EP1066404A1 - Methodes de production de banques de sequences de genes exprimables - Google Patents

Methodes de production de banques de sequences de genes exprimables

Info

Publication number
EP1066404A1
EP1066404A1 EP99917335A EP99917335A EP1066404A1 EP 1066404 A1 EP1066404 A1 EP 1066404A1 EP 99917335 A EP99917335 A EP 99917335A EP 99917335 A EP99917335 A EP 99917335A EP 1066404 A1 EP1066404 A1 EP 1066404A1
Authority
EP
European Patent Office
Prior art keywords
protein
mrna
human
hypothetical
hypothetical protein
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP99917335A
Other languages
German (de)
English (en)
Other versions
EP1066404A4 (fr
Inventor
Joseph Manuel Fernandez
John Alastair Heyman
James Paul Hoeffler
Heather Lynn Marks-Hull
Michelle Lynn Sindici
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Life Technologies Corp
Original Assignee
Invitrogen Corp
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Invitrogen Corp filed Critical Invitrogen Corp
Publication of EP1066404A1 publication Critical patent/EP1066404A1/fr
Publication of EP1066404A4 publication Critical patent/EP1066404A4/fr
Withdrawn legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/1034—Isolating an individual clone by screening libraries
    • C12N15/1086—Preparation or screening of expression libraries, e.g. reporter assays
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids

Definitions

  • the invention disclosed herein relates to the fields of genomics and molecular biology. More specifically the invention relates to new high through-put methods of making libraries of expressed gene sequences and the libraries made using said methods.
  • the present invention comprises a method for producing libraries of expressible gene sequences.
  • the method of the invention allows for the simultaneous manipulation of multiple gene sequences and thus allows libraries to be created in an efficient and high through-put manner.
  • the expression vectors containing verified gene sequences can be used to transfect cells for the production of recombinant proteins.
  • the invention method utilizes known techniques in such a way as to create an efficient high through-put means of producing libraries of expressible gene sequences.
  • the invention further comprises libraries of expressible gene sequences produced using the method of the invention and expression vectors used in the construction of such libraries.
  • Figure 1 shows a schematic representation of the vaccinia topoisomerase type I cloning method used in the practice of the invention.
  • the present invention comprises a method for producing libraries of expressible gene sequences.
  • the invention method comprises the following steps: amplifying a plurality of gene sequences, purifying the amplified gene sequences, inserting each of the purified gene sequences into an expression vector, and verifying the size and orientation of the inserted gene sequence.
  • the gene sequences that are to be expressed are amplified.
  • amplification it is meant that the copy number of the gene sequence(s) is increased.
  • One commonly used method of amplification is the polymerase chain reaction (PCR).
  • PCR polymerase chain reaction
  • starter DNA is heat-denatured into single strands.
  • Two synthetic oligonucleotides, one complementary to sequence at the 3' end of the sense strand of DNA segment of interest and the other complementary to the sequence at the 3' end of the anti-sense strand of a DNA segment of interest, are added in great excess to the DNA sequence to be amplified and the temperature is lowered to 50 - 60° C.
  • the specific oligonucleotides hybridize with the complementary sequences in the DNA and then serve as primers of DNA chain synthesis, which requires the addition of a supply of deoxynucleotides and a temperature-resistant DNA polymerase, such as Taq polymerase, which can extend the primers at temperatures up to 72° C.
  • a temperature-resistant DNA polymerase such as Taq polymerase
  • the whole mixture is heated further (up to 95° C) to melt the newly formed DNA duplexes.
  • the temperature is lowered again, another round of synthesis takes place, since an excess of primer is still present. Repeated cycles of synthesis and melting quickly amplify the sequence of interest.
  • a more detailed description of PCR can be found in Erlich, Ed, PCR Technology: Principles and Applications for DNA Amplification, W.H. Freeman and Co., 1992 and Erlich, et al, Eds., Polymerase Chain Reaction, Cold Spring Harbor Laboratory, 1989, both of which are incorporated by reference herein.
  • Starter DNA can come from a variety of sources. It can be total genomic
  • DNA from an organism for example, or can be cDNA that has been synthesized from cellular mRNA using reverse transcriptase.
  • Sources of suitable RNA include normal and diseased tissues, cellular extracts, and the like.
  • the desired gene sequences can come from any source.
  • the examples presented below show the amplification of all open reading frames (ORFs) from a single organism, Saccharomyces cerevisiae, for example.
  • ORFs open reading frames
  • open reading frame it is meant a segment of DNA that exists between a start codon and a stop codon and is likely to represent a gene.
  • the examples presented below further show the amplification of a group of human genes thought to be important in the development of cancer.
  • yeast Sacharomyces cerevisiae
  • prokaryotes Bacillus subtilis, Bacillus subtilis, Bacillus subtilis, and the like
  • fish Fegu rubripes
  • mammals human, mouse
  • plants rice, cotton
  • Well known databases include GenBank, Unigene, EMBL, IMAGE and TIGR, for example.
  • Public databases such as these can be used a source of gene sequences for use in the method of the invention.
  • the primers employed in the amplification step are specific for each desired gene sequence and include a variety of unique features.
  • the 5' "sense" primer starts with the sequence 5' -C ACC ATG... (the start codon is underlined).
  • the CACC sequence is added as a Kozak consensus that aids in translational efficiency.
  • the 3' "antisense" codon is preferably designed to make the amplification product end at the 3rd position of the last codon of the gene being amplified, plus a single adenine residue.
  • the gene sequence need not encode a full-length sequence, however, as the invention methods are equally suitable for any gene sequence, including Expressed Sequence Tags (ESTs).
  • ESTs Expressed Sequence Tags
  • the primers can be synthesized and dried in multiwell formats, such as 96-well microtiter plates to facilitate identification and further processing.
  • the amplified gene products are next isolated from the other components of the amplification reaction mixture.
  • This purification can be accomplished using a variety of methodologies such as column chromatography, gel electrophoresis, and the like.
  • a preferred method of purification utilizes low-melt agarose gel electrophoresis.
  • the reaction mixture is separated and visualized by suitable means, e.g. by ethidium bromide staining.
  • DNA bands that represent correctly sized amplification products are cut away from the rest of the gel and placed into appropriate corresponding wells of a 96-well microtiter plate. These plugs are subsequently melted and the DNA contained therein utilized as cloning inserts.
  • the use of gel electrophoresis has the advantage that the practitioner can purify the desired amplified gene sequence while additionally verifying that the sequence is of the correct size, i.e., represents the entire desired gene sequence.
  • the purified, amplified gene sequences are next inserted into an expression vector.
  • a variety of expression vectors are suitable for use in the method of the invention, both for prokaryotic expression and eukaryotic expression.
  • the expression vector will have one or more of the following features: a promoter- enhancer sequence, a selection marker sequence, an origin of replication, an affinity purification tag sequence, an inducible element sequence, an epitope-tag sequence, and the like.
  • Promoter-enhancer sequences are DNA sequences to which RNA polymerase binds and initiates transcription. The promoter determines the polarity of the transcript by specifying which strand will be transcribed.
  • Bacterial promoters consist of consensus sequences, -35 and -10 nucleotides relative to the transcriptional start, which are bound by a specific sigma factor and RNA polymerase. Eukaryotic promoters are more complex. Most promoters utilized in expression vectors are transcribed by RNA polymerase II.
  • General transcription factors (GTFs) first bind specific sequences near the start and then recruit the binding of RNA polymerase II.
  • AP-1 DNA-binding/trans-activating proteins
  • Viral promoters serve the same function as bacterial or eukaryotic promoters and either provide a specific RNA polymerase in trans (bacteriophage T7) or recruit cellular factors and RNA polymerase (SV40, RSV, CMV). Viral promoters are preferred as they are generally particularly strong promoters.
  • Promoters may be, furthermore, either constitutive or, more preferably, regulatable (i.e., inducible or derepressible).
  • Inducible elements are DNA sequence elements which act in conjunction with promoters and bind either repressors (e.g. lacO/LAC Iq repressor system in E. coli) or inducers (e.g. gall/GAL4 inducer system in yeast). In either case, transcription is virtually “shut off until the promoter is derepressed or induced, at which point transcription is "turned-on".
  • constitutive promoters include the int promoter of bacteriophage ⁇ , the bla promoter of the ⁇ -lactamase gene sequence of pBR322, the CAT promoter of the chloramphenicol acetyl transferase gene sequence of pPR325, and the like.
  • inducible prokaryotic promoters include the major right and left promoters of bacteriophage (P L and P R ), the trp, reca, lacZ, Lad, AraC and gal promoters of E. coli, the ⁇ -amylase (Ulmanen et al, J. Bacteriol. 162:176-182. 1985) and the sigma-28-specific promoters of B.
  • subtilis (Gilman et al, Gene sequence 32:11-20(1984)), the promoters of the bacteriophages of Bacillus (Gryczan, In: The Molecular Biology of the Bacilli, Academic Press, Inc., NY (1982)), Streptomyces promoters (Ward et al, Mol. Gen. Genet. 20J.:468-478, 1986), and the like.
  • prokaryotic promoters are reviewed by Glick (J. Ind. Microbiol. 1:277- 282, 1987); Cenatiempo (Biochimie 68_:505-516, 1986); and Gottesman (Ann. Rev. Genet. 18:415-442, 1984).
  • Preferred eukaryotic promoters include, for example, the promoter of the mouse metallothionein I gene sequence (Hamer et al, J. Mol. Appl. Gen. 1:273-288, 1982); the TK promoter of Herpes virus (McKnight, Cell 11:355-365, 1982); the SV40 early promoter (Benoist et al, Nature (London) 290:304-310, 1981); the yeast gall gene sequence promoter (Johnston et al, Proc. Natl Acad. Sci. (USA) 72:6971-6975, 1982); Silver et al, Proc. Natl. Acad. Sci. (USA) 81:5951-5955, 1984), the CMV promoter, the EF-1 promoter, Ecdysone-responsive promoter(s), and the like.
  • Selection marker sequences are valuable elements in expression vectors as they provide a means to select for growth only those cells which contain a vector.
  • markers are of two types: drug resistance and auxotrophic.
  • a drug resistance marker enables cells to detoxify an exogenously added drug that would otherwise kill the cell.
  • Auxotrophic markers allow cells to synthesize an essential component (usually an amino acid) while grown in media which lacks that essential component.
  • Common selectable marker gene sequences include those for resistance to antibiotics such as ampicillin, tetracycline, kanamycin, streptomycin, bleomycin, hygromycin, neomycin, ZeocinTM, and the like.
  • Selectable auxotrophic gene sequences include, for example, hisD, which allows growth in histidine free media in the presence of histidinol.
  • a preferred selectable marker sequence for use in yeast expression systems is URA3.
  • Laboratory yeast strains carrying mutations in the gene which encodes orotidine-5' -phosphate decarboxylase, an enzyme essential for uracil biosynthesis, are unable to grow in the absence of exogenous uracil.
  • a copy of the wild-type gene (ura4+ in S. pombe and URA3 in S. cerevisiae) will complement this defect in trans.
  • a further element useful in an expression vector is an origin of replication sequence.
  • Replication origins are unique DNA segments that contain multiple short repeated sequences that are recognized by multimeric origin-binding proteins and which play a key role in assembling DNA replication enzymes at the origin site.
  • Suitable origins of replication for use in expression vectors employed herein include E. coli oriC, 2 ⁇ and ARS (both useful in yeast systems), sfl, SV40 (useful in mammalian systems), and the like.
  • Affinity purification tags are generally peptide sequences that can interact with a binding partner immobilized on a solid support. Synthetic DNA sequences encoding multiple consecutive single amino acids, such as histidine, when fused to the expressed protein, may be used for one-step purification of the recombinant protein by high affinity binding to a resin column, such as nickel sepharose. An endopeptidase recognition sequence is often engineered between the polyamino acid tag and the protein of interest to allow subsequent removal of the leader peptide by digestion with a specific protease.
  • Sequences encoding peptides such as the chitin binding domain (which binds to chitin), glutathione-S-transferase (which binds to glutathione), biotin (which binds to avidin or strepavidin), and the like can also be used for facilitating purification of the protein of interest.
  • the affinity purification tag can be separated 8
  • inteins protein self-splicing elements
  • Epitope tags are short peptide sequences that are recognized by epitope specific antibodies.
  • a fusion protein comprising a recombinant protein and an epitope tag can be simply and easily purified using an antibody bound to a chromatography resin.
  • the presence of the epitope tag furthermore allows the recombinant protein to be detected in subsequent assays, such as Western blots, without having to produce an antibody specific for the recombinant protein itself.
  • Examples of commonly used epitope tags include V5, glutathione-S-transferase (GST), hemaglutinin (HA), the peptide Phe-His-His-Thr-Thr, chitin binding domain, and the like.
  • a further useful element in an expression vector is a multiple cloning site or polylinker.
  • Synthetic DNA encoding a series of restriction endonuclease recognition sites is inserted into a plasmid vector downstream of the promoter element. These sites are engineered for convenient cloning of DNA into the vector at a specific position.
  • Suitable prokaryotic vectors include plasmids such as those capable of replication in E. coli (for example, pBR322, ColEl, pSClOl, PACYC 184, itVX, pRSET, pBAD (Invitrogen, Carlsbad, CA) and the like). Such plasmids are disclosed by Sambrook (cf. "Molecular Cloning: A Laboratory
  • Bacillus plasmids include pC194, pC221, ⁇ T127, and the like, and are disclosed by Gryczan (In: The Molecular Biology of the Bacilli, Academic Press, NY (1982), pp. 307-329).
  • Suitable Streptomyces plasmids include plJlOl (Kendall et al, J. Bacteriol.
  • Pseudomonas plasmids are reviewed by John et al. (Rev. Infect. Dis. &693-704, 1986), and Izaki (Jpn. J. Bacte ⁇ ol. 33:729-742, 1978).
  • Suitable eukaryotic plasmids include, for example, BPV, vaccinia, SV40, 2- micron circle, pcDNA3.1, pCDNA3.1/GS, pYES2/GS, pMT, p LND, pIND(Spl), pVgRXR (Invitrogen), and the like, or their derivatives.
  • Such plasmids are well known in the art (Botstein et al, Miami Wntr. Symp. 19:265-274, 1982); Broach, In: "The Molecular Biology of the Yeast Saccharomyces: Life Cycle and Inheritance", Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, p.
  • DNA ligase has limitations, however, in that it is relatively slow acting and temperature sensitive.
  • any site-specific enzyme of this type is suitable, for example, a type I topoisomerase or a site-specific recombinase.
  • suitable site- specific recombinases include lambda integrase, FLP recombinase, Pl-Cre protein, Kw recombinase, and the like (Pan, et al, J. Biol. Chem.
  • a particularly suitable enzyme for use in the invention method is a type I topoisomerase, particularly vaccinia DNA topoisomerase.
  • topoisomerase binds to duplex DNA and cleaves the phosphodiester backbone of one strand.
  • the enzyme exhibits a high level of sequence specificity, akin to that of a restriction endonuclease. Cleavage occurs at a consensus pentapyrimidine element 5'-(C/T)CCTT in the scissile strand. In the cleavage reaction, bond energy is conserved via the formation of a covalent adduct between the 3' phosphate of the incised strand and a tyrosyl residue of the protein.
  • Vaccinia topoisomerase can religate the covalently held strand across the same bond originally cleaved (as occurs during DNA relaxation) or it can religate to a heterologous acceptor DNA and thereby create a recombinant molecule.
  • cleavage is accompanied by the spontaneous dissociation of the downstream portion of the cleaved strand.
  • the resulting topoisomerase-DNA complex containing a 5' single-stranded tail, can religate to an acceptor DNA if the acceptor molecule has a 5' OH tail complementary to that of the activated donor complex.
  • this reaction has been optimized for joining PCR-amplified DNA fragments into plasmid vectors (See Figure 1).
  • PCR fragments are naturally good surrogate substrates for the topoisomerase I religation step because they generally have 5' hydroxyl residues from the primers used for the amplification reaction. The 5' hydroxyl is the substrate for the religation reactions.
  • the use of vaccinia topoisomerase type I for cloning is described in detail in copending US patent application serial number 08/358,344, filed 12/19/94, incorporated by reference herein in its entirety.
  • the gene sequence being inserted into the expression vector can insert in either the sense or antisense direction. Therefore, the invention method provides for verification of both the size and orientation of the insert to insure that the gene sequence will express the desired protein.
  • the insert plus vector is utilized in a standard bacterial transformation reaction and the contents of the transformation 11
  • Bacterial transformation and growth selection procedures are well known in the art and described in detail in, for example, Ausubel, et al, Short Protocols in Molecular Biology, 3rd ed. 1995.
  • Performing the PCR reaction directly from the cultured cell lysates, rather than first preparing DNA from the bacteria, is a particular advantage of the invention method as it significantly reduces both the time needed to generate the required data and the cost of doing so.
  • Plasmid DNA is prepared for use in the transformation of host cells for expression.
  • Methods of preparing plasmid DNA and transformation of cells are well known to those skilled in the art. Such methods are described, for example, in Ausubel, et al, supra.
  • Prokaryotic hosts are, generally, very efficient and convenient for the production of recombinant proteins and are, therefore, one type of preferred expression system. Prokaryotes most frequently are represented by various strains of E. coli. However, other organisms may also be used, including other bacterial strains.
  • prokaryotic hosts include bacteria such as E. coli and those from genera such as Bacillus, Streptomyces, Pseudomonas, Salmonella, Serratia, and the like. However, under such conditions, the polypeptide will not be glycosylated.
  • the prokaryotic host selected for use herein must be compatible with the replicon and control sequences in the expression plasmid. 12
  • Suitable hosts may often include eukaryotic cells.
  • Preferred eukaryotic hosts include, for example, yeast, fungi, insect cells, and mammalian cells either in vivo, or in tissue culture.
  • Mammalian cells which may be useful as hosts include HeLa cells, cells of fibroblast origin such as VERO, 3T3 or CHOK1, HEK 293 cells or cells of lymphoid origin (such as 32D cells) and their derivatives.
  • Preferred mammalian host cells include nonadherent cells such as CHO, 32D, and the like.
  • Preferred yeast host cells include S. pombe, Pichi pastoris, S. cerevisiae (such as INVScl), and the like.
  • plant cells are also available as hosts, and control sequences compatible with plant cells are available, such as the cauliflower mosaic virus 35S and 19S, nopaline synthase promoter and polyadenylation signal sequences, and the like.
  • Another preferred host is an insect cell, for example the Drosophila larvae. Using insect cells as hosts, the Drosophila alcohol dehydrogenase or MT promoter can be used. Rubin, Science 240:1453-1459, 1988).
  • baculovirus vectors can be engineered to express large amounts of peptide encoded by a desire gene sequence in insects cells (Jasny, Science 23 !:1653, 1987); Miller et al., In: Genetic Engineering (1986), Setlow, J.K., et al., eds., Plenum, Vol. 8, pp. 277-297).
  • libraries of expressible gene sequences produced by the methods of the invention comprise gene sequences from a variety of sources such as yeast, mammals (including humans), and the like.
  • the present invention also features the purified, isolated or enriched versions of the expressed gene products produced by the methods described above.
  • Kits comprising one or more containers or vials containing components for using the libraries of the present invention are also within the scope of the invention.
  • Kits can comprise any one or more of the following elements: one or more expressible gene sequences, cells which are or can be transfected with said gene sequences, and antibodies recognizing the expressed gene product or an epitope tag associated therewith.
  • Cells suitable for inclusion in such a kit include bacterial cells, yeast cells (such as INVScl), insect cells or mammalian cells (such as CHO). 13
  • such a kit can comprises a detergent solution, preferably the Trax® lysing reagent (6% NP-40 and 9% Triton X-100 in IX PBS). Also included in the kit can be one or more binding partners, e.g., an antibody or antibodies, preferably a pair of antibodies to the same expressed gene product, which preferably do not compete for the same binding site on the expressed gene product.
  • a detergent solution preferably the Trax® lysing reagent (6% NP-40 and 9% Triton X-100 in IX PBS).
  • binding partners e.g., an antibody or antibodies, preferably a pair of antibodies to the same expressed gene product, which preferably do not compete for the same binding site on the expressed gene product.
  • a kit can comprise more than one pair of such antibodies or other binding partners, each pair directed against a different target molecule, thus allowing the detection or measurement of a plurality of such target molecules in a sample.
  • one binding partner of the kit may be pre-adsorbed to a solid phase matrix, or alternatively, the binding partner and matrix are supplied separately and the attachment is performed as part of the assay procedure.
  • the kit preferably contains the other necessary washing reagents well- known in the art.
  • the kit contains the chromogenic substrate as well as a reagent for stopping the enzymatic reaction when color development has occurred.
  • the substrate included in the kit is one appropriate for the enzyme conjugated to one of the antibody preparations. These are well-known in the art, and some are exemplified below.
  • the kit can optionally also comprise a target molecule standard; i.e., an amount of purified target molecule that is the target molecule being detected or measured.
  • a kit of the invention comprises in one or more containers: (1) a solid phase carrier, such as a microtiter plate coated with a first binding partner; (2) a detectably labeled second binding partner which binds to the same expressed gene product as the first binding partner; (3) a standard sample of the expressed gene product recognized by the first and second binding partners; (4) concentrated detergent solution; and (5) optionally, diluent.
  • a solid phase carrier such as a microtiter plate coated with a first binding partner
  • a detectably labeled second binding partner which binds to the same expressed gene product as the first binding partner
  • a standard sample of the expressed gene product recognized by the first and second binding partners (4) concentrated detergent solution
  • diluent optionally, diluent.
  • the following example illustrates the creation of a library of expressible yeast gene sequences.
  • Amplification - 6,032 yeast ORFs and a corresponding gene-specific primer of the 3' end of each were obtained from Research Genetics (Huntsville, AL) in a 96-well microtiter plate format at a concentration of 0.3 ng/ ⁇ l.
  • Each gene specific primer was designed to exclude the gene's stop codon. Since the templates each contain a common sequence immediately 5' of the start ATG (5'- GCAGTCCTGGAATTCCAGCTGACCACC) (SEQ ID NO:l), it was possible to amplify each template with a common 5' primer.
  • ORF template 5 ⁇ l was added to a fresh 96-well microtiter plate (polycarbonate Thermowell Thinwall, Model M. Cat # 6511) using a 12 channel pipetter. 6 ⁇ l of specific 3' primer solution (2 ⁇ M) was added and the total volume per well brought to 30 ⁇ l with PCR cocktail, immediately after which the plate was placed on ice.
  • Hybaid Micromat lid was washed by soaking in 0.1 M HC1, the rinsed for 2 minutes with distilled water and dried completely before applying to the 96-well plate.
  • the PCR reaction was performed using a Hybaid, Ltd. (Middlesex, UK) thermo-cycler according to the manufacturer's instructions.
  • the conditions used were as follows: pre-melt step: 94° C x 4 min; melt step: 94° C x 30 sec, anneal step: 58° C x 45 sec, extend step: 72° C x 3 min - repeated for 25 cycles; final extension: 72° C x 4 min; final block temperature set to room temp (approx. 22° C).
  • the plates were stored at 4° C. 15
  • each lane containing the amplified gene sequence was cut from the gel and transferred to a well in a 96-well microtiter plate, melted on a heat block (75° C), and a portion of the melt multi-channel pipetted into a 96-well microtiter plate (7 ⁇ l/well) containing one of two expression vectors: TOPO-adapted pcDNA3.1/GS or pYES2/GS (Invitrogen, Carlsbad, CA) previously digested with Hindlll. The plate was covered with parafilm and incubated at 37° C for 7 minutes.
  • the contents of each well were plated onto a LB(10g tryptone, 5g yeast extract, lOg NaCl per liter)/1.5% agar petrie plate containing the appropriate selection marker (ampicillin (50 ⁇ g/ml) for pYES2/GS and ZeocinTM (25 ⁇ g/ml) for pcDNA3.1/GS).
  • the petrie plates were grown overnight at 37° C.
  • Contamination is a potentially serious problem in this step. Care should be taken to guard against contaminating the process through airborne contamination, unsterile reagents or equipment, or well-to-well contamination.
  • Each well contained 100 ⁇ l of 2X LB plus 100 ⁇ g/ml ampicillin or 50 ⁇ g/ml ZeocinTM as appropriate for the expression vector used. The plates were incubated overnight at 37° C.
  • the plates were spun briefly at 1000 rpm.
  • the cells were stirred by pipetting up and down in a pipetter, then 2 ⁇ l from each well was transferred to a corresponding well in a PCR reaction plate containing 28 ⁇ l/well PCR cocktail (PCR cocktail for 840 reactions - 5040 ⁇ l 5X Buffer J, 336 ⁇ l dNTPs (50mM stock), 84 ⁇ l common 5' primer (1 ⁇ g/ ⁇ l stock, Dalton Chemical Lab. Inc, Ont. CAN), 84 ⁇ l 3' H ⁇ stopprevu primer (1 ⁇ g/ ⁇ l, Dalton Chemical Lab. Inc, Ont.
  • H ⁇ stopprevu primer has the sequence 5 ' AAA CTC AAT GGT GAT GGT GAT GAT GACC - 3') (SEQ ID NO:2).
  • the PCR reaction was run essentially as described above with the following cycle: pre-melt step: 94° C x 10 min; melt step: 94° C x 1 min, anneal step: 67° C x 1 min, extend step: 72° C x 3 min - 35 cycles; final extension: 72° C x 4 min; final block temp set to room temp (approximately 22° C).
  • pre-melt step 94° C x 10 min
  • melt step 94° C x 1 min
  • anneal step 67° C x 1 min
  • extend step 72° C x 3 min - 35 cycles
  • final extension 72° C x 4 min
  • final block temp set to room temp (approximately 22° C).
  • the plates were spun briefly at 100 rpm and 6 ⁇ l of 6X gel loading dye added to each well. Samples were run on a 1% agarose gel which was subsequently stained with ethidium bromide. Only plasmids with correctly oriented inserts give
  • the location of the positive clones was entered into a database and a spreadsheet of positive clones generated.
  • the spreadsheet was downloaded onto a Qiagen BioRobot 9600TM to direct the re-racking of the positive cultures into deep- 17
  • CHO cells were transfected with the prepared plasmid DNA using the Pfx-6 PerFect Lipid system (Invitrogen, Cat #T930-16).
  • Yeast cells (INVScl) were transfected using the S.C. EasyComp Transformation kit (Invitrogen, Cat #K5050- 01). Expression was verified by Western blot using anti-V5 antibody to detect the epitope tag. A total of 558 clones expressing a correct protein were obtained after a single pass.
  • Fetal human heart tissue was obtained from the International Institute for the Advancement of Medicine (HAM).
  • Poly A+ mRNA was isolated using the FastTrackTM 2.0 Kit (Invitrogen, Carlsbad, CA) according to the manufacturer's instructions.
  • the mRNA was converted to first-strand cDNA using a cDNA Cycle® Kit (Invitrogen) using the oligo dT primer provided and the protocols suggested.
  • a single cDNA synthesis reaction was split into 12 separate wells of a 96-well PCR amplification plate, and PCR amplifications were performed using specific primer sets, essentially as described above, with the exception that the ratio of Taq to Pfu was 50:1 in the initial amplification (final cone. 2 U Taq:0.04 U Pfu/well).
  • Primers were synthesized using a Primerstation 960 (Intelligent Automation Systems, Inc.) used according to the manufacturer's instructions and were designed from sequences downloaded from Unigene and sent directly to the synthesizer. Approximately 15 nMoles of each primer, having an average length of 25 basepairs, was synthesized in a 96-well format. After synthesis, the primers were cleaved from the supports, deprotected and dried in the same 96-well format (see manufacturer's instructions). 18
  • the amplified gene sequences were purified and inserted into the pcDNA3.1/GS expression vector essentially as described above.
  • the expression vectors containing sequences verified to be in the correct orientation were transfected into CHO cells in 96-well deep-well blocks using the Pfx-6 PerFect Lipid system (Invitrogen, Cat #T930-16). Cell lysates were made 48 hours after transfection, and the lysates were separated by SDS-PAGE and analyzed by Western blot according to standard protocols using an anti-V5 epitope tag Mab/horseradish peroxidase conjugate. Table 1 lists the human proteins successfully expressed using this methodology. A total of 66 clones expressing a correct protein, out of 118, were obtained after a single pass.
  • H3 H-AB006969 Homo sapiens hGAAl mRNA, 68.42 70 complete eds
  • G3 H-AD001528 Homo sapiens spermidine 40.37 40 aminopropyltransferase mRNA, complete eds
  • H4 H-AF008936 Homo sapiens syntaxin-16B 35.75 47 mRNA, complete eds
  • H5 H-AF009243 Homo sapiens proline-rich Gla 22.33 36 protein 2 (PRGP2) mRNA, complete eds
  • H6 H-AF024714 Homo sapiens interferon- 37.84 48 inducible protein (AIM2) mRNA, complete eds
  • H5 H-AF026071 Homo sapiens soluble death 30.58 50 receptor 3 beta (DR3) mRNA, complete eds
  • VTI1 Homo sapiens vesicle soluble 25.63 36.0kDa NSF attachment protein receptor (VTI1) mRNA, complete eds
  • F3 H-AF037335 Homo sapiens carbonic anhydrase 39.05 39 precursor (CA 12) mRNA, complete eds
  • GI H-AF039019 Homo sapiens zinc finger DNA 87.45 87 binding protein 89 kDa (ZBP-89) mRNA, complete eds
  • E2 H-AJ001340 Homo sapiens mRNA for U3 52.36 60 snoRNP associated 55 kDa protein
  • M236 B2 H-D45248 proteasome activator hPA28, 26.4 38 subunit bet may be cell adhesion protein
  • H2 H-D86322 Homo sapiens mRNA for 67.21 64 calmegin, complete eds
  • E2 H-D88308 Homo sapiens mRNA for very- 68.31 64 long-chain acyl-CoA synthetase, complete eds
  • E3 H-J02854 Human 20-kDa myosin light 19.03 31 chain (MLC-2) mRNA, complete eds
  • M311 F2 H-L11245 complement component 4-binding 27.83 30 protein, beta
  • JNK2 human protein kinase
  • E3 H-L40802 Homo sapiens 17-beta- 42.68 60 hydroxysteroid dehydrogenase (17-HSD) gene
  • G6 H-M33680 Human 26-kDa cell surface 26.07 24 protein TAPA-1 mRNA, complete eds
  • HAP1 apurinic/apyrimidinic endonuclease
  • proS prolyl-tRNA synthetase
  • VSPIM adenine specific DNA 60.06 methyltransferase
  • H-PHIMC cytosine specific DNA 36.3 methyltransferase
  • Rho Rho

Abstract

La présente invention concerne une méthode de production de banques de séquences de gènes exprimables. La méthode selon l'invention permet la manipulation simultanée de plusieurs séquences de gènes et permet donc de créer des banques de manière efficace et à un débit élevé. On peut utiliser les vecteurs d'expression afin de produire des protéines de recombinaison. L'invention concerne en outre des banques de séquences de gènes exprimables produites grâce à la méthode selon l'invention et des vecteurs d'expression utilisés dans l'élaboration de ces banques.
EP99917335A 1998-04-03 1999-04-02 Methodes de production de banques de sequences de genes exprimables Withdrawn EP1066404A4 (fr)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US5493698A 1998-04-03 1998-04-03
PCT/US1999/007270 WO1999051766A1 (fr) 1998-04-03 1999-04-02 Methodes de production de banques de sequences de genes exprimables
US54936 2002-01-25

Publications (2)

Publication Number Publication Date
EP1066404A1 true EP1066404A1 (fr) 2001-01-10
EP1066404A4 EP1066404A4 (fr) 2004-04-07

Family

ID=21994497

Family Applications (1)

Application Number Title Priority Date Filing Date
EP99917335A Withdrawn EP1066404A4 (fr) 1998-04-03 1999-04-02 Methodes de production de banques de sequences de genes exprimables

Country Status (5)

Country Link
EP (1) EP1066404A4 (fr)
JP (1) JP2002510502A (fr)
AU (1) AU754276B2 (fr)
CA (1) CA2324514A1 (fr)
WO (1) WO1999051766A1 (fr)

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6870046B2 (en) * 2001-04-26 2005-03-22 Isis Pharmaceuticals, Inc. Antisense modulation of interferon gamma receptor 2 expression
ZA200305980B (en) 2001-02-12 2007-01-31 Res Dev Foundation Modified proteins, designer toxins, and methods of making thereof
JP2004535202A (ja) 2001-07-17 2004-11-25 リサーチ　ディベロップメント　ファンデーション アポトーシス促進性蛋白質を含む治療剤

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1996019497A1 (fr) * 1994-12-19 1996-06-27 Sloan-Kettering Institute For Cancer Research Procede de clonage moleculaire et de synthese de polynucleotides au moyen d'une topoisomerase d'adn de vaccine
WO1996034112A1 (fr) * 1995-04-24 1996-10-31 Chromaxome Corp. Procedes de generation et de criblage de nouvelles voies metaboliques
WO1996039186A1 (fr) * 1995-06-06 1996-12-12 Cedars-Sinai Medical Center Anticorps cytoplasmique anti-neutrophile associe a la rectocolite hemorragique, procedes et kits correspondants
WO1999051620A1 (fr) * 1998-04-03 1999-10-14 Invitrogen Corporation Banques de sequences de genes pouvant etre exprimees

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU582288B2 (en) * 1986-03-07 1989-03-16 Damon Biotech Inc. Vector and method for achieving high level expression in eukaryotic cells
US5723286A (en) * 1990-06-20 1998-03-03 Affymax Technologies N.V. Peptide library and screening systems

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1996019497A1 (fr) * 1994-12-19 1996-06-27 Sloan-Kettering Institute For Cancer Research Procede de clonage moleculaire et de synthese de polynucleotides au moyen d'une topoisomerase d'adn de vaccine
WO1996034112A1 (fr) * 1995-04-24 1996-10-31 Chromaxome Corp. Procedes de generation et de criblage de nouvelles voies metaboliques
WO1996039186A1 (fr) * 1995-06-06 1996-12-12 Cedars-Sinai Medical Center Anticorps cytoplasmique anti-neutrophile associe a la rectocolite hemorragique, procedes et kits correspondants
WO1999051620A1 (fr) * 1998-04-03 1999-10-14 Invitrogen Corporation Banques de sequences de genes pouvant etre exprimees

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See also references of WO9951766A1 *

Also Published As

Publication number Publication date
AU3548299A (en) 1999-10-25
WO1999051766A1 (fr) 1999-10-14
JP2002510502A (ja) 2002-04-09
AU754276B2 (en) 2002-11-07
EP1066404A4 (fr) 2004-04-07
CA2324514A1 (fr) 1999-10-14

Similar Documents

Publication Publication Date Title
AU2019250224B2 (en) Enhanced transgene expression and processing
Martin et al. The gene for histone RNA hairpin binding protein is located on human chromosome 4 and encodes a novel type of RNA binding protein
Klingbeil et al. Multiple mitochondrial DNA polymerases in Trypanosoma brucei
EP1696038B1 (fr) Isolation de modulateurs biologiques à partir de banques de fragments de gènes présentant une diversité biologique
WO1993008278A1 (fr) Banque de peptides et procede de depistage
JP2003527072A (ja) 蛋白質ライブラリーに関する蛋白質設計オートメーション
WO1994014980A1 (fr) Molecules, compositions et procedes de liaison d'adn specifiques a des sequences
Kuchař et al. Interactions of putative telomere-binding proteins in Arabidopsis thaliana: identification of functional TRF2 homolog in plants
EP1053347B1 (fr) Procede de detection de peptides
Russnak et al. REF2 encodes an RNA-binding protein directly involved in yeast mRNA 3′-end formation
US20030134302A1 (en) Libraries of expressible gene sequences
WO1997035985A1 (fr) Mutants d'expression de cellules hotes d'un recepteur naturel couple a la proteine g (gpcr); gene ste2 saccharomyces cerevisiae, et leur utilisation en tant que biodetecteurs
US20040009477A1 (en) Methods for producing libraries of expressible gene sequences
Vollmer et al. [15] High expression cloning, purification, and assay of Ypt—GTPase-activating proteins
AU754276B2 (en) Methods for producing libraries of expressible gene sequences
Baltz et al. The pollen-specific LIM protein PLIM-1 from sunflower binds nucleic acids in vitro
WO1996022301A1 (fr) Production de polypeptides heterologues en l'absence de fonction de degenerescence de l'arn messager a mediation non-sens
Pérez-Morga et al. A protein linked to mitochondrion development in Trypanosoma brucei
JP2001502545A (ja) 真核Ｒａｄ５２を用いた組成物及び方法
CN106749560B (zh) 脂滴或脂肪体通过mldsr蛋白参与的转录调控的发现及应用
Clarke DNA Template Sequence Effects on RNA Polymerase I Transcription Elongation
Atlason Experimental evolution of substrate specificity in amino acid transporters
JPH08224087A (ja) Ｃｉｉｔａ活性を示すタンパク質の活性を抑制するインヒビター、その同定方法、およびその薬学的組成物
WO2000034486A1 (fr) Phospholipase a2 secretoire humaine
Nomura et al. RNA polymerase I, the nucleolus and synthesis of 35S rRNA in the yeast Saccharomyces cerevisiae

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20001031

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): CH DE FR GB LI NL

RBV Designated contracting states (corrected)

Designated state(s): CH DE FR GB LI NL

RIN1 Information on inventor provided before grant (corrected)

Inventor name: MARCIL, ROBERT

Inventor name: FONCERRADA, LUIS

Inventor name: LEE, WAI-YEE

Inventor name: SINDICI, MICHELLE, LYNN

Inventor name: MARKS-HULL, HEATHER, LYNN

Inventor name: HOEFFLER, JAMES, PAUL

Inventor name: HEYMAN, JOHN, ALASTAIR

Inventor name: FERNANDEZ, JOSEPH, MANUEL

A4 Supplementary search report drawn up and despatched

Effective date: 20040220

RIC1 Information provided on ipc code assigned before grant

Ipc: 7G 01N 33/68 B

Ipc: 7C 12N 15/10 B

Ipc: 7G 01N 33/53 B

Ipc: 7C 12Q 1/06 A

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION HAS BEEN WITHDRAWN

18W Application withdrawn

Effective date: 20041209