EP1037994A1 - Peptides antagonistes du facteur de croissance de l'endothelium vasculaire - Google Patents

Peptides antagonistes du facteur de croissance de l'endothelium vasculaire

Info

Publication number
EP1037994A1
EP1037994A1 EP98963815A EP98963815A EP1037994A1 EP 1037994 A1 EP1037994 A1 EP 1037994A1 EP 98963815 A EP98963815 A EP 98963815A EP 98963815 A EP98963815 A EP 98963815A EP 1037994 A1 EP1037994 A1 EP 1037994A1
Authority
EP
European Patent Office
Prior art keywords
vegf
vegfι
exon
gst
cells
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP98963815A
Other languages
German (de)
English (en)
Inventor
Michael Klagsbrun
Shay Soker
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Childrens Medical Center Corp
Original Assignee
Childrens Medical Center Corp
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Childrens Medical Center Corp filed Critical Childrens Medical Center Corp
Publication of EP1037994A1 publication Critical patent/EP1037994A1/fr
Withdrawn legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/71—Receptors; Cell surface antigens; Cell surface determinants for growth factors; for growth regulators
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00—Drugs for skeletal disorders
    • A61P19/02—Drugs for skeletal disorders for joint disorders, e.g. arthritis, arthrosis
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A61P35/04—Antineoplastic agents specific for metastasis
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00—Drugs for disorders of the cardiovascular system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy

Definitions

  • the present invention relates to vascular endothelial growth factor (VEGF). More particularly, the invention relates to antagonists of VEGF and use of those antagonists in the treatment of disorders that are associated with VEGF.
  • VEGF vascular endothelial growth factor
  • Blood vessels are the means by which oxygen and nutrients are supplied to living tissues and waste products are removed from living tissue.
  • Angiogenesis refers to the process by which new blood vessels are formed. See, for example, the review by Folkman and Shing, J. Biol. Chem. 267, 10931-10934 (1992), Dvorak, et al., J.
  • angiogenesis is a critical biological process. It is essential in reproduction, development and wound repair. However, inappropriate angiogenesis can have severe negative consequences. For example, it is only after many solid tumors are vascularized as a result of angiogenesis that the tumors have a sufficient supply of oxygen and nutrients that permit it to grow rapidly and metastasize. Because maintaining the rate of angiogenesis in its proper equilibrium is so critical to a range of functions, it must be carefully regulated in order to maintain health.
  • the angiogenesis process is believed to begin with the degradation of the basement membrane by proteases secreted from endothelial cells (EC) activated by mitogens such as vascular endothelial growth factor (VEGF) and basic fibroblast growth factor (bFGF).
  • VEGF vascular endothelial growth factor
  • bFGF basic fibroblast growth factor
  • endothelial cells In adults, the proliferation rate of endothelial cells is typically low compared to other cell types in the body. The turnover time of these cells can exceed one thousand days. Physiological exceptions in which angiogenesis results in rapid proliferation typically occurs under tight regulation, such as found in the female reproduction system and during wound healing.
  • angiogenesis involves a change in the local equilibrium between positive and negative regulators of the growth of microvessels.
  • the therapeutic implications of angiogenic growth factors were first described by Folkman and colleagues over two decades ago (Folkman, N. Engl. J. Med., 285: 1182-1186 (1971)).
  • Abnormal angiogenesis occurs when the body loses at least some control of angiogenesis, resulting in either excessive or insufficient blood vessel growth. For instance, conditions such as ulcers, strokes, and heart attacks may result from the absence of angiogenesis normally required for natural healing. In contrast, excessive blood vessel proliferation can result in tumor growth, tumor spread, blindness, psoriasis and rheumatoid arthritis.
  • fibroblast growth factor (FGF) family Yanagisawa-Miwa, et al., Science, 257:1401-1403 (1992) and Baffour, et al, J Vase Surg, 16:181-91 (1992)
  • ECGF endothelial cell growth factor
  • VEGF vascular endothelial growth factor
  • angiogenesis is desirable.
  • many diseases are driven by persistent unregulated angiogenesis, also sometimes referred to as "neovascularization.”
  • angiogenesis also sometimes referred to as "neovascularization.”
  • new capillary blood vessels invade the joint and destroy cartilage.
  • new capillaries invade the vitreous, bleed, and cause blindness.
  • Ocular neovascularization is the most common cause of blindness.
  • Tumor growth and metastasis are angiogenesis-dependent. A tumor must continuously stimulate the growth of new capillary blood vessels for the tumor itself to grow.
  • VEGF may be a major regulator of angiogenesis (reviewed in Ferrara, et al., Endocr. Rev., 13, 18-32 (1992); Klagsbrun, et al., Curr. Biol., 3, 699-702 (1993); Klagsbrun, et al., Ferrara, et al., Biochem. Biophys. Res. Commun., 161, 851-858 (1989) ).
  • VEGF was initially purified from the conditioned media of folliculostellate cells (Ferrara, et al., Biochem. Biopsy. Res.
  • VEGF was found to be identical to vascular permeability factor, a regulator of blood vessel permeability that was purified from the conditioned medium of U937 cells at the same time (Keck, et al., Science, 246: 1309-1312 (1989)). VEGF is a specific mitogen for endothelial cells (EC) in vitro and a potent angiogenic factor in vivo.
  • VEGF vascular endothelial growth factor
  • NEGF appears to play a principle role in many pathological states and processes related to neovascularization. Regulation of NEGF expression in affected tissues could therefore be key in treatment or prevention of NEGF induced neovascularization/angiogenesis.
  • VEGF is a secreted 40-45K homodimer (Tischer E, et. al., J. Biol. Chem. 266:
  • NEGF exists in a number of different isoforms that are produced by alternative splicing from a single gene containing eight exons (Ferrara, et al., Endocr. Rev., 13: 18-32 (1992); Tischer, et al., J. Biol. Chem., 806: 1 1947-1 1954 (1991); Ferrara, et al., Trends Cardio Med, 3:244- 250 (1993); Polterak, et al., J Biol. Chem., 272:7151-7158 (1997)).
  • Human VEGF isoforms consists of monomers of 121, 145, 165, 189, and 206 amino acids, each capable of making an active homodimer (Polterak et al., J. Biol. Chem, 272:7151-7158 (1997); Houck, et al, Mol. Endocrinol, 8: 1806-1814 (1991)).
  • the VEGF, 2 ⁇ and VEGF ⁇ 5 isoforms are the most abundant.
  • VEGF 121 is the only VEGF isoforms that does not bind to heparin and is totally secreted into the culture medium.
  • VEGF )65 is functionally different than VEGFj 2 ⁇ in that it binds to heparin and cell surface heparin sulfate proteoglycans (HSPGs) and is only partially released into the culture medium (Houck, et al., J. Biol. Chem., 247:28031-28037 (1992); Park, et al, Mol. Biol. Chem., 4:1317-1326 (1993)). The remaining isoforms are entirely associated with cell surface and extracellular matrix HSPGs (Houck, et al, J. Biol. Chem., 247:28031-28037 (1992); Park, et al., Mol. Biol. Chem., 4:1317-1326 (1993)).
  • HSPGs heparin and cell surface heparin sulfate proteoglycans
  • VEGF receptor tyrosine kinases KDR/Flk-1 and/or Fit- 1 , are mostly expressed by EC (Terman, et al., Biochem. Biophys. Res. Commun., 187:1579-1586 (1992); Shibuya, et al, Oncogene, 5:519-524 (1990); De Vries, et al., Science, 265:989-991 (1992); Gitay-Goran, et al, J. Biol. Chem., 287:6003-6096 (1992); Jakeman, et al., J. Clin. Invest, 89:244-253 (1992)).
  • VEGF activities such as mitogenicity, chemotaxis, and induction of morphological changes are mediated by KDR/Flk-1 but not Fit- 1 , even though both receptors undergo phosphorylation upon binding of VEGF (Millauer, et al, Cell, 72:835-846 (1993); Waltenberger, et al., J. Biol. Chem., 269:26988-26995 (1994); Seetharam, et al, Oncogene, 10:135-147 (1995); Yoshida, et al., Growth Factors, 7:131-138 (1996)).
  • VEGF 165 R VEGF ⁇ 5 receptor
  • VEGF ⁇ 5 binds to VEGF ⁇ 5 R via its exon 7- encoded domain which is absent in VEGF ⁇ ⁇ (Soker, et al., J. Biol. Chem., 271 :5761- 5767 (1996)).
  • the function of the receptor was unclear.
  • VEGF ⁇ s acts as an antagonist to all VEGF isoforms, which is surprising since not all forms of VEGF have exon 7.
  • GST glutathione S-transferase
  • VEGF, 65 (SEQ ID NO: 1)).
  • This fusion protein inhibited the binding of 125 I-VEGF ⁇ 65 to receptors on human umbilical cord vein-derived EC (HUVEC) and on 231 cells. The inhibitory activity was localized to the C-terminal portion of the exon 7-encoded domain (amino acids 22-44). Furthermore, the fusion protein inhibited VEGF-induced proliferation of HUVEC. The fusion protein also inhibits VEGF ⁇ ⁇ -induced mitogenicity, which was an unexpected result considering that VEGF i2 ⁇ does not contain exon 7.
  • the polypeptides of the present invention are antagonists against the major isoforms of VEGF and can be used to treat diseases and conditions associated with VEGF-induced neovascularization or angiogenesis.
  • VEGF is directly associated with a number of cancers expressing the VEGF ⁇ 5 R/NP-l (Soker, et al., Cell 92, 735-745 (1998)), and that inhibition of VEGF binding to this receptor can be used to treat such cancers.
  • the present invention provides a polypeptide having a portion of SEQ ID NO: l having VEGF antagonist activity as determined, for example, by the human umbilical vein endothelial cell (HUVEC) proliferation assay using VEGF ⁇ 5 as set forth below in the Examples.
  • the portion has at least a 25% reduction in HUVEC proliferation, more preferably a 50% reduction, even more preferably a 75% reduction, most preferably a 95% reduction.
  • the portion has an even number of cysteine residues.
  • VEGF antagonist activity may also be determined by inhibition of binding of labeled VEGF] 6 to VEGF ⁇ 5 R as disclosed in Soker et al., J. Biol. Chem. 271, 5761- 5767 (1996)) and forth below in the Examples.
  • the portion inhibits binding by at least 25%, more preferably 50%, most preferably 75%.
  • the present invention further provides polypeptides comprising SEQ ID NO: 2 (CSCKNTDSRCKARQLELNERTCRC) or a portion thereof having VEGF antagonist activity as determined, for example, by the human umbilical vein endothelial cell (HUVEC) proliferation assay using VEGF ⁇ 65 as set forth below in the Examples.
  • the portion has at least a 25% reduction in HUVEC proliferation, more preferably a 50% reduction, even more preferably a 75% reduction, most preferably a 95% reduction.
  • the portion has an even number of cysteine residues.
  • One preferred polypeptide of the present invention has the structure of the following formula (I):
  • Xi is H, or any portion of amino acids 2-21 of SEQ ID NO: 1.
  • Xi is H, or C, CR, RC or CRC.
  • the polypeptides of formula (I) have VEGF antagonist activity as determined, for example, by the human umbilical vein endothelial cell (HUVEC) proliferation assay using VEGF) as set forth below in the Examples.
  • the polypeptide has at least a 25% reduction in HUVEC proliferation, more preferably a 50% reduction, even more preferably a 75% reduction, most preferably a 95% reduction.
  • the polypeptide has an even number of cysteine residues.
  • the polypeptides of formula (I) include analogs.
  • Analogs refers to a polypeptide differing from the sequence of one of the peptides of the invention but which still exhibits at least 50% of the VEGF antagonist activity of the polypeptide of SEQ ID NO: 2 in the human umbilical vein endothelial cell (HUVEC) proliferation assay using VEGF ⁇ 5 as set forth below in the Examples.
  • the analog exhibits 75% of the VEGF antagonist activity of the polypeptide of SEQ ID NO: 2, most preferably 95%.
  • the differences are preferably conservative amino acid substitutions, in which an amino acid is replaced with another naturally occurring amino acid of similar character.
  • substitutions are considered "conservative": Gly ⁇ -» Ala; Val ⁇ ->Ile; Asp ⁇ -» Glu; Lys ⁇ -» Arg; Asn ⁇ -> Gin; and Phe -> Tip ⁇ -> Tyr.
  • Nonconservative changes are generally substitutions of one of the above amino acids with an amino acid from a different group (e.g., substituting Asn for Glu), or substituting Cys, Met, His, or Pro for any of the above amino acids.
  • the polypeptides of the present invention are part of a fusion protein or conjugated to a moiety to enhance purification, increase stability and/or to provide a biological activity.
  • the polypeptides of the present invention are used to target cells expressing the VEGF ⁇ 65 R/NP-l.
  • This targeting can be used for diagnostic as well as therapeutic applications.
  • the polypeptide is radiolabeled and used to detect cells expressing the VEGF ⁇ 6 R/NP-l.
  • expression of the receptor has a high correlation to disease state in a number of cancers, such as prostate and breast, particularly metastatic cancers.
  • the polypeptide can be used in a prognostic manner for particular cancers.
  • the polypeptide can be used to deliver agents to cells expressing the VEGF ⁇ 6 jR/NP-l.
  • the polypeptides can be used as carriers to deliver a desired chemical or cytotoxic moiety to the cells.
  • the cytotoxic moiety may be a cytotoxic drug or an enzymatically active toxin of bacterial, fungal or plant origin, or an enzymatically active polypeptide chain or fragment ("A chain") of such a toxin.
  • Enzymatically active toxins and fragments thereof are preferred and are exemplified by diphtheria toxin A fragment, non-binding active fragments of diphtheria toxin, exotoxin A (from Pseudomonas aeruginosa), ricin A chain, abrin A chain, modeccin A chain, alphasarcin, certain Aleurites fordii proteins, certain Dianthin proteins, Phytolacca americana proteins (PAP, PAPII and PAP-S),
  • the invention further provides a method of treating a disease or disorder/condition associated with VEGF-induced neovascularization or angiogenesis.
  • neovascularization refers to the growth of blood vessels and capillaries.
  • Diseases, disorders, or conditions, associated with VEGF-induced neovascularization or angiogenesis include, but are not limited to retinal neovascularization, hemagiomas, solid tumor growth, leukemia, metastasis, psoriasis, neovascular glaucoma, diabetic retinopathy, rheumatoid arthritis, osteoarthritis, endometriosis, mucular degeneration and retinopathy of prematurity (ROP).
  • ROP retinopathy of prematurity
  • a therapeutic amount of a polypeptide of the invention is administered to a host, e.g., human or other mammal, having a disease or condition, associated with VEGF or having a tumor expressing VEGF 165 R/NP- 1.
  • a host e.g., human or other mammal
  • Methods for detecting the expression of VEGF 165 R NP- 1 are set forth in Soker, et al., Cell 92:135-145 (1998).
  • the invention also provides a composition comprising an effective amount of a polypeptide of the invention in combination with a pharmaceutically acceptable carrier.
  • a composition comprising an effective amount of a polypeptide of the invention in combination with a pharmaceutically acceptable carrier.
  • Other aspects of the invention are disclosed infra. BRIEF DESCRIPTION OF THE DRAWINGS
  • Fig. 1 Cross-linking of 125 I-VEGF 165 , 125 I-VEGF, 2 ⁇ , and 125 I-GST-EX 7 to HUVEC.
  • I 25 I-VEGF 165 (5 ng/ml) (lane 1) or 125 I-VEGF, 2 ⁇ (10 ng/ml) (lane 2) or I25 I- GST-EX 7 (50 ng/ml) (lane 3) were bound to subconfluent cultures of HUVEC in 6- cm dishes. The binding was carried out in the presence of 1 ug/ml heparin.
  • each 125 I-VEGF isoform was chemically cross-linked to the cell surface.
  • the cells were lysed and proteins were resolved by 6% SDS-PAGE.
  • the polyacrylamide gel was dried and exposed to x-ray film.
  • HUVEC proliferation in response to VEGF ⁇ 65 and VEGF 12 HUVEC were cultured in 96-well dishes (5,000 cell/well) for 24 h. Increasing amounts of VEGF ⁇ 65 (closed circles) or VEGF 121 (open circles) were added to the medium, and the cells were incubated for 3 more days. DNA synthesis based on the incorporation of [3H] thymidine into HUVEC DNA was measured as described in the Examples. The results represent the average counts in three wells, and the standard deviations were determined.
  • Figs. 3A-3C Inhibition of 125 I-VEGF ⁇ 65 binding to HUVEC, MDA MB 231 cells, and PAE-KDR cells by GST-EX 7 + 8.
  • 125 I-VEGF ⁇ 65 (5 ng/ml) was bound to subconfluent cultures of HUVEC(3A), MDA MB 231 cells (3B), and PAE-KDR cells (3C) in 48-well dishes in the presence of increasing amounts of GST-Ex 7 + 8 (closed square) or control GST protein (open squares).
  • the cells were washed and lysed, and the cell-associated radioactivity was determined with a ⁇ -counter. The counts obtained are expressed as the percentage of the counts obtained in the presence of PBS without addition of GST or fusion protein.
  • Fig. 4 GST-EX 7 + 8 fusion protein inhibits cross-linking of I25 I-VEGF 165 to VEGF 165 R and to KDR/Flk-1.
  • 125 I-VEGF 165 (5 ng/ml) was bound to subconfluent cultures of HUVEC (lanes 1 and 2) and MDA-MB-231 cells (lanes 3 and 4) in 6-cm dishes. The binding was carried out in the presence (lanes 2 and 4) or the absence (lanes 1 and 3) of 15 ug/ml GST-Ex 7 + 8. Heparin (1 ug/ml) was added to each dish. At the end of a 2-h incubation, 123 I-VEGF ⁇ 65 was chemically cross-linked to the cell surface.
  • the cells were lysed, and proteins were resolved by 6% SDS-PAGE. The gel was dried and exposed to x-ray film.
  • Figs. 5 A and 5B Localization of a core inhibitory region within exon 7.
  • GST- Ex 7 fusion proteins containing full-length exon 7-encoded domain or truncations at the N-terminal and C-terminal ends were prepared as described in the Examples. 12:, I- VEGFi 65 (5 ng/ml) was bound to subconfluent HUVEC cultures as described in Fig. 3, in the presence of increasing concentrations of the GST fusion proteins.
  • the cells were washed and lysed, and the cell-associated radioactivity was determined with a ⁇ counter.
  • the counts obtained are expressed as percentage of the counts obtained in the presence of PBS without fusion protein B, the amino acid sequences of VEGF exon 7 derivatives. These derivatives were prepared to contain the first cysteine residue of exon 8 at their C termini to keep an even number of cysteine residue.
  • Fig. 6 GST-Ex 7 + 8 fusion protein inhibits VEGF ⁇ 65 -stimulated HUVEC proliferation.
  • HUVEC were cultured in 96-well dishes (5,000 cell/well) as in Fig. 2. Increasing concentrations of VEGF] 65 (open circles), together with 15 ug/ml GST-Ex 7 + 8 (closed circles) or 25 ug/ml GST (squares), were added to the medium, and the cells were incubated for 4 more days. DNA synthesis was measured in HUVEC as described in Fig. 2. The results represent the average counts of three wells, and the standard deviations were determined.
  • Fig. 7 GST-Ex 7 + 8 fusion protein inhibits VEGF ]65 and VEGF ⁇ ⁇ -stimulated HUVEC proliferation.
  • Increasing concentration of VEGF) 65 (circles) or VEGF ⁇ ⁇ (square) with 15 ug/ml GST-Ex 7 + 8 (closed symbols) or without GST-Ex 7 + 8 (open symbols) were added to HUVEC, and [*H]thymidine incorporation into the DNA was measured as in Fig. 2. The results represent the average counts of three wells, and the standard deviations were determined.
  • the present invention provides isolated polypeptides having VEGF antagonist activity, nucleic acids encoding peptides, pharmaceutical compositions comprising the polypeptides and nucleic acids and methods for treating diseases or disorders associated with VEGF, e.g., tumors that express VEGF ⁇ 65 R/NP-l and VEGF induced angiogenesis.
  • the polypeptides of the invention include polypeptides comprising a portion of SEQ ID NO: 1 having VEGF antagonist activity, polypeptides comprising SEQ ID NO: 2 (CSCKNTDSRCKARQLELNERTCRC) or a portion thereof having VEGF antagonist activity, and a polypeptide having the structure of formula (I), set forth above.
  • the present invention further includes analogs and derivatives of these polypeptides having VEGF antagonist activity.
  • the DNA sequence encoding exon 7 and exon 8 are set forth in the sequence listing as SEQ ID NOS: 17 and 18 respectively.
  • VEGF antagonist activity can be determined using techniques known in the art. For example, VEGF antagonist activity can be determined by looking at a wild type VEGF activity and comparing the inhibition or reduction of such activity when the antagonist polypeptide is used.
  • the polypeptide of SEQ ID NO: 2 can be used as a standard.
  • the portion has at least a 25% reduction in HUVEC proliferation, more preferably a 50% reduction, even more preferably a 75% reduction, most preferably a 95% reduction.
  • the portion has an even number of cysteine residues.
  • VEGF antagonist activity may also be determined by inhibition of binding of labeled VEGF 165 to VEGF ⁇ 65 R as disclosed in Soker et al., J. Biol. Chem. 271, 5761- 5767 (1996)) and forth below in the Examples.
  • the portion inhibits binding by at least 25%, more preferably 50%, most preferably 75%.
  • the ability of the NEGF antagonist polypeptides to influence angiogenesis can also be determined using a number of know in vivo and in vitro assays. Such assays are disclosed in Jain et al., Nature Medicine 3, 1203-1208(1997), the disclosure of which is herein incorporated by reference.
  • assays for the ability to inhibit angiogenesis in vivo include the chick chorioallantoic membrane assay and mouse, rat or rabbit corneal pocket assays. See, Polverini et al., 1991, Methods Enzymol. 198: 440-450.
  • corneal pocket assays a tumor of choice is implanted into the cornea of the test animal in the form of a corneal pocket.
  • the potential angiogenesis inhibitor is applied to the corneal pocket and the corneal pocket is routinely examined for neovascularization.
  • a "derivative" of a NEGF antagonist polypeptide is a polypeptide in which one or more physical, chemical, or biological properties has been altered. Such modifications include, but are not limited to: amino acid substitutions, modifications, additions or deletions; alterations in the pattern of lipidation, glycosylation or phosphorylation; reactions of free amino, carboxyl, or hydroxyl side groups of the amino acid residues present in the polypeptide with other organic and non-organic molecules; and other modifications, any of which may result in changes in primary, secondary or tertiary structure. Yet such a derivative will exhibit at least one of the aforementioned NEGF antagonist activities.
  • the polypeptides of the invention are preferably produced by recombinant methods.
  • polypeptides of the invention may be obtained by chemical synthesis, expression in bacteria such as E. coli and eukaryotes such as yeast, baculovirus, or mammalian cell-based expression systems, etc., depending on the size, nature and quantity of the polypeptide.
  • isolated means that the polypeptide is removed from its original environment (e.g., the native VEGF molecule).
  • a naturally-occurring polynucleotides or polypeptides present in a living animal is not isolated, but the same polynucleotides or DNA or polypeptides, separated from some or all of the coexisting materials in the natural system, is isolated.
  • Such polynucleotides could be part of a vector and/or such polynucleotides or polypeptides could be part of a composition, and still be isolated in that such vector or composition is not part of its natural environment.
  • any suitable system can be used.
  • suitable vectors, expression vectors and constructions therefor will be apparent to those skilled in the art.
  • Suitable expression vectors may be based on phages or plasmids, both of which are generally host-specific, although these can often be engineered for other hosts.
  • Other suitable vectors include cosmids and retroviruses, and any other vehicles, which may or may not be specific for a given system.
  • Control sequences such as recognition, promoter, operator, inducer, terminator and other sequences essential and/or useful in the regulation of expression, will be readily apparent to those skilled in the art.
  • a DNA fragment encoding the polypeptide of the invention, the receptor or fragment thereof, may readily be inserted into a suitable vector.
  • the receiving vector has suitable restriction sites for ease of insertion, but blunt-end ligation, for example, may also be used, although this may lead to uncertainty over reading frame and direction of insertion. In such an instance, it is a matter of course to test transformants for expression, 1 in 6 of which should have the correct reading frame.
  • Suitable vectors may be selected as a matter of course by those skilled in the art according to the expression system desired.
  • the desired polypeptide or protein By transforming a suitable organism or, preferably, eukaryotic cell line, such as HeLa, with the plasmid obtained, selecting the transformant with ampicillin or by other suitable means if required, and adding tryptophan or other suitable promoter-inducer (such as indoleacrylic acid) if necessary, the desired polypeptide or protein may be expressed.
  • the extent of expression may be analyzed by SDS polyacrylamide gel electrophoresis-SDS-PAGE (Lemelli, Nature 227:680-685 (1970)). Suitable methods for growing and transforming cultures etc. are usefully illustrated in, for example, Maniatis (Molecular Cloning, A Laboratory Notebook, Maniatis et al. (eds.), Cold Spring Harbor Labs, N.Y. (1989)).
  • Cultures useful for production of polypeptides or proteins may suitably be cultures of any living cells, and may vary from prokaryotic expression systems up to eukaryotic expression systems.
  • One preferred prokaryotic system is that of E. coli, owing to its ease of manipulation.
  • a higher system such as a mammalian cell line, for expression of an eukaryotic protein.
  • Currently preferred cell lines for transient expression are the HeLa and Cos cell lines.
  • Other expression systems include the Chinese Hamster Ovary (CHO) cell line and the baculovirus system.
  • streptomycetes for example, and yeasts, such as Saccharomyces spp., especially S. cerevisiae. Any system may be used as desired, generally depending on what is required by the operator. Suitable systems may also be used to amplify the genetic material, but it is generally convenient to use E. coli for this purpose when only proliferation of the DNA is required.
  • polypeptides and proteins may be isolated from the fermentation or cell culture and purified using any of a variety of conventional methods including: liquid chromatography such as normal or reversed phase, using HPLC, FPLC and the like; affinity chromatography (such as with inorganic ligands or monoclonal antibodies); size exclusion chromatography; immobilized metal chelate chromatography; gel electrophoresis; and the like.
  • liquid chromatography such as normal or reversed phase, using HPLC, FPLC and the like
  • affinity chromatography such as with inorganic ligands or monoclonal antibodies
  • size exclusion chromatography size exclusion chromatography
  • immobilized metal chelate chromatography immobilized metal chelate chromatography
  • gel electrophoresis gel electrophoresis
  • the polypeptides may also be generated by any of several chemical techniques. For example, they may be prepared using the solid-phase synthetic technique originally described by R. B. Merrifield, "Solid Phase Peptide Synthesis. I.
  • one method of treatment involves attachment of a suitable toxin to the peptides which then target the area of the tumor.
  • a suitable toxin may comprise toxic radioisotopes, heavy metals, enzymes and complement activators, as well as such natural toxins as ricin which are capable of acting at the level of only one or two molecules per cell.
  • suitable physiologically active compounds which may be used, for example, to treat cancers.
  • the present invention provides for the administration of, for example, peptides to a patient, then this may be by any suitable route. If the tumor is still thought to be, or diagnosed as, localized, then an appropriate method of administration may be by injection direct to the site.
  • Administration may also be by injection, including subcutaneous, intramuscular, intravenous and intradermal injections.
  • Formulations may be any that are appropriate to the route of administration, and will be apparent to those skilled in the art.
  • the formulations may contain a suitable carrier, such as saline, and may also comprise bulking agents, other medicinal preparations, adjuvants and any other suitable pharmaceutical ingredients. Catheters are another preferred mode of administration.
  • the term "effective amount” refers to an amount of VEGF antagonist polypeptide or nucleic acid encoding the polypeptide sufficient to exhibit a detectable therapeutic effect.
  • the therapeutic effect may include, for example, without limitation, inhibiting the growth of undesired tissue or malignant cells, inhibiting inappropriate angiogenesis (neovascularization), limiting tissue damage caused by chronic inflammation, inhibition of tumor cell growth, and the like.
  • the precise effective amount for a subject will depend upon the subject's size and health, the nature and severity of the condition to be treated, and the like. Thus, it is not possible to specify an exact effective amount in advance. However, the effective amount for a given situation can be determined by routine experimentation based on the information provided herein.
  • pharmaceutically acceptable refers to compounds and compositions which may be administered to mammals without undue toxicity.
  • Exemplary pharmaceutically acceptable salts include mineral acid salts such as hydrochlorides, hydrobromides, phosphates, sulfates, and the like; and the salts of organic acids such as acetates, propionates, malonates, benzoates, and the like.
  • the VEGF antagonist polypeptides are administered orally, topically, or by parenteral means, including subcutaneous and intramuscular injection, implantation of sustained release depots, intravenous injection, intranasal administration, and the like. Accordingly, VEGF antagonists may be administered as a pharmaceutical composition comprising a VEGF antagonist in combination with a pharmaceutically acceptable carrier.
  • compositions may be aqueous solutions, emulsions, creams, ointments, suspensions, gels, liposomal suspensions, and the like.
  • Suitable carriers include water, saline, Ringer's solution, dextrose solution, and solutions of ethanol, glucose, sucrose, dextran, mannose, mannitol, sorbitol, polyethylene glycol (PEG), phosphate, acetate, gelatin, collagen, Carbopol Registered TM , vegetable oils, and the like.
  • Cream or ointment bases useful in formulation include lanolin, Silvadene Registered TM (Marion), Aquaphor Registered TM (Duke Laboratories), and the like.
  • Other topical formulations include aerosols, bandages, and other wound dressings.
  • Other devices include indwelling catheters and devices such as the Alzet Registered TM minipump.
  • Ophthalmic preparations may be formulated using commercially available vehicles such as Sorbi-care Registered TM (Allergan), Neodecadron
  • TM Merck, Sharp & Dohme
  • Lacrilube Registered TM Lacrilube Registered TM
  • topical preparations such as that described in U.S. Pat. No. 5,124,155, incorporated herein by reference.
  • VEGF antagonist in solid form, especially as a lyophilized powder. Lyophilized formulations typically contain stabilizing and bulking agents, for example human serum albumin, sucrose, mannitol, and the like. A thorough discussion of pharmaceutically acceptable excipients is available in Remington's Pharmaceutical Sciences (Mack Pub. Co.).
  • the antagonist polypeptides of the present invention can be used topically or intravascularly.
  • topical applications the formulation would be applied directly at a rate of about 10 ng to about 1 mg/cm /day.
  • the inhibitor is used at a rate of about 1 mg to about 10 mg/kg/day of body weight.
  • the formulation may be released directly into the region to be treated either from implanted slow release polymeric material or from slow release pumps or repeated injections. The release rate in either case is about 100 ng to about 100 mg/day/cm 3 .
  • the VEGF antagonist polypeptides of the invention can be combined with a therapeutically effective amount of another molecule which negatively regulates angiogenesis which may be, but is not limited to, TNP-470, platelet factor 4, thrombospondin-1, tissue inhibitors of metalloproteases (TIMPl and TIMP2), prolactin (16-Kd fragment), angiostatin (38-Kd fragment of plasminogen), endostatin, bFGF soluble receptor, transforming growth factor ⁇ , interferon alfa, soluble KDR and FLT- 1 receptors and placental proliferin-related protein.
  • TNP-470 TNP-470
  • platelet factor 4 thrombospondin-1
  • tissue inhibitors of metalloproteases TIMP2
  • prolactin (16-Kd fragment
  • angiostatin 38-Kd fragment of plasminogen
  • endostatin bFGF soluble receptor
  • transforming growth factor ⁇ interferon alfa
  • a VEGF antagonist polypeptide of the invention may also be combined with chemotherapeutic agents.
  • Diseases, disorders, or conditions, associated with abnormal angiogenesis or neovascularization, and can be treated with a therapeutic compound of the invention include, but are not limited to retinal neovascularization, tumor growth, hemagioma, solid tumors, leukemia, metastasis, psoriasis, neovascular glaucoma, diabetic retinopathy, arthritis, endometriosis, and retinopathy of prematurity (ROP).
  • ROP retinopathy of prematurity
  • Nucleic acid e.g., DNA
  • a VEGF antagonist polypeptide of the invention can be delivered to a host by any method known to those of skill in the art to treat disorders associated with VEGF.
  • a preferred embodiment of the present invention relates to methods of inhibiting angiogenesis of solid tumors to prevent further tumor growth and eventual metastasis.
  • any solid tumor or the region surrounding the tumor accessible to gene transfer will be a target for the disclosed therapeutic applications.
  • a DNA encoding a VEGF antagonist polypeptide of the invention or a derivative or analog thereof, housed within a recombinant viral - or non-viral-based gene transfer system may be directed to target cells within proximity of the tumor by any number of procedures known in the art, including but not limited to (a) surgical procedures coupled with administration of an effective amount of the DNA to the site in and around the tumor (involving initial removal of a portion or the entire tumor, if possible); (b) injection of the gene transfer vehicle directly into or adjacent to the site of the tumor; and, (c) localized or systemic delivery of the gene transfer vector and/or gene product using techniques known in the art.
  • any solid tumor which contains VEGF or VEGF ⁇ 65 R/NP-l or NP-2 expressing cells will be a potential target for treatment.
  • solid tumors which will be particularly vulnerable to gene therapy applications are (a) neoplasms of the central nervous system such as, but again not necessarily limited to glioblastomas, astrocytomas, neuroblastomas, meningiomas, ependymomas; (b) cancers of hormone-dependent, tissues such as prostate, testicles, uterus, cervix, ovary, mammary carcinomas including but not limited to carcinoma in situ, medullary carcinoma, tubular carcinoma, invasive (infiltrating) carcinomas and mucinous carcinomas; (c) melanomas, including but not limited to cutaneous and ocular melanomas; (d) cancers of the lung which at least include squamous cell carcinoma, spindle carcinoma, small cell carcinoma, adenocarcinoma and
  • Expression vectors are defined herein as DNA sequences that are required for the transcription of cloned copies of genes and the translation of their mRNAs in an appropriate host. Such vectors can be used to express eukaryotic genes in a variety of hosts such as bacteria, bluegreen algae, fungal cells, yeast cells, plant cells, insect cells and animal cells. Specifically designed vectors allow the shuttling of DNA between hosts such as bacteria-yeast or bacteria-animal or bacteria- insect cells.
  • An appropriately constructed expression vector should contain: an origin of replication for autonomous replication in host cells, selectable markers, a limited number of useful restriction enzyme sites, a potential for high copy number, and active promoters.
  • a promoter is defined as a DNA sequence that directs RNA polymerase to bind to DNA and initiate RNA synthesis. A strong promoter is one which causes mRNAs to be initiated at high frequency.
  • Expression vectors may include, but are not limited to, cloning vectors, modified cloning vectors, specifically designed plasmids or viruses.
  • mammalian expression vectors may be used to express recombinant VEGF antagonists in mammalian cells.
  • Commercially available mammalian expression vectors which may be suitable for recombinant expression, include but are not limited to, pcDNA3.1 (Invitrogen), pBlueBacHis2 (Invitrogen), pLITMUS28,pLITMUS29, pLITMUS38 and pLITMUS39 (New England BioLabs), pcDNAI, pcDNAlamp (Invitrogen), pcDNA3 (Invitrogen), pMClneo (Stratagene), pXTl (Stratagene), pSG5 (Stratagene), EBO-pSV2-neo (ATCC 37593) pBPV- 1(8-2) (ATCC 37110), pdBPV-MMTneo(342-12) (ATCC 37224), pRSVgpt (ATCC 37199), pRSVneo
  • DNA encoding a VEGF antagonist of the invention may also be cloned into an expression vector for expression in a recombinant host cell.
  • Recombinant host cells may be prokaryotic or eukaryotic, including but not limited to bacteria, yeast, mammalian cells including but not limited to cell lines of human, bovine, porcine, monkey and rodent origin, and insect cells including but not limited to drosophila, moth, mosquito and armyworm derived cell lines.
  • the expression vector may be introduced into host cells via any one of a number of techniques including but not limited to transformation, transfection, Ad/polylysine DNA complexes, protoplast fusion, and electroporation.
  • Cell lines derived from mammalian species which may be suitable and which are commercially available, include but are not limited to, CV-1 (ATCC CCL 70), COS-1 (ATCC CRL 1650), COS-7 (ATCC CRL 1651), CHO-K1 (ATCC CCL 61),3T3 (ATCC CCL 92), NIH/3T3 (ATCC CRL 1658), HeLa (ATCC CCL 2), C1271 (ATCC CRL 1616), BS- C-l (ATCC CCL 26) and MRC-5 (ATCC CCL 171) and HEK 293 cells.
  • CV-1 ATCC CCL 70
  • COS-1 ATCC CRL 1650
  • COS-7 ATCC CRL 1651
  • CHO-K1 ATCC CCL 61
  • 3T3 ATCC CCL 92
  • NIH/3T3 ATCC CRL 1658
  • HeLa ATCC CCL 2
  • C1271 ATCC CRL 1616
  • BS- C-l ATCC CCL 26
  • Insect cell lines which may be suitable and are commercially available include but are not limited to 3M-S (ATCC CRL 8851) moth (ATCC CCL 80) mosquito (ATCC CCL 194 and 195; ATCC CRL 1660 and 1591) and armyworm (Sf9, ATCC CRL 1711).
  • 3M-S ATCC CRL 8851
  • moth ATCC CCL 80
  • ATCC CRL 1660 and 1591 mosquito
  • Sf9 ATCC CRL 1711
  • a DNA fragment encoding a VEGF antagonist polypeptide may be delivered either systemically or to target cells in the proximity of a solid tumor of the mammalian host by viral or non-viral based methods.
  • Viral vector systems which may be utilized in the present invention include, but are not limited to, (a) adenovirus vectors; (b) retrovirus vectors; (c) adeno- associated virus vectors; (d) herpes simplex virus vectors; (e) SV 40 vectors; (f) polyoma virus vectors; (g) papilloma virus vectors; (h) picarnovirus vectors; and (i) vaccinia virus vectors.
  • the recombinant virus or vector containing the DNA encoding the VEGF antagonist of the present invention is preferably administered to the host by direct injection into a solid tumor and/or quiescent tissue proximal to the solid tumor, such as adipose or muscle tissue. It will of course be useful to transfect tumor cells in the region of targeted adipose and muscle tissue. Transient expression of the VEGF antagonist in these surrounding cells will result in a local extracellular increase in these peptides and will promote binding with VEGF receptors, thus inhibiting binding of VEGF to the receptors.
  • Non-viral vectors which are also suitable include DNA-lipid complexes, for example liposome-mediated or ligand/ poly-L-Lysine conjugates, such as asialoglyco- protein-mediated delivery systems (see, e.g., Feigner et al., 1994, J. Biol. Chem. 269: 2550-2561; Derossi et al., 1995, Restor. Neurol. Neuros. 8: 7-10; and Abcallah et al., 1995, Biol. Cell 85:1-7).
  • DNA-lipid complexes for example liposome-mediated or ligand/ poly-L-Lysine conjugates, such as asialoglyco- protein-mediated delivery systems (see, e.g., Feigner et al., 1994, J. Biol. Chem. 269: 2550-2561; Derossi et al., 1995, Restor. Neurol. Neuros. 8: 7-10; and Abcallah et al., 1995
  • the invention also provides a pharmaceutical pack or kit comprising one or more containers filled with one or more of the ingredients of the pharmaceutical compositions of the invention.
  • a pharmaceutical pack or kit comprising one or more containers filled with one or more of the ingredients of the pharmaceutical compositions of the invention.
  • Optionally associated with such containers can be a notice in the form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals or biological products, which notice reflects approval by the agency of manufacture, use or sale for human administration.
  • VEGF ]65 was purified from the conditioned medium of infected Sf-21 cells by heparin affinity chromatography, and VEGF 121 was purified by anion exchange chromatography.
  • Basic FGF was kindly provided by Dr. Judith Abraham (Scios, Sunnyvale, CA). Cell culture media were purchased from
  • I-Sodium was purchased from NEN Life Science Products. Disuccinimidyl suberate and IODO-BEADS were purchased from Pierce. G- glutathione-agarose, NAP-5 columns, and pGEX-2TK plasmid were purchased from Pharmacia Biotech Inc. TSK-heparin columns were purchased from TosoHaas (Tokyo, Japan). Molecular weight marker was purchased from Amersham Corp. (IL). Porcine intestinal mucosal-derived heparin was purchased from Sigma.
  • Human umbilical vein endothelial cells were obtained from the American Type Culture Collection (ATCC) (Rockville, MD) and grown on gelatin- coated dishes in M-199 medium containing 20% fetal calf serum (FCS) and a mixture of glutamine, penicillin, and streptomycin (GPS). Basic FGF (1 ng/ml) was added to the culture medium every other day.
  • Porcine endothelial cells PAE
  • parental and transfected to express KDR/Flk-1 PAE-KDR
  • MDA- MB-231 (231) cells were obtained from ATCC and grown in Bulbecoo's modified Eagle's medium containing 10% FCS and GPS. Endothelial Cell Proliferation Assay.
  • HUVEC HUVEC were seeded in gelatin-coated 96-well dishes at 4,000 cells/200 Ul/well in M-199 containing 5% FCS and GPS. After 24 H, VEGF isoforms and VEGF exon 7-GST fusion proteins were added to the wells at the same time. The cells were incubated for 72 h, and [3H]thymidine (1 ⁇ C/ml) was added for 10-12 h. The medium was aspirated, and the cells were trypsinized and harvested by an automatic cell harvester (TOMTEC) and loaded onto Filtermats (Wallac). The Filtermats were scanned and cpm were determined by a MicroBeta counter (Wallac). The results represent the average of samples assayed in triplicate, and the standard derivations were determined. All experiments were repeated at least three times and similar results were obtained.
  • TOMTEC automatic cell harvester
  • Radioiodination of VEGF was carried out using IODO-
  • BEADS according to the manufacturer's instructions. Briefly, one IODO-BEAD was rinsed with 100 ul of 0.1 M sodium phosphate, pH 7.2, dried, and incubated with 125 I- sodium (0.2 mCi/ug protein) in 100 ul of 0.1 M sodium phosphate, pH 7.2, for 5 min at room temperature. VEGF (1-3 ug) was added to the reaction mixture, and after 5 min the reaction was stopped by removing the bead. The solution containing 125 I-
  • VEGF was adjusted to 2 mg/ml gelatin and purified by size exclusion chromatography using a NAP-5 column that was pre-equilibrated with PBS containing 2 mg/ml gelatin. Aliquots of the iodinated proteins were frozen on dry ice and stored at -80 JC. The specific activity ranged from 40,000 to 100,000 cpm/ng protein.
  • I25 I- VEGF cross-linked complexes were resolved by 6% SDS-PAGE, and the gels were exposed to a phosphor screen and scanned after 24 h by a Phosphorlmager (Molecular Dynamics). Subsequently, the gels were exposed to x-ray film.
  • exon 7 + 8 Ex 7 + 8
  • CGGGATCCCCCCTGTGGGCCTTGCTC SEQ ID NO:4
  • GGAATTCTTACCGCTCGGCTTGTC SEQ ID NO:5
  • exon 7 Ex 7
  • CGGGATCCCCCTGTGGGCCTTGCTC SEQ ID NO:6
  • GGAATTCTTAACATCTGCAAGTACGTT SEQ ID NO:7
  • exon 7 with residues 1-10 deleted Ex 7d-(l-10)
  • CGGGATCCCATTTGTTTGTACAAGAT SEQ ID NO:8
  • GGAATTCTTAACATCTGCAAGTACGTT SEQ ID NO:9
  • GGAATTCTTAACATCTGCAAGTACGTT SEQ ID NO: 14
  • exon 7 with residues 30-44 deleted (Ex 7d-(30-44)
  • CGGGATCCCCCTGTGGGCCTTGCTC SEQ ID NO: 15
  • GGAATTCTAGTCTGTGTTTTTGCA SEQ ID NO: 16
  • the amplified products were digested with BamHI and EcoRI restriction enzymes and cloned into the vector pGEK-2TK (Pharmacia Biotech Inc.) encoding GST (Smith, et al., Gene(Amst), 87, 31-40 (1988)) to yield the plasmid p2TK-exon 7 + 8 and its derivatives.
  • Escherichia coli (DH4a) were transformed with p2TK-exon 7 + 8 and derivatives to produce GST fusion proteins (see Fig. 5B for sequences).
  • Bacterial lysates were subsequently separated by a glutathione-agarose affinity chromatography (Smith, et al., Gene(AmsL), 87, 31-40 (1988)). Samples eluted from glutatione-agarose were analyzed by 15% SDS-PAGE and silver staining. GST fusion proteins were further on a TSK-heparin column as described.
  • VEGC 165 and VEGF ⁇ 2 ⁇ differ in their ability to interact with VEGF receptors expressed on HUVEC (Soker, et al., J. Biol. Chem., 271, 5761-5767 (1996), Gitay-
  • VEGF l2 ⁇ binds to KDR/Flk-1 to form a 240-kDa labeled complex (Fig. 1, lane 2), whereas VEGF ⁇ 65 in addition to forming this size complex, also forms a lower molecular mass complex of 165 -175 kDa (Fig. 1, lane 1).
  • This isoform-specific receptor has been named the VEGF ⁇ 65 receptor (VEGF165R).
  • VEGF )65 was a more potent mitogen for HUVEC than was VEGF ⁇ ⁇ (Fig. 2).
  • VEGF ⁇ 65 stimulated half-maximal DNA synthesis at 1 ng/ml and maximal stimulation at 4 ng/ml resulting in an 8-fold increase over control.
  • 2 ng/ml VEGF 121 were required for half-maximal stimulation and 20 ng/ml for maximal stimulation resulting in a 4- fold increase in HUVEC proliferation over control.
  • twice as much VEGF] j compared with VEGF] 65 was needed to attain half-maximal stimulation, and VEGF ⁇ 2 ⁇ - induced proliferation was saturated at about one-half the level induced by VEGF 165 .
  • a Fusion Protein Containing the Exons 7- and 8-Encoded Domains Inhibits the Binding of 125 I-VEGF ⁇ 65 to Receptors on HUVEC and 231 Cells.
  • GST fusion proteins containing a peptide encoded by VEGF exon 7 or by VEGF exons 7 and 8 were prepared.
  • exon 8 The 6 amino acids encoded by exon 8 which is C-terminal to exon 7 were included to facilitate the preparation of the fusion protein but did not affect the results in any way (data not shown).
  • the exon 7 fusion protein binds directly to VEGF
  • the GST-Ex 7 fusion protein encompasses the entire 44 amino acid exon 7- encoded domain. To determine whether a core inhibitory region exists, deletions were made at the N and C termini of exon 7, and the effects on I2: T-VEGFi 65 binding to
  • HUVEC HUVEC were measured (Fig. 5).
  • a fusion protein containing the exon 7-encoded domain plus the cysteine residue at position of exon 8 was included to keep the number of cysteine residues in the VEGF portion of the fusion protein even.
  • the GST-Ex 7 fusion protein inhibited 125 I-VEGF ⁇ 65 binding to HUVEC by 80% at 2 ug/ml fusion protein (Fig. 5). Inhibition of 125 -I-VEGF ⁇ 65 binding to HUVEC and 231 cells was comparable to that of GST-Ex 7 + 8 (data not shown).
  • VEGF )65 binding to KDR/Flk-1 by the GST-Ex 7 + 8 fusion protein as shown in Fig. 4 suggested that it might also be an inhibitor of VEGF ⁇ 65 mitogenicity since KDR/Flk-1 mediates VEGF mitogenic activity (Waltenberger, et al., J. Biol. Chem., 269, 26988-26995 (1994)).
  • Addition of 1-5 ng/ml VEGF 165 to HUNEC resulted in a 5.5-fold increase in the proliferation rate, peaking at 2.5 ng/ml (Fig. 6).
  • 15 ug/ml GST-Ex 7 + 8 was added in addition to NEGF ⁇ 65 . HUVEC proliferation was reduced by about 60%.
  • GST-Ex 7 + 8 inhibits the level of VEGF ⁇ 65 -induced mitogenicity, about 2- fold, to about the level of VEGF 121 -induced mitogenicity (Fig. 7).
  • GST-Ex 7 + 8 at 15 ug/ml, also inhibited VEGF ⁇ 2 j -mediated HUVEC proliferation, by about 2-fold. This was an unexpected result considering that VEGF ⁇ 2) does not contain exon 7.
  • the effect of GST-EX 7 + 8 on the binding of 3 I-VEGF ⁇ 2 ⁇ to VEGF receptors was analyzed by cross-linking studies.
  • VEGF 165 and VEFG ⁇ ⁇ The most abundant of the VEGF isoforms are VEGF 165 and VEFG ⁇ ⁇ .
  • An important question in terms of understanding VEGF biology is whether these isoforms differ in their biochemical and biological properties.
  • VEGF ⁇ 65 but not VEGF 121 binds to cell-surface HSPG (Houck, et al., Mol. Endocrinol, 8, 1806-1814 (1991), Houck, et al., J. Biol. Chem., 247, 28031- 28037 (1992), Park, et al, Mol. Biol.
  • VEGF, 65 is a more potent EC mitogen than is VEGF121 (Smith, et al., Gene(Amst.), 87, 31-40 (1988)) (Fig. 2).
  • a novel 130-kDa VEGF receptor found on the surface of HUVEC and tumor cells that is specific in that it binds VEGF 165 but not VEGF 12 ⁇ (Soker, et al, J. Biol. Chem., 271, 5761-5767 (1996)).
  • VEGF 165 binds to this receptor, termed VEGF ⁇ 65 R, via the 44 amino acids encoded by exon 7, the exon which is present in VEGF ⁇ 65 but not VEGF ⁇ 2 ⁇ .
  • KDR Flk-1 and Flt-1 bind both VEGF ⁇ 65 and VEGF I2 ⁇ and do so via the VEGF exons 4 and 3, respectively (Keyt, et al., J. Biol. Chem., 271, 5638-5646 (1996)).
  • Our goal in the present study was to determine whether exon 7 modulated VEGF 165 activity, in particular mitogenicity for HUVEC, and by what mechanism.
  • the GST-Ex 7 + 8 fusion protein inhibited VEGF ⁇ 65 -induced proliferation of HUVEC by about 60%, to a level equivalent to that induced by VEGF 121 suggesting that activation of the KDR/Flk-1 tyrosine kinase receptor was somehow being adversely affected.
  • cross-linking analysis showed that the fusion protein not only inhibited cross-linking of 125 I-VEGF I65 to VEGF ⁇ 65 R but to KDR/Flk-1 as well.
  • a VEGF 165 dimer interacts simultaneously with KDR/Flk-1 via the exon 4 domain and with VEGF 1 5 R via the exon 7 domain, generating a three-component complex.
  • the GST-Ex 7 + 8 fusion protein by competing directly with the binding of VEGF ⁇ 65 to VEGF 165 R impairs indirectly the ability of VEGF 165 to bind to the signaling receptor, KDR/Flk-1.
  • an efficient binding of VEGF ⁇ 65 to KDR/Flk-1 might be dependent in part on successful interaction with VEGF165R.
  • the exon 7-encoded domain contains a heparin-binding domain (Soker, et al., J. Biol.
  • VEGF 1 5 R and KDR Flk-1 are in proximity on the cell surface and that excess GST- Ex 7 + 8 bound to VEGF 165 R sterically inhibits access of VEGF121 to KDR/Flk-1.
  • Cross-linking analysis did indeed show diminished binding of I-VEGF 1 21 to KDR/Flk-1 in the presence of GST-Ex 7 + 8 which does not bind directly to KDR/Flk- 1, suggesting an indirect effect of the fusion protein on the binding of VEGF 121 to KDR/Flk-1.
  • GST-Ex 7 + 8 also inhibits VEGF] 65 binding to 231 breast cancer cells, which express VEGF165R and not KDR/Flk-1.
  • VEGF 165 The coordinate binding of VEGF 165 to a higher and to a lower affinity receptor (KDR/Flk-1 and VEGF )65 R, respectively) on HUVEC (Soker, et al., J. Biol. Chem., 271, 5761-5767 (1996)) and the inhibitory effects of GST-Ex 7 + 8 fusion protein on the binding of VEGF 1 65 to these two receptors suggest that there is a dual receptor system at work in mediating VEGF ⁇ 65 activity.
  • Several other growth factors have been shown to bind to high and low affinity receptors.
  • Transforming growth factor- ⁇ generates a complex with three receptors; two of the, receptors I and II, are the signaling receptors, whereas transforming growth factor-B receptor Ill/betaglycan is a lower affinity accessory binding molecule (Lopez-Casillas, et al., Cell, 47, 785-796 (1991)).
  • the low affinity receptor for the nerve factor family, p75 is part of a complex with the signaling TRK receptors (Barbacid, M., Curr. Opin. Cell Biol, 1, 148-155 (1995)).
  • a different type of dual receptor recognition is the binding of bFGF to cell-surface HSPGs and its signaling receptors (Yayon, et al., Cell, 64, 841-848
  • Receptor binding studies were used to identify an inhibitory core within the 44 amino acids encoded by exon 7. Deletions were made in both the N-terminal and C- terminal regions of exon 7, and the inhibitory activity was localized to the 23-amino acid C-terminal portion of exon 7 (amino acids 22-44). Of these 23 amino acids, 5 are cysteine residues. The high proportion of cysteine residues suggests that this domain has a defined three-dimensional structure required for efficient binding to VEGF 165 R. The cysteine residue at position 22 of the exon 7 domain is critical for inhibitory activity, probably for maintenance of a necessary three-dimensional structure.
  • cysteine residue is not involved in the formation of interdisulfide bounds between two VEGF monomers but might rather involve intradisulfide bonding within the monomer.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Engineering & Computer Science (AREA)
  • Rheumatology (AREA)
  • Immunology (AREA)
  • Pain & Pain Management (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Heart & Thoracic Surgery (AREA)
  • Cardiology (AREA)
  • Orthopedic Medicine & Surgery (AREA)
  • Physical Education & Sports Medicine (AREA)
  • Cell Biology (AREA)
  • Toxicology (AREA)
  • Zoology (AREA)
  • Oncology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Peptides Or Proteins (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

L'invention porte sur des polypeptides isolés à activité d'antagonistes du VEGF, sur des préparations pharmaceutiques et des méthodes de traitement associées. Lesdits polypeptides en comprennent certains qui comportent une partie de la SEQ ID NO:1 à activité d'antagonistes du VEGF, certains autres qui comportent la SEQ ID NO:2 ou l'une de ses parties à activité d'antagonistes du VEGF, ainsi qu'un polypeptide présentant la structure de la formule (I) donnée ci-dessus. L'invention porte en outre sur des analogues et dérivés des susdits polypeptides à activité d'antagonistes du VEGF.
EP98963815A 1997-12-09 1998-12-09 Peptides antagonistes du facteur de croissance de l'endothelium vasculaire Withdrawn EP1037994A1 (fr)

Applications Claiming Priority (5)

Application Number Priority Date Filing Date Title
US6915597P 1997-12-09 1997-12-09
US69155P 1997-12-09
US6968797P 1997-12-12 1997-12-12
US69687P 1997-12-12
PCT/US1998/026103 WO1999029861A1 (fr) 1997-12-09 1998-12-09 Peptides antagonistes du facteur de croissance de l'endothelium vasculaire

Publications (1)

Publication Number Publication Date
EP1037994A1 true EP1037994A1 (fr) 2000-09-27

Family

ID=26749747

Family Applications (1)

Application Number Title Priority Date Filing Date
EP98963815A Withdrawn EP1037994A1 (fr) 1997-12-09 1998-12-09 Peptides antagonistes du facteur de croissance de l'endothelium vasculaire

Country Status (5)

Country Link
EP (1) EP1037994A1 (fr)
JP (2) JP4312955B2 (fr)
AU (2) AU1906099A (fr)
CA (1) CA2313390A1 (fr)
WO (2) WO1999030157A2 (fr)

Families Citing this family (23)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7423125B2 (en) 1995-08-01 2008-09-09 Vegenics Limited Antibodies to VEGF-C
US6635421B1 (en) * 1997-12-09 2003-10-21 Children's Medical Center Corporation Neuropilins and use thereof in methods for diagnosis and prognosis of cancer
US7045133B2 (en) * 2000-01-18 2006-05-16 Ludwig Institute For Cancer Research VEGF-D/VEGF-C/VEGF peptidomimetic inhibitor
EP1259626B1 (fr) 2000-02-25 2007-10-31 Ludwig Institute For Cancer Research Materiaux et procedes impliquant un hybride d'adn de facteur de croissance de l'endothelium vasculaire et de proteines
AU2001266696A1 (en) 2000-06-02 2001-12-11 Bracco Research Usa Compounds for targeting endothelial cells
US8263739B2 (en) 2000-06-02 2012-09-11 Bracco Suisse Sa Compounds for targeting endothelial cells, compositions containing the same and methods for their use
AU2001285919B2 (en) * 2000-09-05 2007-08-23 Jiangsu Simcere Pharmaceutical R&D Co., Ltd Recombinant endothelial cell growth inhibitors derived from a mammalian plasminogen
GB0029015D0 (en) 2000-11-28 2001-01-10 Univ London Medical device
US7611711B2 (en) 2001-01-17 2009-11-03 Vegenics Limited VEGFR-3 inhibitor materials and methods
US7794693B2 (en) 2002-03-01 2010-09-14 Bracco International B.V. Targeting vector-phospholipid conjugates
CA2513044A1 (fr) 2002-03-01 2004-08-05 Dyax Corp. Peptides de liaison kdr et vegf/kdr et leur utilisation a des fins diagnostiques et therapeutiques
US7261876B2 (en) 2002-03-01 2007-08-28 Bracco International Bv Multivalent constructs for therapeutic and diagnostic applications
US8623822B2 (en) 2002-03-01 2014-01-07 Bracco Suisse Sa KDR and VEGF/KDR binding peptides and their use in diagnosis and therapy
GB0207644D0 (en) * 2002-04-02 2002-05-15 Ark Therapeutics Ltd Peptides and their use
PL1944312T3 (pl) 2003-03-03 2012-12-31 Dyax Corp Peptydy, które specyficznie wiążą receptor HGF (CMET) i ich zastosowanie
MX2008001966A (es) * 2005-08-12 2008-03-26 Regeneron Pharma Tratamiento de enfermedades mediante administracion subcutanea de un antagonista vegf.
ES2363758T3 (es) 2005-08-15 2011-08-16 Vegenics Pty Ltd Vegf y pdgf modificados con propiedades angiogénicas mejoradas.
RU2395090C2 (ru) * 2005-10-21 2010-07-20 БАЙЕР ХелсКер ЛЛСи Способы прогнозирования и предсказания рака и мониторинг терапии раковых заболеваний
UA96139C2 (uk) 2005-11-08 2011-10-10 Дженентек, Інк. Антитіло до нейропіліну-1 (nrp1)
CN102711756A (zh) * 2010-01-14 2012-10-03 株式会社三和化学研究所 用于预防或治疗伴有眼内血管生成及/或眼内血管通透性增高的疾病的药物
NZ605449A (en) 2010-07-09 2015-03-27 Genentech Inc Anti-neuropilin antibodies and methods of use
US11505610B2 (en) 2018-04-06 2022-11-22 Atyr Pharma, Inc. Compositions and methods comprising anti-NRP2 antibodies
US11807687B2 (en) 2019-10-03 2023-11-07 Atyr Pharma, Inc. Therapeutic compositions comprising anti-NRP2 antibodies

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1173991C (zh) * 1992-11-13 2004-11-03 马克斯普朗克科学促进协会 作为血管内皮生长因子受体的f1k-1
US6020473A (en) * 1995-08-25 2000-02-01 Genentech, Inc. Nucleic acids encoding variants of vascular endothelial cell growth factor

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO9929861A1 *

Also Published As

Publication number Publication date
AU1906099A (en) 1999-06-28
WO1999030157A9 (fr) 1999-10-21
AU1810899A (en) 1999-06-28
CA2313390A1 (fr) 1999-06-17
WO1999029861A1 (fr) 1999-06-17
JP2009148293A (ja) 2009-07-09
WO1999030157A2 (fr) 1999-06-17
JP2001526032A (ja) 2001-12-18
WO1999030157A3 (fr) 1999-07-22
JP4312955B2 (ja) 2009-08-12

Similar Documents

Publication Publication Date Title
US7414027B2 (en) Peptide antagonists of vascular endothelial growth factor
WO1999029861A1 (fr) Peptides antagonistes du facteur de croissance de l'endothelium vasculaire
US7736655B2 (en) Soluble inhibitors of vascular endothelial growth factor and use thereof
US7335357B2 (en) Antagonists of neuropilin receptor function and use thereof
US6635421B1 (en) Neuropilins and use thereof in methods for diagnosis and prognosis of cancer
US20140294941A1 (en) Anti-angiogenic compositions and therapeutic applications thereof
Neufeld et al. VEGF 145 expression vectors

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20000628

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20020702