MXPA98006317A - Production of hydroxyled fatty acids in plants genetically modifies - Google Patents

Abstract

This invention relates to fatty acid-plant doroxylases. Methods for using conserved amino acid or nucleotide sequences to obtain plant fatty acid-hydroxylases are described. The use of cDNA clones encoding a plant hydroxylase to produce a family of hydroxylated fatty acids in transgenic plants is also described. In addition, the use of genes coding for fatty acid-hydroxylases or desaturases to alter the level of unsaturation of lipid fatty acids in transgenic plants is described

Description

PRODUCTION OF HYDROXYLED FATTY ACIDS IN GENETICALLY MODIFIED PLANTS TECHNICAL FIELD.

The present invention relates to the identification of nucleic acid sequences, and constructions, and to methods related thereto and to the use of these sequences and constructions to produce genetically modified plants for the purpose of altering the composition of the fatty acids of the oils , waxes and related compounds of plants.

DEFINITIONS The subject of the invention is a class of enzymes that introduce a hydroxyl group into several different fatty acids resulting in the production of several different classes of hydroxylated fatty acids. In particular, these enzymes catalyze the hydroxylation of oleic acid to 12-hydroxy-oleic acid and icosenoic acid to 14-hydroxy-icosoic acid. Other fatty acids such as palmitoleic acids and fatty acids can also be substrates.

REF .: 28032"> erucic Since it is not possible to refer to the enzyme by reference to a single substrate or product, the enzyme refers to the entire length as the kappa-hydroxylase to indicate that the enzyme introduces the hydroxyl, three distant carbons (ie, far of the carboxyl-carbon of the chain to the acyl) of a double bond located near the center of the acyl chain. The following fatty acids are also the object of this invention: ricinoleic acid, acid 12-hydroxyoctadec-cis-9-enoic (120H-18: cls? S); Lesqueroic acid, 14-hydroxy-cis-ll-icosenoic acid (14OH-20: lcls? L1); Densipolic acid, 12-hydroxyoctadec-cis-9-15-dienoic acid (120H-18: 2cls? 9'15); auricolic acid, 14-hydroxy-cis-ll, 17-icosadienoic acid (14OH-20: 2clsAl1'17); hydroxierucic acid, 16-hydrodoxicos-cis-12-enoic acid (160H-22: 1C1S 13); hydroxypical itoleic acid, 12-hydroxyhexadec cis-9-enoic acid (120H-16: lcls? 9); icosoic acid (20: lcls? L1). It will be noted that icosenoic acid is spelled eicosenoic in some countries.

BACKGROUND Extensive studies of the fatty acid composition of seed oils from different species of higher plants have resulted in the identification of at least 33 plant-derived, monohydroxylated, structurally distinct, and 12 different polyhydroxy fatty acids that are accumulate by one or more plant species (reviewed by van de Loo et al., 1993). Ricinoleic acid, and its main constituent of seed oil from the ricin plant, Ricinus communis (L.), is of commercial importance. A gene has been cloned from that species encoding a fatty acid-hydroxylase, and this gene has been used to produce ricinoleic acid in transgenic plants of other species. Some of this scientific evidence has been published by the present inventors (van de Loo et al., 1995). The use of the castor hydroxylase gene or to also produce other hydroxylated fatty acids such as lesquerólico acid, densipólico acid, hidroxipalmitoleico acid, hidroxierucico, and auricólico, in transgenic plants that is the subject of this invention.

In addition, the identification of a gene encoding a homologous hydroxylase from Lesquerella fendleri, and the use of this gene to produce these hydroxylated fatty acids in transgenic plants is the subject of this invention. Castor is a minor crop of oil seeds. Approximately 50% of the weight of the seed is oil (triacylglycerol) in which 85-90% of the total fatty acids are the hydroxylated fatty acid, ricinoleic acid. The pressed oil extracted from the castor beans has many industrial uses based on the properties provided by the hydroxylated fatty acid. The most important uses are the production of paints and varnishes, synthetic nylon-type polymers, resins, lubricants, and cosmetics (Ats on, 1989). In addition to oil, castor bean contains extremely toxic protein ricin, allergenic proteins, and the ricinin alkaloid. These constituents prevent the use of untreated seed food (after oil extraction) as a livestock feed, usually an important economic aspect of the use of oil seeds. In addition, with the variable nature of castor plants and a lack of investment in reproduction, castor beans have few favorable agronomic characteristics. For a combination of these reasons, castor bean is not grown any longer in the United States and the development of an alternative national source of hydroxylated fatty acids would be attractive. The production of ricinoleic acid, the important constituent of castor oil, in the cultivation of oilseed, established through genetic engineering would be a particularly effective means of creating a national source. Because there is no practical source of lesquerólico, densipólico, and auricólico acids from plants that adapt to the practices of modern agriculture, there is currently no large-scale use of these fatty acids by industry. However, fatty acids would have uses similar to those of ricinoleic acid if they could be produced in large quantities at a cost comparable to other fatty acids derived from plants (Smith, 1985). Plant species, such as certain species in the genus Lesquerella, which accumulate a high proportion of these fatty acids, have not been domesticated and are not commonly considered a practical source of fatty acids (Hirsinger, 1989). This invention represents a useful step towards the eventual production of these and other hydroxylated fatty acids in transgenic plants of agronomic importance. Taxonomic relationships between plants that have similar or identical classes of unusual fatty acids have been examined (van de Loo et al., 1993). In some cases, particular fatty acids occur mainly or only in related taxa. In other cases, there does not seem to be a direct link between taxonomic relationships and the occurrence of unusual fatty acids. In this regard, ricinoleic acid has now been identified in 12 genera of 10 families (reviewed in van de Loo et al., 1993). In this way, it seems that the ability to synthesize hydroxylated fatty acids has evolved several times independently during the radiation of angiosperms. This suggests that enzymes that introduce hydroxyl groups into fatty acids arise from minor modifications of the related enzyme. In fact, as shown herein, the sequence similarity between the 12 fatty acid-desaturases and the kappa-hydroxylase of the castor is high, so that it is not possible to determine inaccessibly whether a particular enzyme is a desaturase or a hydroxylase based on the evidence in the scientific literature. Similarly, a patent application (PCT WO 94/11516) which aims to teach the isolation and use of the 12 fatty acid desaturases does not teach how to distinguish a hydroxylase from a desaturase. In view of the importance of being able to distinguish between these activities for the purpose of genetic engineering of plant oils, the utility of this application is limited to the several cases where direct experimental evidence was presented (for example, altered composition of fatty acids in transgenic plants) to support the assignment of function. A method for distinguishing between fatty acid-desaturases and hydroxylases of fatty acids based on the amino acid sequence of the enzyme is also a subject of this invention. A characteristic of hydroxylated or other unusual fatty acids is that they are generally confined to seed triacylglycerols, which are largely excluded from the polar lipids of unknown mechanisms (Battey and Ohlrogge 1989; Prasad et al., 1987). This is particularly intriguing since triacylglycerol is a precursor of both triacylglycerol and polar lipid. With castor microsomes, there is some evidence that the mixture of polar lipid containing ricinonoleoyl is minimized by a preference of diacylglycerol acyltransferase for diacylglycerols containing ricinoleate (Bafor et al., 1991). Analyzes of vegetative tissues have generated few supports of unusual fatty acids, different from those that occur in the cuticle. The cuticle contains several hydroxylated fatty acids that are inter-esterified to produce a high molecular weight polyester that serves as a structural paper. A small number of other exceptions exist in which the unusual fatty acids are found in tissues other than the seed. The biosynthesis of ricinoleic acid of oleic acid in the endosperm in development of the castor (Ricinus communis) has been studied by a variety of methods. Morris (1967) established double-label studies that hydroxylation occurs directly by hydroxyl substitution in. place of keto- or epoxy-intermediate, or unsaturated intermediate. Hydroxylation using oleoyl-CoA as a precursor can be demonstrated in crude preparations or microsomes, but the activity of the microsomes is unstable and variable, and the isolation of the microsomes comprised a considerable, or sometimes complete, loss of activity (Galliard et al. Stumpf, 1966; Moreau and Stumpf, 1981). Oleic acid can replace oleoyl-CoA as a precursor, but only in the presence of CoA, Mg2 and ATP (Galliard and Stumpf, 1966) indicating that activation of acyl-CoA is necessary. However, radioactivity could not be detected in ricinoleoyl-CoA (Moreau and Stumpf, 1981). These observations and some more recent ones (Bafor et al., 1991) have been interpreted as evidence that the substrate for castor hydroxylase oleate is oleic acid esterified to phosphatidylcholine or another phospholipid. Hydroxylase is sensitive to cyanide and azide, and dialysis against metallic chelating agents reduces activity, which is restored by the addition of FeS0, suggesting the involvement of iron in enzymatic activity (Galliard and Stumpf, 1966). The synthesis of ricinoleic acid requires molecular oxygen (Galliard and Stumpf, 1966; Moreau and Stumpf, 1981) and requires NAD (P) H to reduce cytochrome b5, which is taught to be the intermediate electron donor for the hydroxylase reaction (Smith et al. 1992). Carbon monoxide does not inhibit hydroxylation, indicating that a cytochrome P450 is not included (Galliard and Stumpf, 1966, Moreau and Stumpf, 1981). The data from a hydroxylase substrate specificity study show that all substrate parameters (ie, chain length and double bond position with respect to both ends) are important, deviations in those parameters caused activity reduced in relation to oleic acid (Howling et al., 1972). The position at which hydroxyl was introduced, however, was determined by the position of the double bond, provided there are three distant carbons. In this way, the ricin acyl hydroxylase enzyme can produce a family of different hydroxylated fatty acids depending on the availability of the substrates. Thus, as a matter of convenience, the enzyme refers to the entire length of this specification as a kappa-hydroxylase (instead of an oleate-hydroxylase) to indicate the broad specificity of the substrate.

Castor kappa-hydroxylase has many superficial similarities to acyl-desaturases, fats, microsomes (Browse and Somerville, 1991). In particular, the plants have a microsomal oleate-desaturase activity in the • position? The substrate of this enzyme (Schmidt et al., 1993) and hydroxylase (Bafor et al., 1991) appears to be a gray acid in the sn-2 position of phosphatidylcholine. When the oleate is the substrate, the modification occurs in the same position (? 12) in the carbon chain, and requires the same co-factors, specifically the electrons of NADH via cytochrome b5 and molecular oxygen. No enzyme is inhibited by carbon monoxide (Moreau and Stumpf, 1981), the characteristic inhibitor of cytochrome P450 enzymes. No biotechnical studies of the properties of the enzyme (s) hydroxylase in Lesquerella appear to have been published.

Conceptual basis of the invention The use of a cDNA clone from the castor has been described herein for the production of ricinoleic acid in transgenic plants. As noted above, biochemical studies have suggested that castor hydroxylase may not have strict specificity for oleic acid but will also catalyze the hydroxylation of other fatty acids such as icosenoic acid (20: lcls? L1) (Ho ling et al. 1972). Based on these studies, the expression of kappa-hydroxylase in transgenic plants of species such as Brassica napus and Arabidopsis thaliana that accumulate fatty acids such as icosenoic acid (20: lcls? L1) and erucic acid (13-docosenoic acid; : lcls? l3) can cause the accumulation of hydroxylated derivatives of these fatty acids due to the activity of hydroxylase in these fatty acids. Direct evidence is presented in Example 1 that hydroxylated derivatives of ricinoleic, lesqueroic, densipolic and auricolic fatty acids are produced in transgenic Arabidopsis plants. Example 2 shows the isolation of a new kappa-hydroxylase gene from Lesquerella fendleri. In view of the high degree of sequence similarity between the? 2 fatty acid-desaturases and the castor hydroxylase (van de Loo et al., 1995), the validity of the claims (eg, PCT WO 94/11516) for using a limited set of desaturase or hydroxylase genes or sequences derived from them to identify genes of identical functions from other species should be viewed with skepticism. In this application, a method is taught by which the hydroxylase genes should be distinguished from the desaturases. A mechanistic basis for the similar reaction mechanisms of desaturases and hydroxylases is described. Briefly, the available evidence suggests that fatty acid-desaturases have a reaction mechanism similar to the bacterial enzyme methane-monooxygenase that catalyzes a reaction comprising the transfer of oxygen atoms (CH4 - * > CH3OH) (van de Loo and collaborators, 1993). The cofactor in the hydroxylase component of methane-monooxygenase is called a di-iron cluster, with μ-oxo bridge (FeOFe). The two iron atoms of the FeOFe group are linked by the nitrogen or oxygen atoms, derived from the protein, and are firmly coupled by the covalent binding oxygen atom. The FeOFe grouping accepts two electrons, reducing to the deferred state, before the union of the oxygen. In oxygen binding, it is likely that heterolitic cleavage also occurs, leading to a high valence oxohier reactive species that is stabilized by possible resonance rearrangements within the tightly coupled FeOFe cluster. The oxygen state, high valence, stabilized methane-oxygenase is capable of extracting protons from methane, followed by oxygen transfer, giving methanol. The cofactor FeOFe has been shown to be directly relevant to fatty acid modifications of plants by the demonstration that castor-stearoyl-ACP-desaturase contains this type of cofactor (Fox et al., 1993). Based on the above considerations, it has been suggested that castor oleate hydroxylase may be an acyl-desaturase, fat, structurally modified, based on three arguments. The first argument comprises the taxonomic distribution of plants containing ricinoleic acid. Ricinoleic acid has been found in 12 genera of 10 higher plant families (reviewed in van de Loo et al., 1993). In this way, plants in which ricinoleic acid is present are found throughout the plant kingdom, even close relationships to these plants do not contain the unusual fatty acid. This pattern suggests that the ability to synthesize ricinoleic acid has appeared (and has been lost, several times) independently, and therefore, has diverged recently. In other words, the ability to synthesize ricinoleic acid has appeared rapidly, suggesting that a relatively minor genetic change in the structure of the ancestral enzyme was necessary to achieve it. The second argument is that many biochemical properties of castor kappa-hydroxylase are similar to those of microsomal desaturases, as discussed above (for example, both act preferentially on fatty acids esterified to the sn-2 position of phosphatidylcholine, both use cytochrome b5 as an intermediate donor, both are inhibited by cyanide, both require molecular oxygen as a substrate, both are thought to be located in the endoplasmic reticulum). The third argument comes from the discussion of the previous oxygenase cofactors, in which it is suggested that the fatty acid-desaturases attached to the membrane of the plant may have a cofactor-type cluster dihierro bridge bridged by μ-oxo bridge, and that these cofactors are able to catalyze both fatty acid desaturations and hydroxylations, depending on the electronic properties and properties of the active site of the protein. Taking these three arguments together, it is suggested that the kappa-hydroxylase from the castor endosperm is homologous to the microsomal oleate-γ2-desaturase, found in all plants. A number of genes encoding microsomal? 12 from several species have recently been cloned (Okuley et al., 1994) and substantial information about the structure of these enzymes is now known (Shanklin et al., 1994). Therefore, in the following invention, it is taught how to use the structural information to isolate and identify the kappa-hydroxylase genes. This example teaches the method by which any acyl hydroxylase gene, fat, from plants insensitive to carbon monoxide, can be identified by one skilled in the art. An unexpected result of the studies on the castor hydroxylase gene in the transgenic Arabidopsis plants was the discovery that the expression of the hydroxylase leads to the increased accumulation of oleic acid in the lipids of the seed. Due to the low homology of the nucleotide sequence between the castor hydroxylase and the? 2-desaturase (approximately 67%), this effect is unlikely to be due to the deletion (also called homosense deletion or co-suppression) of the expression of the desaturase gene by the hydroxylase gene. Whatever the basis for the effect, this invention teaches the use of the hydroxylase genes to alter the level of fatty acid unsaturation in transgenic plants. this invention also teaches the use of genes of hydroxylase and desaturase, genetically modified, to achieve direct modification of the levels of unsaturation of fatty acids.

BRIEF DESCRIPTION OF THE DRAWINGS Figures 1A-D show the mass spectra of the hydroxy fatty acid standards (Figure IA, O-TMS-methylricinoleate, Figure IB, O-TMS-methyl-densipolylate, Figure IC, O-TMS-methyl-leskoleate; and Figure ID, O-TMS-methylauricoleate).

Figure 2 shows the fragmentation pattern of the trimethylsilylated methyl esters of the hydroxy fatty acids.

Figure 3A shows the gas chromatogram of the fatty acids extracted from seeds of the wild type Arabidopsis plants. Figure 3B shows the gas chromatogram of the fatty acids extracted from the seeds of the transgenic Arabidopsis plants containing the fahl2-hydroxylase gene. The numbers indicate the following fatty acids: [1] 16: 0; [2] 18: 0; [3] 18: lcis? 9; [4] 18.2c1S? 9.i2. [5] 20: 0; [6] 20: lcls? L1; [7] 18: 3cis? 9 '? 1E; [8] 20: 2casA11'14; [9] 22: lcls? L3; [10] ricinoleic acid; [11] densipolic acid; [12] lesqueroic acid; and [13] auricolic acid.

Figures 4A-D show the mass spectra of the new fatty acids found in the seeds of the transgenic plants. Figure 4A shows the mass spectrum of peak 10 of Figure 3A. Figure 4B shows the mass spectrum of peak 11 from Figure 3B. Figure 4C shows the mass spectrum of the spectrum 12 from Figure 3B. Figure 4D shows the mass spectrum of peak 13 from Figure 3B.

Figure 5 shows the nucleotide sequence of pLesq2 (SEQ ID NO: 1).

Figure 6 shows the nucleotide sequence of pLesq3 (SEQ ID NO: 2).

Figure 7 shows a transfer Northern of the total RNA from L. fendleri seeds probed with pLesq2 or pLesq3. S, indicates that RNA is from seeds; L, indicates that the RNA is from the leaves.

Figures 8A-B show the nucleotide sequence of the genomic clone encoding pLesq-HYD (SEQ ID NO: 3), and the deduced amino acid sequence of the hydroxylase enzyme encoded by the gene (SEQ ID NO: 4).

Figures 9A-B show the alignment of multiple sequences of deduced amino acid sequences for microscopic kappa-hydroxylases and l-2-desaturases. The abbreviations are: Rcfahl2, fahl2-hydroxylase gene from R. communis (van de Loo et al., 1995); Lffahl2, kappa-hydroxylase gene from L. fendleri; Atfad2, fad2-desaturase from Arabidopsis thaliana (Okuley et al., 1994); Gmfad2-1, fad2-desaturase from Glycine max (GenBank accession number L43920); Gmfad2-2, fad2-desaturase from Glycine max (Genbank accession number L43921); Zmfad2, fad2 desaturase from Zea mays (PCT WO 94/11516); Rcfad2, fad2-desaturase fragment from R. communis (PCT WO 94/11516); Bnfad2, fad2 desaturase from Brassica napus (PCT WO 94/11516); LFFAH12.AMI, SEQ ID NO: 4; FAH12.AMI, SEQ ID NO: 5; ATFAD2.AMI, SEQ ID NO: 6; BNFAD2.AMI, SEQ ID NO: 7; GMFAD2-1.AMI, SEQ ID NO: 8; GMFAD2-2. AMI, SEQ ID NO: 9; ZMFAD2.AMI, SEQ ID NO: 10; and RCFAD2.AMI, SEQ ID NO: 11.

Figure 10 shows a Southern blot of genomic DNA from L. fendleri probed with pLesq-HYD. E = EcoRI, H = HindIII, X = Xbal.

Figure 11 shows a map of the binary Ti plasmid PSLJ44024.

Figure 12 shows a map of the plasmid pYES2.0 Figure 13 shows part of a gas chromatogram of the fatty acids derivatized from yeast cells containing the plasmid pLesqYes in which the expression of the idroxylase gene was induced by the addition of galactose to the growth medium. The arrow points to a peak that is not present in the non-induced cells. The lower part of the figure is the mass spectrum of the peak indicated by the arrow.

BRIEF DESCRIPTION OF THE INVENTION This invention relates to acyl-fatty-hydroxylases of plants. Methods for using conserved amino acid or nucleotide sequences to obtain acyl-fatty-hydroxylases from plants are described. The use of cDNA clones encoding a plant hydroxylase to produce a family of hydroxylated fatty acids in transgenic plants is also described.

In a first embodiment, this invention is directed to recombinant DNA constructs that can provide transcription, or transcription and translation (expression) of the kappa-hydroxylase sequence of the plant. In particular, constructs that are capable of transcription, or of transcription and translation in host cells of the plant are preferred. These constructs may contain a variety of regulatory genes that include transcriptional initiation regions obtained from genes preferentially expressed in the tissue of the plant seeds. In a second aspect, this invention relates to the presence of these constructs in host cells, especially plant host cells having a plant kappa-hydroxylase, expressed, therein. In yet another aspect, this invention relates to a method for producing a plant kappa-hydroxylase in a host cell or progeny thereof via the expression of a cell construct. Cells containing a plant kappa-hydroxylase as a result of production of the sequence coding for plant kappa-hydroxylase are also contemplated herein.

In another embodiment, this invention relates to methods for using a DNA sequence encoding a plant kappa-hydroxylase for modifying the proportion of the hydroxylated fatty acids produced within a cell, especially plant cell. Plant cells having this modified hydroxylated fatty acid composition are also contemplated herein. In a further aspect of this invention, plant kappa-hydroxylase proteins, and sequences that are related thereto, including the amino acid and nucleic acid sequences, are contemplated. The plant kappa-hydroxylase exemplified herein includes the fatty acid-hydroxylase of Lesquerella fendleri. This exemplified fatty acid hydroxylase can be used to obtain other plant fatty acid-hydroxylases of this invention. In a further aspect of this invention, a nucleic acid sequence that directs seed-specific expression of an associated polypeptide coding sequence is described. The use of this nucleic acid sequence or derivatives thereof to obtain seed-specific expression in higher plants of any coding sequence is contemplated herein. In a further aspect of this invention, the use of genes encoding the acyl-fatty hydroxylases of this invention is used to alter the amount of fatty acid unsaturation of the lipids of the seed. The present invention further describes the use of genes of hydroxylase and desaturases, genetically modified, to achieve the targeted modification of the levels of unsaturation of fatty acids.

DETAILED DESCRIPTION OF THE INVENTION A genetically transformed plant of the present invention that accumulates hydroxylated fatty acids can be obtained by expressing the double-stranded DNA molecules described in this application. A plant-fatty acid hydroxylase of this invention includes any amino acid sequence, such as a protein, polypeptide or peptide fragment, or nucleic acid sequences encoding these polypeptides, obtainable from a plant source demonstrating the ability to catalyze the production of ricinoleic, lesqueroic, hydroxy-erucic (16-hydroxidoc-cis-13-enoic acid) or hydroxy-limetoleic acid (12-hydroxyhexadec-cis-9-enoic acid) from the linked monoenoic fatty acid substrates to CoA, ACP or lipids, under reactive conditions of plant enzymes. By "reactive enzyme conditions" it is meant that any of the necessary conditions are available in an environment (i.e., factors such as temperature, pH, lack of inhibitory substances) that will allow the enzyme to function. The preferential activity of a plant fatty acid-hydroxylase towards a particular fatty acid substrate is determined in comparison to the amounts of the hydroxylated fatty acid product obtained by different fatty acyl substrates. For example, by "which prefers oleate" is meant that the hydroxylase activity of the enzyme preparation demonstrates a preference for substrates containing oleates on other substrates. Although the precise substrate of castor-acid-hydroxylase of castor is not known, it is thought that it is a portion of unsaturated fatty acid that is esterified to a phospholipid such as phosphatidylcholine.

However, it is also possible that the mono-unsaturated fatty acids esterified to phosphatidylethanolamine, phosphatidic acid or a neutral lipid such as diacylglycerol or the thioester of co-enzyme-A can also be substrates. As noted above, significant activity has been observed in radioactive labeling studies using fatty acyl substrates other than oleate (Ho ling et al., 1972) indicating that the specificity of the substrate is for a family of related fatty acyl compounds. Because castor hydroxylase introduces three carbon hydroxy groups from a double bond, close to the methyl-carbon of the fatty acid, the enzyme is called a kappa-hydroxylase for convenience. Of particular interest, the present invention discloses that castor kappa-hydroxylase can be used for the production of 12-hydroxy-9-octadecenoic acid (ricinooleate), 12-hydroxy-9-hexadecenoic acid, 14-hydroxy-11- acid eicosenoic, 16-hydroxy-16-docosenoic acid, 9-hydroxy-6-octadecenoic acid by expression in plant species that produce non-hydroxylated precursors. The present invention also describes the production of additionally modified fatty acids such as 12-hydroxy-9, 15-octadecadienoic acid resulting from the desaturation of hydroxylated fatty acids (eg, 12-hydroxy-9-octadecenoic acid in this example). ). The present invention also discloses that future developments in the genetic engineering of plants will lead to the production of substrate fatty acids, such as icosoic acid esters, and palmitoleic acid esters in plants that do not normally accumulate these fatty acids. The invention described herein can be used in conjunction with these future improvements to produce hydroxylated fatty acids of this invention in any of the plant species that respond to direct genetic modification. In this way, the applicability of this invention is not limited to the present conception only of those species that currently accumulate suitable substrates. As noted above, a plant kappa-hydroxylase of this invention will exhibit activity towards various fatty acyl substrates. During the biosynthesis of the lipids in a plant cell, the fatty acids are typically covalently bound to the acyl carrier protein (ACP), co-enzyme-A (CoA) or various cellular lipids.

Plant kappa-hydroxylase which exhibit preferential activity towards the lipid-bound acyl substrate are especially preferred because they are probably more closely associated with the normal route of lipid synthesis or storage in immature embryos. However, activity towards acyl-CoA substrates or other synthetic substrates is also contemplated herein, by way of example. Other plant kappa-hydroxylases can be obtained from the exemplified, specific sequences provided herein. Additionally, it will be apparent that natural and synthetic plant kappa-hydroxylase can be obtained, including the modified amino acid sequences and starting materials for the modeling of synthetic proteins for the plant kappa-hydroxylase exemplified and from the plant kappa-hydroxylases. which are obtained from the use of these exemplified sequences. Modified amino acid sequences include sequences that have not been mutated, truncated, elongated or the like, if these sequences were partially or completely synthesized. The sequences that are actually purified from plant preparations or are identical or code for proteins identical thereto, without considering the method used to obtain the protein or sequence, are also considered naturally derived. In this manner, one skilled in the art will readily recognize that antibody preparations, nucleic acid probes (DNA and RNA) or the like can be prepared and used to detect and recover "homologous" or "related" kappa-hydroxylases from a variety of plant sources. Typically, the nucleic acid probes are killed to allow detection, preferably with radioactivity although enzymes or other methods can be used. For immunological detection methods, antibody preparations either monoclonal or polyclonal are used. Polyclonal antibodies, although less specific, are typically more useful in gene isolation. For detection, the antibody is labeled using radioactivity or any of a variety of second antibody / enzyme conjugate systems that are commercially available. Homologous sequences are found when there is a sequence entity and can be determined in the comparison of the sequence information, nucleic acid or amino acid, or through the hybridization reactions between a known kappa-hydroxylase and a candidate source. Conservative changes, such as Val / lie, Ser / Thr, Arg / Lys and Gln / Asn can also be considered in determining the homology of the sequence. Typically, a long nucleic acid sequence can show as little as 50-60% sequence identity, more preferably at least 70% sequence entity, between the target sequence and the given plant kappa-hydroxylase of interest excluding any of the deletions that may be presented, and is still considered related. The amino acid sequences are considered homologous for as little as 25% sequence entity between the two complete mature proteins (see generally Doolittle, R.F., OF URFS and ORFS, University Science Books, CA, 1986). A suitable genomic or other library prepared from the candidate plant source of interest can be probed with the conserved sequences from the plant kappa-hydroxylase to identify the homologously related sequences. The use of a complete cDNA or other sequence can be used if the shorter probe sequences are not identified. The positive clones are then analyzed by digestion with restriction enzymes and / or sequencing. When a genomic library is used, one or more sequences can be identified by providing both the modification region, as well as the transcriptional regulatory elements of the kappa-hydroxylase gene from this plant source. Also the probes can be considerably shorter than the complete sequence. Oligonucleotides, for example, may be used, but must be at least about 10, preferably at least about 15, more preferably at least 20 nucleotides in length. When regions with shorter length are used for comparison, a greater degree of sequence entity is required for the longer sequences. Frequently, shorter probes are particularly useful for polymerase chain reactions (PCR), especially when highly conserved sequences can be identified (see Gould et al. 1989 for examples of the use of PCRs to isolate homologous genes from taxonomic species. diverse). When longer nucleic acid fragments are used (>; 100 bp) as probes, especially when full or long cDNA sequences are used, is detected with little severity (for example, 40-50 ° C below the melting temperature of the probes) in order to obtain the signal to from the target sample with 20-50% deviation, that is, homologous sequences (Beltz et al., 1983). In a preferred embodiment, a plant kappa-hydroxylase of this invention will have at least 60% similarity of the complete amino acid sequence to the plant kappa-hydroxylase, exemplified. In particular, the kappa-hydroxylases that can be obtained from an amino acid sequence or nucleic acid of a kappa-hydroxylase from castor or Lesquerella are especially preferred. The plant kappa-hydroxylase may have preferential activity towards the longer or shorter chain fatty acyl extracts. Plant acyl-fatty hydroxylases having oleate-12-hydroxylase activity and eicosenoate-14-hydroxylase activity are considered both homologously related proteins due to in vitro evidence (Howling et al., 1972), and the evidence described in The present, castor kappa-hydroxylase will act on both substrates. Hydroxylated fatty acids can be subjected to further enzymatic modification with other enzymes that are normally present, or introduced by genetic engineering methods. For example, 14-hydroxy-11,17-eicosadienoic acid, which is present in some Lesquerella species (Smith, 1985), is thought to be produced by the desaturation of 14-hydroxy-11-eicosenoic acid. Again, not only clones and materials derived therefrom can be used to identify plant acyl-fatty-hydroxylases, homologues, but the resulting sequences obtained therefrom can also provide an additional method to obtain the acyl-fatty-hydroxylases. of plant from other plant sources. In particular, PCR can be a useful technique for obtaining the related acyl-plant-hydroxylases from the plant, from the sequence data provided herein. A person skilled in the art will be able to designate oligonucleotide probes based on comparisons of the highly conserved sequence typically. Of special interest are the primers of the polymerase chain reaction based on the conserved regions of the amino acid sequences between the kappa-hydroxylase of castor and the hydroxylase of L. fendleri (SEQ ID NO: 4). The details relate to the design and methods for a PCR reaction using these probes are described more fully in the examples. It should also be noted that acyl hydroxylases from a variety of sources can be used to investigate cases of fatty acid hydroxylation in a wide variety of plant applications and in vivo. Because all plants synthesize fatty acids via a common metabolic pathway, the study and / or application of a plant fatty acid-hydroxylase to a heterologous plant host can be easily achieved in a variety of species. Once the nucleic acid sequence is obtained, the transcription, or transcription and translation (expression), of the plant acyl hydroxylases in a host cell is desired to produce a ready source of the enzyme and / or to modify the composition of the fatty acids found therein in the form of free fatty acids, esters (particularly esterified to glycerolipids or as components of wax esters), stolides, or ethers. Other useful applications can be found when the host cell is a plant host cell, in vitro and in vivo. For example, by increasing the amount of a kappa-hydroxylase available in the plant, an increased percentage of ricinoleate or leseroleate (14-hydroxy-11-eicosenoic acid) 'can be provided.

Kappa-hydroxylase For this invention, a mechanism for the biosynthesis of ricyloleic acid in plants is demonstrated. Specifically, that a specific plant kappa-hydroxylase having preferential activity towards fatty acyl substrates is comprised in the accumulation of hydroxylated fatty acids in at least some plant species. The use of the terms ricinoleate or ricinoleic acid (or lesqueroleate or lesquerólico acid, densipoleato, etc.) is proposed to include the free acids, esters of ACP and CoA, the salts of these acids, esters of glycerolipids (particularly esters of triacylglycerol), the esters of waxes, the stolides and the ether derivatives of these acids. The determination that plant acyl-fatty-hydroxylases are active in the in vivo production of hydroxylated fatty acids suggest several possibilities for plant enzyme sources.

Actually, hydroxylated fatty acids are found in the same species of natural plants in abundance. For example, three hydroxy fatty acids related to ricinoleate are present in higher amounts in seed oils from several Lesquerella species. Of particular interest, lesqueroic acid is a homolog of 20 carbon atoms of ricinoleate with two additional carbon atoms at the carboxyl end of the chain (Smith, 1985). Other natural plant sources of the hydroxylated fatty acids include, but are not limited to, seeds of the Linum genus, seeds of the Wrigthtia species, Lycopodium species, Strophanthus species, Convolvulaces species, Calendula species and many others (van de Loo et al., 1993). Plants that have a significant presence of ricinoleate or leskoleate or other desaturated or modified derivatives of these fatty acids are preferred candidates for naturally obtaining kappa-hydroxylases. For example, Lesquerella densipila contains a fatty acid of 18 carbon atoms, diunsaturated with a hydroxyl group (van de Loo et al., 1993) that is thought to be produced by an enzyme that is closely related to castor kappa-hydroxylase. , according to the theory on which this invention is based. In addition, a comparison between the kappa-hydroxylases and between the plant acyl-fatty-hydroxylases that introduce hydroxyl groups at different positions of the 12-carbon oleate atom or 14 carbon-atom of lescaroleate or into different substrates of the nucleic acid and Icosenoic acid can produce insights for gene identification, protein modeling or other modifications as discussed above. Especially of interest are the acyl-fatty hydroxylases which demonstrate activity towards the fatty acyl substrates other than oleate or which introduce the hydroxyl group to a different location of the carbon atom 12. As described above, other plant sources can also provide Sources of these enzymes through the use of protein purification, nucleic acid probes, antibody preparations, protein modeling, or sequence comparisons, for example, and of particular interest are the respective amino acid and nucleic acid sequences, which correspond to these plant acyl-fatty-hydroxylases. Also, as described previously, once a given nucleic acid sequence for the plant hydroxylase is obtained, the additional plant sequences can be compared and / or probed to obtain the DNA sequences homologously related thereto and thus successively.

Genetic Engineering Applications As is well known in the art, once the cDNA clone encoding a plant kappa-hydroxylase is obtained, it can be used to obtain its corresponding, corresponding, genomic nucleic acid sequences thereto. Nucleic acid sequences encoding plant kappa-hydroxylases can be used in various constructions, for example, as probes to obtain additional sequences from the same or other species. Alternatively, these sequences can be used in conjunction with appropriate regulatory sequences to increase the levels of the respective hydroxylase of interest in a host cell for the production of hydroxylated fatty acids or the study of the enzyme in vitro or in vivo or to decrease or increasing the levels of the respective hydroxylase of interest for the same applications when the host cell is a plant entity, including plant cells, plant parts (including but not limited to seeds, species or tissues) and plants. The nucleic acid sequence encoding a plant kappa-hydroxylase of this invention may include the genomic sequence, cDNA or mRNA. By "coding" it is meant that the sequence corresponds to a particular amino acid sequence either in a homosense or antisense orientation. By "recombinant" is meant that the sequence contains a genetically engineered modification through manipulation via mutagenesis, restriction enzymes, or the like. A cDNA sequence can encode pre-processing sequences, or not, such as transit or signal peptide sequences. The peptide or transit or signal sequences facilitate the distribution of the protein to a given organelle and are frequently cleaved from the polypeptide at the entrance to the organelle, releasing the "mature" sequence. The use of the precursor DNA sequence is preferred in the plant cell expression cartridges. Additionally, as discussed above, the complete genomic sequence of plant kappa-hydroxylase can be obtained by detecting a genomic library with a probe, such as a cDNA probe, and isolating those sequences that regulate expression in the plant tissue. Once the desired nucleic acid sequence of the plant kappa-hydroxylase is obtained, it can be manipulated in a variety of ways. Where the sequence comprises flanking regions of non-coding, the flanking regions can be subjected to reception, mutagenesis, etc. In this way, transitions, transversions, deletions, insertions can be made in the sequence that occurs naturally. In addition, all or part of the sequence can be synthesized. In the structural gene, one or more codons may be modified to provide a modified amino acid sequence, or one or more codon mutations may be introduced to provide a convenient restriction site or other purpose comprised with the construct or expression. The structural gene can be further modified by employing synthetic adapters, linkers to introduce one or more convenient restriction sites, or the like.

The nucleic acid or amino acid sequences encoding a plant kappa-hydroxylase of this invention can be combined with other non-native, or "heterologous" sequences in a variety of ways. By "heterologous" sequences is meant any sequence that is not naturally bound to the plant kappa-hydroxylase, which includes, for example, the combination of nucleic acid sequences from the same plant that are not found naturally united together. The DNA sequence encoding a plant kappa-hydroxylase of this invention can be used in conjunction with all or part of the gene sequences normally associated with kappa-hydroxylase. In its component parts, a DNA sequence coding for a kappa-hydroxylase is combined in a DNA construct having, in the 5 'to 3' direction of the transcription, a transcription initiation control region capable of promoting transcription and / or translation in a host cell, the DNA sequence encoding the plant kappa-hydroxylase and a transcription and / or translation termination region.

Potential host cells include both prokaryotic and eukaryotic cells. A host cell can be unicellular or is found in a multicellular, differentiated or undifferentiated organism, depending on the proposed use. The cells of this invention can be distinguished by having a plant kappa-hydroxylase foreign to the wild type cell present therein, for example, by having a recombinant nucleic acid construct encoding a plant kappa-hydroxylase therein. . Depending on the host, the regulatory regions will vary, including regions of viral, plasmid or chromosomal genes, or the like. By the expression in prokaryotic or eukaryotic microorganisms, particularly in unicellular hosts, a wide variety of constitutive or regulatable promoters can be employed. Expression in a microorganism can provide a ready source of the plant enzyme. Among the transcriptional initiation regions that have been described are the regions of the bacterial and yeast hosts, such as E. coli, B. subtilis, saccharomyces cerevisiae, including genes such as beta-galactosidase, T7-polymerase, trpE and the like .

For the most part, the constructions will comprise functional regulatory regions of plants that provide modified production of the plant kappa-hydroxylase with the resulting modification of the composition of the fatty acids. The open reading frame, which codes for the plant kappa-hydroxylase or the functional fragment thereof will be bound at its 5 'end to a regulatory region of transcription initiation. Numerous regions of transcription initiation are available that provide a wide variety of constitutive or regulatable, eg, inducible, transcription of structural gene functions. Among the transcriptional initiation regions used for plants are regions associated with structural genes such as nopaline monopin-synthases, or with napin-soybean-β-conglycinin, oleosin, storage protein 12S, promoters of the 35S mosaic virus of cauliflower, or similar. The transcription / translation initiation regions corresponding to these structural genes are located immediately in the 5 'direction at the respective start codons. In embodiments, wherein the expression of the kappa-hydroxylase protein is desired in a plant host, the use of all or part of the complete plant kappa-hydroxylase gene is desired. If a different promoter is desired, such as a promoter inactive to the plant host of interest or a modified promoter, ie, having transcription initiation regions derived from a gene source and translation initiation regions derived from a different gene source or improved promoters, such as double 35S-CaMV promoters, the sequences can be joined together using normal techniques. For these applications, when the 5 'non-coding regions are obtained from other genes regulated during seed maturation, those preferentially expressed in the tissue of the embryos of the plant, such as the initiation control regions, are desired. of transcription from the napina gene of B. napus, or the 12S storage protein of Arabidopsis, or soybean-β-conclicinin (Bray et al., 1987). Transcription initiation regions that are preferentially expressed in the seed tissue, ie, that are detectable in other plant parts, are considered desirable for fatty acid modifications in order to minimize any of the reducing or adverse effects. of the gene product. The termination regions of the regulatory transcript can also be provided in the DNA constructs of this invention. The transcript termination regions can be provided by the DNA sequence encoding the plant kappa-hydroxylase or a convenient transcription termination region derived from a different gene source, for example, the transcript termination region that it is associated in a natural way with the region of initiation of the transcript. When the region of transcript termination is from a different gene source, it will contain at least about 0.5 kb, preferably about 1-3 kb of the 3 'sequence to the structural gene from which the terminating region is derived. Expression or transcription constructs of the plant having a plant kappa-hydroxylase as the DNA sequence of interest for increased or decreased expression thereof may be employed with a wide variety of plant life, particularly, life span. plant included in the production of vegetable oils for edible or industrial uses. The most especially preferred crops are the oil seed cultures, tempered. The plants of interest include, but are not limited to anything (cañola and varieties of high erucic content), Crambe, Brassica júncea, Brassica nigra, carricera, linseed, sunflower, safflower, cotton, Cuphea, soybean, peanut, coconut palms and oil and corn. An important criterion in the selection of suitable plants for introduction into kappa-hydroxylase is the presence in the host plant of a substrate suitable for hydroxylase. Thus, for example, the production of ricinoleic acid will be best achieved in plants that normally have high levels of ricinoleic acid in the lipids of the seed. Similarly, the production of lesqueroic acid will be best achieved in plants that have high levels of icosoic acid in the lipids of the seeds. Depending on the method for introducing the recombinant constructs into the host cells, other DNA sequences may be required. Importantly, this invention can be applied to different dicotyledonous and monocotyledonous species and will be readily applicable to new and / or improved transformation and regulation techniques. The transformation method is not critical to the present invention; Various methods of plant transformation are currently available. Since newer methods are available to transform crops, they can be applied directly later. For example, many plant species naturally susceptible to the infection of agrobacterium can be successfully transformed via tripartite or binary vector methods of transformation mediated by agrobacterium. In addition, microinjection techniques have been developed, bombardment of DNA particles, electroporation, which allows the transportation of several species of monocotyledonous and dicotyledonous plants. In the development of DNA construction, the various components of the construct or fragments thereof will normally be inserted into a convenient cloning vector that is capable of replication in a bacterial host, e.g., E. coli. Numerous vectors have been described in the literature. After each cloning, the plasmid can be isolated and subjected to further manipulation, such as restriction, insertion of new fragments, ligation, suppression, insertion, resection, etc., to provide the components of the desired sequence. Once the construction has been completed, it can then be transferred to an appropriate vector for further manipulation according to the manner of transformation of the host cell. Normally, included with the construction of DNA will be a structural gene that has the regulatory regions necessary for expression in a host and that provides for the selection of transformed cells. The example of providing resistance to a cytotoxic agent, for example, antibiotic, heavy metal, toxin, etc., prototropia that provides complementation, for an auxotrophic host, viral immunity or the like. Depending on the number of different host species, the expression construct or the components therein are introduced, one or more markers may be used, where different conditions are used for selection for the different hosts. It is pointed out that the regeneration of the DNA code provides that some codon substitutions are permissible for the DNA sequences without any corresponding modification of the amino acid sequence. As mentioned above, the manner in which the DNA construct is introduced into the plant host is not critical to this invention.

Any method that provides efficient transformation can be employed. Various methods for the transformation of plant cells include the use of Ti- or Ri- plasmids, microinjection, electroporation, infiltration, inhibition, bombardment of DNA particles, fusion of liposomes, bombardment of DNA or the like. In many cases, it will be desirable to have the construction limited on one or both sides of the T-DNA, which has particularly the left and right boundaries, more particularly the right boundary. This is particularly useful when the construction uses A. tumefaciens or A. rhizogenes as a mode for transformation, although the T-DNA boundaries may find use with other modes of transformation. When Agrobacterium is used for the transformation of plant cells, a vector that can be introduced into the host of Agrobacterium for homologous recombination with T-DNA or the Ti- or Riplasmid present in the host of Agrobacterium can be used. The Ti or Ri-plasmid containing the T-DNA for recombination can be armed (capable of causing the formation of bile) or disarmed (unable to cause bile), the latter being permissible, while the vir genes are present in the host of Agrobacterium, transformed. The armed plasmid can give a mixture of normal plant cells and bile. In some cases where Agrobacterium is used as the vehicle to transform the plant cells, the expression construct limited by the T-DNA boundaries will be inserted into a broad-spectrum host vector, which are broad-spectrum host vectors described in Literature. Commonly used is pRK2 or derivatives thereof. See, for example, Ditta et al. (1980), which is incorporated herein by reference. Included with the expression construct and the T-DNA will be one or more markers, which allow the selection of the transformed Agrobacterium and the transformed plant cells. A number of markers have been developed for use with plant cells, such as resistance in kanamycin, aminoglycoside G418, hygromycin, or the like. The particular marker employed is not essential to this invention, one or the other marker being preferred depending on the particular host and the manner of construction. For the transformation of plant cells using Agrobacterium, the explants can be combined and incubated with the transformed Agrobacterium for a sufficient time for transformation, dead bacteria, and plant cells grown in a selective, appropriate medium. Once the calluses are formed, shoot formation can be stimulated by using the appropriate plant hormones according to known methods and the shoots are transferred to the implanting medium for regeneration of the plants. Then, the plants can be grown to seeds and the seeds are used to establish repetitive generations and for the isolation of vegetable oils.

Use of Hydroxylase Genes to Alter Acid-Fatty Desaturases Activity A widely known goal of common efforts to improve the nutritional quality of edible plant oils, or to facilitate industrial applications of plant oils, is to alter the level of unsaturation of plant storage lipids (Topfer and collaborators, 1995). In particular, in many crop species, it is desired to substantially reduce the level of polyunsaturation of the storage lipids and increase the level of the oleic acid. The precise amount of the various fatty acids in a particular plant oil varies with the proposed application. In this way, it is desirable to have a strong method that will allow genetic manipulation of the level of unsaturation at any desired level. A substantial progress has been made recently in the isolation of genes coding for plant fatty acid desaturases (reviewed in Topfer et al., 1995). These genes have been introduced into several plant species and have been used to alter the level of unsaturation of fatty acids in one of three ways. First, the genes can be placed under the transcriptional control of a strong promoter so that the amount of the corresponding enzyme is increased. In some cases, this leads to an increase in the amount of the fatty acid which is a product of the reaction catalyzed by the enzyme. For example, Arondel et al. (1992) increased the amount of linoleic acid (18: 3) in tissues of transgenic Arabidopsis plants by placing the fad3 gene located in the endoplasmic reticulum, under the transcriptional control of the 35S virus promoter of the mosaic. the cauliflower, constitutive, strong.

A second method for using the cloned genes to alter the level of unsaturation in the fatty acids is to cause the transcription of all or part of a gene in transgenic tissues, so that the transcripts have an antisense orientation relative to the normal mode of transcription. This has been used by a number of laboratories to reduce the level of expression of one or more desaturase genes having a significant homology of the nucleotide sequence to the gene used in the construction of the antisense gene (reviewed in Topfer et al.). For example, the antisense repression of desaturase oleate-12 in transgenic naba resulted in a strong increase in oleic acid content (compare, Topfer et al., 1995). A third method for using cloned genes to alter fatty acid desaturation is to exploit the phenomenon of co-suppression or "gene slowing" (Matzke et al., 1995). Although the mechanisms responsible for gene lentification are not known in any detail, it has been frequently observed that in transgenic plants the expression of an introduced gene leads to the inactivation of homologous endogenous genes.

For example, the high-level homosense expression of the fad8 gene of Arabidopsis, which codes for a? 15 of saturase localized in the chloroplast, in transgenic plants of Arabidopsis caused suppression of the endogenous copy of the fad8 gene and the homologous fad7 gene (coding an isozyme of the fadd gene) (Gibson et al., 1994). The fad7 and fadd genes are only 76% identical at the nucleotide level. At the time of publication, this example represented the most divergent pair of plant genes for which co-suppression has been observed. In view of the prior evidence that relates to the relatively high level of nucleotide sequence homology required to obtain co-suppression, it is not obvious to one skilled in the art that homosense expression in acyl-fatty transgenic plants Castor-hydroxylase of this invention would significantly alter the saturation amount of the storage lipids. However, the present inventors state that the acyl-fatty hydroxylase genes can be used for this purpose as taught in Example 4 of this specification. Of particular importance, this invention teaches the use of the acyl-fatty-hydroxylase genes to increase the proportion of oleic acid in tissues of transgenic plants. The mechanism by which the expression of the gene exerts this effect is not known, but may be due to one of several possibilities that are elaborated in Example 4. The invention that has now been described in general, will be more easily understood by reference to the following examples which are included for purposes of illustration only and are not intended to limit the present invention.

EXAMPLES In the experimental description that follows, all temperatures are given in degrees centigrade (° C), the weights are given in grams (g), milligrams (mg) or micrograms (μg), the concentrations are given as molar (M), millimolar (mM) or micromolar (μM) and all volumes are given in liters (1), microliters (μl) or milliliters (ml), unless otherwise indicated.

EXAMPLE 1 - PRODUCTION OF NEW HYDROXYLED FATTY ACIDS IN ARABIDOPSIS THALIANA Global appraisal The kappa-hydroxylase encoded by the fahl2 gene of castor bean was used to produce ricinoleic acid, lesqueroic acid, densipholic acid and auricolic acid in transgenic Arabidopsis plants.

Production of transgenic plants A variety of methods have been developed to insert a DNA sequence of interest into the genome of a plant host to obtain the transcription and translation of the sequence to effect the phenotypic changes. The following methods represent only one of many equivalent means for producing transgenic plants and causing expression of the hydroxylase gene. Arabidopsis plants were transformed, by the Agrobacterium-mediated transformation, with the kappa-hydroxylase encoded by the fahl2 gene of castor into the binary pB6 Ti-plasmid. This plasmid has also been used to transform Nicotiana tabacum for the production of ricinoleic acid. The inocula of the Agrobacterium tumefaciens strain GV3101 containing the binary plasmid pB6 were placed in L-broth plates containing 50 μg / ml kanamycin and incubated for 2 days at 30 ° C. Individual colonies were used to inoculate large liquid cultures (medium of L-broth with 50 mg / l of rifampin, 110 mg / l of gentamicin and 200 mg / l of kanamycin) to be used for the transformation of Arabidopsis plants . The Arabidopsis plants were transformed by the plant transformation process essentially as described by Bechtold et al. (1993). The cells of A. tumefaciens GV3101 (pB6) were harvested from the liquid cultures by centrifugation, then redispersed in the infiltration medium at OD6oo = 0.8. The filtration medium was Murashige and Skoog macro and the micronutrient medium (Sigma Chemical Co., St. Louis, MO) containing 10 mg / l of 6-benzylaminopurine and 5% glucose. The batches of 12-15 plants were grown during 3 to 4 weeks in natural light at an average daily temperature of approximately 25 ° C in 3.5-inch pots containing soil. The intact plants were immersed in the bacterial suspension, then transferred to a vacuum chamber and placed under 600 nm of vacuum produced by a laboratory vacuum pump until the tissues appeared to be uniformly soaked with water (approximately 10 minutes). The plants were grown at 25 ° C under continuous light (100 μmol m 's' 1 irradiation in the range of 400 to 700 not shown) for four weeks. The seeds obtained from all the plants in a pot were collected as a batch. Seeds were sterilized by sequential treatment for 2 minutes with ethanol followed by 10 minutes in a mixture of household bleach (Clorox), water and Tween 80 (50%, 50%, 0.05%) then thoroughly rinsed with sterile water. The seeds were plated at high density (2000 to 4000 per plate) in the medium solidified with agar in 100 mm petri dishes containing the medium of the Murashige and Skoog 1/2 X salts enriched with vitamins B5 (Sigma Chemical Co., St. Louis, MO) and containing kanamycin at 50 mg / l. After incubation for 48 h at 4 ° C to stimulate germination, the saplings were grown for a period of seven days until the transformants were clearly identifiable as healthy green trees against a backdrop of sapwood trees sensitive to kanamycin, chlorotic. The transformants were transferred to a solid for two weeks before the tissue of the sheet could be used for DNA and lipid analysis. More than 20 transformants were obtained. The DNA was extracted from the young leaves of the transformants to verify the presence of an intact fahl2 gene. The presence of the transgene in a number of putative transgenic lines was verified by using the polymerase chain reaction to amplify the pB6 insert. The primers used were HF2 = GCTCTTTTGTGCGCTCATTC (SEQ ID NO: 12) and HR1 = CGGTACCAGAAAACGCCTTG (SEQ ID NO: 13), which were designed to allow the amplification of 700 bp fragments. Approximately 100 mg of genomic DNA was added to a solution containing 25 pmol of each primer, 1.5 U of Taq polymerase (Boeringer Manheim), 200 uM of dNTPs, 50 mM KCl, 10 M Tris.Cl, (pH 9), 0.1 % (w / w) of Triton X-100, 1.5 mM MgCl2, 3% formamide (w / w), to a final volume of 50 μl. The amplification conditions were: denaturation step of 4 minutes at 94 ° C, followed by 30 cycles of 92 ° C for 1 minute, 55 ° C for 1 minute, 72 ° C for 2 minutes. A final extension step closed the program at 72 ° C for 2 minutes. Transformants were positively identified after visualization of a characteristic 1 kb amplified fragment on an agarose gel stained with ethidium bromide. All the transgenic characteristics tested yielded a PCR product of a size consistent with the expected genotype, confirming that the lines were, in fact, transgenic. All additional experiments were done with three transgenic lines representative of the wild type designated 1-3, 4D, 7-4 and a transgenic line of the mutant line JB12 of fad2. The transgenic line of JB12 was included in order to test whether the increased accumulation of oleic acid in this mutant would have an effect on the amount of ricinoleic acid that accumulates in the transgenic plants.

Analysis of Transgenic Plants The leaves and seeds from the transgenic Arabidopsis plants of fahl2 were analyzed for the presence of hydroxylated fatty acids using gas chromatography. The lipids were extracted from 100-200 mg leaf tissue or 50 seeds. Fatty acid methyl esters (FAMES) were prepared by placing the tissue in 1.5 ml of 1.0 M methanolic HCl (Supelco Co.) in a 13 x 10 mm screw cap glass tube capped with a teflon-lined cap and heated at 80 ° C for 2 hours. On cooling, 1 ml of petroleum ether was added and the FAMES was removed by completely aspirating the ether phase which was then dried under a stream of hydrogen in a glass tube. One hundred μl of N, O-bis (trimethylsilyl) -trifluoroacetamide (BSTFA, Pierce Chemical Co.) and 200 μl of acetonitrile were designated to derivatize the hydroxyl groups. The reaction was carried out at 70 ° C for 15 minutes. The products were dried under nitrogen, redissolved in 100 μl of chloroform and transferred to a gas chromatography bottle. Two μl of each sample was analyzed on a fused silica capillary column, SP2340 (30 m, ID 0.75 mm, 0.20 mm film, Supelco), using a Gas Chromatograph Series 5890-11, Hewlett-Packard. The samples were not divided, the temperature program was 195 ° C for 18 minutes, it was increased to 230 ° C at 25 ° C / minute, it was maintained at 230 ° C for 5 minutes then it was lowered to 195 ° C at 25 ° C / minute, and flame ionization detectors were used.

The chromatographic elution time of the methyl esters and the O-TMS derivatives of ricinoleic acid, lesqueroic acid and auricolic acid were established by GC-MS of the lipid samples from L fendleri seeds and compared to the chromatograms published on the fatty acids of these species (Carlson et al., 1990). A standard of O-TMS-methyl-ricinoleate was prepared from the ricinoleic acid obtained from Sigma Chemical Co. (St., Luis, MO). Standards of O-TMS-methyl-lesqueroleate and O-TMS-methyl-auricoleate were prepared from purified triacylglycerols from L. fendleri seeds. The mass spectrum of O-TMS-methyl-ricinoleate, O-TMS-methyl-densipolyate, 0-TMS-methyl-leskoleate, and O-TMS-methyl-auricoleate are shown in Figures 1A-D, respectively. The structures of the characteristic ions produced during the mass spectrometry of their derivatives are shown in Figure 2. The lipid extracted from the transgenic tissues was analyzed by gas chromatography and mass spectrometry for hydroxylated fatty acid spectrometry. As a reference material, the average fatty acid composition of the leaves in wild type Arabidopsis and the fad2 mutant lines are reported by Miguel and Browse (1992). The gas chromatograms of the methylated and silylated fatty acids of these wild-type seeds and a fahl2 transgenic wild-type plant are shown in Figures 3A and 3B, respectively. The profiles are very similar except for the presence of three small peaks, very different, at 14.3, 15.9 and 18.9 minutes. A very small peak at 20.15 minutes was also evident. The elution time of the peaks at 14.3 and 18.9 minutes corresponded precisely to that of the standards of ricinoleic and lesqueroic acid, comparably prepared, respectively. No significant differences were observed in the lipid extracts of the leaves or roots of the wild type and the transgenic wild type lines fahl2 (Table 1). Thus, despite the fact that the fahl2 gene is expressed throughout the plant, the effects on fatty acid composition were observed only in the seed tissue. A similar observation has been made for transgenic fahl2 tobacco.

Table 1. Fatty acid composition of lipids from the wild-type transgenic type of Arabidopsis. The values are the average obtained from the analysis of the samples from three independent transgenic lines,. or three independent samples of the wild type and fad2 lines.

Table 1 Table 1 (continued) In order to confirm that the new peaks observed, the transgenic lines correspond to ricinoleic, lesqueroic, densipolic and auricolic acid derivatives, mass spectrometry was used. The fatty acid derivatives were determined by gas chromatography as described above except that a mass selective detector of the Hewlett-Packard series 5971 was used in place of the flame ionization detector used in the previous experiment. The spectrum of the four new peaks in Figure 3B (peak numbers 10, 11, 12, and 13) are shown in Figures 4A-D, respectively. The comparison of the spectrum obtained for the standards with that obtained for the 4 peaks from the transgenic lines confirms the identity of the four new peaks. Based on the three characteristic peaks at M / Z 187, 270 and 299, peak 10 is unambiguously identified as O-TMS-methylricinoleate. Based on the three characteristic peaks at M / Z 185, 270 and 299, peak 11 is unambiguously identified as O-TMS-methyldensipoleate. Based on the three characteristic peaks at M / Z 187, 298 and 327, peak 12 is unambiguously identified as O-TMS-methyl-geraseleate. Based on the three characteristic peaks at M / Z 185, 298 and 327, peak 13 is inambiguously identified as O-TMS-methylauricoleate. These results unequivocally demonstrate the identity of fahl2 cDNA as encoding a hydroxylase that hydroxylates both oleic acid to produce ricinoleic acid to produce lesqueroic acid. These results also provide additional evidence that hydroxylase can be functionally expressed in a heterologous plant species in such a way that the enzyme is catalytically functional. These results also demonstrate that the expression of this hydroxylase gene leads to the accumulation of ricinoleic, lesqueroic, densipolic and auricolic acid in a plant species that does not normally accumulate hydroxylated fatty acids in extractable lipids. It is expected to find lesqueroic acid in transgenic plants based on biochemical evidence suggesting a broad substrate specificity of kappa-hydroxylase. In contrast, the accumulation of densipolic and auricolic acids was less predictable. Since Arabidopsis does not normally contain significant amounts of the non-hydroxylated precursors of these fatty acids that could serve as substrates for hydroxylase, it appears that one or more of the three n-3 fatty acid-desaturases known in Arabidopsis ( example, fad3, fad7, fad8; reviewed in Gibson et al. 1995) are capable of desaturating the hydroxy compounds at the n-3 position. That is, the densipolic acid is produced by the action of an n-3-desaturase in the ricinoleic acid. Auricolic acid is produced by the action of a n-3 desaturase in the lesquerólico acid. Because it is located in the endoplasmic reticulum, fad3 desaturase is almost certainly responsible. This can be tested in the future by producing transgenic plants containing fahl2 from the deficient mutant of fad3 from Arabidopsis (similar experiments can be done with fad7 and fad8), It is also formally possible that the enzymes that normally lengthen 18: lcis? 9 to 20 : lcisAl1 can lengthen 120H-18: lcisA9 to 14OH-20: lcisAl1 ', and 120H-18: 2cis? 9.i5 to i4oH-20: 2cis? 11'17. The amount of the various fatty acids in the lipids of the seeds, leaves and roots of the control and transgenic plants are also presented in Table 1. Although the amount of the hydroxylated fatty acids produced in this example is less than that desired for the production of ricinoleate and other hydroxylated fatty acids from plants, numerous improvements can be envisaged which will increase the level of accumulation of the hydroxylated fatty acids of plants expressing the fahl2 or related hydroxylase genes. Improvements in tissue level and specificity of hydroxylase gene expression are also envisioned. Methods for achieving this by the use of strong seed-specific promoters such as the napina promoter from B. napus will be obvious to one skilled in the art. Additional improvements are envisaged, including the modification of enzymes that cleave hydroxylated fatty acids from phosphatidylcholine, the reduction in the activities of enzymes that degrade hydroxylated fatty acids and the replacement of acyltransferases that transfer hydroxylated fatty acids to the sn-1, sn-2 and sn-3 positions of the glycerolipids. Although the genes for these enzymes have not been described in the scientific literature, their usefulness and improvement in the production level of hydroxylated fatty acids can be easily appreciated based on the results of the biochemical investigations of ricinoleate synthesis.

Although Arabidopsis is not an economically important plant species, it is widely accepted by plant biologists as a model for higher plants. Therefore, the inclusion of this example is proposed to demonstrate the general utility of the invention written here to the modification of the oil composition in higher plants. An advantage of studying the expression of this new gene in Arabidopsis is the existence of this system of a large body of knowledge in the metabolism of lipids, as well as the availability of a collection of mutants that can be used to provide useful information in the biochemistry of hydroxylation of fatty acids in plant species. Another advantage is the ease of the transposition of any information obtained in the metabolism of ricinoleate in Arabidopsis to closely related species such as the cultivars Brassica napus, Brassica júncea or Cra be abyssinica in order to mass produce ricinoleate, lesqueroleate or other hydroxylated fatty acids for industrial use. Kappa-hydroxylase is useful for the production of ricinoleate or leseroleate in any plant species that accumulates significant levels of precursors, oleic acid and icosenoic acid. Of particular interest are genetically modified varieties that accumulate high levels of oleic acid. These varieties are currently available for sunflower and cañola. The production of lesqueroic acid and related hydroxy fatty acids can be achieved in species that accumulate high levels of icosenoic acid or other long chain monoenoic acids. These plants can, in the future, be produced by genetic engineering of plants that do not normally elaborate these precursors. In this way, the use of kappa-hydroxylases will be of general utility.

EXAMPLE 2. ISOLATION OF THE GENETIC CLONE OF KAPPA-HIDR0XILA5A OF LESQUERELLA General Appreciation The regions of the nucleotide sequence that are retained in both the castor kappa-hydroxylase and the? 12 -fad2-fatty acid desaturase fad2 of Arabidopsis were used to design the oligonucleotide primers. These were used with genomic DNA from Lesquerella fendleri to amplify the fragments of several homologous genes. These amplified fragments were then used as hybridization zones to identify full-length genomic clones from a genomic library of L. fendleri. Hydroxylated fatty acids are specific to the seed tissue of Lesquerella sp, and are not found to any appreciable extent in plant tissues. One of the two genes identified by this method was expressed both in the leaves and in the developing seeds and is therefore thought to correspond to λ2 fatty acid-desaturase. The other gene was expressed at high levels in the seeds of development, but was not expressed or expressed at very low levels in the leaves and is the kappa-hydroxylase from this species. The identity of the gene as an acyl-fatty-hydroxylase was established by the functional expression of the gene in yeast. The identity of this gene was also established by introducing the gene into the transgenic plants of Arabidopsis and showing that it causes the accumulation of ricinoleic acid, lesqueroic acid, densipolic acid and auricolic acid and seed lipids.

The various steps involved in this process are described in detail later. Unless indicated otherwise, routine methods for manipulating nucleic acids, bacteria and phages were as described by Sambrook et al. (1989).

Isolation of a fragment of the kappa-hydroxylase gene from Lesquerella Oligonucleotide primers have been designed for the amplification of the kappa-hydroxylase of L. fendleri by choosing regions of high homology of the deduced amino acid sequence between the kappa-hydroxylase of castor and the? 12-desaturase of Arabidopsis (fad2) . Because most of the more are encoded by several codons, these oligonucleotides were designed to encode all possible codons that could code for the corresponding amino acids. The sequence where these mixed oligonucleotides were Oligo 1: TAYWSNCAYMGNMGNCAYCA (SEQ ID NO: 14) and Oligo 2: RTGRTGNGCNACRTGNGTRTC (SEQ ID NO: 15) where Y = C + T, W = A + T, S = G + C, N = A + G + C + 'T, M = A + C, and R = A + G.

These oligonucleotides were used to amplify a DNA fragment from the genomic DNA of L. fendleri by the polymerase chain reaction (PCR) using the following conditions: approximately 100 nm of genomic DNA was added to a solution containing 25 pmol of each primer, 1.5 U of Taq-polymerase (Boeheringer Manheim), 200 uM of dNTPs, 50 mM KCl, 10 mM Tris.Cl, (pH9), 0.1% (v / v) of Triton X-100, MgCl2 1.5 mM, 3% (v / v) of formamide, to a final volume of 50 μl. The amplification conditions were: denaturation step of 4 minutes at 94 ° C, followed by 30 cycles at 92 ° C for 1 minute, 55 ° C for 1 minute, 72 ° C for 2 minutes. A final extension step closed the program at 72 ° C for 5 minutes. PCR products of approximately 540 bp were observed after electrophoretic separation of the PCR reaction products on agarose gels. Two of these fragments were cloned into pBluescript (Stratagene) to elicit plasmids pLesq2 and pLesq3. The sequence of the inserts in these two plasmids was determined by the chain termination method. The sequence of the insert in pLesq2 is presented as Figure 5 (SEQ ID NO: 1) and the sequence of the insert in pLesq3 is presented as Figure 6 (SEQ ID NO: 2). The high degree of sequence identity between the indicated clones that were both potential candidates to be a? 12 desaturase or a kappa-hydroxylase.

Northern Analysis In L. fendleri, hydroxylated fatty acids were found in large quantities in the seed oils but were not found in appreciable amounts in the leaves. An important criterion in the discrimination between an acyl-fatty-desaturase and the kappa-hydroxylase is that the kappa-hydroxylase gene is expected to be expressed more highly in tissues that have a higher level of hydroxylated fatty acids than in other tissues. In contrast, all tissues of the plant can contain mRNA for the 6-acyl-fatty-desaturase since the diunsaturated fatty acids are found in the lipids of all tissues in most or all plants. Therefore, it was of great interest to determine if the gene corresponding to pLesq2 was also expressed only in seeds or only expressed in other tissues. This question was proven by testing the hybridization of pLesq2 to purified RNA from developing and leaf seeds. Total RNA was purified from the developing seeds of the young leaves of L. fendleri using a Rneasy extraction kit (Qiagen), according to the manufacturer's instructions. RNA concentrations were quantified by UV spectrophotometry at α = 260 and 280 nm. In order to ensure uniform charging of the gel to be used for the Northern blotting, the RNA concentrations were further adjusted after recording the fluorescence under UV light of the RNA samples stained with ethidium bromide and runs on a gel Denaturing test. Total RNA prepared as described above from the developing leaves and seeds was subjected to electrophoresis through an agarose gel containing formaldehyde (Iba et al., 1993). An equal amount (10 μg) of the RNA was loaded into both cells, and RNA standards (0.16-1.77 kb scale, Gibco-BRL) were loaded into a third cell. After electrophoresis, the RNA was transferred from the gel to a nylon membrane (Hybond N +, Amersham) and fixed to the filter by exposure to UV light. 32 P-labeled probe was prepared from the insert DNA of clone pLesq2 by random priming and hybridized to the membrane overnight at 52 ° C, after which it had been prehybridized for 2 h. The prehybridization solution contained 5X SSC, 10X Denhardt solution, 0.1% SDS, 0.1 M KP04, pH 6.8, 100 μg / ml salmon sperm DNA. The hybridization solution had the same basic composition, but not SDS, and contained 10% dextran sulfate and 30% formamide. The transfer was washed once in 2X SSC, 0.5% SDS at 65 ° C, then in IX SSC at the same temperature. The brief exposure (30 minutes) of the transfer to the X-ray film revealed that the pLesq2 probe hybridized to an individual band only in the seed RNA cell (Figure 7). The transfer was re-probed with the insert from the en of pLesq3, which gave bands of similar intensity in the cells of the seed and leaves (Figure 7). These results show that the gene corresponding to the pLesq2 clone is expressed highly and specifically in the L. fendleri seeds. In conjunction with the knowledge of the deduced nucleotide and amino acid sequence, the strong specific expression of the seed of the gene corresponding to the insert in pLesq2 is a convincing indicator of the role of the enzyme in the synthesis of hydroxylated fatty acids in the oil of the seeds .

Characterization of a genomic clone of kappa-hydroxylase Genomic DNA was prepared from young leaves of L. fendleri as described by Murray and Thompson (1980). A partial digestion genome library of Sau3AI constructed in the vector DashII (Stratagene, 11011 North Torrey Pines Road, La Jolla CA 92037) was prepared by partially digesting 500 μg of DNA, selecting by size the DNA in a viscous gradient (Sambrook and collaborators 1989), and by ligating the DNA (average size 12 kb) to the arms digested by Ba Hl from? DashII. The complete ligation was packaged according to the manufacturer's conditions and plated on E. coli strain SLl-Blue MRA-P2 (Stratagene). This produced 5 x 10 5 primary recombinant clones. The library was then amplified according to the conditions of the manufacturers. A fraction of the genomic library was plated on XLl-blue E. coli plates and the resulting plates (150,000) were lifted onto the loaded nylon membranes (Hybond N +, Amersham), according to the manufacturer's conditions. The DNA was crosslinked to the filters under UV in a Strata-linker (Stratagene). Several clones having the genomic sequences corresponding to L. fendleri hydroxylase were isolated by probing the membranes with the pLesq2 insert that was amplified by PCR with internal primers and labeled 32 P by random priming. The filters were prehybridized for 2 hours at 65 ° C in 7% SDS, 1 mM EDTA, 0.25 m Na2HP04 (pH 7.2), 1% BSA was hybridized to the probe for 16 hours in the same solution. The filters were washed sequentially at 65 ° C in solutions containing 2 x SSC, 1 x SSC, 0.5 X SSC in addition to 0.1% SDS. A fragment of 2.6 kb Xba containing the complete coding sequence for the kappa-hydroxylase and approximately 1 kb of the region in the 5 'direction was subcloned into the corresponding site of pBluescript KS to produce the plasmid pLewq-Hyd and the sequence it was completely determined using an automatic sequencer by the dideoxy chain termination method. The sequence data was analyzed using the DNASIS program (Hitachi Company).

The sequence of the insert in the pLesq-Hyd clone is shown in Figures 8A-B. The sequence brings with it 1855 bp of the contiguous DNA sequence (SEQ ID NO: 3). The clone encoded a 5 'untranslated region of 401 bp (ie, nucleotides preceding a first ATG codon, an open reading frame of 1152 bp, and a 3' untranslated region of 302 bp. open reading codes for a protein of 384 amino acids with a predicted molecular weight of 44,370 (SEQ ID NO: 4) .The term amino lacks the characteristics of a typical signal peptide (von Heijne, 1985) .The exact transduction methionine- initiation has not been determined experimentally, but based on the homology of the amino acid sequence deduced to the castor kappa-hydroxylase (indicated below) is thought to be methionine encoded by the first ATG codon at nucleotide 402. The comparison of the deduced amino acid sequence of pLesq-Hyd with the sequences of membrane bound desaturases and castor hydroxylase (Figs. 9A-B) indicates that pLesq-Hyd is homologous to these genes. This figure shows an alignment of the hydroxylase of L. fendleri (SEQ ID NO: 4) with the castor hydroxylase (van de Loo et al., 1995), the fad2 cDNA of Arabidopsis coding for an α2-desaturase (so-called fad2) located in the endoplasmic reticulum (Okuley et al., 1994), two clones of soy fad2 desaturase, a fad2 clone of Brassica napus, a clone of fad2 of Zea mays and the partial sequence of a clone of Fad2 of an R communis. The high degree of homology of the sequence indicates that the gene products are of similar function. For example, the complete homology between the Lesquerella hydroxylase and the fad2 saturase of Arabidopsis was 92.2% similarity and 84.8% identity and the two sequences were different in length by only one amino acid.

Southern Hybridization Southern analysis was used to examine the copy number of the genes in the L. fendleri genome corresponding to the pLesq-Hyd clone. The genomic DNA (5 μg) was digested with EcoRI, HindIII and Xbal and separated into a 0.9% agarose gene. The DNA was transferred alkaline to a loaded nylon membrane (Hybond N +, Amersham), according to the manufacturer's protocol. The transfer was prehybridized for 2 hours at 65 ° C in 7% SDS, 1 mM EDTA, 0.25 M Na2HP04 (pH 7.2) 1% BSA and was hybridized to the probe for 16 hours in the same solution with the pLesq insert. -Hyd amplified by PCR with internal primers and labeled with 32P by random priming. The filters were washed sequentially at 65 ° C in solutions containing 2 X SSC, 1 X SSC, 0.5 X SSC in addition to 0.1% SDS, then exposed to an X-ray film. The probe hybridized with an individual band at each DNA digestion of L. fendleri (Figure 10), indicating that the gene from which pLesq-Hyd was transcribed is present in an individual copy in the L. fendleri genome.

Expression of pLesq-Hyd in transgenic plants There is a wide variety of plant promoter sequences that can be used to elicit tissue-specific expression of the cloned genes in the transgenic plants. For example, the napkin promoter and the acyl carrier protein promoters have previously used the modification of the seed oil composition by the expression of an antisense form of a desaturase (Knutson et al., 1992). Similarly, the promoter for the β-subunit of soy β-conglycinin has been shown to be highly active and results in specific expression of the residue in transgenic plants from species other than soybean. (Bray et al., 1987). In this manner, other promoters that drive seed specific expression can also be employed for the production of the modified seed oil composition. These modifications of the invention described herein will be obvious to one skilled in the art. Constructs for the expression of kappa-hydroxylase from L. fendleri in plant cells are prepared as follows: a Sali fragment of 13 kb containing the pLesq-Hyg gene was ligated into the Xhol site of the pSLJ44026 vector of Ti-plasmid binary (Jones et al., 1992) (Figure 11) to produce the plasmid pTi-Hyd and was transformed into the strains GV3101 of Agrobacterium tumefaciens by electroporation. Strain GV3101 (Koncz and Shell, 1986) contains a disarmed Ti-plasmid. The cells for electroporation were prepared as follows. The GV3101 was cultured in the LB medium with reduced NaCl (5 g / l).

A culture of 250 ml was grown at OD60o = 0.6, then centrifuged at 4000 rpm (Sorvall GS-A rotor) for 15 minutes. The supernatant was immediately aspirated from the loose pellet, which was redispersed gently in 500 ml of ice water. The cells were centrifuged as before, redispersed in 30 ml of ice-cold water, transferred to a 30 ml tube and centrifuged at 5000 rpm (Sorvall SS-34 rotor) for 5 minutes. This was repeated three times, the cells were redispersed consecutively in 30 ml of ice-cold water, 30 ml of 10% glycerol with ice, and finally in 0.75 ml of 10% glycerol cooled with ice. These cells were taken with aliquots, frozen in liquid nitrogen, and stored at -80 ° C. The electroporations used a Biorad Gene Pulser instrument using cold 2 mm separation specimens containing 40 μl of cells and 1 μl of DNA in water, at a voltage of 2.5 KV, and resistance of 200 Ohms. The cells subjected to electroporation were diluted with 1 ml of SOC medium (Sambrook et al., 1989, page A2) and incubated at 28 ° C for 2-4 hours before plating in medium containing kanamycin (50 mg / l).

The Arabidopsis thaliana can be transformed with the Agrobacterium cells containing pTi-Hyd as described in Example 1 above. Similarly, the presence of the hydroxylated fatty acids in transgenic Arabidopsis plants can be demonstrated by the methods described in Example 1 above.

Constitutive expression of L. fendleri hydroxylase in transgenic plants An EcoRI fragment of 1.5 kb from pLesq-Hyg comprising the complete coding region of the hydroxylase was gel purified, then cloned into the corresponding site of pBluescript KS (Stratagene). The plasmid DNA from a number of recombinant clones was then restricted with PstI, which must cut only once an insert and once in the polylinker sequence of the vector. The release of a 920 bp fragment with PstI indicated the correct orientation of the insert for further manipulations. The DNA from this clone was further restricted with Sali, the 5 'overhangs were filled in with the Klenow fragment of DNA polymerase I, then cut with Sacl. The insert fragment was gel purified, and cloned between the Smal and Sacl sites of pBI121 (Clontech) behind the 35S virus promoter from the cauliflower mosaic. After verifying that the sequence of the binding between the insert and the vector DNA was appropriate, the plasmid DNA from the recombinant clone was used to transform the A. tumefaciens (GV3101). The kanamycin-resistant colonies were then used for the in-plant transformation of A. thaliana as previously described. DNA was extracted from kanamycin-resistant small trees, and was used to PCR amplify selected fragments from the hydroxylase using the nested primers. When the fragments of the expected size could be amplified, the corresponding plants were grown in the greenhouse or oval plates, and the fatty acids were extracted from the fully spread leaves, roots and dry seeds. The GC-MS analysis was then performed as previously described to characterize the different fatty acid species and to detect the accumulation of hydroxy-fatty acids in the transgenic tissues.

Expression of Lesquerella hydroxylase in yeast In order to demonstrate that the cloned L. fendleri gene encoded by a kappa-hydroxylase, the gene was expressed in yeast cells under the transcriptional control of an inducible promoter and the yeast cells were examined for the presence of the hydroxylated fatty acids by GS-MS. In a first step, the lambda genomic clone containing the L. fendleri hydroxylase gene was cut with EcoRI, and a resulting 1400 bp fragment containing the hydroxylase gene coding sequence was subcloned into the EcoRI site of the pBluescript vector KS (Stratagene). This subclone, pLesqco, contains the coding region of Lesquerella hydroxylase plus some additional 3 'sequence. In a second step, the pLesqcod was cut with HindIII and Xbal, and the insert fragment was cloned into corresponding sites of the yeast expression vector pYes2 (Invitrogen; Figure 12). This subclone, pLesqYes, contains the hydroxylase of L. fendleri in the homosense orientation relative to the 3 'side of the Gall promoter. This promoter is inducible by the addition of galactose to the culture medium, and is repressed in the glucose addition. In addition, the vector carries origins of replication that allow the propagation of pLesqYes in both yeast and E. coli.

Transformation of host strain CGY2557 of S. cerevisiae The yeast strain CGY2557 (MATa, GAL +, ura3-52, leu2-3, trpl, ade2-l, lys2-l, his5, canl-100) was cultured overnight at 28 ° C in the liquid medium YPD (10 g of yeast extract, 20 g of bacto-peptone, 20 g of dextrose per liter) and an aliquot of the culture was inoculated into 100 ml of fresh YPD medium and cultured until the OD6oo of the culture was 1. Then, the cells they were collected by centrifugation and redispersed in approximately 200 μl of the supernatant. Aliquots of 40 μl of the cell suspension were then mixed with DNA 1-2 μg and subjected to electrophoresis in test pieces with a separation of 2 mm-gap using a Biorad Gene Pulser instrument adjusted to 600 V, 200 O, 25 μf, were added 160 μl of YPD and the cells were plated in the selective medium containing glucose. The selective medium consisted of 6.7 g of yeast nitrogen base (Difco), 0.4 g of casamino acids (Difco), 0.02 g of adenine sulfate, 0.03 g of L-leucine, 0.02 g of L-tryptophan, 0.03 g of L-lysine-HCl, 0.03 of L-histidine-HCl, 2% glucose, water at 1 liter. The plates were solved using Difco Bacto-agar 1.5%. The transformant colonies appeared after 3 to 4 days of incubation at 28 ° C.

Expression of L. fendleri hydroxylase in yeast The independent transformant colonies from the previous experiment were used to inoculate 5 ml of the selective medium containing either 2% glucose (repressed gene) or 2% galactose (induced gene) as the sole carbon source. The independent colonies of CGY2557 transformed with pYES2 that do not contain insert were used as controls. After 2 days of growth at 28 ° C, an aliquot of the cultures was used to inoculate 5 ml of the fresh selective medium. The new culture was placed at 16 ° C and cultivated for 9 days.

Analysis of yeast fatty acids expressing the hydroxylase of L. fendleri Cells from 2.5 ml of the culture were pelleted at 1800 g, and the supernatant was aspirated as completely as possible. The pellets were then dispersed in 1 ml of 1 N methanolic HCl (Supelco, bellafonte, PA). The transmethylation and derivatization of the hydroxy fatty acids was performed as described above. After drying under nitrogen, the mixtures were redissolved in 50 μl of chloroform before they were analyzed by GC-MS. The samples were injected into a fused silica capillary column SP2330 (30 m X ID 0.25 mm, film thickness 0.25 μ, Supelco). The temperature profile was 100-160 ° C, 25 ° C / min, 160-230 ° C, 10 ° C / min, 230 ° C, 3 min, 230-100 ° C, 25 ° C / min. The flow rate was 0.9 ml / min. The fatty acids were analyzed using a mass spectrum detector of the 5971 series from Hewlett-Packard. The gas chromatograms of the methyl esters of the fatty acids derivatized from the induced cultures of yeast containing pLesqYes contained a new peak that eluted at 7.6 min (Figure 13). The O-TMS-methyl-ricinoleate eluted to exactly the same position in the control chromatograms. This peak was not present in cultures lacking pLesqYes or in cultures containing pLesqYes grown in glucose (control conditions) instead of lactose (induction conditions). The mass spectrometry of the peak (Figure 13) revealed that the peak has the same spectrum as O-TMS-methyl-ricinoleate. In this way, based on the chromatographic retention time and the mass spectrum, it was concluded that the peak corresponded to O-TMS-methyl-ricinoleate. The presence of ricinoleate in the transgenic yeast cultures confirms the entity of the gene as a kappa-hydroxylase of this invention.

EXAMPLE 3. OBTAINING OTHER PLANT ACIL-HYDROXYLASES The castor fahl2 sequence can be used to identify other kappa-hydroxylases by methods such as PCR and heterologous hybridization. However, due to the high degree of sequence similarity between the γ2-desaturases u and the kappa-hydroxylases, the prior art does not teach how to distinguish between the two classes of enzymes without a functional test such as demonstrating activity in transgenic plants or another suitable host (e.g., microbial or animal cells, transgenic). The identification of the hydroxylase of L. fendleri provides the development of the criteria by which a hydroxylase and a desaturase can be distinguished solely on the basis of the deduced amino acid sequence information. Figures 9A-B show an alignment of the sequences of castor hydroxylase and L. fendleri with the castor hydroxylase sequence and all sequences publicly available for all 12 plant microsomal fatty acid desaturases. Of the 384 amino acid residues in the castor hydroxylated sequence, more than 95% are identical to the corresponding residue in at least one of the saturase sequences. Thus, none of these residues are responsible for the catalytic differences between hydroxylase and desaturases. Of the remaining 16 residues in castor hydroxylase and the 14 residues in Lesquerella 4 hydroxylase, the seven represent cases where the hydroxylase sequence has a conservative substitution compared to one or more of the desaturase sequences, or there is extensive variability in the amino acid at that position in the various desaturases. By conservative, it can be said that the following amino acids are functionally equivalent: Ser / Thr, Ile / Leu / Val / Met, Asp / Glu. These structural differences also can not account for the catalytic differences between desaturases and hydroxylases. This leaves only seven amino acid residues where the castor hydroxylase and Lesquerella hydroxylase differ from all known desaturases and where all known microsomal 12-desaturases have the identical amino acid residue. These residues are presented in positions 69, 111, 155, 226, 304, 331 and 333 of the alignment in Figure 9. Therefore, these seven sites distinguish hydroxylases from desaturases. Based on this analysis, it is believed that any enzyme with more than 60% sequence identity to one of the enzymes listed in Figure 9 can be classified as a hydroxylase is deferred from the sequence of the desaturases in these seven positions. Due to the slight differences in the number of residues in a particular protein, the numbering may vary from protein to protein but the intent of the number system will be evident if the protein in question is aligned with the castor hydroxylase using the numbering system shown in the present. Thus, in conjunction with methods for using the Lesquerella hydroxylase gene to isolate the homologous genes, the structural criteria described herein teach how to isolate and identify the plant kappa-hydroxylase genes for the purpose of genetically encoding the fatty acid composition as described herein.

EXAMPLE 4. USE OF HYDROXYLASE TO ALTER THE NUTRITION OF THE INSATURATION OF FATTY ACIDS The evidence that the kappa-hydroxylases of this invention can be used to alter the saturation level of the fatty acids, was obtained from the analysis of the transgenic plants expressing the castor hydroxylase under the control of the mosaic virus promoter. of the cauliflower. The construction of the plasmids and the production of the transgenic Arabidopsis plants are described in Example 1 (above). The fatty acid composition of the wild-type seed lipids and six transgenic lines (1-2 / a, 1-2 / b, 1-3 / b, 4F, 7E, 7F) is shown in Table 2 .

Table 2. Fatty acid composition of lipids from the Arabidopsis seed. The asterist (*) indicates that for some of these samples, the peaks 18: 3 and 20: 1 superimposed on the gas chromatogram and therefore, the total amount of these two fatty acids is reported. r-n The results in Table 2 show that expression of the castor hydroxylase in the transgenic Arabidopsis plants caused a substantial increase in the amount of oleic acid (18: 1) in the lipids of the seeds and a correspondingly corresponding decrease in the amount of linoleic acid (18: 2). The average amount of oleic acid in the six transgenic lines was 29.9% versus 14.7% in the wild type. No precise mechanism is known by which the expression of the castor hydroxylase gene causes the increased accumulation of oleic acid. However, an increase in the mechanism is not required in order to exploit this invention for the direct alteration of the fatty acid composition of plant lipids. Additionally, it will be recognized by one skilled in the art that many improvements of this invention can be anticipated. Of particular interest will be the use of other promoters that have high levels of seed-specific expression. Since the hydroxylated fatty acids were not detected in the lipids of the seeds of the l-2b transgenic line, it seems likely that it is not the presence of hydroxylated fatty acids per se that causes the effect of the castor hydroxylase gene on activity. of the desaturasas. The protein-protein interaction between the hydroxylase and the? 12-oleate-desaturase or other protein may be required for the complete reaction (eg, cytochrome b5) or for the regulation of the desaturases activity. For example, the interaction between hydroxylase and this other protein can suppress the activity of the desaturase. In particular, the quaternary structure of the desaturases bound to the membrane has not been established. It is possible that these enzymes are active as dimers or as multimeric complexes containing more than two subunits. Thus, if the dimers or multimers are formed between the desaturase and the hydroxylase, the presence of the hydroxylase in the complex can break down the activity of the desaturase. Transgenic plants can be produced in which the hydroxylase enzyme has become inactive by the removal of one or more of the histidine residues that have been proposed that bind the iron molecules required for catalysis. Several of these histidine residues have been shown to be essential for the activity of the desaturase by sequence-directed mutagenesis (Shanklin et al., 1994). The codons coding for the histidine residues in the castor hydroxylase gene will be changed to alanine residues, as described by Shanklin et al. (1994). The modified genes will be introduced into transgenic Arabidopsis plants, and possibly other species such as tobacco, by the methods described in Example 1 of this application. In order to examine the effect on all tissues, the strong promoter of the constitutive cauliflower mosaic virus can be used to elicit transcription of the modified genes. Nevertheless, it will be recognized that in order to specifically examine the effect of mutant gene expression on seed lipids, a seed-specific promoter such as the napina promoter from B. napus can be used. An expected result is that the expression of the inactive hydroxylase protein in the transgenic plants will inhibit the activity in the? 12-desaturase located in the endoplasmic reticulum. Maximum inhibition will be obtained by expressing high levels of the mutant protein. In a further embodiment of this invention, mutations that inactivate other hydroxylases, such as the Lesquerella hydroxylases of this invention, may also be useful for decreasing the amount of α12 activity located in the endoplasmic reticulum in the same manner as the castor gene. In a further embodiment of this invention, many similar genes of the desaturase genes can also be used to inactivate the endogenous desaturases. In this way, the expression of the catalytically inactive fad2 gene from Arabidopsis in the transgenic Arabidopsis can inhibit the activity of the endogenous fad2 gene product. Similarly, the expression of the catalytically inactive forms of the? 2-desaturase from Arabidopsis or other plants in transgenic soybeans, naba, crambe, brassica júncea, cañola, flax, sunflower, safflower, cotton, cuphea, soybean, peanut , coconut, oil or corn core can condition the inactivation of endogenous? 12-desaturase activity in these plants. In a further embodiment of this invention, the expression of the catalytically inactive forms of other desaturases such as α5-desaturases can lead to the inactivation of the corresponding desaturases. An example of a class of mutants useful in the present invention are the "negative, dominant" mutants that block the function of a gene at the protein level (Herskowitz, 1987). A cloned gene is altered so that it encodes a mutant product capable of inhibiting the wild-type gene product in a cell, thereby causing the cell to be deficient in the function of that gene product. Inhibitory variants of a wild-type product can be designed because the proteins have multiple functional domains that can be independently mutated, for example, oligomerization, substrate binding, catalysis, membrane association domains or the like. In general, the dominant negative proteins retain the functional subset, intact from the wild-type protein domains, of origin, but the complete subunit of that subunit that is deleted or altered to be nonfunctional. Whichever is the precise basis for the inhibitory effect of castor hydroxylase on desaturation, because castor hydroxylase has very low homology of the nucleotide sequence (ie, approximately 67%) to the fad2 gene of Arabidopsis (which codifies for the? 2-desaturase located in the endoplasmic reticulum), the inhibitory effect of this gene, which is tentatively called "protein-mediated inhibition" ("protohibition"), may have wide utility because it does not depend to a greater degree on the homology of the nucleotide sequence between the transgene and the endogenous target gene. In particular, castor hydroxylase can be used to inhibit the activity of the? 2-desaturase located in the endoplasmic reticulum of higher plants. Of particular interest are those species used for oil production. These include, but are not limited to: Naba, Crambe, Brassica Júncea, cañola, flax, sunflower, safflower, cotton, cuphea, soy, peanut, coconut, corn oil cream.

CONCLUSION NOTES By the above examples, the demonstration of critical factors in the production of new hydroxy fatty acids by the expression of a kappa-hydroxylase gene from castor in transgenic plants is described. In addition, a complete kappa-hydroxylase cDNA sequence from Lesquerella fendleri is also provided. A complete sequence of the castor hydroxylase is also given with various constructs for use in host cells.

Through this invention, the amino acid and nucleic acid sequences encoding the plant acyl-fatty-hydroxylases can be obtained from a variety of sources and for a variety of applications. Also pertinent is a new method by which the level of fatty acid desaturation can be altered in a direct way through the use of genetically altered genes of hydroxylase or desaturase. All the publications mentioned in this specification are indicative of the level of the person skilled in the art to which this invention corresponds. All publications are incorporated herein by reference to the same degree as if each individual publication was specifically and individually indicated to be incorporated by reference. Although the above invention has been described in some detail by way of illustration and by way of example for purposes of clarity and understanding, it will be obvious that certain changes and modifications may be practiced within the scope of the appended claims.

REFERENCES Arondel, V., B. Lemieux, I. Hwang, S. Gibson, H. Goodman, C.R. Somerville. Map-based cloning of a gene controlling omega-3 fatty acid desaturation in Arabidopsis. Science 258, 1353-1355 (1992).

Ats on, D. (1989) Beaver, in Oil Crops of the World Robbelen, G., Downey, K.R., and Ashri, A., Eds., McGraw-Hill, New York p. 438-447.

Bechtold, N., Ellis, J. and Pelletier, G. (1993) In Plant Agrobacterium mediated gene transfer by infiltration of adult Arabidopsis thaliana plants. C.R. Acad. Sci. Paris 316, 1194-1199.

Beltz, G.A., Jacobs, K.A., Eickbuch, T.H., Cherbas, P.T., Kafatos, F.C. (1983) Isolation of multigene families and determination of homologies by filter hybridization methods. Methods in Enzymology 100, 266-285.

Bray, E.A., Naito, S., Pan, N.S., Anderson, E., Dube, P., Beachy, R.N. (1987) Expression of the ß-subunit of ß-conglycinin in seeds of transgenic plants. Plant 172, 364-370.

Carlson, K.D., Chaudhry, A., Bagby, M.O (1990) Analysis of oil and meal from lesquerella fendleri seed. J. Am. Oil Chem. Soc. 67, 438-442.

Ditta, G., Stanfield, S., Corbin, D., Helinski, D.R. (1980) Broad host range DNA cloning system for gram-negative bacteria: Construction of a gene bank of Rhizobium meliloti. Proc. Nati Acad. Sci. USA 77, 7347-7351.

Gibson, S., Arondel, V., Iba, K., Somerville, C.R. (1994) Temperature Regulated Expression of a Gene Encoding to Chloroplast omega-3 Desaturase from Aratidopsis thaliana. Plant Physiol. 106, 1615-1621.

Gould, S.J., Subra ani, S., Scheffler, I.E. (1989) Use of the DNA polymerase chain reaction for homology probing. Proc. Nati Acad. Sci. USA 86, 1934-1938.

Herskowitz, I. (1987) Functional inactivation of genes by dominant negative mutations. Nature 329, 219-222.

Hirsinger, F. (1989) New oil crops, in Oil Crops of the World, Robbelen, G., Downey, K.R., and Ashri, A., Eds., McGraw-Hill, New York, pp. 518-533.

Howling, D., Morris, L.J., Gurr, M.I., James, A.T. (1972) The specificity of fatty acid desaturases and hydroxylases. The dehydrogenation and hydroxylation of monoenoic acids, Biochim. Biophys. Acta 260, 10 Huyuh, T.V., Young, R.A., Davis, R.W. (1985) Constructing and screening cDNA libraries in AgtlO and kgEll. In DNA Cloning, Vol. 1: A Practical Approach, (ed.) D.M. Glover. IRL Press, Washington DC pp 49-77.

Iba, K., Gibson, S., Nishiuchi, T., Fuse, T., Nishimura, M., Arondel, V., Hugly, S., and Somerville, C. (1993) A gene encoding a chloroplast omega- 3 fatty acid desaturase complements alterations in fatty acid desaturation and chloroplast copy number of the fad7 mutant of Arabidopsis thaliana. J. Biol. Chem. 268, 24099-24105.

Jones, JDG, Shlum.ukov, L., Carland, F., English, J., Scofield, S., Bishop, GJ, Harrison, K. (1992) Effective vectors for transformation, expression of heterologous genes, and assaying transposon excision in tranegenic plants. Transgenic Res. 1, 285-297.

Knutson, D.S., Thompson, G.A., Radke, S.E., Johnson, W.B., Knauf, V.C., Kridl, J.C. (1992) Proc. Nati Acad. Sci. USA 89, 2624-2628.

Koncz, C, Schell, J. (1986) The promoter of TL-DNA gene 5 controls the tissue-specific expression of chimeric genes carried out by a novel type of Agrobacterium binary vector. Mol. Gen. Genet. 204, 383-396.

Matzke, M., Matzke, A.J.M. (1995) How and why do plants inactivate homologous (Trans) genes? Plant Physiol. 107, 679-685.

Miquel, M. Browse, J. (1992) Arabidopsis mutants deficient in polyunsaturated fatty acid synthesis. J. Biol. Chem. 267, 1502-1509.

Murray, M.G., Thompson, W.F. (1980) Rapid isolation of high molecular weight plant DNA. Nucí Acid Res. 8, 4321-4325.

Okuley, J., Lightner, J., Feldman, K., Yadav, N., Lark, E., Browse, J. (1994) Arabidopsis FAD2 gene * encodes the enzyme; hat is essential for polyunsaturated iipid. Plant Cell 6, 147-158.

Sambrook, J., Fritsch, E.F., and Maniatis, T., 5 Molecular Cloning: a fabora tory Manual, 2nd ecl., Cold Spring Harbor Laboratory Press, 1989.

Shanklin, J., Whittle, E., Fox, B.G. (1994) Eight histidine residues are catalytically essential in a 10 membrane-associated iron enzyme, stearoyl-CoA desaturase, and are conserved in alkane hydroxylase and xylene monoxygenase. Biochemistry 33, 12787-12794.

Smith, C.R., Jr. (1985) Unusual seed oils and their 15 fatty acids, in Fatty Acids, Pryde E.H., Ed., American Oil Chemists' Society, Champaign, Second edition, pp. 29-47.

Topfer, R., Martini, N., Schell, J. (1995) 20 Modification of plant lipid synthesis. Science 268, 681-686. van de Loo, F.J., Fox, B.G., Somerville, C. (1993) Unusual fatty acids, in Lipid Metabolis in Plants, 25 T.S. Moore Jr. , Ed., CRC Press, Boca Raton, pp 91-126. van de Loo, F.N., Turner, S., Somerville, C.R. (1995, An Léate 12-nydroxylase fro * castor (Rlclnus co ^ unls L. l ls fatty aoyl desaturase no olog. Proc.

Nati Acad -. cS ^ cii. TUTbAA 9y2¿ ,, 6743-6747. ".. r (1985) Signal sequences. J. Mol. Biol. Von Hei ne, G. 1 ^ 0D '° and 194, 99-105.

LIST OF SEQUENCES (1) GENERAL INFORMATION (i) APPLICANT: Somerville, Chris Broun, Pierre Van de Loo, Frank Boddupalli, Sekhar S. (ii) TITLE OF THE INVENTION: Production of Hydroxylated Fatty Acids in Genetically Modified Plants (iii) SEQUENCE NUMBER: 15 (iv) CORRESPONDENCE ADDRESS: (A) RECIPIENT: PILLSBURY MADISON & SUTRO (B) STREET: 1100 NEW YORK AVENUE, N.W. (C) CITY: WASHINGTON (D) STATE: D.C. (E) COUNTRY: USA (F) POSTAL CODE: 20005-3918 (v) COMPUTER LEGIBLE FORM: (A) TYPE OF MEDIA: Flexible disk (B) COMPUTER: compatible with IBM PC (C) OPERATING SYSTEM: DOS 5.0 (D) PROGRAM: Word Perfect 5.1 (vi) DATA OF THE CURRENT APPLICATION: (A) APPLICATION NUMBER: has not been assigned (B) DATE OF SUBMISSION: February 6, 1997 (C) CLASSIFICATION: ) INFORMATION FOR SEQ ID NO: l: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 543 nucleotides (B) TYPE: nucleotide (C) TYPE OF HEBRA: simple D) TOPOLOGY: linearPTION FOR SEQ. ID No: 1: TATTGGCACC GGCGGCACCÁ TTCCAACAAT GGATCCCTAG_40_AAAAAGATGA AGTCTTTGTC CCACCTAAGA AAGCTGCAGT 80 CANATGGTAT GTCAAATACC TCAACAACCC TCTTGGACGC 120 ATTCTGGTGT TAACAGTTCA GTTTATCCTC GGGTGGCCTT 160 TGTATCTAGC CTTTAATGTA TCAGGTAGAC CTTATGATGG 200 TTTCGCTTCA CATTTCTTCC CTCATGCACC TATCTTTAAG 240 GACCGTGAAC GTCTCCAGAT ATACATCTCA GATGCTGGTA 2 80 TTCTAGCTGT CTGTTATGGT CTTTACCGTT ACGCTGCTTC 320 ACAAGGATTG ACTGCTATGA TCTGCGTCTA CGGAGTACCG 3 60 CTTTTGATAG TGAACTTTTT CCTTGTCTTG GTCACTTTCT 400 TGCAGCACAC TCATCCTTCA TTACCTCACT ATGATTCAAC 440 CGAGTGGGAA TGGATTAGAG GAGCTTTGGT TACGGTAGAC 480 AGAGACTATG GAATCTTGAA CAAGGTGTTT CACAACATAA 520 CAGACACCCA CGTAGCACAC CAC. 543 (2) INFORMATION FOR SEQ ID NO: 2: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 544 nucleotides s (B) TYPE: nucleotide (C) TYPE OF HEBRA: simple (D) TOPOLOGY: linear (xi) DESCRIPTION FOR THE SEQUENCE: SEQ. ID No: 2: TATAGGCACC GGAGGCACCA TTCCAACACA GGATCCCTCG 40 AAAGAGATGA AGTATTTGTC CCAAAGCAGA AATCCGCAAT BO CAAGTGGTAC GGCGAATACC TCAACAACCC TCCTGGTCGC 120 ATCATGATGT TAACTGTCCA GTTCGTCCTC GGATGGCCCT 160 TGTACTTAGC CTTCAACGTT TCTGGCAGAC CCTACAATGG 200 TTTCGCTTCC CATTTCTTCC CCAATGCTCC TATCTACAAC 240 GACCGTGAAC GCCTCCAGAT TTACATCTCT GATGCTGGTA 280 TTCTAGCCGT CTGTTATGGT CTTTACCGTT ACGCTGTTGC 320 ACAAGGACTA GCCTCAATGA TCTGTCTAAA CGGAGTTCCG 360 CTTCTGATAG TTAACTTTTT CCTCGTCTTG ATCACTTACT 400 TACAACACAC TCACCCTGCG TTGCCTCACT ATGATTCATC 440 AGAGTGGGAT TGGCTTAGAG GAGCTTTAGC TACTGTAGAC 48 0 AGAGACTATG GAATCTTGAA CAAGGTGTTC CATAACATCA 520 CAGACACCCA CGTCGCACAC CACT 544 (2) INFORMATION FOR SEQ ID NO: 3: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 1855 nucleotides (B) TYPE: nucleotide (C) TYPE OF HEBRA: simple (D) TOPOLOGY: linear (xi) DESCRIPTION FOR THE SEQUENCE: SEQ. ID No: 3: ATGAAGCTTT ATAAGAAGTT AGTTTTCTCT GGTGACAGAG 40 AAATT TGTC AATTGGTAGT GACAGTTGAA GCAACAGGAA 80 CAACAAGGAT GGTTGGTGNT GATGCTGATG TGGTGATGTG 120 TTATTCATCA AATACTAAAT ACTACATTAC TTGTTGCTGC 160 CTACTTCTCC TATTTCCTCC GCCACCCATT TTGGACCCAC 200 GANCCTTCCA TTTAAACCCT CTCTCGTGCT ATTCACCAGA 240 AGAGAAGCCA AGAGAGAGAG AGAGAGAATG TTCTGAGGAT 280 CATTGTCTTC TTCATCGTTA TTAACGTAAG TTTTTTTTGA 320 CCACTCATAT CTAAAATCTA GTACATGCAA TAGATTAATG 360 ACTGTTCCTT CTTTTGATAT TTTCAGCTTC TTGAATTCAA 400 GATGGGTGCT GGTGGAAGAA TAATGGTTAC CCCCTCTTCC 440 AAGAAATCAG AAACTGAAGC CCTAAAACGT GGACCATGTG 480 AGAAACCACC ATTCACTGTT AAAGATCTGA AGAAAGCAAT 520 CCCACAGCAT TGTTTCAAGC GCTCTATCCC TCGTTCTTTC 560 TCCTACCTTC TCACAGATAT CACTTTAGTT TCTTGCTTCT 600 ACTACGTTGC CACAAATTAC TTCTCTCTTC TTCCTCAGCC 640 TCTCTCTACT TACCTAGCTT GGCCTCTCTA TTGGGTATGT 680 CAAGGCTGTG TCTTAACCGG TATCTGGGTC ATTGGCCATG 72C AATGTGGTCA CCATGCATTC AGTGACTATC AATGGGTAGA 760 TGACACTGTT GGTTTTATCT TCCATTCCTT CCTtCTCGTC 800 CCTTACTTCT CCTGGAAATA CAGTCATCGT CGTCACCATT 840 CCAACAATGG ATCTCTCGAG AAAGATGAAG TCTTTGTCCC 880 ACCGAAGAAA GCTGCAGTCA AATGGTATGT TAAATACCTC 920 AACAACCCTC TTGGACGCAT TCTGGTGTTA ACAGTTCAGT 960 TTATCCTCGG GTGGCCTTTG TATCTAGCCT TTAATGTATC 100O AGGTAGACCT TATGATGGTT TCGCTTCACA TTTCTTCCCT 1040 CATGCACCTA TCTTTAAAGA CCGAGAACGC CTCCAGATAT 1080 ACATCTCAGA TGCTGGTATT CTAGCTGTCT GTTATGGTCT 1120 TTACCGTTAC GCTGCTTCAC AAGGATTGAC TGCTATGATC 1160 TGCGTCTATG GAGTACCGCT TTTGATAGTG AACTTTTTCC 1200 TTGTCTTGGT AACTTTCTTG CAGCACACTC ATCCTTCGTT 1240 ACCTCATTAT GATTCAACCG AGTGGGAATG GATTAGAGGA 1280 GCTTTGGTTA CGGTAGACAG AGACTATGGA ATATTGAACA 1320 AGGTGTTCCA TAACATAACA GACACACATG TGGCTCATCA 1360 TCTCTTTGCA ACTATACCGC ATTATAACGC AATGGAAGCT 1400 ACAGAGGCGA TAAAGCCAAT ACTTGGTsAT TACTACCACT 1440 TCGATGGAAC ACCGTGGTAT GTGGCCATGT ATAGGGAAGC 1480 AAAGGAGTGT CTCTATGtAG AACCGGATAC GGAACGTGGG 1520 AAGAAAGGTG TCTACTATTA CAACAATAAG TTATGAGGCt 1560 GATAGGGCGA GAGAAGTGCA ATTATCAATC TTCATTTCCA 1600 TGTTTTAGGT GTCTTGTTTA AGAAGCTATG CTTTGTTTCA 16 0 ATAATCTCAG AGTCCATNTA GTTGTGTTCT GGTGCATTTT 1680 GCCTAGTTAT GTGGTGTCGG AAGTTAGTGT TCAAACTGCT 1720CTGCCCAGTG AAGAACAAGT TTACGTGTTT 1760 AAAATACTCG GAACGAATTG ACCACAANAT ATCCAAAACC 1800 GGCTATCCGA ATTCCATATC CGAAAACCGG ATATCCAAAT 1840 TTCCAGAGTA CTTAG_1855_) INFORMATION FOR SEQ ID NO: 4: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 384 amino acids (B) TYPE: amino acid (C) TYPE OF HEBRA: (D) TOPOLOGY: linear (xi) DESCRIPTION FOR THE SEQUENCE: SEQ. ID No: 4: Met Gly Ala Gly Gly Arg He Met Val Thr 5 10 Pro Ser Ser Lys Lys Ser Glu Thr Glu Wing 15 20 Leu Lys Arg Gly Pro Cys Glu Lys Pro Pro 25 30 Phe Thr Val Lys Asp Leu Lys Lys Wing He 35 40 Pro Gln His Cys Phe Lys Arg Ser He Pro 45 50 Arg Ser Phe Ser Tyr Leu Leu Thr Asp He 55 60 Thr Leu Val Ser Cys Phe Tyr Tyr Val Wing 65 70 Thr Asn Tyr Phe Ser Leu Leu Pro Gln Pro 75 80 Leu Ser Thr Tyr Leu Wing Trp Pro Leu Tyr 85 90 Trp Val Cys Gln Gly Cys Val Leu Thr Gly 95 100 lie Trp Val lie Gly His Glu Cys Gly His 105 110 H s Wing Phe Ser Asp Tyr Gln Tm Val Asp 115 '120 Asp Thr Val Gly Phe lie Phe His Ser Phe '125 130 Leu Leu Val Pro Tyr Phe Ser Trp Lys Tyr 135 140 Ser His Arg Arg His His Ser Asn Asn Gly 145 150 Ser Leu Glu Lys Asp Glu Val Phe Val Pro 155 160 Pro Lys Lys Ala Wing Val Lys Trp Tyr Val 165 170 Lys Tyr Leu Asn Asn Pro Leu Gly Arg He 175 180 Leu Val Leu Thr Val Gln Phe lie Leu Gly 185 190 Trp Pro Leu Tyr Leu Wing Phe Asn Val Ser 195 200 Gly Arg Pro Tyr Asp Gly Phe Ala Ser His 205 210 Phe Phe Pro His Wing Pro lie Phe Lys Asp 215 220 Arg Glu Arg Leu Gln He Tyr He Ser Asp • 225 230 Ala Gly He Leu Ala Val Cys Tyr Gly Leu 235 240 Tyr Arg Tyr Ala Ala Ser Gln Gly Leu Thr 245 250 Wing Met He Cys Val Tyr Gly Val Pro Leu 255 260 Leu Hem Val Asn Phe Phe Leu Val Leu Val 265 270 Thr Phe Leu Gln His Thr His Pro Ser Leu 275 280 Pro His Tyr Asp Ser Thr Glu Trp Glu Trp 285 290 He Arg Gly Ala Leu Val Thr Val Asp Arg 295 300 Asp Tyr Gly He Leu Asn Lys Val Phe His 305 310 Asn He Thr Asp Thr His Val Wing His His 315 '320 Leu Phe Ala Thr He Pro His Tyr Asn Ala 325 330 • Met Glu the Thr Glu Ala He Lys Pro He 335 340 Leu Gly Asp Tyr Tyr His Phe Asp Gly Thr 345 350 Pro Trp Tyr Val Wing Met Tyr Arg Glu Wing 355 360 Lys Glu Cys Leu Tyr Val Glu Pro Asp Thr 365. 370 Glu Arg Gly Lys Lys Gly Val Tyr Tyr Tyr 375 380 Asn Asn Lys Leu ORMATION FOR SEQ ID NO: 5: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 387 amino acids (B) TYPE: amino acid (C) TYPE OF HEBRA: (D) TOPOLOGY: linear (xi) DESCRIPTION FOR THE SEQUENCE: SEQ. ID No: 5: Met Gly Gly Gly Gly Arg Met Ser Thr Val 5 10 He Thr Ser Asn Asn Ser Glu Lys Lys Gly 15 20 Gly Ser Ser His Leu Lys Arg Ala Pro His 25 30 Thr Lys Pro Pro Phe Thr Leu Gly Asp Leu 35 40 Lys Arg Ala He Pro Pro His Cys Phe Glu 45 50 Arg Ser Phe Val Arg Ser Phe Ser Tyr Val 55 60 Wing Tyr Asp Val Cys Leu Ser Phe Leu Phe 65 70 Tyr Ser He Wing Thr Asn Phe Phe Pro Tyr 75 80 I Ser Ser Pro Leu Ser Tyr Val Ala Trp 85 90 Leu Val Tyr Trp Leu Phe Gln Gly Cys He 95 100 Leu Thr Gly Leu Trp Val He Gly His Glu 105 110 Cys Gly His His Wing Phe Ser Glu Tyr Gln 115 120 Leu Ala Asp Asp He Val Gly Leu He Val 125 130 His Ser Ala Leu Leu Val Pro Tyr Phe Ser 135 140 Trp Lys Tyr Ser His Arg Arg His His Ser 145 150 Asn He Gly Ser Leu Glu Arg Asp Glu Val 155 160 Phe Val Pro Lys Ser Lys Ser Lys He Ser 165 170 Trp Tyr Ser Lys Tyr Ser Asn Asn Pro Pro 175 180 Gly Arg Val Leu Thr Leu Ala Wing Thr Leu 185 190 Leu Leu Gly Trp Pro Leu Tyr Leu Wing Phe 195 200 Asn Val Ser Gly Arg Pro Tyr Asp Arg Phe 205 210 Ala Cys His Tyr Asp Pro Tyr Gly Pro He 215 220 Phe Ser alu Arg Glu Arg Leu Gln He Tyr 225 230 He Wing Asp Leu Gly He Phe Wing Thr Thr 235 240 Phe Val Leu Tyr Gln Ala Thr Met Ala Lys 245 250 Gly Leu Wing Trp Val Met Arg He Tyr Gly 255 260 Val Pro Leu Leu He Val Asn Cys Phe Leu 265 270 Val Met He Thr Tyr Leu Gln His Thr His 275 280 Pro Ala He Pro Arg Tyr Gly Ser Ser Glu 285 290 Trp Asp Trp Leu Arg Gly Wing Met Val Thr 295 300 Val Asp Arg Asp Tyr Gly Val Leu Asn Lys 305 310 Val Phe His Asn He Wing Asp Thr His Val 315 320 Ala His His Leu Phe Ala Thr Val Pro His 325 330 Tyr His Wing Met Glu Wing Thr Ly9 Wing He 335 335 Lys Pro He Met Gly Glu Tyr Tyr Arg Tyr 345 350 A = p Gly Thr Pro Phe T / r Lys Ala Leu Trp 355 360 Arg Glu Ala Lys Glu Cys Leu Phe Val Glu 365 370 Pro Asp Glu Gly Wing Pro Thr Gln Gly Val 375 380 Phe Trp Tyr Arg Asn Lys Tyr 385 ORMATION FOR SEQ ID NO: 6: i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 383 amino acids (B) TYPE: amino acid (C) TYPE OF HEBRA: (D) TOPOLOGY: linear (xi) DESCRIPTION FOR THE SEQUENCE: SEQ. ID No: 6: Met Gly Wing Gly Gly Arg Met Pro Val Pro 5 10 Thr Ser Ser Lys Lys Ser Glu Thr Asp Thr 15 20 Thr Lys Arg Val Pro Cys Glu Lys Pro Pro 25 30 Phe Ser Val Gly Asp Leu Lys Lys Ala He 35 40 Pro Pro His Cys Phe Lys Arg Ser He Pro 45 50 Arg Ser Phe Ser Tyr Leu He Ser Asp He 55 60 He He Wing Being Cys Phe Tyr Tyr Val Wing 65 70 Thr Asn Tyr Phe Ser Leu Leu Pro Gln Pro 75 80 Leu Ser Tyr Leu Wing Trp Pro Leu Tyr Trp 85 90 Ala Cys Gln Gly Cys Val Leu Thr Gly He 95 100 Trp Val He Ala His Glu Cys Gly His His 105 110 Wing Phe Ser Asp Tyr Gln Trp Leu Asp Asp 115 120 Thr Val Gly Leu He Phe His Ser Phe Leu 125 130 Leu Val Pro Tyr Phe Ser Trp Lys Tyr Ser 135 140 His Arg Arg His His Ser Asn Thr Gly Ser 145 150 Leu Glu Arg Asp Glu Val Phe Val Pro Lys 155 160 Gln Lys Ser Ala He Lys Trp Tyr Gly Lys 165 170 Tyr Leu Asn Asn Pro Leu Gly Arg He Met 175 180 Met Leu Thr Val Gln Phe Val Leu Gly Trp '185 190 Pro Leu Tyr Leu Ala Phe Asn Val Ser Gly 195 200 Arg Pro Tyr Asp Gly Phe Ala Cys His Phe 205 210 Phe Pro Asn Ala Pro He Tyr Asn Asp Arg 215 220 Glu Arg Leu Gln He Tyr Leu Ser Asp Ala 225 230 Gly He Leu Wing Val Cys Phe Gly Leu Tyr 235 240 Arg Tyr Ala Ala Ala Gln Gly Met Ala Ser 245 250 Met He Cys Leu Tyr Gly Val Pro Leu Leu 255 260 He Val Asn Ala Phe Leu Val Leu He Thr 265 270 Tyr Leu Gln His Thr His Pro Ser Leu Pro 275 280 His Tyr Asp Ser Ser Glu Trp Asp Trp Leu 285 290 Arg Gly Wing Leu Wing Thr Val Asp Arg Asp 295 300 Tyr Gly He Leu Asn Lys Val Phe His Asn 305 310 He Thr Asp Thr His Val Ala His His Leu 315 320 Phe Ser Thr Met Pro His Tyr Asn Ala Met 325 330 Glu Ala Thr Lys Ala He Lys Pro He Leu 335 340 Gly Asp Tyr Tyr Gln Phe Asp Gly thr Pro 345 350 Trp Tyr Val Ala Met Tyr Arg Glu Ala Lys 355 360 Glu Cys He Tyr Val Glu Pro Asp Arg Glu 365 370 Gly Asp Lys Lys Gly Val Tyr Trp Tyr Asn 375 380 Asn Lys Leu 2) INFORMATION FOR SEQ ID NO: 7: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 384 amino acids (B) TYPE: amino acid (C) TYPE OF HEBRA: 10 (D) TOPOLOGY: linear (xi) DESCRIPTION FOR THE SEQUENCE: SEQ. ID No: 7 Met Gly Wing Gly Gly Arg Met.Gln Val Ser 5 10 Pro Pro Ser Lys Lys Ser Glu Thr Asp Asn 15 20 He Lys Arg Val Pro Cys Glu Thr Pro Pro 25 30 Phe Thr Val Gly Glu Leu Lys Lys Ala He 35 40 Pro Pro His Cys Phe Lys Arg Ser He Pro 45 50 Arg Ser Phe Ser His Leu He Trp Asp He 55 60 He He Wing Being Cys Phe Tyr Tyr Val Wing 65 70 Thr Thr Tyr Phe Pro Leu Leu Pro Asn Pro 75: 80 Leu Ser Tyr Phe Wing Trp Pro Leu Tyr Trp 85 90 Ala Cys Gln Gly Cys Val Leu Thr Gly Val 95 100 Trp Val He Ala His Glu Cys Gly His Ala 105 110 Wing Phe Ser Asp Tyr Gln Trp Leu Asp Asp 115 120 Thr Val Gly Leu He Phe His Ser Phe Leu 125 130 Leu Val Pro Tyr Phe Ser Trp Lys Tyr Ser 135 140 His Arg Arg His His Ser Asn Thr Gly Ser 145 150 Leu Glu Arg Asp Glu Val Phe Val Pro Arg 155 160 Arg Ser Gln Thr Ser Ser Gly Thr Ala Ser 165 170 Thr Ser Thr Thr Phe Gly Arg Thr Val Met 175 180 Leu Thr Val aln Phe Thr Leu Gly Trp Pro 185 190 Leu Tyr Leu Ala Phe Asn Val Ser Gly Arg 195 200 Pro Tyr Asp Gly Gly Phe Ala Cys His Phe 205 210 His Pro Asn Ala Pro He Tyr Asn ASD Arg 215"220 Glu Arg Leu Gln He Tyr He Ser Asp Ala 225 230 Gly He Leu Wing Val Cys Tyr Gly Leu Leu 235 240 Pro Tyr Ala Ala Val Gln Gly Val Ala. Ser 245 'S0 Met Val Cys Phe Leu Arg Val Pro Leu Leu • 255 260 lie Val Asn Gly Phe Leu Val Leu He T r 265 270 Tyr Leu Gln His thr His Pro Ser Leu Pro 275 230 His Tyr Asp Being Ser Glu Trp Asp Trp Leu 285 290 Arg Gly Ala Leu Ala Thr Val Asp Arg Asp 295 300 Tyr Gly He Leu Asn Gln Gly Phe His Asn 305 310 He Thr Asp Thr His Glu Wing His His Leu 315 320 Phe Ser Thr Met Pro His Tyr His Ala Met 325 330 Glu Ala Thr Lys Ala He Lys Pro lie Leu 335 340 Gly Glu Tyr Tyr Gln Phe Asp Gly Thr Pro 345 350 Val Val Lys Ala Met Trp Arg Glu Ala Lys 355 360 Glu Cys He Tyr Val slu Pro Asp Arg Gln 365 370 Gly Glu Lys Lys Gly Val Phe Trp Tyr Asn 375 380 Asn Lys Leu Xaa ORMATION FOR SEQ ID NO: 8: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 390 amino acids (B) TYPE: amino acid (C) TYPE OF HEBRA: (D) TOPOLOGY: linear (xi) DESCRIPTION FOR THE SEQUENCE: SEQ. ID No: 8 * * Being Leu Leu Thr Being Phe Being Tyr Val Val 5 10 Tyr Asp Leu Being Phe Wing Phe He Phe Tyr 15 20 He Wing Thr Thr Tyr Phe His Leu Leu Pro 25 30 Gln Pro Phe Ser Leu He Wing Trp Pro He 35 40 Tyr Trp Val Leu Gln Gly Cys Leu Leu Thr 45 50 Arg Val Cys Gly His His Wing Phe Ser Lys 55 60 Tyr Gln Trp Val Asp Asp Val Val Gly Leu 65 70 Thr Leu His Ser Thr Leu Leu Val Pro Tyr 75 80 Phe Ser Trp Lys He Ser His Arg Arg His 85 90 His Ser Asn Thr Gly Ser Leu Asp Arg Asp 95 100 Glu Arg Val Lys Val Wing Trp Phe Ser Lys 105 110 Tvr Leu Asn Asn Pro Leu Gly Arg Wing Val 115 120 * * Be Leu Leu Val Thr Leu Thr He Gly Trp 125 130 Pro Met Tyr Leu Wing Phe Asn Val Ser Gly 135 1 0 Arg Pro Tyr Asp Ser Phe Wing Ser His Tyr '145 iso His Pro Tyr Arg Val Arg Leu Lßu He Tyr 155 160 Val Ser Asp Val Ala Leu Phe Ser Val Thr 165 170 Tyr Ser Leu Tyr Arg Val Wing Thr Leu Lys 175 180 Gly Leu Val Trp Leu Leu Cys Val Tyr Gly 185 190 Val Pro Leu Leu He Val Asn Gly Phe Leu 195 200 Val Thr He Thr Tyr Leu Arg Val His Tyr 205 210 Asp Ser Ser Glu Trp Asp Trp Leu Lys Gly 215 220 Wing Leu Wing Thr Met Asp Arg Asp Tyr Gly 225 230 He Leu Asn Lys Val Phe His His He Thr 235 240 Asp Thr His Val Wing His His Leu Phe Ser 245 250 Thr Met Pro His Tyr His Leu Arg Val Lys 255 260 Pro He Leu Gly Glu Tyr Tyr Gln Phe Asp 265 270 Asp Thr Pro Phe Tyr Lys Ala Leu Trp Arg 275 280 Glu Ala Arg Glu Cys Leu Tyr Val Glu Pro 285 290 Asp Glu Gly Thr Ser Glu Lys Gly Val Tyr 295 300 Trp Tyr Arg Asn Lys Tyr Leu Arg Val 305 ORMATION FOR SEQ ID NO: 9: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 302 amino acids (B) TYPE: amino acid (C) TYPE OF HEBRA: (D) TOPOLOGY: linear (xi) DESCRIPTION FOR THE SEQUENCE: SEQ. ID No: 9: Phe Ser Tyr Val. Val Tyr Asp Leu Thr He 5 10 Wing Phe Cys Leu Tyr Tyr Val Wing Thr His 15 20 Tyr Phe His Leu Leu Pro Gly Pro Leu Ser 25 30 Phe Arg Gly Met Wing He Tyr Trp Wing Val 35 40 Gln Gly Cys He Leu Thr Gly Val Trp Val 45 50 Val Ala Phe Ser Asp Tyr aln Leu Leu Asp 55 60 Asp He Val Gly Leu He Leu His Ser Wing 65 70 Leu Leu Val Pro Tyr Phe Ser Trp Lys Tyr 75 80 Ser His Arg Arg His His Ser Asn Thr Gly 85 90 Ser Leu Glu Arg Asp Glu Val Phe Val Pro 95 100 Lys Val Ser Lys Tyr Leu Asn Asn Pro Pro IOS 110 Gly Arg Val Leu Thr Leu Wing Val Thr Leu 115 120 Thr Leu Gly Trp Pro Leu Tyr Leu Ala Leu 125 130 Asn Val Ser Gly Arg Pro Tyr Asp Arg Phe 135 140 Ala Cys His Tyr Asp Pro Tyr Gly Pro He 145 150 Tvr Ser Val He Ser Asp Wing Gly Val Leu 155 ISO Wing Val Val Tyr Gly Leu Phe Arg Leu Wing 165 170 Met Ala Lys Gly Leu Ala Trp Val Val Cys • 175 13 ° Val Tvr Gly Val Pro Leu Leu Val Val Asn Glv Phe Leu Val Leu He Thr Phe Leu Gln 1 3_95 200 His Thr His Val Ser Glu Trp Asp Trp Leu 205 210 Arg Gly Ala Leu Ala Thr Val Asp Arg Asp 215 220 Tyr Gly He Leu Asn Lys Val Phe His sn 1 22S 230 He Thr Asp thr His Val Wing His His L u 235 240 Phe Ser thr Met Pro His Tyr His Ala Met 245 25 ° Glu Ala Thr Val Glu Tyr Tyr Arg Phe Asp 255 260 Glu Thr Pro Phe Val Lys Wing Met Trp Arg 265 2 / u Glu Ala Arg Glu Cys He Tyr Val Glu Pro Asp Gin Ser thr Glu Ser Lys Gly Val Phe 285 Trp Tyr Asn Asn Lys Leu Wing Met Glu Wing 295 300 Thr Val ORMATION FOR SEQ ID NO: 10: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 372 amino acids (B) TYPE: amino acid (C) TYPE OF HEBRA: (D) TOPOLOGY: linear (xi) DESCRIPTION FOR THE SEQUENCE: SEQ. ID No: 10 Met Gly Wing Gly Gly Arg Met Thr Glu Lys 5 10 Glu Arg Glu Lys Gln Glu Gln Leu Arg Wing 15 20 Wing Thr Gly Gly Wing Wing Met Gln Arg Ser 25 30 Pro Val Glu Lys Pro Pro Phe Thr Leu Gly 35 40.

Gln He Lys Lys Wing Pro Pro His Cys 45 50 Phe Glu Arg Ser Val Leu Lys Ser Phe Ser 55 60 Tyr Val Val His Asp Leu Val He Wing Wing 65 70 Ala Leu Leu Tyr Phe Ala Leu Ala He He 75 80 Pro Ala Leu Pro Ser Pro Leu Arg Tyr Ala 85 90 Wing Trp Pro Leu Tyr Trp He Wing Gln Gly 95 100 Wing Phe Ser Asp Tyr Ser Leu Leu Asp Asp 105 110 Val Val Gly Leu Val Leu His Ser Ser Leu 115 120 Met Val Pro Tyr Phe Ser Trp Lys Tyr Ser 125 130 His Arg Arg His His Ser Asn Thr Gly Ser 135 140 Leu Glu Arg Asp Glu Val Phe Val Pro Lys 145 150 Lys Lys Glu Ala Leu Pro Trp Tyr Thr Pro 155 160 Tyr Val Tyr Asn Asn Pro Val Gly Arg.Val 165 170 Val His He Val Val Gln Leu Thr Leu Gly .175 180 Trp Pro Leu Tyr Leu Wing Thr Asn Wing Ser 185 190 Gly Arg Pro Tyr Pro Arg Phe Ala Cys His 195 200 Phe Asp Pro Tyr Gly Pro He Tyr Asn Asp 205 210 Arg Glu Arg Ala Gln He Phe Val Ser Asp 215 220 Wing Gly Val Val Wing Val Wing Phe Gly Leu 225 230 Tyr Lys Leu Wing Wing Wing Phe Gly Val Trp 235 240 Trp Val Val Arg Val Tyr Ala Val Pro Leu 245 250 Leu He Val Asn Ala Trp Leu Val Leu He 255 260 Thr Tyr Leu Gln His Thr His Pro Ser Leu 265 270 Pro His Tyr Asp Ser Ser Glu Trp Asp Trp 275 280 Leu Arg Gly Ala Leu Ala Thr Met A3p Arg 285 290 Asp Tyr Gly He Leu Asn Arg Val Phe His 295 300 A = n He Thr Asp Thr His Val Wing His His 305 310 Leu Phe Ser thr Met Pro Hís Tyr His Ala 315 320 Met Glu Wing Thr Lys Wing He Arg Pro He 325 330 Leu Gly Asp Tyr Tyr His Phe Asp Pro Thr 335 340 Pro Val Wing Lys Wing Thr Trp Arg Glu Wing 345 350 Gly Giu Cys He Tyr Val Glu Pro Glu Asp 355 360 Arg Lys Gly Val Phe Trp Tyr Asn Lys Lys 365 370 Phe Xaa ORMATION FOR SEQ ID NO: 11: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 224 amino acids (B) TYPE: amino acid (C) TYPE OF HEBRA: (D) TOPOLOGY: linear (xi) DESCRIPTION FOR THE SEQUENCE: SEQ. ID No: 11 Trp Val Met Wing His Asp Cys Giy His His 5 10 Wing Phe Ser Asp Tyr Gln Leu Leu Asp Asp 15 20 Val Val Gly Leu He Leu His Ser Cys Leu 25 30 Leu Val Pro Tyr Phe Ser Trp Lys His Ser 35 40 His Arg Arg His His Ser Asn Thr Gly Ser 45 50 Leu Glu Arg Asp Glu Val Phe Val Pro Lys 55 60 Lys Lys Ser Ser He Arg Trp Tyr Ser Lys 65 70 Tyr Leu Asn Asn Pro Pro Gly Arg He Met 75 80 Thr He Ala Val Thr Leu Ser Leu Gly Trp 85 90 Pro Leu Tyr Leu Wing Phe Asn Val Ser: Gly 95 100 Arg Pro Tyr Asp Arg Phe Ala Cys His Tyr 105 no Asp Pro Tyr Gly Pro He Tyr Asn Asp Arg 115 120 Glu Arg He Glu He Phe He Ser Asp Ala 125 130 Gly Val Leu Ala Val Thr Phe Gly Leu Tyr 135 140 Gln Leu Ala He Ala Lys Gly Leu Ala Trp 145 150 Val Val Cys Val Tyr Gly Val Pro Leu. Leu 155 160 Val Val Asn Ser Phß Leu Val Leu He Thr 165 170 Phe Leu Gln His Thr His Pro Ala Leu Pro 175 180 His Tyr Asp Being Ser Glu Trp Asp Trp Leu 185 190 Arg Gly Ala Leu Ala Thr Val Asp Arg Asp 195 200 Tyr Gly He Leu Asn Lys Val Phe His Asn 205 210 He Thr Asp Thr Gln Val Wing His His Leu 215 220 Phe Thr Met Pro 2) INFORMATION FOR SEQ ID NO: 12: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 20 nucleotides (B) TYPE: nucleotide (C) ) TYPE OF HEBRA: simple (D) TOPOLOGY: linear (xi) DESCRIPTION FOR THE SEQUENCE: SEQ. ID No: 12 GCTCTTTTGT GCGCTCATTC 20 2) INFORMATION FOR SEQ ID NO: 13: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 20 nucleotides (B) TYPE: nucleotide (C) 'TYPE OF HEBRA: simple (D) TOPOLOGY: linear (xi) DESCRIPTION FOR THE SEQUENCE: SEQ. ID No: 13: CGGTACCAGA AAACGCCTTG 20 2) INFORMATION FOR SEQ ID NO: 14: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 20 nucleotides (B) TYPE: nucleotide (C) TYPE OF HEBRA: simple (D) TOPOLOGY: linear (xi) DESCRIPTION FOR THE SEQUENCE: SEQ. ID No: 14: TAYWSNCAYM GNMGNCAYCA 20 2) INFORMATION FOR SEQ ID NO: 15: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 21 nucleotides (B) TYPE: nucleotide (C) TYPE OF HEBRA: simple (D). TOPOLOGY: linear (xi) DESCRIPTION FOR THE SEQUENCE: SEQ. ID No: 15: RTGRTGNGCN ACRRTGNGTRT C 21 It is noted that in relation to this date, the best method known by the applicant to carry out the present invention is that which is clear from the present description of the invention.

Having described the invention as above, the content of the following is claimed as property:

Claims (34)

1. A method for altering an amount of an unsaturated fatty acid in a seed of a plant, characterized in that it comprises: decreasing the activity of a fatty acid-desaturase in the seed by genetic manipulation in at least one of the fatty acid-desaturase or fatty acid-hydroxylase.

2. The method according to claim 1, characterized in that an endogenous gene of the fatty acid hydroxylase is mutated and thus decreases the activity of the fatty acid hydroxylase in the seed.

3. The method according to claim 1, characterized in that the plant is transformed with a nucleic acid containing a sequence coding for a fatty acid-hydroxylase or derivative thereof.

4. The method according to claim 3, characterized in that the derivative is a dominant negative mutant which thereby alters the amount of the unsaturated fatty acid in the seed.

5. The method according to claim 3, characterized in that the derivative is a mutant fatty acid-hydroxylase in which one or more essential histidine residues have been mutated, which thereby alters the amount of the saturated fatty acid in the seed .

6. The method according to claim 1, characterized in that an endogenous gene for the fatty acid desaturase is mutated and thereby decreases the activity of the fatty acid-desaturase in the seed.

7. The method according to claim 1, characterized in that the plant is transformed with a nucleic acid containing a sequence coding for a fatty acid-desaturase or derivative thereof.

8. The method according to claim 7, characterized in that the derivative is a dominant negative mutant which thus alters the amount of the unsaturated fatty acid in the seed.

9. The method according to claim 7, characterized in that the derivative is a mutant fatty acid-desaturase in which one or more essential histidine residues have been mutated, thereby altering the amount of the unsaturated fatty acid in the seed.

10. The method according to claim 1, characterized in that the plant is sucked from the group consisting of naba, Cra be, Brassica júncea, cañola, flax, sunflower, safflower, cotton, cuphea, soybean, peanut, coconut, palm oil and corn

11. A method for altering an amount of an unsaturated fatty acid, characterized in that it comprises: (a) transforming a plant cell with a nucleic acid containing a sequence encoding a fatty acid-hydroxylase or a negative, dominant mutant of the acid -hydroxylase-fat or a negative, dominant mutant of the fatty acid-desaturase. (b) cultivate a plant that has seeds from the transformed plant cell of step (a), and (c) identifying a seed of the plant of step (b) with the altered amount of unsaturated fatty acid and seed.

12. The method according to claim 11, characterized in that the nucleic acid contains a sequence coding for the negative, dominant mutant of the fatty acid-hydroxylase in which one or more essential histidine residues have been mutated.

13. The method according to claim 11, characterized in that the nucleic acid contains a sequence coding for the dominant negative of the fatty acid-hydroxylase which thus alters the amount of the unsaturated fatty acid in the seed.

14. The method according to claim 11, characterized in that the nucleic acid contains a sequence coding for the negative, dominant mutant of the fatty acid-desaturase in which one or more essential histidine residues has been mutated.

15. The method according to claim 11, characterized in that the nucleic acid contains a sequence coding for the negative, dominant mutant of the fatty acid-desaturase which thereby alters the amount of the unsaturated fatty acid in the seed.

16. The method according to claim 11, characterized in that the plant is selected from the group consisting of naba, Cra be, Brassica júncea, cañola, flax, sunflower, safflower, cotton, cuphea, soybean, peanut, coconut, palm oil and corn

17. A recombinant nucleic acid according to the use of claim 1, characterized in that the nucleic acid contains a sequence coding for a fatty acid-hydroxylase with an amino acid entity of 60% greater than SEQ ID NO: 4.

18. The recombinant nucleic acid according to claim 17, characterized in that the amino acid identity is 90% or greater than SEQ ID NO: 4.

19. The recombinant nucleic acid according to claim 17, characterized in that the amino acid identity is 100% of SEQ ID NO: 4.

20. The recombinant nucleic acid according to claim 17, characterized in that the nucleic acid contains a sequence having a nucleotide identity of 90% greater than SEQ ID NO: 1, 2 or 3.

21. The reccmbinant nucleic acid according to claim 17, characterized in that the nucleic acid contains SEQ ID NO: 1, 2 or 3.

22. The recombinant nucleic acid according to claim 17, characterized in that the sequence can be obtained from a plant sequence that produces a hydroxylated fatty acid.

23. A recombinant nucleic acid according to the use in claim 1, characterized in that the nucleic acid contains a sequence coding for at least one fatty acid-desaturase or a fatty acid-hydroxylase.

24. The recombinant nucleic acid according to claim 23, characterized in that the sequence can be obtained from Ricinus communis (L.) (castor).

25. The recombinant nucleic acid according to claim 23, characterized in that the sequence can be obtained from Lesquerella fendleri.

26. The recombinant nucleic acid according to claim 23, characterized in that the nucleic acid contains a sequence that * codes for at least one of fatty acid-desaturase or fatty acid-hydroxylase in which one or more histidine residues have been mutated essentials

27. The method according to claim 1, characterized in that it further comprises: processing the seed containing the altered amount of unsaturated fatty acid to obtain the oil and / or seed feed.

28. The oil characterized in that it can be obtained by the method of claim 27.

29. The seed food characterized in that it is obtained by the method of claim 27.

30. The plant characterized in that it is obtained by the method of claim 1.

31. The method according to claim 11, characterized in that it further comprises: processing the seed containing the altered amount of unsaturated fatty acid to obtain oil and / or seed feed.

32. The oil characterized in that it obtains per the method of claim 31.

33. The seed food, characterized in that it is obtained by the method of claim 31.

34. The plant characterized in that it is obtained by the method of claim 11.