EP1071785A2 - Interconversion de desaturases et d'hydroxylases d'acides gras vegetaux - Google Patents

Interconversion de desaturases et d'hydroxylases d'acides gras vegetaux

Info

Publication number
EP1071785A2
EP1071785A2 EP99921394A EP99921394A EP1071785A2 EP 1071785 A2 EP1071785 A2 EP 1071785A2 EP 99921394 A EP99921394 A EP 99921394A EP 99921394 A EP99921394 A EP 99921394A EP 1071785 A2 EP1071785 A2 EP 1071785A2
Authority
EP
European Patent Office
Prior art keywords
desaturase
amino acid
modified
hydroxylase
fatty acyl
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP99921394A
Other languages
German (de)
English (en)
Inventor
Pierre Broun
John Shanklin
Edward J. Whittle
Chris Somerville
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Individual
Original Assignee
Individual
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Individual filed Critical Individual
Publication of EP1071785A2 publication Critical patent/EP1071785A2/fr
Withdrawn legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/0071—Oxidoreductases (1.) acting on paired donors with incorporation of molecular oxygen (1.14)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
    • C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
    • C12N15/8247—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine involving modified lipid metabolism, e.g. seed oil composition
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/0071—Oxidoreductases (1.) acting on paired donors with incorporation of molecular oxygen (1.14)
    • C12N9/0083—Miscellaneous (1.14.99)

Definitions

  • the present invention concerns the modification of nucleic acid sequences and constructs, and methods related thereto, and the use of these sequences and constructs to produce modified enzymes which exhibit altered catalytic activities.
  • the modified nucleic acids are of utility in producing genetically modified plants for the purpose of altering the fatty acid composition of plant oils, waxes, and other fatty acid-containing compounds.
  • the present invention concerns the modification of nucleic acids for the selective production of plant fatty acid desaturases and hydroxylases.
  • ricinoleic acid In addition to common plant fatty acids such as linoleic or linolenic acids, a number of plant species accumulate hydroxylated fatty acids. For example, castor (.Ricinus communis) accumulates a seed oil which may contain more than 80% ricinoleic acid ( ⁇ -12-hydroxyoctadec- cis-9-enoic acid). This industrial fatty acid, used in the fabrication of lubricants and certain types of nylon, is also present in a number of other unrelated plant species. Biosynthesis of ricinoleic acid in castor has been studied in detail (van de Loo et al., 1995).
  • oleic acid is esterified to phosphatidylcholine.
  • the reaction requires molecular oxygen, NAD(P)H and cytochrome b5 as an electron donor.
  • oleate hydroxylation has extensive similarity to microsomal oleate desaturation, a key step in the biosynthesis of linoleic acid.
  • Genes encoding the castor and Lesquerella fendleri oleate hydroxylases have been identified and the gene products have been shown to have a high degree of sequence similarity to plant oleate desaturases (van de Loo et al., 1995; Broun et al., 1997).
  • the castor oleate hydroxylase is about 70% identical to some oleate desaturases, and contains clusters of histidine residues diagnostic of class III diiron-oxo proteins, which include: plant desaturases FAD2, FAD3, FAD5, FAD6, FAD7, FAD8, bacterial alkane and xylene hydroxylases, carotene hydroxylase, carotene ketolase, and sterol methyl oxidases among others (Shanklin et al., 1997).
  • the oleate hydroxylase from the crucifer Lesquerella fendleri shows about 81% sequence identity to the oleate desaturase from the crucifer Arabidopsis thaliana and about 71% sequence identity to the oleate hydroxylase from the more distantly related species, Ricinus communis (Broun et al., 1998).
  • Ricinoleic acid is synthesized by hydroxylation of oleic acid by enzymes that have similar enzymatic properties and exhibit a high degree of sequence similarity to oleate desaturases (Moreau et al., 1981 and van de Loo et al., 1995).
  • the oleate desaturases and hydroxylases are integral membrane proteins, which are members of a large family of functionally diverse enzymes that includes alkane hydroxylase/alkene epoxidase, xylene monooxygenase, carotene ketolase, and sterol methyl oxidase (Shanklin et al., 1998).
  • the castor and L fendleri oleate hydroxylase sequences are compared herein with the sequences of various oleate desaturases.
  • the concept underlying this comparison was that if a particular residue was conserved in all known oleate desaturases but differed from the castor and L fendleri oleate hydroxylases, it could be important in determining the outcome of the reaction. By contrast, if a particular residue was not conserved among the desaturases, it was unlikely to be responsible for the outcome of the reaction.
  • modified enzymes include mutagenesis of existing genes and synthesis of novel genes.
  • the most specific way of obtaining modified enzymes is by site-directed mutagenesis, enabling specific substitution of one or more amino acids by any other desired amino acid.
  • Site-directed mutagenesis can be performed, after cloning the encoding gene, by mutagenesis in vitro or in vivo and expression of the encoded enzyme by causing transcription and translation of the mutated gene in a suitable host cell.
  • the present invention provides novel modified hydroxylase and desaturase enzymes, obtained by expression of genes encoding said enzymes having amino acid sequences which differ in at least one amino acid from the corresponding wild-type enzymes. These mutant enzymes exhibit novel catalytic properties for modifying plant oil composition.
  • a preferred embodiment of the invention is a mutant of the Arabidopsis thaliana FAD2 desaturase.
  • the invention provides a transgenic plant, comprising a plant that has been modified by the introduction of a gene for a modified hydroxylase.
  • this invention provides a system, which identifies and produces mutant fatty acyl desaturase, hydroxylase, desaturase/hydroxylase enzymes with novel properties that can be used to modify plant oil composition.
  • Figure 1 shows a multiple sequence alignment of deduced amino acid sequences for oleate hydroxylases and microsomal ⁇ 12 desaturases.
  • Abbreviations are: Rcfahl2, oleate 12- hydroxylase gene from R. communis (van de Loo et al., 1995); LFAH12, oleate 12-hydroxylase gene from L.
  • FAD2 desaturase from Arabidopsis thaliana (Okuley et al., 1994); Gmfad2-1, FAD2 desaturase from Glycine max (GenBank accession number L43920); Gmfad2-2, FAD2 desaturase from Glycine max (Genbank accession number L43921); Zmfad2, FAD2 desaturase from Zea mays (PCT/US93/09987).
  • Figure 2 shows a general strategy for site-directed mutagenesis of A. thaliana FAD2 oleate desaturase.
  • Figure 3 shows the nucleic acid sequence of the coding region of the A. thaliana FAD2 oleate desaturase gene and the corresponding amino acid sequence of the enzyme.
  • Figure 4 shows a general strategy for introducing seven mutations into the A. thaliana FAD2 gene.
  • Figure 5 shows a comparison of the nucleic acid sequences of the coding regions of the A. thaliana FAD2 gene and the mFAD2 gene.
  • Figure 6 shows a comparison of the deduced amino acid sequences of the A. thaliana FAD2 gene and mFAD2 gene.
  • Figure 7 shows a comparison of the nucleic acid sequences of the coding regions of the L fendleri FAH12 gene and the mFAH12 gene.
  • Figure 8 shows a comparison of the deduced amino acid sequences of the L. fendleri FAH12 gene and the mFAH12 gene.
  • Figure 9 shows the fatty acid composition of yeast cells expressing desaturase and hydroxylase genes.
  • Figure 10 shows the genetic complementation of the Arabidopsis fad.2 mutation with the m 7 LFAH12 gene.
  • Figure 11 shows the fatty acid content of seed lipids from independent transgenic
  • Figure 12 shows the contribution of individual amino-acid substitutions to the activity of the modified Lesquerella hydroxylase.
  • fatty acyl hydroxylases that introduce a hydroxyl group into fatty acids.
  • the fatty acyl hydroxylases of the invention can catalyze hydroxylation of oleic acid to 12-hydroxy oleic acid (i.e., ricinoleic acid) and icosenoic acid to 14-hydroxy icosenoic acid (i.e., lesquerolic acid).
  • This enzyme is referred to herein as "oleate hydroxylase”.
  • enzymes have also been referred to as a class of kappa hydroxylases to indicate that the enzyme introduces the hydroxyl group three carbons distal (i.e., away from the carboxyl carbon of the acyl chain) from a double bond located near the center of the acyl chain.
  • a second subject of this invention is a class of enzymes, designated fatty acyl desaturases, that introduce double bonds into fatty acids.
  • fatty acyl desaturases of the invention can introduce a double bond between carbons 12 and 13 (counting from the carboxyl end) of eighteen carbon fatty acids.
  • This enzyme is referred to herein as "oleate desaturase”.
  • the above enzymes are named oleate hydroxylase and oleate desaturase in accordance with their discovery in oleate-containing plants.
  • the native enzymes are able to metabolize fatty acids with chain lengths other than eighteen carbons.
  • the present invention is not limited to metabolizing oleic acid but can also produce saturated and/or hydroxylated fatty acids of varying chain lengths.
  • Preferred are substrates with chain lengths of 16, 18, 20 and 22 carbons.
  • the following fatty acids are also the subject of this invention: palmitoleic acid, hexadec-cis-9-enoic (16:1 C1S ⁇ 9 ); hydroxypalmitoleic acid, 12-hydroxy-hexadec-cis-9-enoic (120H-16:l cis ⁇ 9 ); oleic acid, octadec-cis-9-enoic acid (18:l cis ⁇ 9 ); ricinoleic acid, 12- hydroxyoctadec-cw-9-enoic acid (120H-18:l cis ⁇ 9 ); octadec- -9,15-dienoic acid (18:2 cis ⁇ 9 - 15 ); densipolic acid, 12-hydroxyoctadec- -9,15-dienoic acid (120H-18:2 cu ⁇ 9 ' 15 ); icosenoic acid (20:l cis ⁇ n ); lesquerolic acid, 14-hydroxy-cis-eno
  • a further subject of this invention is the creation of modified genes encoding modified enzymes which have novel catalytic activities.
  • modified enzyme as used herein always refers to the product of a modified gene rather than to any direct modification of the corresponding wild-type (WT) protein.
  • WT wild-type
  • modified enzymes which before modification had oleate hydroxylase activity but had low levels of oleate desaturase activity relative to the amount of hydroxylase activity, but which after modification exhibit higher levels of oleate desaturase activity.
  • synthetic oleate desaturases This designation does not preclude the possibility that the modified enzyme may also retain some amount of hydroxylase activity.
  • This invention is based on the discovery that plant oleate hydroxylases and oleate desaturases are structurally related enzymes (van de Loo et al., 1995). Indeed, because these enzymes are highly similar in primary structure, we have previously described methods for distinguishing between the two types of enzymes based on a comparison of the amino acid sequences (U.S. Appln. Nos. 08/530,862 and 08/597,313; international Appln. Nos. PCTAJS95/11855 (WO 96/10075) and PCT/US97/02187 (WO 97/30582), referred to herein above.
  • An object of this invention is a method to convert an oleate hydroxylase to an oleate desaturase.
  • an oleate hydroxylase can be converted into an oleate desaturase by changing all seven conserved residues in oleate hydroxylases to the residues that would be found in oleate desaturases.
  • the observation that many combinations of six changes can convert a hydroxylase to a synthetic desaturase shows that no single amino acid change is absolutely required. Thus, there is no amino acid residue that is required for hydroxylase activity but not for desaturase activity. This implies that the functionally significant difference between a hydroxylase and a desaturase is the conformation of the active site as comprised of the conserved amino acid residues.
  • changes in the conformation of the active site can change the outcome of the overall reaction.
  • any fatty acyl hydroxylase can be converted into a synthetic desaturase by making changes in the conformation of the active site.
  • One aspect of this invention is a procedure for identifying the changes that are made to convert any hydroxylase to a desaturase.
  • An object of this invention is a method to convert an oleate desaturase into a synthetic oleate hydroxylase by changing all seven conserved residues in oleate desaturases to the residues that would be found in oleate hydroxylases. Based on the analysis of effects of mutations on the amount of desaturase activity exhibited by the LFAH12 hydroxylase, it appears clear that the functionally significant difference between a desaturase and a hydroxylase is the conformation of the active site.
  • any desaturase can be converted into a hydroxylase by making changes in the conformation of the active site.
  • One aspect of this invention is a procedure for identifying the relevant changes that need to be made to convert any desaturase to a synthetic hydroxylase. Changing of a subset of the seven amino acids, as few as four amino acids, results in the conversion of a desaturase to a synthetic hydroxylase. Similarly, changing of the seven, or fewer, amino acids can confer hydroxylase activity on a desaturase. Thus, these seven amino acid positions define the active site of these fatty acyl enzymes.
  • crystallographic and/or spectroscopic techniques may also be used to correlate changes in the active site with enzymatic function.
  • Assays based on determining the chemical and physical properties of the enzymes may be performed with substrate and/or cofactor analogs to slow or to stabilize the enzymatic reaction. This active site and its function is distinct from the histidine residues previously identified.
  • modifying a fatty acyl metabolic enzyme e.g., by genetic engineering
  • a modification of the fatty acyl metabolic enzyme may be determined to increase, decrease or not affect any enzymatic activity (e.g., desaturase, hydroxylase) by assaying the fatty acyl content of a cell or plant containing the modified enzyme.
  • a statistically significant increase or decrease in particular desaturated or hydroxylated fatty acids will identify modifications that increase or decrease, respectively, enzymatic activity.
  • amino acid sequences are considered to be related with as little as 70% or 80% similarity between the two polypeptides; however, at least 90% or 95% similarity is preferred; and at least 98% similarity is more preferred. Conservative amino acid substitutions may be considered when making sequence comparisons.
  • the method according to the present invention is suitable for the production, screening and selection of modified hydroxylase and desaturase enzymes which are derived from naturally existing enzymes.
  • modified hydroxylase and desaturase enzymes which are derived from naturally existing enzymes.
  • Such mutants are, for example, those encoded by a gene derived from a wild-type FAD2 gene of A. thaliana which can be converted to a synthetic oleate hydroxylase.
  • the method can further be advantageously used for the selection of synthetic hydroxylases derived from desaturases other than FAD2-like desaturases.
  • any fatty acyl desaturase that shows amino acid sequence similarity to the A. thaliana FAD2 gene can be modified according to the teachings of this invention.
  • the corresponding numbers based on the FAD2 sequence are 63, 104, 148, 217, 295, 322, 324. More generally, we envision that by comparison of the sequences of delta-9 stearoyl-ACP desaturases and stearoyl-9-hydroxylases it will be possible to identify the amino acid residues that are conserved in all delta-9 stearoyl-ACP desaturases but which differ between delta-9 desaturases and 9-hydroxylases. Once such differences have been identified, the knowledge and methods taught herein can be used to create synthetic stearoyl-9-hydroxylases. We also envision that it will be possible to create synthetic hydroxylases for which naturally occurring enzymes are not available.
  • fatty acid 12-epoxidases will also be found in species such as Euphorbia lagascae and Stokesia laevis that will be closely related to delta- 12-desaturase. We envision that these enzymes will be active on linoleate rather than oleate, and will introduce a 12,13 epoxy group. Other lipid enzymes that modify the 12-position such as a ketolase may be related in a similar way as the desaturase and hydroxylase. The methods taught here will also teach how to interconvert any combination of these functionalities.
  • oligonucleotide-aided site-directed mutagenesis or region- directed random mutagenesis can be used or any other suitable method for efficiently generating mutations in the hydroxylase or desaturase genes, including complete or partial synthesis of the gene.
  • the method for selecting modified enzymes according to the present invention may comprises the following steps: m ⁇ tagenizing a cloned gene encoding an enzyme of interest or a fragment thereof; isolating the obtained mutant gene or genes; introducing said mutant gene or genes, preferably on a suitable vector, into a suitable host strain for expression and production; recovering the produced modified enzyme; and identifying those genes encoding modified enzymes having improved properties for application in modifying plant lipid composition.
  • m ⁇ tagenizing a cloned gene encoding an enzyme of interest or a fragment thereof isolating the obtained mutant gene or genes; introducing said mutant gene or genes, preferably on a suitable vector, into a suitable host strain for expression and production; recovering the produced modified enzyme; and identifying those genes encoding modified enzymes having improved properties for application in modifying plant lipid composition.
  • modified enzymes could also be produced by partial or complete synthesis of modified genes using currently available methods for oligonucleotide synthesis and composition of genes from oligonucleotides and/or fragments from preexisting genes.
  • Suitable host strains for production of enzymes include transformable microorganisms in which expression of the enzymes can be achieved.
  • strains of Saccharomyces cerevisiae are among the preferred hosts.
  • Expression of fatty acyl enzymes is obtained by using expression signals that function in the selected host organism. Expression signals include sequences of DNA regulating transcription and translation of the fatty acyl metabolizing genes. Proper vectors are able to replicate at sufficiently high copy numbers in the host strain of choice or enable stable maintenance of the introduced gene in the host strain by chromosomal integration.
  • Assays known in the art may be used to determine and quantify the activity of the modified enzymes in the microbial host. Results provided in the examples show that such results are useful predictors of the activity of the modified enzymes in transgenic plants.
  • the properties of the naturally occurring or mutated enzymes may be enhanced by introducing a variety of mutations in the enzyme. For the most part, the mutations will be substitutions, either conservative or non-conservative, but deletions and insertions may also find use.
  • Another aspect of the invention is the development of novel assays and other processes using the modified enzymes.
  • any amino acid may be substituted with any other amino acid in the same chemical category, particularly on the same line.
  • the polar amino acids N, Q may substitute or be substituted for by the charged amino acids.
  • Positions for substitution of particular interest include 63, 105, 149, 218, 296, 323, 325 (numbering based on the LFAH12 sequence).
  • the corresponding positions based on the FAD2 sequence are 63, 104, 148, 217, 295, 322, 324. At some positions there will be an intent to change an amino acid, while maintaining the general conformation and volume of the amino acid at that site.
  • nucleic acids e.g., recombinant clones, expression constructs
  • Such polynucleotides may be genomic DNA, cDNA, cRNA, mRNA or heterogeneous RNA (hnRNA).
  • the nucleic acid may contain introns; promoters, enhancers, silencers, transcription initiation/termination sites or other transcriptional regulatory regions; translation initiation/termination sites or other translational regulatory regions; translocation or cellular localization signals; transmembrane regions; regions that regulate message stability; polyadenylation sites; or combinations thereof.
  • a recombinant clone made by genetic engineering may be used to transfect plants, other organisms (e.g., bacteria, fungi, yeast), or cells thereof.
  • nucleotide sequences which encode a plant fatty acyl enzyme may be used in various constructs, for example, as probes to obtain further nucleic acids from the same or other species.
  • these sequences may be used in conjunction with appropriate regulatory sequences to increase levels of the respective fatty acyl enzyme of interest in a host cell for the production of fatty acids with varying amounts of saturation/hydroxylation or study of the enzyme in vitro or in vivo, or to decrease or increase levels of the respective fatty acyl enzyme of interest for some applications when the host cell is a plant entity, including plant cells, plant parts (including, but not limited to, seeds, cuttings, and tissues), and plants.
  • a nucleotide sequence encoding a plant fatty acyl enzyme of the present invention may include genomic, cDNA or mRNA derived sequences.
  • encoding is meant that the sequence corresponds to a particular amino acid sequence either in a sense or anti-sense orientation.
  • recombinant is meant that the sequence contains a genetically engineered modification through manipulation via mutagenesis, nucleic acid modifying enzymes, or the like.
  • a cDNA sequence may or may not encode pre-processing sequences, such as transit or signal peptide sequences. Transit or signal peptide sequences facilitate the delivery of the protein to a given organelle and are frequently cleaved from the polypeptide upon entry into the organelle, releasing the "mature" sequence.
  • the complete genomic sequence of a wild-type plant fatty acyl enzyme may be obtained by the screening of a genomic library with a probe, such as a cDNA probe, and isolating those sequences which regulate expression in seed tissue.
  • a probe such as a cDNA probe
  • the transcription and translation initiation regions, enhancers, silencers, introns, and/or transcript and translation termination regions of the plant fatty acyl enzyme may be obtained for w ⁇ VTO /5 0 ⁇ 7 a3 PCT/US99/08400
  • nucleotide sequences corresponding to the plant fatty acyl enzyme of the present invention may also provide signal sequences useful to direct transport into an organelle, 5' upstream non- coding regulatory regions (promoters) having useful tissue and timing profiles, 3' downstream non-coding regulatory region useful as transcriptional and/or translational regulatory regions, or may lend insight into other features of the gene.
  • the desired plant fatty acyl enzyme nucleotide sequence may be manipulated in a variety of ways. Where the sequence involves non-coding flanking regions, the flanking regions may be subjected to resection, mutagenesis, etc. Thus, transitions, transversions, deletions, and insertions may be performed on the naturally occurring sequence. In addition, all or part of the sequence may be synthesized.
  • one or more codons may be modified to provide for a modified amino acid sequence, or one or more codon mutations may be introduced to provide for a convenient restriction site, or other purposes involved with construction or expression.
  • the structural gene may be further modified by employing synthetic adapters, linkers to introduce one or more convenient restriction sites, or the like.
  • nucleotide or amino acid sequences encoding a plant fatty acyl enzyme of the present invention may be combined with other non-native, or "heterologous", sequences in a variety of ways.
  • heterologous sequences is meant any sequence which is not naturally found joined to the plant fatty acyl enzyme, including, for example, combination of nucleotide sequences from the same plant which are not naturally found joined together.
  • a “heterologous" nucleic acid describes nucleic acid which is introduced into a host cell or organism which does not naturally contain the nucleic acid.
  • compositions of the present invention may be made substantially pure by overexpressing the nucleic acid or peptide and isolating same.
  • substantially pure a composition of a molecule is described as being at least 80%, preferably at least 90%, more preferably at least 95%, and most preferably at least 99% pure by weight as compared to other substances (i.e., contaminants) of the same chemical character as the recited molecule (e.g., lipid, nucleic acid, protein).
  • the DNA sequence encoding a plant fatty acyl enzyme of the present invention may be employed in conjunction with all or part of the gene sequences normally associated with the fatty acyl enzyme.
  • a DNA sequence encoding fatty acyl enzyme is combined in a DNA construct having, in the 5' to 3' direction of transcription, a transcription initiation control region capable of promoting transcription and translation in a host cell, the DNA sequence w ⁇ y v 5w30u7 7 3 J PCT/US99/08400
  • Potential host cells include both prokaryotic and eukaryotic cells.
  • a host cell may be unicellular or found in a multicellular differentiated or undifferentiated organism depending upon the intended use.
  • Cells of the present invention may be distinguished by having a plant fatty acyl enzyme foreign to the wild-type cell present therein, for example, by having a recombinant nucleic acid construct encoding a plant fatty acyl enzyme therein.
  • the regulatory regions will vary, including regions from viral, plasmid or chromosomal genes, or the like.
  • regions from viral, plasmid or chromosomal genes or the like.
  • a wide variety of constitutive or regulatable promoters as well as terminators may be employed. Expression in a microorganism can provide a ready source of the plant enzyme.
  • transcriptional initiation regions which have been described are regions from bacterial and fungal (e.g., mold, yeast) hosts, such as E. coli, B.
  • subtilis Saccharomyces cerevisiae, including promoters such as lacUV5 or a derivative such as trc; bacteriophage T3, T7 or SP6 promoters; trpE; ADC1, Gall, GallO, PHOS, or the like.
  • the constructs will involve regulatory regions functional in plants which provide for modified production of plant fatty acyl enzyme with resulting modification of the fatty acid composition.
  • the open reading frame, coding for the plant fatty acyl enzyme or functional fragment thereof will be joined at its 5' end to a transcription initiation regulatory region such as the wild-type sequence naturally found 5' upstream to the fatty acyl enzyme structural gene.
  • transcription initiation regions are available which provide for a wide variety of constitutive or regulatable (e.g., inducible) transcription of the structural gene.
  • transcriptional initiation regions used for plants are such regions associated with the structural genes such as for nopaline and mannopine synthases, or with napin, soybean ⁇ -conglycinin, oleosin, 12S storage protein, the cauliflower mosaic virus 35S promoters, or the like.
  • the transcription/ translation initiation regions corresponding to such structural genes are found immediately 5' upstream to the respective start codons.
  • the use of all or part of the complete plant fatty acyl enzyme gene is desired, namely all or part of the 5' upstream non-coding regions (promoter) together with the structural gene sequence and 3' downstream non-coding regions may be employed.
  • a different promoter such as a promoter native to the plant host of interest or a modified promoter, i.e., having transcription initiation regions derived from one gene source and translation initiation regions derived from a different gene source, including the sequence encoding the plant fatty acyl enzyme of interest, or enhanced promoters, such as double 35S CaMV promoters, the sequences may be joined together using standard techniques.
  • transcription initiation control regions from the B. napus napin gene, or the Arabidopsis 12S storage protein, or soybean ⁇ -conglycinin (Bray et al., 1987), or the plant fatty acyl hydroxylase promoter are desired.
  • Transcription initiation regions which are preferentially expressed in seed tissue, i.e., which are undetectable in other plant parts, are considered desirable for fatty acid modifications in order to minimize any disruptive or adverse effects of the gene product.
  • Transcription termination regions may be provided by the DNA sequence encoding the plant fatty acyl enzyme or a convenient transcription termination region derived from a different gene source, for example, the transcription termination region which is naturally associated with the transcription initiation region. Where the transcription termination region is from a different gene source, it will contain at least about 0.5 kb, preferably about 1-3 kb of sequence 3' to the structural gene from which the termination region is derived.
  • Plant expression or transcription constructs having a plant fatty acyl enzyme as the DNA sequence of interest for increased or decreased expression thereof may be employed with a wide variety of plant life, particularly, plant life involved in the production of vegetable oils. Most especially preferred are temperate oilseed crops. Plants of interest include, but are not limited to rapeseed (canola and high erucic acid varieties), Crambe, Brassica juncea, Brassica nigra, meadowfoam, flax, sunflower, safflower, cotton, Cuphea, soybean, peanut, coconut and oil palms and corn.
  • An important criterion in the selection of suitable plants for the introduction on the fatty acyl enzyme is the presence in the host plant of a suitable substrate for the fatty acyl enzyme. Thus, for example, production of vernolic acid will be best accomplished in plants that normally have high levels of linoleic acid in seed lipids.
  • the present invention is applicable to dicotyledons and monocotyledons species alike and will be readily applicable to new and/or improved transformation and regulation techniques.
  • the method of transformation is not critical to the present invention: various methods of plant transformation are currently available. As newer methods are available to transform crops, they may be directly applied hereunder. For example, many plant species naturally susceptible to Agrobacterium infection may be successfully transformed via tripartite or binary vector methods of Agrobacterium mediated transformation. In addition, techniques of microinjection, particle bombardment, and electroporation have been developed which allow for the transformation of various monocot and dicot plant species.
  • the various components of the construct or fragments thereof will normally be inserted into a convenient cloning vector which is capable of replication in a bacterial host, e.g., E. coli.
  • a convenient cloning vector which is capable of replication in a bacterial host, e.g., E. coli.
  • Numerous vectors exist that have been described in the literature e.g., plasmid, bacteriophage, cosmid, yeast artificial chromosome or YAC, bacterial artificial chromosome or BAC).
  • the plasmid may be isolated and subjected to further manipulation, such as restriction, insertion of new fragments, ligation, deletion, insertion, resection, etc., so as to tailor the components of the desired sequence.
  • the construct Once the construct has been completed, it may then be transferred to an appropriate vector for further manipulation in accordance with the manner of transformation of the host cell.
  • included with the DNA construct will be a structural gene having the necessary regulatory regions for expression in a host and providing for selection of transformant cells.
  • the gene may provide for resistance to a cytotoxic agent, e.g., antibiotic, heavy metal, toxin, etc., complementation providing prototropy to an auxotrophic host, viral immunity, or the like.
  • one or more markers may be employed, where different conditions for selection are used for the different hosts.
  • the manner in which the DNA construct is introduced into the plant host is not critical to the present invention. Any method which provides for efficient transformation may be employed.
  • Various methods for plant cell transformation include the use of Ti- or Ri-plasmids, microinjection, electroporation, infiltration, imbibition, DNA particle bombardment, liposome fusion, DNA bombardment, or the like.
  • a vector may be used which may be introduced into the Agrobacterium host for homologous recombination with T-DNA or the Ti- or Ri-p asmid present in the Agrobacterium host.
  • the Ti- or Ri-plasmid containing the T- DNA for recombination may be armed (capable of causing gall formation) or disarmed (incapable of causing gall), the latter being permissible, so long as the vir genes are present in the transformed Agrobacterium host.
  • the armed plasmid can give a mixture of normal plant cells and gall.
  • the expression construct bordered by the T-DNA border(s) will be inserted into a broad host spectrum vector, there being broad host spectrum vectors described in the literature. Commonly used is pRK2 or derivatives thereof. See, for example, Ditta et al. (1980). Included with the expression construct and the T-DNA will be one or more markers, which allow for selection of transformed Agrobacterium and transformed plant cells. A number of markers have been developed for use with plant cells, such as resistance to kanamycin, the aminoglycoside G418, hygromycin, or the like. The particular marker employed is not essential to the present invention, one or another marker being preferred depending on the particular host and the manner of construction.
  • explants For transformation of plant cells using Agrobacterium, explants may be combined and incubated with the transformed Agrobacterium for sufficient time for transformation, the bacteria killed, and the plant cells cultured in an appropriate selective medium. Once callus forms, shoot formation can be encouraged by employing the appropriate plant hormones in accordance with known methods and the shoots transferred to rooting medium for regeneration of plants. The plants may then be grown to seed and the seed used to establish repetitive generations and for isolation of vegetable oils.
  • Polypeptides with fatty acyl enzymatic activity may be isolated using the identified nucleic acid sequence.
  • the polypeptide may be isolated from natural sources (i.e., plants) or from host cells expressing recombinant fatty acyl enzyme sequences.
  • Polypeptides may be purified using centrifugation, precipitation, specific binding, electrophoresis, and/or chromatography. Separation may be faciliated using enzyme substrates, antibody and/or attachment of a fusion peptide (e.g., avidin, glutathione S-transferase, poly-His, maltose binding protein, myc 9E10-epitope, protein A/G, SV40 T antigen).
  • a fusion peptide e.g., avidin, glutathione S-transferase, poly-His, maltose binding protein, myc 9E10-epitope, protein A/G, SV40 T antigen.
  • Detection of protein expression and localization is facilitated by fusions with reporters such as, for example, alkaline phosphatase (AP), ⁇ -galactosidase (LacZ), chloramphenicol acetyltransferase (CAT), ⁇ -glucoronidase (GUS), green fluorescent protein (GFP), ⁇ -lactamase, luciferase (LUC), or derivatives thereof.
  • reporters would use cognate substrates that are preferably assayed by a chromogen, fluorescent, or luminescent signal. Transcriptional and/or translational fusions of the fatty acyl gene or enzyme and a heterologous nucleic acid or peptide, respectively, may be made.
  • a non-translated region of the heterologous gene may be ligated to the fatty acyl metabolic gene or, alternatively, a non-translated region of the fatty acyl gene may be ligated to the heterologous gene.
  • the reading frames of the peptide which is a fatty acyl enzyme and a heterologous peptide may be joined in a translational fusion. If a reporter or selectable marker is used as the heterologous nucleic acid/peptide, then the effect of mutating the nucleotide/amino acid sequences of the fatty acyl enzyme or heterologous nucleic acid/peptide on fatty acid metabolism may be readily assayed.
  • a transcriptional fusion may be used to localize a regulated promoter of the fatty acyl metabolic gene and a translational fusion may be used to localize the fatty acyl metabolic protein in the cell.
  • a peptide recognition site for a protease e.g., enterokinase, Factor Xa, thrombin
  • a protease e.g., enterokinase, Factor Xa, thrombin
  • oligonucleotides used for producing modified forms of the FAD2 gene and the Lfahl2 gene are shown in Table 1.
  • H2f b A105G CTGGGTCATTGgCCATGAATGTGGTCACC
  • H2r b A105G GGTGACCACATTCATGGcCAATGACCCAG
  • H3r b T149N TTCTAGGGATCCAtTGTTGGAATGGTG
  • H4r b Y218F CACGGTCCTTAaAGATAGGTGCATG
  • H6f b S323A CATCTCITTgCAACTATACCGCATT H6r b S323A AATGCGGTATAGTTGcAAAGAGATG
  • Oligonucleotide H5' adds a Stul site immediately before LFAH12 initiating codon.
  • Oligonucleotide H3' introduces a Sacl site following the terminator codon of LFAH12.
  • Oligonucleotide D5' adds Kpnl and Smal sites immediately before FAD2 initiating codon.
  • Oligonucleotide D3' introduces restriction sites Sacl, EcoRV, and Ec ⁇ RI sites following the terminator codon of FAD2.
  • the various uses were (a) introduction of all seven mutations into LFAH12, (b) to revert each of the seven mutations of m7FAH12 to their equivalents in the wt LFAH12 sequence in order to create all combinations of six of the seven changes of m7FAH12, (c) introduction of all seven mutations into FAD2, and (d) introduction of convenient restriction sites in the coding region of genes to facilitate subsequent cloning.
  • Plasmid Constructions The basic construct which was used to create modified hydroxylases from the A. thaliana
  • FAD2 desaturase was named pYES-F2.
  • This plasmid was constructed as follows. A. thaliana cDNA clone 146M12T7 encoding FAD2 was obtained from the Arabidopsis Stock Center at the Ohio State University. This cDNA sequence was amplified using Pfu DNA polymerase (Stratagene) in conjunction with primers designated D5' and D3' to introduce the flanking restriction sites, Kpnl and Smal immediately preceding the initiation codon ATG, and Sacl and EcoRI restriction sites following the terminator codon TGA ( Figure 2).
  • the insert was then excised by restriction with Kpnl and ZscoRI and cloned into the corresponding sites in the bacterial-yeast shuttle vector pYESII (Invitrogen).
  • the pYESII-F2 plasmid was transformed into yeast strain INVSC2 (Invitrogen) by electroporation using a BTX electroporator (BTX).
  • Plasmid pBNL was used to produce transgenic plants containing the wild type FAD2 gene or modified versions of the gene. This plasmid was constructed as follows.
  • the FAD2 insert in pYES-F2 was excised using the restriction enzymes Smal and Sacl.
  • This fragment was cloned into a bacteria-plant shuttle vector pDN, behind the seed specific napin promotor using corresponding restriction sites to produce plasmid pBNL.
  • This construct was introduced into Agrobacterium tumafaciens strain GV3101 pMP90 using electroporation (BTX).
  • BTX electroporation
  • the agrobacterium was used to transform the FAD2 mutant of A. thaliana by vacuum infiltration (Bechtold et al., 1993), and transformants selected for by challenging seeds to germinate on kanamycin containing agarose.
  • Oligonucleotide PCR primers were designed to introduce nucleotide substitutions into LFAH12 and FAD2 through overlap-extension PCR (Ho et al., 1989). These included complementary oligonucleotides 22-32 bp long, encompassing the substitution sites ("mutagenic" primers), and terminal primers.
  • mutagenic substitution sites
  • terminal primers terminal primers.
  • overlapping mutagenized fragments were amplified in separate PCR reactions using pairs of mutagenic primers ' , or a mutagenic primer and a terminal primer for terminal fragments.
  • purified overlapping products from the previous steps were assembled and amplified using terminal primers only.
  • Modified LFAH12 genes containing one or seven substitutions were constructed using native-wildtype (WT) coding sequences as templates in the first PCR step.
  • Modified LFAH12 genes containing only six mutations were constructed using a gene substituted at all seven codons (mLFAH12) as a template.
  • the 5'-end of terminal primers was modified to allow the introduction of convenient restriction sites for the cloning of PCR products.
  • Two sets of PCR "mutagenic" primers were constructed to modify the LFAH12 gene. In the first set (mHl-5,mH67), the oligonucleotides contained one or two mismatches to modify a target codon(s) in the WT sequence.
  • the primers contained no mismatch with the WT sequence, and were designed for the substitution of a WT codon for a mutant codon in mLFAH12.
  • FAD2 only one set of oligonucleotides was synthesized (mDl- 5,mD67) which was designed for the modification of the WT gene OTable 1).
  • modified desaturase or hydroxylase genes containing each of the seven mutations may be recombined to produce any combination of two, three, four, five or six mutations. As shown below, such modified genes will exhibit varying degrees of metabolic activities.
  • First step 10 ng of plasmid DNA was added to a PCR reaction containing 200 ⁇ M dNTPs, 100 mM KC1, 100 mM (NIL iSO,,, 200 mM Tris-HCl (pH 8.8), 20 mM MgS0 4, 1% (v/v) Triton X-100, 1000 ⁇ g/ml BSA, 3 mM MgCl 2 , 5% (v/v) DMSO, 125 pmol of each primer, 1.25 units of cloned Pfu polymerase (Stratagene), to a final volume of 50 ⁇ l.
  • 200 ⁇ M dNTPs 100 mM KC1, 100 mM (NIL iSO,,, 200 mM Tris-HCl (pH 8.8), 20 mM MgS0 4, 1% (v/v) Triton X-100, 1000 ⁇ g/ml BSA, 3 mM MgCl 2 ,
  • Amplifications conditions were: 4 min denaturation step at 94°C, followed by 30 cycles of 92°C for 1 min, 50°C for 1 min, 72°C for 2 min, concluded with a final extension step at 72°C for 5 min.
  • PCR products were run on and purified from agarose or polyacrylamide gels.
  • Second step 10 ng of purified overlapping fragments were used as templates in PCR reactions similar to the above. Amplification conditions were identical except that products were amplified for only 15 cycles.
  • PCR fragments encoding modified LFAH12 enzymes were cloned into pBluescriptKS- derived plasmids using one of two general strategies, depending on the location in the molecule of the nucleotides to be substituted. In these approaches, advantage was taken of a unique Pstl site near the middle of the coding sequence and that Pfu polymerase generates blunt-ended fragments.
  • nucleotide substitutions to be introduced were 5' of the Pstl site, overlapping fragments were assembled using terminal primers H5' and mH4r. The resulting products were purified then cut with Pstl.
  • the pBluescript-derived pLFAH12-l plasmid (ref) was cut with EcoRV and Pstl, and the vector fragment was purified and ligated to the cut PCR fragment. If the nucleotide substitutions to be introduced were located 3' of the Pstl site, overlapping fragments were assembled using mH3f and H3', cut with Pstl, then ligated to the vector fragment from a digest of pLFAH12-l with Pstl and Smal. Alternatively, the assembled PCR products were cut with Pstl and Sacl, then ligated to the vector fragment from a restriction digest of pLFAH12-l with the same enzymes.
  • Yeast expression vectors containing WT or modified LFAH12 genes were constructed by excising inserts from the above constructs using the enzymes HindlR and S ⁇ cl, and cloning them into the bacterial-yeast shuttle vector pYESII (Invitrogen), cut with the same enzymes.
  • pBI121 was cut with Smal and S ⁇ cl, and the resulting vector fragment was purified.
  • inserts were excised from the pBuescriptKS-derived plasmids described above using the enzymes Stwl and S ⁇ cl, and substituted for the GUS gene in the pBI121 vector.
  • A. thaliana cDNA 146 M12T7 encoding FAD2 was obtained from the Arabidopsis Stock
  • This cDNA sequence was amplified using the Pfu DNA polymerase in conjunction with primers D5' and D3' to introduce the flanking restriction sites, Kpnl and Sm l immediately preceding the initiation codon ATG, and S ⁇ cl and EcoRI restriction sites following the terminator codon TGA.
  • This amplified wild type FAD2 fragment was cloned into the EcoRV site in the vector pZErO (Invitrogen).
  • the insert was then excised by restriction with Kpnl and EcoRI and cloned into the corresponding sites in the bacterial-yeast shuttle vector pYESII (Invitrogen), resulting in the plasmid pYESII-F2.
  • the binary vector pDN was constructed for seed-specific expression of the WT and modified FAD2 genes in plants.
  • the napin promoter was amplified from rapeseed DNA using the oligonucleotide primers nap 1 (G GTCGACAAC riTCTGCC ⁇ JATCAAC AGCTTTCA) and nap2 (GGTrTTGAGTAGTGATGTCTTGTATGTTCTAGATGGTACCGTAC).
  • a Hindm-BgHL fragment carrying the napin promoter was substituted for the 35S promoter by cutting the pBI121 plasmid (Clontech) with HindHI and B ⁇ mHI. A separate excision of the FAD2 insert was made using the restriction enzymes Smal and S ⁇ cl. This fragment was cloned into pDN using corresponding restriction sites.
  • the construction of the mFAD2 cDNA encoding a modified FAD2 enzyme containing seven amino acid substitutions was achieved using overlap extension PCR. Following the second round of assembly-amplification using the primers D5' and D3 ⁇ the PCR products were treated exactly as the amplified wild type FAD2 sequence described above with respect to the construction of vectors for expression in yeast and in plants. Once again, all inserts were sequenced to confirm the presence of the expected nucleotide substitutions and the absence of secondary mutations which can arise from PCR amplification.
  • Root microsomes were prepared as in Miquel and Browse (1992), with some modifications: the extraction buffer contained 2.5 mM NADH and catalase was 10,000 U/ml instead of 2,000 U/ml. After centrifugation at 100,000 g, microsomal membranes were rinsed in desaturase reaction buffer (also containing 10,000 U/ml catalase) before being dispersed in the same buffer to a final concentration of -0.5 mg/ml microsomal protein.
  • the membranes were then incubated in the presence of 85,000 dpm 14 C-oleoyl CoA (52 Ci/mol), and the labeled lipids were extracted after addition to the reaction of an equal volume of 2 M NaCl, 0.2 N HCl and 2 ml of chloroform/methanol (1:1).
  • the chloroform phase was recovered, dried under nitrogen, and the fatty acids were transmethylated in 1 N methanohc HCl for 1 h at 80°C.
  • the fatty acid methyl esters FAME
  • the hexane was subsequently evaporated under nitrogen, and the FAME were redissolved in 50 ml chloroform.
  • the FAME were then separated along side standards by argentation TLC as in Miquel and Browse (1992), using hexane/ethyl ether (80:20) as the mobile phase. After drying, the plates were exposed to Phosphorlmager cassettes, and the radioactivity of target fame's was measured by comparison to known quantities of labeled fatty acids spotted on the plate.
  • Proteins were quantitated using Bradford assay reagents (Biorad) or a TCA kit (Pierce) with known amounts of BS A as a standard.
  • Yeast strain INVCS2 (InVitrogen) was electroporated with expression constructs and control vector. Transformed cells were selected on SC-ura plates (obtained from Bio 101) containing 2% glucose. Resulting colonies were used to inoculate SC-ura liquid medium containing 2% galactose. Stationary phase cells were diluted to an OD ⁇ oo of 0.5 in fresh medium, and grown for 5 days at 16°C. The cultures were then centrifuged and pellets were assayed for fatty acid content.
  • Transgenic plants were generated using a modified in planta transformation procedure (Bectold et al., 1993). Batches of 12 to 15 plants were grown on soil covered with nylon screens for 3 to 4 weeks under continuous light (100 mmol m ⁇ V l irradiation in the 400 to 700 nm range). Primary bolts were removed four days before use to promote growth of multiple secondary bolts.
  • Agrobacterium tumefaciens strain GV3101 carrying binary Ti plasmid derivatives was grown in liquid cultures to stationary phase in LB medium with 15 mg ⁇ gentamycin and 50 mg/1 kanamycin. Cells were harvested and resuspended in infiltration medium (Murashige and Skoog macro and micronutrient medium containing 10 mg/1 6-benzylaminopurine and 5% glucose).
  • Plants were immersed in the bacterial suspension, then placed under vacuum (600 mm Hg) until tissues appeared uniformly soaked. Infiltrated plants were grown at 25°C under continuous light for four weeks. Seeds, bulk harvested from each pot, were sterilized in a mixture of bleach, water and Triton X-100 (30%, 70%, 0.1%), then germinated on selective medium (1 X Murashige and Skoog salts medium enriched with B5 vitamins, with 50 mg/1 kanamycin). Kanamycin resistant seedlings (the TI generation) were transferred to soil to produce T2 seed.
  • seed fatty acid composition For analysis of seed fatty acid composition, seeds were harvested from dry siliques and the fatty acid composition was determined from lipids extracted from pools of 50 seeds. For analyses of yeast fatty acid composition, cell pellets from 15 ml cultures were extracted in the same way as seed samples.
  • Fatty acids from samples were transmethylated in 1 ml of IN methanohc HCl (80°C, 1 hour) and extracted twice into hexane after addition of an equal volume of aqueous 0.9% NaCl.
  • Fatty acid methyl esters were derivatized with BSTFA/TMCS (99: 1) at 70°C for 30 min in order to obtain trimethylsilyl fatty acid methyl esters OMS-FAME) of hydroxylated fatty acids.
  • Fatty acids were resolved on an SP2340 fused silica capillary column (0.25 mm ED, 60 m, Supelco) in splitless mode using 1 ml/min of helium.
  • the injector and detector temperatures were 300°C; the temperature program was 100 to 160°C at 25°C min, 160 to 240°C at 7°C min, hold at 240°C for 5 min then decrease to 100°C at 25 min.
  • the identity of fatty acids in the samples was determined by comparing retention times and mass spectra to that of standards.
  • a Hewlett-Packard HP5971 MS was used to confirm the identity of eluting compounds.
  • lipids were extracted as in
  • Example 1 Modification of a desaturase to a hydroxylase.
  • primers mD2f and mD2r 0"able 1) are used in a second reaction
  • mD3f and mD3r are used in a third reaction
  • mD4f and mD4r are used in a fourth reaction
  • mD5f and mD5r are used in a fifth reaction
  • mD67f and mD67r are used in a sixth reaction.
  • the primer pair mD67f and mD67r introduced two amino acid substitutions.
  • the amplified fragments are then separated from the DNA template by excision and elution from a 5% acrylamide gel.
  • a portion of the purified fragments A-G are pooled into a single PCR reaction and are used as the DNA template in an amplification employing only flanking oligonucleotides D5' and D3' Oable 1).
  • various pairs of DNA fragments overlap and become extended until a continuous template is assembled and subsequently the flanking primers allow for amplification of the entire gene containing all the mutations encoded in the original oligonucleotide primers.
  • the fragments are used as a template in the second round of PCR and that full length DNA template is only included in the first round PCR reactions. Following this second round of assembly- amplification, the fragment is treated exactly as the amplified wild type FAD2 sequence described above with respect to its analysis and introduction into yeast and plants for analysis.
  • the nucleotide sequence of the mFAD2 gene is presented as SEQ ID NO:l.
  • the amino acid sequence of the polypeptide product of the mFAD2 gene is presented as SEQ ID NO:2.
  • a comparison of the nucleotide sequences of the FAD2 and mFAD2 genes is presented in Figure 5.
  • a comparison of the deduced amino acid squences of the polypeptide products of the FAD2 gene and the mFAD2 gene is presented in Figure 6.
  • the modified gene was expressed in yeast.
  • FAD2 is active and causes the accumulation of linoleate. Wild-type cells, which do not have this enzymatic activity, do not accumulate this fatty acid.
  • the mutant desaturase gene (mFAD2) was cloned into the pYESII vector downstream of the GAL1 promoter and electroporated into yeast cells. Transgenic cells were grown under conditions that led to expression of the gene, were harvested and their fatty acid composition determined by gas chromatography. As shown in Table 2, there were dramatic differences between the fatty acid phenotypes of cells expressing the mutant and wild-type genes.
  • the mutant gene was expressed in transgenic A. thaliana plants.
  • mFAD2 was expressed in the FAD2 mutant of A. thaliana under the control of the strong seed-specific promoter from the B. rapa napin gene.
  • Table 3 Seed fatty acid composition of transgenic A. thaliana FAD2 mutant plants expressing the mFAD2 gene.
  • the transgenic plants containing the mFAD2 gene were designated MF2-1 to MF2-8, respectively (average of two measurements on 25 T2 seeds).
  • the proportion of hydroxylated fatty acids which included ricinoleic and derivatives densipolic and lesquerolic acids, ranged from 3.2% to 9.4% (6.7% ⁇ 1.9%) of total seed fatty acids.
  • the ratio of seed linoleate to oleate contents were 2 to 12 times higher (6.4 ⁇ 3.1), which indicated significant desaturase activity, albeit lower than in the seeds of plants transformed with the WT gene.
  • the levels of hydroxylated fatty acid accumulation observed in transgenic plants expressing mFAD2 indicate that all or part of the amino acid substitutions were sufficient to promote significant levels of hydroxylase activity in planta. However, these changes did not have the effect of eliminating desaturase activity of the enzyme.
  • Example 2 Conversion of a hydroxylase to a desaturase.
  • the nucleotide sequence of the mFAH12 gene is listed as SEQ ID NO:3.
  • the deduced amino acid sequence of the polypeptide product of the mFAH12 gene is listed as SEQ ED NO:4.
  • a comparison of the nucleotide sequence of the FAH12 and mFAH12 genes is presented as Figure 7.
  • a comparison of the deduced amino acid sequences of the FAH12 and mFAH12 genes is presented as Figure 8.
  • LFAH12 In order to evaluate the effect of the introduced mutations on the activity of LFAH12, we expressed the modified genes in yeasL In yeast, LFAH12 is active and causes the accumulation of ricinoleate. Wild-type cells do not accumulate ricinoleate.
  • the mutant hydroxylase gene mLFAH12
  • mLFAH12 was cloned into the pYESII vector downstream of the GAL1 promoter and electroporated into yeast cells. Induced transgenic cells were harvested and their fatty acid composition determined by gas chromatography. As shown in Table 4, there were dramatic differences between the fatty acid phenotypes of cells expressing the mutant and wild- type genes.
  • Table 4 Fatty acid composition of wild-type yeast, yeast containing the LFAH12 gene and yeast containing the mLFAH12 gene (average values for five independent transformants).
  • yeast cells expressing LFAH12 accumulate linoleic and ricinoleic acids to similar levels, possibly because linoleic acid is tolerated better than ricinoleic acid, a phenomenon also observed in plant cells.
  • mFAH12 the ratio of linoleic to ricinoleic acid was on average 43-fold higher than in.cells expressing the wild-type gene.
  • 16:2 the product of palmitoleic acid desaturation.
  • mLFAH12 was introduced into the A. thaliana FAD2 mutant, which is deficient in oleate desaturation.
  • transgenic FAD2 plants where LFAH12 is driven by the strong CaMV35S promoter, hydroxylated fatty acids accumulate to high levels, while the mutant phenotype is partially suppressed in roots, due to low levels of desaturase activity of the enzyme.
  • mLFAH12 was expressed under the control of the same promoter and the fatty acid composition of leaves and seeds of transgenic plants was measured. Table 5. Seed fatty acid composition of transgenic A. thaliana FAD2 mutant plants expressing the mFAH12 gene.
  • the transgenic plants containing the mFAH12 gene were designated MH2-1 to MH2-8, respectively (Average of two measurements on 25 T2 seeds)
  • overlapping fragments were amplified in separate PCR reactions using primer pairs designed to introduce mutations.
  • the products were gel-purified, then assembled in a PCR reaction primed with terminal primers only.
  • Modified LFAH12 genes containing one or seven substitutions were constructed using pLFAH12-l as template and primers mHl-5 or mH67.
  • Modified LFAH12 genes containing only six mutations were constructed using m 7 LFAH12 as a template and one of primers H1-H7 to revert one of the mutations.
  • the 5'-end of terminal primers was modified to allow the introduction of convenient restriction sites for the cloning of PCR products.
  • the m 7 FAD2 was constructed using oligonucleotides D1-5,D67.
  • the PCR conditions were: 10 ng of plasmid DNA, 200 ⁇ M dNTPs, 100 mM KC1, 100 mM (NH 4 ) 2 SO 4, 200 mM Tris-HCl (pH 8.8), 20 mM MgS0 4 , 1% (v/v) Triton X-100, 1000 ug/ml BSA, 3 mM MgCl 2 , 5% (v/v) DMSO, 125 pmol of each primer, 1.25 U of Pfu polymerase
  • PCR products were purified from agarose or polyacrylamide gels.
  • 10 ng of purified overlapping fragments were used as templates in PCR reactions as above except that only 15 cycles were used.
  • PCR fragments encoding modified LFAH12 enzymes were cloned into pLFAH12-l cut with Pstl and one of Smal or EcoRV or Sacl. All inserts were sequenced.
  • Yeast expression vectors containing WT or modified LFAH12 genes were constructed by excising inserts from the above constructs using the enzymes Hindlll and Sacl, and cloning them into the Hindlll-Sacl sites of pYESII (Invitrogen). Constructs for plant transformation were made by cloning the Stul-Sacl fragment from modified LFAH12 genes into the Smal-Sacl sites of pBI121.
  • the FAD2 cDNA clone 146M12T7 was amplified with Pfu DNA polymerase using primers D5' and D3' to introduce restriction sites for Kpnl and Smal immediately upstream of the initiation codon, and Sacl and EcoRI restriction sites following the terminator codon. The fragment was cloned into the EcoRV site in the vector pZErO (Invitrogen).
  • the insert was excised by restriction with Kpnl and EcoRI and cloned into the corresponding sites in the pYESH, resulting in plasmid pYESII-F2.
  • Binary Ti-vector pDN was constructed for seed-specific expression of FAD2 genes.
  • the napin promoter was amplified from rapeseed DNA using primers ggcgtcgacaagcttctgcggatcaagcagctttca and ggttttgagtagtgatgtcttgtatgttctagatggtaccgtac.
  • a Hindlll-Bglll fragment was cloned into the
  • Plant expression constructs were introduced into Agrobacterium tumefaciens strain GV3101 pMP90 using electroporation and used to transform Arabidopsis fad! mutant plants by vacuum infiltration (D. Bouchez, C. Camilleri, M. Caboche, Comptes Rendus De L'academie Des Sciences Serie Hi 316, 1188 (1993) ).
  • the oligonucleotides used were the same as those earlier described Table 1.
  • the seven residues in the Arabidopsis FAD2 oleate desaturase were replaced with the corresponding Lesquerella hydroxylase residues.
  • the seven mutations were A63V, A105G, T148N, Y217F, A296V, S322A, M324I based on the numbering of the Arabidopsis FAD2 sequence.
  • the activity of the modified and unmodified genes was then determined by expressing them in yeast and transgenic plants, before analyzing the composition of the total fatty acids.
  • Technical difficulties limited the utility of direct measurements of enzyme activity in cell extracts.
  • the enzymes are integral membrane proteins that act on fatty acids esterified to lipids and require cytochrome bs reductase and cytochrome bs for activity.
  • mutant hydroxylase and desaturase genes containing all seven substitutions were expressed in yeast cells under transcriptional control of the GALl promoter.
  • Transgenic cells were harvested after induction and their total fatty acid composition determined by gas chromatography. Wild-type yeast cells do not accumulate detectable levels of diunsaturated or hydroxylated fatty acids (Covello et al. and Kajiwara et al.). The results are shown in Table 7 and presented graphically in Figure 9. Cultures were induced in growth medium containing galactose, ⁇ 2x 10 8 cells were harvested, and fatty acids where extracted and modified for analysis by gas chromatography, as described by Broun et al., 1998.
  • FAD2 and m 7 FAD2 were expressed in the Arabidopsis fad! mutant under the control of the strong seed- specific promoter from the B. rapa napin gene (Miguel et al., 1992).
  • the results are shown in Table 9 and presented graphically in Figure 11.
  • the abbreviations used in Figure 11 are: ricinoleic acid (18:l-OH), densipolic acid (18:2-OH) and lesquerolic acid (20:1-OH).
  • the ratio of seed linoleate to oleate contents was increased an average of 6.4-fold (results not presented), which indicated that m 7 FAD2 exhibited significant desaturase activity, albeit lower than in the seeds of plants transformed with the wild type FAD2 gene.
  • the high levels of hydroxy fatty acid accumulation observed in transgenic plants expressing m FAD2 indicated that the modified desaturase had comparable levels of hydroxylase activity, in the in planta assay, to the native Lesquerella hydroxylase enzyme. However, the seven amino acid substitutions did not completely eliminate the desaturase activity of the enzyme.
  • m 4 FAD2 A modified FAD2 enzyme, designated m 4 FAD2, was constructed in which these four amino acids were replaced by their equivalents from the
  • the ratio of desaturation to hydroxylation can be greatly changed in favor of desaturation by changing as few as six residues.
  • the resulting enzymes are catalytically active in vivo and their expression in transgenic Arabidopsis results in the accumulation of substantial levels of modified fatty acids.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Organic Chemistry (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Oil, Petroleum & Natural Gas (AREA)
  • Nutrition Science (AREA)
  • Cell Biology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)

Abstract

La présente invention concerne un procédé permettant de modifier en hydroxylase d'acyle gras une désaturase d'acyle gras. Ce procédé consiste à identifier et modifier un maximum de quatre radicaux acide aminé qui sont conservés dans des désaturases fonctionnellement équivalentes issues de diverses espèces végétales, mais qui ne sont pas identiques quant aux hydroxylases d'acyles gras présentant une importante ressemblance de séquence d'ensemble avec les désaturases d'acyles gras, et qui catalysent l'hydroxylation au niveau de l'un des radicaux carbone du substrat acyle gras qui est désaturé par la désaturase correspondante. Les modifications consistent en un changement du radical acide aminé qui est identique ou fonctionnellement équivalent au radical acide aminé se trouvant dans l'hydroxylase naturellement présente. L'invention concerne également un procédé semblable visant à modifier en désaturase d'acyle gras une hydroxylase d'acyle gras en modifiant un maximum de sept radicaux acide aminé. L'invention concerne enfin des plantes transgéniques et des produits de telles plantes transgéniques, auquel cas les plantes ont été modifiées pour produire une hydroxylase ou une désaturase modifiée.
EP99921394A 1998-04-16 1999-04-16 Interconversion de desaturases et d'hydroxylases d'acides gras vegetaux Withdrawn EP1071785A2 (fr)

Applications Claiming Priority (5)

Application Number Priority Date Filing Date Title
US8193698P 1998-04-16 1998-04-16
US81936P 1998-04-16
US12316899P 1999-03-05 1999-03-05
US123168P 1999-03-05
PCT/US1999/008400 WO1999053073A2 (fr) 1998-04-16 1999-04-16 Interconversion de desaturases et d'hydroxylases d'acides gras vegetaux

Publications (1)

Publication Number Publication Date
EP1071785A2 true EP1071785A2 (fr) 2001-01-31

Family

ID=26766148

Family Applications (1)

Application Number Title Priority Date Filing Date
EP99921394A Withdrawn EP1071785A2 (fr) 1998-04-16 1999-04-16 Interconversion de desaturases et d'hydroxylases d'acides gras vegetaux

Country Status (6)

Country Link
EP (1) EP1071785A2 (fr)
AU (1) AU3862099A (fr)
BR (1) BR9910125A (fr)
CA (1) CA2326687A1 (fr)
IL (1) IL139062A0 (fr)
WO (1) WO1999053073A2 (fr)

Families Citing this family (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6310194B1 (en) 1994-09-26 2001-10-30 Carnegie Institution Of Washington Plant fatty acid hydroxylases
EP1534843A4 (fr) * 2002-08-02 2007-04-25 Basf Plant Science Gmbh Regulateurs du metabolisme des glucides et du metabolisme lipidique chez les plantes iv
WO2013112578A1 (fr) * 2012-01-23 2013-08-01 Linnaeus Plant Sciences, Inc. Modification du profil en acides gras de l'huile de cameline
WO2021159036A1 (fr) * 2020-02-07 2021-08-12 Board Of Regents Of The University Of Nebraska Procédés de production de phéromones d'insectes

Family Cites Families (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1994011516A1 (fr) * 1992-11-17 1994-05-26 E.I. Du Pont De Nemours And Company Genes pour des desaturases d'acides gras en position delta-12 microsomales et enzymes apparentees provenant de plantes
US7205457B1 (en) * 1993-02-05 2007-04-17 Monsanto Technology Llc Altered linolenic and linoleic acid content in plants
US6310194B1 (en) * 1994-09-26 2001-10-30 Carnegie Institution Of Washington Plant fatty acid hydroxylases
US5801026A (en) * 1994-09-26 1998-09-01 Carnegie Institution Of Washington Use of plant fatty acyl hydroxylases to produce hydroxylated fatty acids and derivatives in plants
CA2557769A1 (fr) * 1995-12-14 1997-06-19 Cargill, Incorporated Vegetaux comportant des sequences mutantes conferant des profils d'acides gras modifies
WO1997022711A1 (fr) * 1995-12-19 1997-06-26 Regents Of The University Of Minnesota Procede metabolique de fabrication de synthases monomeres de polyhydroxyalcanoates
US5705391A (en) * 1996-08-14 1998-01-06 Associated Universities, Inc. Modified acyl-ACP desaturase
ES2275301T3 (es) * 1997-04-15 2007-06-01 Commonwealth Scientific And Industrial Research Organisation Genes de apoxigenasa vegetal de acido graso y la utilizacion de estos genes.

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO9953073A3 *

Also Published As

Publication number Publication date
CA2326687A1 (fr) 1999-10-21
AU3862099A (en) 1999-11-01
WO1999053073A9 (fr) 2000-07-20
BR9910125A (pt) 2003-02-25
WO1999053073A3 (fr) 2000-02-10
WO1999053073A2 (fr) 1999-10-21
IL139062A0 (en) 2001-11-25

Similar Documents

Publication Publication Date Title
AU723161B2 (en) Alteration in an amount of an unsaturated fatty acid by genetic manipulation
US7148336B2 (en) Nucleic acid sequences and methods of use for the production of plants with modified polyunsaturated fatty acid levels
US5475099A (en) Plant fatty acid synthases
US6433250B1 (en) Use of plant fatty acyl hydroxylases to produce hydroxylated fatty acids and derivatives in plants
US5668292A (en) Use of plant fatty acyl hydroxylases to produce hydroxylated fatty acids and derivatives in plants
US6291742B1 (en) Production of hydroxylated fatty acids in genetically modified plants
WO1999053073A2 (fr) Interconversion de desaturases et d'hydroxylases d'acides gras vegetaux
AU2004200281A1 (en) Interconversion of plant fatty acid desaturases and hydroxylases
CA2816177C (fr) Introns de desaturase et methode d'utilisation en vue de la production de plants a acides gras polyinsatures modifies
MXPA98006317A (en) Production of hydroxyled fatty acids in plants genetically modifies
EP1908843A1 (fr) Séquences d'acide nucléique et procédés d'utilisation pour la production de plantes avec des acides gras polyinsaturés modifiés

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20001026

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE

17Q First examination report despatched

Effective date: 20040913

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20071101