 3. The composition of claim 2, wherein said ETM is ferrocene. 4. The composition according to claim 2, wherein said labeled probe comprises a plurality of ETMs. 5. The composition of claim 2, wherein said first portion of said labeled probe further comprises an ETM attached by a covalent bond. 6. The composition of claim 2, wherein said assay complex comprises an amplification probe. 7. The assay complex wherein the assay complex comprises a capture extension probe.
A composition according to claim 2. 8. The composition according to claim 2, wherein said monolayer further comprises an insulator. 9. The composition according to claim 2, wherein the capture probe is attached to the electrode via a conductive oligomer. 10. The composition according to claim 2, wherein the capture probe is attached to the electrode via an insulator. 11. A nucleic acid analog having a backbone comprising at least one metallocene. 12. A first nucleic acid covalently attached to a second nucleic acid via a metallocene. 13. A substituted metallocene comprising two aromatic rings, wherein the first aromatic ring has a first nucleic acid substituent and the second aromatic ring has a second nucleic acid substituent. Substituted metallocene. 14. The formula: embedded image (Wherein PG is a protecting group; Z is a linker; and M is a metal ion). 15. The composition according to claim 14, wherein said ETM is a metallocene. 16. The formula: embedded image A composition according to claim 15 having the formula: 17. A deoxyribonucleoside triphosphate comprising an ETM attached by a covalent bond. 18. The deoxyribonucleoside triphosphate according to claim 17, wherein the ETM is covalently attached to a base. 19. The formula: embedded image 18. The deoxyribonucleoside triphosphate of claim 17, wherein Z is a linker; and ETM is an electron transfer moiety. 20. The deoxyribonucleoside triphosphate according to claim 19, wherein said base is selected from the group comprising adenine, uracil, thymine, cytosine, guanine, inosine, xanthine, hypoxanthine, isocytosine and isoguanine. . 21. The deoxyribonucleoside triphosphate of claim 17, wherein said ETM is covalently attached to ribose. 22. The formula: 22. The deoxyribonucleoside triphosphate of claim 21, wherein Z is a linker; and ETM is an electron transfer moiety. 23. The deoxyribonucleoside triphosphate according to claim 17, wherein said ETM is ferrocene. 24. A nucleic acid comprising: a) at least one ETM; and b) at least one branch point. 25. A nucleic acid comprising: a) an ETM polymer; and b) at least one branch point. 26. The nucleic acid of claim 25, wherein said ETM polymer is a metallocene polymer. 27. The nucleic acid of claim 25, wherein said ETM polymer is a ferrocene polymer. 28. A method for detecting a target nucleic acid sequence in a test sample, comprising: a) attaching the target sequence to an electrode comprising a monolayer of a conductive oligomer; b) at least one label on the target sequence. Attaching the probe directly or indirectly to form an assay complex, provided that the labeled probe comprises a first portion capable of hybridizing to the assay complex component, and a recruiting linker that does not hybridize to the assay complex component. Comprising a labeled probe comprising a second moiety and comprising at least one covalently attached ETM; and c) detecting the presence of said ETM using said electrode. 29. The method of claim 28, wherein said labeled probe comprises a plurality of ETMs. 30. The plurality of ETMs comprising a metallocene polymer.
9. The method according to 8. 31. The method of claim 28, wherein said labeled probe comprises a branch point. 32. The method of claim 28, wherein said target sequence is attached to said electrode by hybridization to a capture probe. 33. The first capture extension probe hybridizes a first portion of the target sequence, and the capture probe on the electrode hybridizes a second portion of the first capture extension probe to the target. Attach the sequence,
29. The method according to claim 28. 34. The target sequence, comprising: a) hybridizing a first portion of the target sequence to a first portion of a first capture extension probe; b) a first portion of the capture probe on an electrode to the first capture extension probe. C) hybridizing a first portion of a second capture extension probe to a second portion of the target sequence; and d) a second portion of the capture probe to the second capture extension. 29. The method of claim 28, wherein the second portion of the probe is hybridized. 35. The method of claim 28, wherein said labeled probe is attached to said target sequence by hybridizing said first portion of said labeled probe to said first portion of said target sequence. 36. The labeled probe, comprising: a) hybridizing a first portion of an amplification probe to a first portion of the target sequence; and b) at least one of the amplification probe to the first portion of at least one labeled probe. 29. The method of claim 28, wherein the amplified sequence is attached to the target sequence by hybridizing. 37. The labeled probe, comprising: a) hybridizing a first portion of the first labeled amplification probe to a first portion of the target sequence; b) a second portion of the first labeled amplification probe to a first portion of the amplification probe. 29. The method of claim 28, wherein the first portion of the at least one labeled probe is hybridized with at least one amplification sequence of the amplification probe. 38. The labeled probe, comprising: a) hybridizing a first portion of the first labeled amplification probe to a first portion of the target sequence; b) a second portion of the first labeled amplification probe to a first portion of the amplification probe. C) hybridizing the first part of the second labeled amplification probe to the second part of the target sequence; d) hybridizing the second part of the second labeled amplification probe to the first part of the amplification probe. 29. The method of claim 28, wherein the method comprises attaching to the target sequence by: e) hybridizing the first portion of the at least one labeled probe with at least one amplification sequence of the amplification probe.