Classifications

• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
  • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
  • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
  • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
  • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
  • C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
  • C12N15/8279—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance
  • C12N15/8286—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance for insect resistance
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
  • C07K14/37—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from fungi
• • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
  • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
  • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
  • Y02A40/00—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production
  • Y02A40/10—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production in agriculture
  • Y02A40/146—Genetically Modified [GMO] plants, e.g. transgenic plants

Definitions

• This invention relates to insecticidal peptides and DNA sequences encoding them, processes for their manufacture and use, and transgenic plants transformed with constructs encoding said peptides.
• the invention relates to insecticidal peptides isolable from the genus Beauveria.
• Beauveria Fungi Imperfecti, Moniliales. Strains of Beauveria bassiana have been used for many years as effective biological control agents and are known to produce a range of insecticidal cyclic depsipeptides such as beauvericin and bassianolide. These toxins are thought to play a role in the pathogenicity of the fungus. Beauveria brongniartiii is another facultative but highly virulent parasite of insects (de Hoog, G.S. (1972) The Genera Beauveria, Isaria, Tritirachium and Acrodontium gen nov. Studies in Mycology 1: 1-41.)
• the present invention provides an insecticidal peptide comprising the amino acid sequence
• XI, X 2 , X 3 , X 4 , X 5 and X 6 are any amino acid; or a fragment thereof, or a homologue, variant or derivative of any of these.
• ⁇ is A or T.
• X 2 is suitably T or S.
• Examples of X 3 include D or N.
• X4 is suitably H or S.
• X5 is N or S.
• X 6 include N or E. - 2 -
• the peptide suitably has at least seven additional amino acids at the 5' end thereof, and these are of sequence
• FCPVGKT (SEQ ID NO 2) or a fragment thereof, or a homologue, variant or derivative of any of these.
• an insecticidal peptide comprising the amino acid sequence
• SEQ ID NO 3 is a peptide derivable from Beauveria bassiana which has been designated EF40.
• the insecticidal peptide comprises the amino acid sequence X7 ⁇ s ⁇ 9 ⁇ o ⁇ ⁇ i 2 X- 3 CSSNRECGSCSCNSWKGKCEE (SEQ ID NO 4) or a fragment thereof, or a homologue, variant or derivative of any of these, where ⁇ 7 ⁇ 8 ⁇ 9 ⁇ o ⁇ n ⁇ i2 ⁇ i3 comprises SEQ ID NO 2 or a homologue, variant or derivative thereof.
• SEQ ID NO 4 is a peptide derivable from Beauveria brongniartii which has been designated EF40'.
• fragment refers to any portion of the given amino acid sequence which has insecticidal activity either alone or when combined with other portions of the amino acid sequence.
• homologues refers to any peptide which has some amino acids in common with the given sequence.
• at least 60% of the amino acids will be similar, more suitably at least 70%, preferably at least 80%, more preferably at least
• similar is used to denote sequences which when aligned have similar (identical or conservatively replaced) amino acids in like positions or regions, where identical or conservatively replaced amino acids are those which do not alter the activity or function of the protein as compared to the starting protein. For example, two - 3 -
• amino acid sequences with at least 85% similarity to each other have at least 85% similar (identical or conservatively replaced amino acid residues) in a like position when aligned optimally allowing for up to 3 gaps, with the proviso that in respect of the gaps a total of not more than 15 amino acid resides is affected.
• the degree of similarity may be determined using methods well known in the art (see, for example, Wilbur, W.J. and Lipman, D.J. "Rapid Similarity Searches of Nucleic Acid and Protein Data Banks.” Proceedings of the National Academy of Sciences USA 80, 726-730 (1983) and Myers E.and Miller W. "Optimal Alignments in Linear Space”. Comput. Appl. Biosci. 4:11-17(1988)).
• MegAlign Lipman-Pearson one pair method (using default parameters) which can be obtained from DNAstar Inc, 1228, Selfpark Street, Madison, Wisconsin, 53715, USA as part of the Lasergene system.
• Amino acids which differ from the basic sequence may be conservatively or non- conservatively substituted.
• a conservative substitution is to be understood to mean that the amino acid is replaced with an amino acid with broadly similar chemical properties.
• conservative substitutions may be made between amino acids with the following groups:
• Suitable homologues may be determined by testing insecticidal properties of the peptide using routine methods, for example as illustrated hereinafter.
• variant includes experimentally generated variants or members of a family of related naturally-occurring peptides as may be identified by molecular genetic techniques. Such techniques are described for example in US Patent No. 5,605,793, US Patent No. 5,811,238 and US Patent No 5,830,721, the content of which is - 4 -
• this technique involves expression of the parental gene in a microbial expression system such as Escherichia coli.
• the particular system selected must be validated and calibrated to ensure that biologically active peptides are expressed, which may be readily achieved using a in vivo bioassay.
• the gene, or preferably a collection of related genes from different species may be subject to mutagenic polymerase chain reaction (PCR) as is known in the art. Fragmentation of the products and subsequent repair using PCR leads to a series of chimeric genes reconstructed from parental variants. These chimeras are then expressed in the microbial system which can be screened in the usual way to determine active mutants, which may then be isolated and sequenced.
• PCR polymerase chain reaction
• variants are those derivable from peptides of SEQ ID NO 1 when preceded by SEQ ID NO 2 or homologues thereof, in particular those isolable from Beauveria spp. .
• Other particular variants are those which are experimentally generated using for example the molecular evolution techniques.
• Preferably such variants will have improved insecticidal activity or function as compared to the native sequences. Suitable improvements may be in relation to the intrinsic specific activity of the protein, the specificity or target range against which the peptide is active or by altering a physical property such as stability.
• the invention provides the use of a peptide or peptides comprising SEQ ID NO 1, and in particular SEQ ID NO 1 preceded by SEQ ID NO 2, in the production of other insecticidal variants using molecular evolution and/or DNA shuffling methods.
• Other variants may be identified or defined using bioinformatics systems.
• An example of such a system is the FASTA method of W.R. Pearson and D.J. Lipman PNAS (1988) 85:2444-2488. This method provides a rapid and easy method for comparing protein sequences and detecting levels of similarity and is a standard tool, used by molecular biologists.
• Such similar sequences may be obtained from natural sources, through molecular evolution or by synthetic methods and comparisons made using this method to arrive at "opt scores" which are indicative of the level of similarity between the proteins.
• variants of the invention will comprise insecticidal peptides with an amino acid sequence with a FASTA opt score (as defined in accordance with FASTA version 3.0t82 November 1, 1997) against SEQ ID NO 3 of greater than 102, for example in excess of 130, more preferably in excess of 150 and most preferably in excess of 190.
• Other variants of the invention will comprise insecticidal peptides with an amino acid sequence with a FASTA opt score (as defined in accordance with FASTA version 3.0t82 November 1, 1997) against SEQ ID NO 4 of greater than 89, for example in excess of 130, more preferably in excess of 150 and most preferably in excess of 190.
• Variants which give FASTA scores in excess of 199 when compared with either SEQ ID NO 3 or SEQ ID NO 4 are particularly preferred.
• derivative relates to peptides which have been modified for example by using known chemical or biological methods.
• the insecticidal peptides of SEQ ID NO 1 combined with SEQ ID NO 2 contains 6 cysteine residues all of which are believed to be involved in forming 3 intramolecular disulphide bonds.
• the arrangement of the cysteine residues may be important in conferring insecticidal activity on the peptide. Therefore, homologues or variants suitably retain the cysteine residues of the combination of SEQ ID NO 1 with SEQ ID NO 2.
• the invention encompasses peptides which may be represented as -AA 1 -Cys-AA 3 -AA 4 -AA 5 -AA 6 -AA 7 -Cys-AA 9 -AA 10 -AA 11 -AA I2 -AA 13 -Cys-AA 15 -AA 16 -Cys- AA 18 -Cys-AA 20 -AA 2 ,-AA 22 -AA 23 -AA 24 -AA 25 -Cys-AA 27 -AA 28 (SEQ ID NO 5) or a fragment thereof, wherein AA, -AA 28 refer to any amino acid other than cysteine.
• At least some and preferably a substantial portion of AA, to AA 28 will be the same as in the corresponding amino acids in SEQ ID NO 1 above.
• at least 85% of the amino acids corresponding to AAj to AA 28 of SEQ ID NO 1, are either identical or conservatively substituted as defined above.
• Peptides of the invention may be used alone or they may be fused to other peptides or proteins so as to form chimeric peptides or proteins.
• the other peptide or protein of the chimera will have some insecticidal effect of its own, or will act as a targeting sequence to target the insecticidal peptide to a particular site in the target pest.
• the above described peptides may be prepared in various ways. For example, they may be extracted and purified from Beauveria isolates.
• Suitable cells include prokaryotic or eukaryotic organisms, in particular micro-organisms such as E. coli,
• Nucleic acids encoding the peptides, as well as vectors, host cells and methods of producing the peptides form further aspects of the invention.
• the invention further provides a nucleic acid which encodes an insecticidal peptide as described above.
• the nucleic acid sequence may be a DNA or RNA sequence.
• the DNA may be a cDNA sequence or a genomic sequence, and may be derived from a cDNA clone, a genomic DNA clone or DNA manufactured using a standard nucleic acid synthesiser.
• the DNA sequence may be predicted from the known amino acid sequence and DNA encoding the peptide may be manufactured using a standard nucleic acid synthesiser. Alternatively, the DNA sequence may be isolated from fungal-derived DNA libraries. Suitable oligonucleotide probes may be derived from the known amino acid sequence and used to screen a cDNA library for cDNA clones encoding some or all of the peptide.
• the natural coding sequence for EF40 and EF40' from a strain of Beauveria bassiana (designated strain CRW 148wa(l) /IMI 379823) and a strain Beauveria brongniartii (designated IMI 379918 by the International Mycological Institute, UK) respectively were obtained through reverse transcription of RNA from these fungi and Rapid Amplification of cDNA Ends (RACE) by Polymerase Chain Reaction (PCR).
• RACE Rapid Amplification of cDNA Ends
• PCR Polymerase Chain Reaction
• the 3' region of the cDNA was isolated first, using the N-terminal amino acid sequence of the EF40 mature peptide for degenerate primer design.
• the specific sequence obtained from the 3 'RACE EF40 fragment was then used to design specific primers for amplification of the 5' region of the corresponding cDNA. Similar techniques could be employed for EF40' or any other member of the EF40 gene family.
• the sequence of the deduced EF40 cDNA is shown in Figure 8 (SEQ ID NO 6) hereinafter and this sequence or fragments thereof, or variants of either of these, which encode insecticidal peptides such as EF40 form a preferred aspect of the invention.
• the natural EF40 gene or related genes such as the EF40' gene may contain introns which would interrupt the integrity of the coding sequences.
• Variants of the nucleic acid sequence include sequences which ' encode homologues to EF40 or EF40' as defined above. These include DNA which hybridizes to the sequence of Figure 8 or fragments thereof. Preferably, such hybridization occurs at, or between, low and high stringency conditions.
• low stringency conditions can be defined as 3 x SCC at about ambient temperature to about 65°C
• high stringency conditions as 0.1 x SSC at about 65°C.
• SSC is the name of a buffer of 0.15M NaCl, 0.015M trisodium citrate.
• 3 x SSC is three time as strong as lx SSC and so on.
• homologues to EF40 or EF40' are homologues identified in other insecticidal fungi either by protein purification and sequence analysis or by amplification from fungal genomes and/or cDNA preparations using PCR primers based on the sequence of EF40 and related protein sequences e.g. the protein sequence of the EF40-related protein identified from Beauveria brongniartii strain by 3' RACE.
• EF40 is a secreted peptide and therefore DNA encoding EF40 isolated from
• Beauveria spp is likely to contain a signal sequence in addition to the DNA sequence - 8 -
• the mature peptide may also contain other sequences which are not present in the mature peptide (e.g. a pro-domain) and which are removed during processing and secretion.
• Oligonucleotide probes or cDNA clones may be used to isolate the gene or genes which encode the insecticidal peptide by screening genomic DNA libraries.
• the DNA sequence encoding the insecticidal peptide may be incorporated into a DNA construct or vector in combination with suitable regulatory sequences (promoter, terminator, etc).
• the DNA sequence may be placed under the control of a constitutive or an inducible promoter (stimulated by, for example, environmental conditions, presence of a pest, presence of a chemical).
• a DNA construct may be cloned or transformed into a biological system which allows expression of the encoded peptide.
• Suitable biological systems include micro-organisms (for example, bacteria such as Escherichia coli, Pseudomonas and endophytes such as Clavibacter xyli subsp.
• cynodontis Cxc
• yeasts such as Saccharomyces cerevisiae and Pichia pas tor is; viruses; bacteriophages; etc), cultured cells (such as insect cells, mammalian cells) and plants.
• the expressed peptide may be isolated and if necessary formulated, for use. Alternatively, the peptide may be expressed in situ or in vivo under circumstances where they will be directly brought into contact with the target pests.
• the peptides of the invention are insecticidal whether applied to pests either orally or by injection. Pests affected in this way include lepidopteran pests, for example as illustrated hereinafter and dipteran species such as the fruit fly Drosophila melanogaster.
• the invention further provides a method of killing or controlling insect pests which comprises administering to said pests or to the environment thereof, a peptide as described above.
• the insecticidal peptide may be used to improve the pest insect-resistance or pest insect-tolerance of crops either during the life of the plant or for post-harvest crop protection. Pests exposed to the peptides are inhibited.
• composition comprising peptide may be applied to the insect or to the environment in which they live, in particular, to plant parts or the surrounding soil, using standard agricultural techniques (such as spraying);
• composition comprising a micro-organism such as an insect virus, genetically modified to express the insecticidal peptide may be applied to a plant or the soil in which a plant grows;
• an endophyte genetically modified to express the insecticidal peptide may be introduced into the plant tissue (for example, via a seed treatment process);
• An endophyte is defined as a micro-organism having the ability to enter into non-pathogenic endosymbiotic relationships with a plant host.
• a method of endophyte-enhanced protection of plants has been described in a series of patent applications by Crop Genetics International Corporation (for example, International Application Publication Number WO90/13224, European Patent Publication Number EP-125468-B1, International Application Publication Number WO91/10363, International Application Publication Number WO87/03303).
• the endophyte may be genetically modified to produce agricultural chemicals.
• International Patent Application Publication Number WO94/ 16076 (ZENECA Limited) describes the use of endophytes which have been genetically modified to express a plant-derived insecticidal peptide].
• DNA encoding an insecticidal peptide may be introduced into the plant genome so that the peptide is expressed within the plant body (the DNA may be cDNA, genomic DNA or DNA manufactured using a standard nucleic acid synthesiser).
• compositions which form a further aspect of the invention, will generally further comprise an agriculturally acceptable carrier or diluent as is known in the art.
• Suitable carriers or diluents are solids or liquids. Concentrates in the form of solids or liquids may be prepared, which require dilution in water prior to application, for example by spraying.
• the peptides of the invention are administered in accordance with method
• nucleic acids of the invention utilize codons which are particularly preferred in plants. - 10 -
• nucleotide sequence forms SEQ ID No 7.
• Plant cells may be transformed with recombinant DNA constructs according to a variety of known methods (Agrobacterium Ti plasmids, electroporation, microinjection, microprojectile gun, etc).
• the transformed cells may then in suitable cases be regenerated into whole plants in which the new nuclear material is stably incorporated into the genome.
• Both transformed monocotyledonous and dicotyledonous plants may be obtained in this way, although the latter are usually more easy to regenerate.
• Some of the progeny of these primary transformants will inherit the recombinant DNA encoding the insecticidal peptide(s).
• the invention further provides a plant containing recombinant DNA which expresses an insecticidal peptide according to the invention. Such a plant may be used as a parent in standard plant breeding crosses to develop hybrids and lines having improved insect resistance.
• the recombinant DNA is incorporated such that it is expressed in a region of the plant which is subject to pest attack (such as the leaves) and is therefore ingested by the pest.
• the DNA may comprise sequences which enhance or control this or which are necessary for the mature peptide to fold correctly.
• the nucleotide sequence encoding the peptide may be under the control of a promoter which is expressed particularly in the desired tissues. Other methods of targeting the peptide are possible.
• the nucleic acid may further comprise a signal sequence which targets the peptide to the apoplast (extra-cellular space) as a general expression location in the plant.
• Suitable signal sequences include those derived for example from the Beauveria EF40 gene itself (see Figure 8), from the Dahlia antifungal peptide Dm- AMP- 1 and the Radish antifungal peptide Rs- AFP1, the latter two of which are as follows: Dahlia: SEQ ID NO 9: -Met Val Asn Arg Ser Val Ala Phe Ser Ala Phe Val SEQ ID NO 8:- ATG GTT AAT AGA TCT GTT GCT TTT TCT GCT TTT GTT GTT GTT GTT GTT GTT GTT GTT GTT GTT GTT GTT GTT GTT GTT GTT GTT - 12 -
• SEQ ID NO l l -Met Ala Lys Phe Ala Ser He He Ala Leu Leu Phe SEQ ID NO 10:-ATG GCT AAG TTT GCT TCT ATT ATT GCT CTT TTG TTT Ala Ala Leu Val Leu Phe Ala Ala Phe Glu Ala Pro GCT GCA CTT GTT TTG TTT GCT GCA TTT GAA GCT CCA Thr Met Val Glu Ala
• EF40 signal sequence is novel and forms a further aspect of the invention.
• Transgenic plants in accordance with the invention show improved resistance or enhanced tolerance to an insect pest when compared to a wild-type plant. Resistance may vary from a slight increase in tolerance to the effects of the pest (where the peptide pest in partially inhibited) to total resistance so that the plant is unaffected by the presence of pest (where the pest is severely inhibited or killed). An increased level of resistance against a particular pest or resistance against a wider spectrum of pests may both constitute an improvement in resistance. Transgenic plants (or plants derived therefrom) showing improved resistance are selected following plant transformation or subsequent crossing.
• genetically modified plants which may be produced include field crops, cereals, fruits and vegetables such as canola, sunflower, tobacco, barley, sorghum, tomato, mango, peach, apple, pear, strawberry, banana, melon, potato, carrot, lettuce, cabbage, onion, etc.
• Particularly preferred genetically modified plants are sugar beet, cotton, maize, wheat, rice, soya spp, sugar cane, pea, field beans, poplar, grape, citrus, alfalfa, rye, oats, turf and forage grasses, flax and oilseed rape, and nut producing plants.
• EF40 has been successfully expressed in both tobacco and tomato leaves using synthetic chimeric expression constructs as illustrated hereinafter.
• the insecticidal peptides of the invention are very active against some of the major cotton pests, it would be particularly advantageous to transform cotton plants with constructs encoding said peptides.
• the peptides may be supplied to cotton plants by any other suitable method.
• the invention still further includes the progeny of the plants of the preceding paragraph, which progeny comprises the said polynucleotide, or functionally sufficient parts thereof, stably incorporated into its genome and heritable in a Mendelian manner and the seeds of such plants and such progeny.
• Plant transformation, selection and regeneration techniques which may require routine modification in respect of a particular plant species, are well known to the skilled man.
• insecticidal peptides of the invention may be employed alone or in combination with other agrochemicals such as herbicides, fungicides or, most suitably, other insecticidal compounds such as insecticidal peptides and proteins.
• insecticidal compositions in accordance with the invention may comprise additional agrochemical compounds.
• nucleic acids encoding these may be included in the composition in the form of expression vectors.
• the additional nucleic acids may be in the same vector as the peptide of the invention, or in additional vectors.
• mixture partners include insecticidal lectins, insecticidal protease inhibitors and insectidal proteins derived from species of the Bacillus thurigiensis ,
• Figure 1 shows a map of a vector useful in cloning the gene encoding peptides of the invention
• Figure 2 is a diagram illustrating a synthetic gene production strategy
• Figure 3 shows the sequence of key elements of the vector of Figure 1 (SEQ ID NO 50); - 14 -
• Figure 4 shows a nucleotide sequence which encodes a peptide of the invention and a dahlia
• Figure 5 shows a nucleotide sequence which encodes a peptide of the invention and a radish
• Figure 6 shows a nucleic acid sequence which encodes a peptide of the invention and a dahlia AFP signal sequence, and a restriction map thereof;
• Figure 7 shows an alternative nucleotide sequence which encodes a peptide of the invention and a radish AFP signal sequence, and a restriction map thereof ;
• Figure 8 shows the sequence of the natural EF40 gene from Beauveria bassiana:
• Figure 9 shows the primers used in the determination of the native sequence of Figure 8;
• Figure 10 illustrates cleavage sites in the sequence
• Figure 11 shows the naturally occuring coding sequence for EF40 and EF40'
• Figure 12 is a restriction map of a plant expression gene construct, designated pVB6EF40r, which includes a synthetic gene encoding a polypeptide of the invention
• Figure 13 is a restriction map of an alternative plant expression gene construct, designated pVB6EF40d, which includes a synthetic gene encoding a polypeptide of the invention.
• Warcup isolation method Warcup, J.H., 1950, 'The soil plate method for isolation of fungi from soil', Nature, 166, 117-118. Soil samples were ground into small particles using a mortar and pestle and 15 mg placed in the centre of a Petri dish. To this 75 ⁇ l of sterile water was added. A selective agar (Doberski and Tribe, 1980, 'Isolation of entomopathogenous fungi from elm bark and soil with reference to ecology of Beauveria bassiana and Metarhizium anisopliae ', Trans. Br. Mycol.
• the resulting supernatant was diluted to 4 litres (2-fold dilution) and equilibrated to 20 mM ammonium acetate (NH 4 Ac), pH 9.0 by adding the appropriate volume of 1 M buffer and adjusting to pH 9.0 with dilute ammonia.
• the supernatant was then passed over a Q- Sepharose (Pharmacia Biotech) column previously equilibrated in 20 mM NH 4 Ac, pH 9.0 and the unbound basic peptide fraction collected.
• Cysteine residues were modified by S-pyridylation using the method of Fullmer (1984, Anal. Biochem., 142, 336-341). Reagents were removed by HPLC on a Sephacil C18 column (Pharmacia) and the modified peptide recovered by eluting with a linear gradient of 0.1% TFA to 49.9% acetonitrile, 0.1% TFA. The resulting peptide fraction was subjected to standard amino acid sequence analysis in a 477A Protein Sequencer (Applied Biosystems) with on-line detection of phenylthiohydantoin amino acid derivatives in a 120 A Analyser (Applied Biosystems).
• EF40 is 28 amino acids in length and contains 6 cysteine residues all of which are involved in forming 3 intramolecular disulphide bonds. - 17 -
• a synthetic EF40 gene was designed, which comprised: Restriction site(s) to aid cloning - upstream (5') of the gene
• a signal sequence to direct the mature protein to a particular part of the plant The EF40 gene sequence itself A Stop Codon Restriction site(s) to aid cloning - downstream (3') of the gene
• pSIN pUc based vector
• Figure 3 which carries a promoter (CaMN 35S-boxed in Figure 3) and terminator ( ⁇ OS 3'- also boxed in Figure 3).
• pSI ⁇ has 5 unique restriction sites for gene cloning between the promoter and terminator as illustrated in Figure 1. After sequencing the gene to check both its orientation and full nucleic acid sequence, it was excised from the pSI ⁇ background as a cassette, complete with promoter and terminator, using the Agel sites which flank the 35S promoter and ⁇ OS terminator, and inserted into a binary plant transformation vector pVB6, also with a unique Agel site.
• Synthetic genes comprising the EF40 coding sequence and the radish AFP and dahlia AFP signal sequences described above may be prepared, using the optimal codon usage for tobacco, Nicotiana tabacum and/or cotton. For example: four shorter, overlapping oligos corresponding to the EF40 sequence as illustrated in Figure 2 were prepared. These comprised:
• D refers to Dahlia and "R” Radish - EF40 sequences. No prefix, D or R, indicates that the sequence is the same in both synthetic genes.
• DEF40/b, DEF40/C and EF40d and REF40/a, REF40/d, REF40/c and EF40/d to fill in the missing nucleotides (Step 2 of Figure 2), and PCR primers based specifically on the ends of the gene sequence used to synthesize numerous copies of full length EF40 synthetic gene by
• Suitable primer sequences are: For Dahlia-EF40 sequences
• DEF40-pcrF TTGGTACCCGGGAACAATGGT (SEQ ID NO 20)
• the reverse primer is the same (SEQ ID NO 20) whereas the forward primer is: (SEQ ID NO 21)
• flanking Xmal restriction sites allowed direct cloning into the Xmal site in pSIN.
• this Xmal restriction sequence CCGGG was flanked with 4 extra nucleotides up and downstream for optimal cleavage efficiency. These promote greater than 90% cleavage in a 2 hour digestion.
• two different restriction sites may be used, such as Kpnl and Pstl , or Xmal and Pstl so that the gene may be forced to insert in only the correct orientation.
• Kpnl cleaves more efficiently when flanked by at least two nucleotides
• Pstl cleaves best when preceded by at least two and followed by up to 10 nucleotides.
• sequential digestion with Pstl and then Xmal suits both of these enzymes well in terms of cleavage.
• the last 2 nucleotides of the Kpnl sequence, CC are the same as the beginning 2 of the Xmal recognition sequence.
• AACAATGGC is included upstream of the ATG initiation codon in order to enhance protein expression, and a double termination codon e.g. TAATAA used, although an alternative sequence would be TGATAA.
• the thus obtained vectors pVB6-EF40d and pVB6-EF40r may be used to transform tobacco cells using known methods.
• EF40 strain CRW 148wa(l) (IMI No. 379823)(50ml) was grown in Sabouraud Dextrose Broth (Difco Laboratories: lOg Bacto Neopeptone and 20g Bacto Dextrose per litre water)for 5 days at 24°C with shaking at 180 rpm. The culture was then spun down (8000rpm for 10 minutes)and the resulting pellet ground to a fine powder using a pestle and mortar under liquid nitrogen. RNA was extracted from lOOmg samples of fungal pellet using the Qiagen RNeasy kit, according to the manufacturers' specifications.
• RNA fraction was eluted from RNeasy purification column in lOO ⁇ l water, stored at -70°C.
• the labelling reaction was carried out in parallel with actual cDNA synthesis reactions, on 1 ⁇ g total RNA. After the steps above were completed:
• cDNA yield was calculated to be 1.1% of total RNA input.
• EF40-F Forward primers, designated EF40-F were designed on the basis of the known amino acid sequence of the N-terminal end of mature EF40 to allow for selective amplification.
• PCR components and cycling conditions used were as follows: cDNA template 5 ⁇ l reaction mix from cDNA synthesis step
• Transformed cells were then allowed to express beta-lactamase by incubation at 37°C in SOC medium (2% tryptone, 0.5% yeast extract, lOmM NaCl, 2.5mM KC1, lOmM MgCl 2 , lOmM MgSO 4 , 20mM glucose) for 30 minutes with shaking at 225rpm.
• SOC medium 2% tryptone, 0.5% yeast extract, lOmM NaCl, 2.5mM KC1, lOmM MgCl 2 , lOmM MgSO 4 , 20mM glucose
• Plasmid DNA was extracted from the cultures by Promega' s Wizard miniprep kit according to the manufacturer's recommendations and with a final elution volume of 60 ⁇ l water. EcoRI digests were prepared to check for inserts :- 3 ⁇ l DNA l ⁇ l EcoR/(Kramel Biotech) l ⁇ l Restriction Buffer 6 (Kramel Biotech) 5 ⁇ l water
• EF40 coding sequence was then readily identifiable in 7 of the clones by translation of the nucleotide sequence into amino acid sequence in all possible reading frames and comparison of this sequence to the known amino acid sequence of EF40.
• This analysis used the DNA Star sequence analysis software (SeqMan, EditSeq, Macaw and Vector NTI).
• 'Anchor-3' (SEQ ID NO 46) , which has a 5' terminal phosphate group and a 3' terminal amido group
• 'Anchor-3 Attachment' (SEQ ID NO 47) attachment primer which also has a 3' terminal amido group (see Figure 9) were annealed to one another in equimolar ratio's at three different final concentrations as follows: InM (l ⁇ l lOnM of each primer, 8 ⁇ l water) lOOnM (l ⁇ l ImM of each primer, 8 ⁇ l water) 1 OmM ( 1 ⁇ l 1 OOmM of each primer, 8 ⁇ l water)
• the attachment primer is complementary to the anchor primer, but contains a 3 ' extension of 5 additional fully degenerate bases i.e. synthesised with A, G, C and T at each position. This degenerate "tail" allows individual attachment primers to anneal to the 3' terminus of any cDNA molecule.
• the amido groups block DNA synthesis from the primers but, the phosphate group on the anchor primer allows ligation of the anchor primer to the 3' end of the cDNA molecules to provide a specific recognition sequence for PCR amplification.
• Oligonucleotide mixtures were heated to 95 °C and cooled slowly to 45°C in a thermal cycler 95°C 30 sec
• PCR reactions were set up using the anchor linked cDNA as the template, and specific primers based on this anchor sequence and the EF40 gene sequence identified previously by 3' RACE. The best result was produced using primers Anchor3-F2 (SEQ ID NO 38) and reverse primer 5' RACE EF40 R2 (SEQ ID NO 41), producing a discreet fragment approximately 450 - 550 base pairs in size.
• PCR Buffer (GibcoBRL) 2.5 ⁇ l MgCl 2 (1.2mM) 0.75 ⁇ l 26 -
• the PCR cycle conditions were:
• Plasmid DNA was then extracted from the clones carrying candidate recombinant plasmids by Wizard miniprep (Promega) according to manufacturer's specifications, EcoRI digested and sequenced as described above.
• EF40 was bioassayed against a range of insect species using the following method:
• test peptides Prior to the assay twenty neonate lepidoptera larvae were gently brushed into each of three 'minipots' containers per treatment (i.e. three replicates per treatment). Test peptides were diluted using 0.1% SynperonicTM solution to act as a wetter and aid the spread of the material over the waxy leaf cuticle. In spectrum assays, test materials were made up to a single high concentration, whereas in potency assays vs. H virescens a rate range was tested.
• the minipots were placed in plastic trays and held in a controlled temperature at 25-27°C.
• test data was run through a logit analysis package to establish the LC 50 . Percent feeding damage to the leaf disc relative to control treatments was also visually estimated.
• EF40 was also tested for activity via injection using the following method:
• Larvae to be tested were mid to late 4th instar stage and weighed approx. lOOmg each. Dilutions of the EF40 to be tested was carried out using sterile double distilled water. Test samples were made up to an appropriate concentration expressed in parts per million (ppm), and applied in terms of ⁇ g of peptide per mg of larval body weight (assuming a body weight of lOOmg). Control treatment larvae were injected with sterile double distilled water.
• Test larvae were placed, one at a time on an injection platform and held in place, motionless, ready for injection with a sheet of cling film held in place by a gentle vacuum source pulling the sheet down over the larva.
• a Hamilton microlitre syringe with a 15mm, 33 gauge needle was used to inject.
• the syringe and needle were cleaned using ethanol and finally distilled water between treatments.
• Five ⁇ l's of test solution were drawn up ready for injection - five larvae being injected per treatment.
• Larvae were injected in the region between the dorsal line and the lateral line thus avoiding the 'heart' and the spiracles to minimise injury.
• the needle was positioned over this region, about a third of the larva from the head at a very shallow angle with the needle pointing away from the head.
• Each larva was injected by carefully pushing the needle through the cling film and cuticle into the haemocoel, penetrating by approx. 3mm before expelling one ⁇ l of test solution.
• the needle was carefully withdrawn after a few seconds (to ensure toxin circulation).
• the procedure was repeated on the remaining four larvae per treatment.
• the injected larvae were assessed for mortality and/or symptoms at appropriate intervals post-injection. Blunt forceps were used to gently prod larvae to elicit a response and determine symptomology if any. After the initial assessment immediately post-injection the larvae were placed in individual containers with a thin layer of diet, lidded, and stored in a 25-27°C controlled environment room between assessments.
• MEL cells mammalian cells
• Sf21 cells insect cells
• MEL cells and Sf21 cells were grown in DMEM and TCI 00 media respectively in 96- well microtitre plates and incubated with the appropriate concentration of peptide.
• the cells were scored for visible cell death after 24 hours and viability and growth assessed after 3 (MEL cells) or 4 (Sf21) days using the reduction of MTT (3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) to form an insoluble purple formazan as a marker for metabolically active cells.
• MTT 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide
• EF40 did not inhibit cell growth or cause any cytotoxic effects on either cell line.
• a thionin purified from plant seed showed significant cell death at rates as low as 1 ⁇ g/ml even after 24 hours.
• Example 5 designed to encode the EF40 protein was used to produce plant expression gene constructs called pVB6EF40r and pVB6EF40d ( Figures 11 and 12 respectively).
• the synthetic EF40 gene had been attached to two different N terminal signal peptides.
• a signal peptide after directing a protein to the extracellular matrix, would subsequently be cleaved to release the mature protein. It was expected therefore that the signal peptide will be cleaved during processing of the chimeric Rs-AFP1/EF40 in pre-peptide and that mature EF40 without the signal peptide will accumulate in the extracellular space.
• the first signal peptide used was from radish seeds and the second from dahlia seeds ( Figure 4 and 5 respectively). Both the radish and the dahlia signal peptides are known to function to direct small antifungal proteins (called RS-AFPl and DM- AMP 1 respectively) to the extracellular space.
• the synthetic EF40 gene was placed under the control of the CaMV 35S promoter.
• the terminator sequence from the 3' end of the Agrobacterium tumefaciens nopaline synthase gene (nos) was used. All expression cassettes were constructed in a Binl 9-based binary vector for transformation by Agrobacterium tumefaciens. The effect gene cassette and selectable 31 -
• the selectable marker cassette in each of these plasmids is composed of the AoPRl promoter - neomycin phosphotransferase (npt l) gene - nos terminator.
• NPTII confers resistance to the antibiotic kanamycin.
• AoPRl is the Asparagus wound induced promoter.
• Agrobacterium mediated transformation of Tobacco was performed with both constructs. Tomato was transformation with pVB6EF40r only.
• the host plants varieties used were:
• the radish construct in tobacco gave higher transgene expression levels than the dahlia in tobacco or even the radish in tomato.
• the resultant material showed insecticidal activity against H.virescens and Drosophila melanogaster.
• Example 6 was repeated using the strain of Example 9 (Beauveria brongniartii strain IMD 79918) instead of Beauveria bassiana. Similar primers were used in the process.
• the coding sequence obtained as a result of following this procedure is shown in Figure 11 (SEQ ID NO 53). This is highly homologous but not identical to that of the
• EF40 natural coding sequence SEQ ID NO 52.
• the emboldening indicates base changes between the two sequences. Since, the underlined sequence corresponds to that of the primer, the existence of mismatches in this area could not be determined. However, determination of the specific sequence of EF40' could be carried out using routine methods, such as 5 '-RACE as described in Example 6 above. - 33 -
• sequences of EF40 and EF40' can be used to design primers or probes with which DNA or RNA libraries may be searched using known methods.
• the protein sequence of EF40 was compared to all publicly available protein sequences using the FASTA method (FASTA version 3.0t82 November 1, 1997 Reference: W.R. Pearson & D.J. Lipman PNAS (1988) 85:2444-2448). Specifically a large non-redundant protein database, including release 36.0 of
• SWISS-PROT queried on Monday 8th February 1999 returned proteins judged to have some similarity to EF40.
• the best way to judge similarity using FASTA by those skilled in the art is to use the opt score output.
• the comparison of EF40 to the non-redundant protein sequence database gave very few proteins and none with a high opt score demonstrating that EF40 is not closely related to any known protein. The 'most similar' was in SWISSPROT and had an opt score of 102.
• the protein sequence of EF40 was also compared to the sequence of EF40' and to itself (EF40) using the FASTA method The comparison of EF40 to EF40' gave an opt score of 199. The comparison of EF40 to itself (EF40) gave an opt score of 236. The comparison of EF40' to EF40' gave an opt score of 227.
• the score comparisons have different opt scores due to the algorithm giving different protein residues different weightings.
• the range of opt scores for these sequences are indicative of the range of opt scores which encompass this family of sequences.

Landscapes

• Life Sciences & Earth Sciences (AREA)
• Health & Medical Sciences (AREA)
• Genetics & Genomics (AREA)
• Chemical & Material Sciences (AREA)
• Organic Chemistry (AREA)
• Engineering & Computer Science (AREA)
• Molecular Biology (AREA)
• Biochemistry (AREA)
• Biophysics (AREA)
• General Health & Medical Sciences (AREA)
• Wood Science & Technology (AREA)
• Bioinformatics & Cheminformatics (AREA)
• General Engineering & Computer Science (AREA)
• Biotechnology (AREA)
• Zoology (AREA)
• Biomedical Technology (AREA)
• Pest Control & Pesticides (AREA)
• Physics & Mathematics (AREA)
• Cell Biology (AREA)
• Insects & Arthropods (AREA)
• Proteomics, Peptides & Aminoacids (AREA)
• Plant Pathology (AREA)
• Medicinal Chemistry (AREA)
• Microbiology (AREA)
• Gastroenterology & Hepatology (AREA)
• Mycology (AREA)
• Agricultural Chemicals And Associated Chemicals (AREA)
• Peptides Or Proteins (AREA)
• Micro-Organisms Or Cultivation Processes Thereof (AREA)

Applications Claiming Priority (5)

Publications (1)

Family

ID=26313140

Family Applications (1)

Country Status (3)

Families Citing this family (1)

Family Cites Families (2)

• 1999
  • 1999-02-16 AU AU25355/99A patent/AU2535599A/en not_active Abandoned
  • 1999-02-16 WO PCT/GB1999/000465 patent/WO1999041393A1/en not_active Application Discontinuation
  • 1999-02-16 EP EP99905050A patent/EP1054987A1/de not_active Withdrawn

Non-Patent Citations (1)

Also Published As

Similar Documents

Legal Events