EP1017716A1 - Recepteurs car, molecules et procedes apparentes - Google Patents

Recepteurs car, molecules et procedes apparentes

Info

Publication number
EP1017716A1
EP1017716A1 EP98944876A EP98944876A EP1017716A1 EP 1017716 A1 EP1017716 A1 EP 1017716A1 EP 98944876 A EP98944876 A EP 98944876A EP 98944876 A EP98944876 A EP 98944876A EP 1017716 A1 EP1017716 A1 EP 1017716A1
Authority
EP
European Patent Office
Prior art keywords
car
receptor
polypeptide
dna
seq
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP98944876A
Other languages
German (de)
English (en)
Other versions
EP1017716A4 (fr
Inventor
David D. Moore
Hueng-Sik Hormone Research Center CHOI
Myriam I. Lab Klinische Chemie O. & N. BAES
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
General Hospital Corp
Original Assignee
General Hospital Corp
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from US08/934,388 external-priority patent/US6989242B1/en
Application filed by General Hospital Corp filed Critical General Hospital Corp
Publication of EP1017716A1 publication Critical patent/EP1017716A1/fr
Publication of EP1017716A4 publication Critical patent/EP1017716A4/fr
Withdrawn legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/72—Receptors; Cell surface antigens; Cell surface determinants for hormones
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • the nuclear hormone receptor superfamily includes approximately a dozen distinct genes that encode zinc finger transcription factors, each of which is specifically activated by binding a ligand such as a steroid, thyroid hormone (T3) or retinoic acid (RA).
  • a ligand such as a steroid, thyroid hormone (T3) or retinoic acid (RA).
  • T3 thyroid hormone
  • RA retinoic acid
  • members of the superfamily are called orphan receptors. While the role of the better characterized conventional receptors in regulating important processes in developing and adult individuals is becoming clearer, the function of the orphan receptors has been uncertain.
  • the conventional receptors in this P box- defined subgroup include those that bind estrogen, vitamin D, T3 and RA, and nearly all of the orphan receptors identified to date also fall into this class. As a consequence of this overlap in binding specificity, many hormone response elements can bind more than one type of receptor.
  • the best characterized of these is the element upstream of the rat growth hormone gene, which can be activated by three different isoforms of the T3 receptor encoded by two different genes and by an unknown number of retinoic acid receptor isoforms encoded by three different genes. While it does not appear to respond to the estrogen receptor or the vitamin D receptor, its response to other members of the subgroup remains uncertain.
  • the invention features substantially pure CAR receptor polypeptide.
  • a receptor polypeptide includes an amino acid sequence substantially identical to the amino acid sequence shown in Fig. 1 (SEQ ID NO: 10) or Fig. 2 (SEQ ID NO: 12).
  • the invention further features a substantially pure polypeptide which includes a CAR receptor DNA binding domain and a CAR receptor gene activation domain (preferably, also including the ligand binding domain).
  • the DNA binding domain includes a sequence substantially identical to amino acids 11-75 of Fig. 1 (SEQ ID NO: 10) or amino acids 21-86 of Fig.
  • the gene activation or ligand binding/gene activation domain includes a sequence substantially identical to amino acids 76-348 of Fig. 1 (SEQ ID NO: 10) or amino acids 182-358 or 352-357 of Fig. 2 (SEQ ID NO: 12), or a gene activating fragment thereof.
  • the invention features a substantially pure polypeptide which includes a CAR receptor heterodimerization domain.
  • the receptor polypeptide is mammalian, and preferably, human or murine.
  • the invention features substantially pure DNA which encodes a CAR receptor polypeptide of the invention.
  • DNA is cDNA; and encodes a human or murine CAR receptor polypeptide.
  • the invention also features a vector which includes such substantially pure DNA and which is capable of directing expression of the protein encoded by the DNA in a vector-containing cell.
  • the invention features a cell which contains the substantially pure DNA.
  • the cell is a eukaryotic cell, for example, a mammalian cell.
  • the invention features a method of producing a recombinant CAR receptor polypeptide (or a fragment or analog thereof).
  • the method involves (a) providing a cell transformed with DNA encoding a CAR receptor or a fragment or analog thereof positioned for expression is the cell; (b) culturing the transformed cell under conditions for expressing the DNA; and (c) isolating the recombinant CAR receptor polypeptide.
  • the invention features a substantially pure antibody which specifically binds a CAR receptor polypeptide of the invention.
  • the invention features therapeutic compositions which include as an active ingredient a CAR receptor polypeptide of the invention formulated in a physiologically-acceptable carrier.
  • Such therapeutic compositions may be used in methods of treating Graves' disease or cancer (for example, lung cancer) in a mammal; such methods involve administering the therapeutic composition to the mammal in a dosage effective to decrease thyroid hormone receptor function (for the treatment of Graves' disease) or in a dosage effective to increase retinoic acid receptor expression (for the treatment of cancer).
  • the invention features methods of identifying a CAR ligand.
  • One method involves (a) providing a nucleic acid sequence which encodes a CAR receptor polypeptide; (b) introducing into a host cell which is functionally deficient for CAR receptor (i) the nucleic acid which encodes the CAR receptor polypeptide (preferably, a CAR receptor polypeptide including an amino acid sequence substantially identical to the amino acid sequence shown in Fig. 1; SEQ ID NO: 10 or Fig.
  • a reporter gene operably linked to a CAR receptor polypeptide binding site (preferably, the binding site GGGTAGGGTTCACCGAAAGTTCACTCG; SEQ ID NO: 5); (c) measuring induction of the reporter gene in the transfected host cell; (d) contacting the transfected host cell with a candidate ligand; and (e) measuring induction of said reporter gene in the presence of the candidate ligand, an increase or decrease in the induction as compared to the induction in (c) being indicative of the presence of a CAR ligand.
  • a CAR receptor polypeptide binding site preferably, the binding site GGGTAGGGTTCACCGAAAGTTCACTCG; SEQ ID NO: 5
  • the second method involves (a) providing a nucleic acid sequence which encodes a CAR receptor polypeptide (preferably, including an amino acid sequence substantially identical to the amino acid sequence shown in Fig. 1; SEQ ID NO: 10 or Fig. 2; SEQ ID NO: 12); (b) introducing the nucleic acid into a host cell so that the recombinant CAR receptor polypeptide is expressed; (c) isolating the recombinant protein; (d) immobilizing the recombinant protein on a solid substrate (preferably, a column); (e) contacting the immobilized recombinant protein with a candidate ligand under conditions which allow formation of an affinity complex between the immobilized recombinant CAR receptor polypeptide and the candidate ligand; and (f) detecting complex formation as an indication of the presence of a CAR ligand.
  • a CAR receptor polypeptide preferably, including an amino acid sequence substantially identical to the amino acid sequence shown in Fig. 1; SEQ ID NO: 10
  • the invention features methods of identifying a CAR receptor DNA binding site.
  • One method involves (a) providing a nucleic acid sequence which encodes a CAR receptor polypeptide (preferably including an amino acid sequence substantially identical to the amino acid sequence shown in Fig. 1; SEQ ID NO: 10 or Fig. 2; SEQ ID NO: 12); (b) introducing into a host cell which is functionally deficient for CAR receptor (i) the nucleic acid which encodes the CAR receptor polypeptide and (ii) a reporter gene which is operably linked to a candidate CAR receptor DNA binding site; and (c) measuring induction of the reporter gene in the transfected host cell, induction being indicative of the presence of an operably linked CAR receptor DNA binding site.
  • a second method involves (a) providing a nucleic acid sequence which encodes a CAR receptor polypeptide (preferably, including an amino acid sequence substantially identical to the amino acid sequence shown in Fig. 1; SEQ ID NO: 10 or Fig. 2; SEQ ID NO: 12); (b) introducing the nucleic acid into a host cell so that the recombinant CAR receptor polypeptide is expressed; (c) isolating the recombinant protein; (d) contacting the recombinant protein with a candidate DNA binding site under conditions which allow formation of an affinity complex between the recombinant CAR receptor polypeptide and the candidate binding site; and (e) detecting complex formation as an indication of the presence of a CAR receptor DNA binding site.
  • a nucleic acid sequence which encodes a CAR receptor polypeptide preferably, including an amino acid sequence substantially identical to the amino acid sequence shown in Fig. 1; SEQ ID NO: 10 or Fig. 2; SEQ ID NO: 12
  • the invention features chimeric receptors.
  • Such chimeric receptors may include the DNA binding domain of a CAR receptor polypeptide (preferably, including a sequence substantially identical to amino acids 11-75 of Fig. 1; SEQ ID NO:10 or amino acids 21-86 of Fig.
  • a heterologous protein preferably, a nuclear hormone receptor, or a protein chosen from the group consisting of: glucocorticoid receptor, ⁇ -retinoic acid receptor, ⁇ -retinoic acid receptor, ⁇ - retinoic acid receptor, estrogen receptor, progesterone receptor, vitamin D receptor, mineralocorticoid receptor, thyroid receptor, VP16, and GAL4; or the chimeric receptor may include the gene activation domain of a CAR receptor polypeptide (preferably, including a sequence substantially identical to amino acids 76-348 of Fig.
  • a heterologous protein preferably, a nuclear hormone receptor or a protein chosen from the group consisting of: glucocorticoid receptor, ⁇ -retinoic acid receptor, ⁇ -retinoic acid receptor, ⁇ -retinoic acid receptor, estrogen receptor, progesterone receptor, vitamin D receptor, mineralocorticoid receptor, thyroid receptor, and GAL4.
  • CAR receptor polypeptide is meant a polypeptide which is capable of binding to a DNA sequence of GGGTAGGGTTCACCGAAAGTTCACTCG (SEQ ID NO: 5) and activating the expression of downstream genes, even when mammalian cells harboring the receptor are grown in medium containing charcoal-stripped serum; in particular, a CAR receptor polypeptide activates such gene expression in the absence of retinoic acid.
  • substantially pure is meant that the CAR receptor polypeptide provided by the invention is at least 60%, by weight, free from the proteins and naturally-occurring organic molecules with which it is naturally associated.
  • the preparation is at least 75%, more preferably at least 90%, and most preferably at least 99%, by weight, CAR receptor polypeptide.
  • a substantially pure CAR receptor polypeptide may be obtained, for example, by extraction from a natural source (e.g., a mammalian liver cell); by expression of a recombinant nucleic acid encoding a CAR receptor polypeptide, or by chemically synthesizing the protein.
  • polypeptide any chain of amino acids, regardless of length or post-translational modification (e.g., glycosylation)
  • substantially identical is meant an amino acid sequence which differs only by conservative amino acid substitutions, for example, substitution of one amino acid for another of the same class (e.g., valine for glycine, arginine for lysine, etc.) or by one or more non-conservative substitutions, deletions, or insertions located at positions of the amino acid sequence which do not destroy the function of the protein or domain (assayed, e.g., as described herein).
  • the amino acid sequence is at least 60%, preferably, 70%, more preferably, 85%, and, most preferably, 95% identical to the sequence of either SEQ ID NO: 10 or SEQ ID NO: 12.
  • a "substantially identical" nucleic acid sequence codes for a substantially identical amino acid sequence as defined above.
  • DNA binding domain is meant a stretch of amino acids which is capable of directing specific polypeptide (e.g., receptor) binding to a particular DNA sequence.
  • gene activation domain is meant a stretch of amino acids which is capable of inducing the expression of a gene to whose control region it is bound.
  • heterodimerization domain is meant a stretch of amino acids which is capable of directing specific complex formation with a heterologous protein; such a domain may direct the formation of dimers, trimers, tetramers, or other higher order hetero-oligomers.
  • substantially pure DNA is meant DNA that is free of the genes which, in the naturally-occurring genome of the organism from which the DNA of the invention is derived, flank the gene.
  • the term therefore includes, for example, a recombinant DNA which is incorporated into a vector; into an autonomously replicating plasmid or virus; or into the genomic DNA of a prokaryote or eukaryote; or which exists as a separate molecule (e.g., a cDNA or a genomic or cDNA fragment produced by PCR or restriction endonuclease digestion) independent of other sequences. It also includes a recombinant DNA which is part of a hybrid gene encoding additional polypeptide sequence.
  • transformed cell is meant a cell into which (or into an ancestor of which) has been introduced, by means of recombinant DNA techniques, a DNA molecule encoding (as used herein) a CAR receptor polypeptide.
  • positioned for expression is meant that the DNA molecule is positioned adjacent to a DNA sequence which directs transcription and translation of the sequence (i.e., facilitates the production of, e.g., CAR receptor polypeptide).
  • a host cell which is functionally deficient for CAR receptor is meant a cell, e.g., a mammalian cell, which exhibits little or no CAR receptor- mediated gene stimulatory activity; such activity may be measured in standard transactivation assays using, e.g., a transfected reporter gene operably linked to a CAR binding site as described herein.
  • substantially pure antibody antibody which is at least 60%), by weight, free from the proteins and naturally-occurring organic molecules with which it is naturally associated.
  • the preparation is at least 75%, more preferably at least 90%, and most preferably at least 99%, by weight, antibody, e.g., CAR receptor-specific antibody.
  • a substantially pure CAR receptor antibody may be obtained, for example, by affinity chromatography using recombinantly-produced CAR receptor polypeptide and standard techniques.
  • telomere binding By “specifically binds”, as used herein, is meant an antibody which recognizes and binds CAR receptor polypeptide but which does not substantially recognize and bind other molecules in a sample, e.g., a biological sample, which naturally includes CAR receptor polypeptide.
  • reporter gene is meant a gene whose expression may be assayed; such genes include, without limitation, chloramphenicol transacetylase (CAT) and ⁇ -galactosidase.
  • CAT chloramphenicol transacetylase
  • ⁇ -galactosidase ⁇ -galactosidase
  • operably linked is meant that a gene and a regulatory sequence(s) are connected in such a way as to permit gene expression when the appropriate molecules (e.g., transcriptional activator proteins) are bound to the regulatory sequence(s).
  • heterologous any protein other than the human CAR receptor which includes a suitable (i.e., a DNA binding, gene activation, and/or ligand binding) domain.
  • Fig. 1 is the nucleic acid sequence (SEQ ID NO:l) and deduced amino acid sequence (SEQ ID NO: 10) of the human CAR receptor.
  • Fig. 2 is the nucleic acid (SEQ ID NO:l 1) and deduced amino acid sequence (SEQ ID NO: 12) of the murine CAR receptor mCARl .
  • Figure 3A is a schematic representation of the sequences of mCARl and mCAR/MB67.
  • the sequence of mCARl (Genbank accession number AF009327) is shown, and differences between mCARl and the previously described MB67 (referred to here as hCAR) and also the mCAR2 variant (Genbank accession number AF900328) are indicated.
  • the DNA binding domain is in bold. Dots indicate residues not present in hCAR.
  • the positions of the introns in the mCAR gene are indicated.
  • the first intron is 5 nucleotides upstream of the ATG encoding the first methionine. Introns that fall within a codon are indicated after the corresponding amino acid.
  • Figure 3B is a schematic representation indicating comparisons of mCARl to related members of the nuclear hormone receptor superfamily.
  • the DNA binding, hinge, and ligand binding/dimerization domains of mCARl are indicated, and the percent identity of the analogous domains of related proteins is indicated.
  • VDR is the human vitamin D receptor
  • xONR is a Xenopus laevis orphan receptor (Smith et al., Nucl. Acids Res. 22:66-71, 1994)
  • EcR is the Drosophila melanogaster ecdysone receptor.
  • Figures 4A and 4B are photographs demonstrating expression of mCARl and mCAR2 in liver mRNA.
  • mRNA based PCR was used to amplify mCAR sequences using primers flanking the mCAR2 deletion, with mouse liver mRNA as a template.
  • Figure 4A the positions of amplified bands of -l ithe sizes expected for mCARl and mCAR2 are indicated.
  • the products of the mRNA based PCR reaction are in the left lane. Size markers are in the right lane.
  • Figure 4B an experiment is shown in which the gel in Figure 4A was blotted and hybridized with probes corresponding to the intact mCAR ligand binding domain or just exon 8, as indicated. Control lanes showed no bands by ethidium staining or hybridization.
  • Figure 5 A is a diagram indicating the positions of the mCAR introns, 5' untranslated and 3' untranslated regions of the primary transcript, and the positions of various portions of the transcript and protein.
  • the 3' untranslated region extends into the 3' flanking region.
  • the 8th exon deleted in mCAR2 is indicated by a star.
  • Figure 5B is a photograph showing a primer extension analysis of mCAR transcripts. Either control RNA (lane 1) or total mouse liver RNA (lane 2) was used as a template for primer extension using a 5' end labeled mCAR primer from the 5' untranslated region. Products were resolved next to a sequence ladder generated using the same primer. The arrow indicates specifically extended product. To the right of the photograph is indicated the position of the primary transcriptional start site relative to the mCAR genomic sequence (Genbank accession number AF009326).
  • Figure 6 is a photograph and diagram indicating the expression of mCAR transcripts.
  • a Northern blot containing mouse polyA + mRNA from various tissues was sequentially hybridized with either a full length mCAR probe ("A") or a series of shorter probes as indicated.
  • Probes "B” and “C” were generated by PCR using the mCAR cDNA as a template, and probe “D” was generated by PCR using the genomic clone as a template. Only the results with liver mRNA are shown for the smaller probes. In much longer exposures of hybridizations with either the full length probe or the two probes from the 3' end, an additional transcript of approximately 2.8 kb was observed in heart, brain, skeletal muscle, and kidney.
  • FIG 7 is a photograph showing DNA binding by mCARl and mCAR2.
  • mCARl, mCAR2, RXR, and RAR proteins were expressed by in vitro translation and used for electrophoretic mobility shift assays with a ⁇ RARE probe as indicated.
  • S indicates competition with the ⁇ RARE oligonucleotide
  • NS competition with a nonspecific oligonucleotide.
  • Equivalent amounts of mCARl, mCAR2, and RAR were used in the binding reactions, as determined by 35 S-methionine labeling.
  • Figures 8 A and 8B are graphs indicating transactivation by mCARl and mCAR2.
  • a luciferase reporter containing three copies of the ⁇ RARE upstream of the TK promoter was cotransfected into HepG2 cells with the indicated receptor expression vectors and a TKGH control plasmid. Normalized luciferase activity is expressed by comparison to the activity observed with the CDM8 vector alone.
  • two reporter constructs containing 336 bp of the RAR ⁇ 2 promoter driving expression of luciferase (Moghal et al., Mol. Cell. Biol. 15:3945-3959 1995) were cotransfected into HepG2 cells with control, mCARl, or mCAR2 expression vectors, as indicated, along with the TKGH internal control.
  • Figure 9A is a diagram showing the sequence of the AF-2 region of mCARl .
  • the sequence that matches the AF-2 consensus of a glutamate flanked by paired hydrophobic residues (Danielian et al., EMBO J. 11:1025- 1033, 1992) is in bold, and a sequence that corresponds to the 9th heptad in TR and other receptors (Forman et al, Mol. Endocrinol. 4:1293-1302, 1990) is underlined. Mutations introduced into the mCARl sequence are indicated; dashes represent residues present in the mutant proteins.
  • Figure 9B is a photograph showing transactivation by mCARl and AF-2 mutants.
  • HepG2 cells were cotransfected with either the CDM8 vector alone or the vectors expressing the indicated CAR proteins, the ⁇ RARE-TKluc reporter, and a TKGH internal control. Expression relative to the wild type mCARl is indicated.
  • Figure 9C is a graph indicating DNA binding by mCAR mutants.
  • Whole cell extracts from COSM6 cells transfected with expression vectors for the indicated mCAR proteins were incubated with analogous extracts from
  • RXR transfected cells and the ⁇ RARE oligonucleotide, and specific complexes were resolved by electrophoretic mobility shift.
  • a human liver cDNA library was screened by standard techniques with the following degenerate oligonucleotide probe: TG C/T GAG GGI TG C/T AAG G G/C ITT C/T TT C/T A C G (SEQ ID NO. 2).
  • This probe was based on the sequence of the P box of the thyroid/retinoid receptor subgroup, the most highly conserved portion of the DNA binding domain. As expected, a number of clones encoding previously described members of the nuclear receptor superfamily were isolated. Based on limited sequence analysis (by standard techniques), one clone that did not correspond to any previously reported cDNA was chosen for further analysis. The complete sequence of this cDNA is presented in Fig. 1 (SEQ ID NO: 1).
  • this cDNA encodes a protein of 348 amino acids that contains conserved features of the nuclear receptor superfamily in both the DNA binding (C) domain and the putative ligand binding/dimerization (E) domain. Because of the activities of this protein described below, it is called CAR (Constitutive Activator of Retinoic acid response elements). CAR is one of the smallest superfamily members, with the shortest known A/B domain. As expected from the oligonucleotide used for screening, the sequence of the P box DNA binding specificity determining region of the first zinc finger placed CAR in the thyroid/retinoid group.
  • CAR was not strongly related to any other superfamily member, but was most similar to the vitamin D receptor, sharing 42 identical amino acids out of 66 in the C domain (64%), and 61/152 in the E domain (40%). This is quite similar to the relationship between the thyroid hormone and retinoic acid receptors: TR ⁇ and RAR ⁇ which share 60% and 40% sequence identity in the C and E domains, respectively. By comparison, the closely related human TR ⁇ and TR ⁇ receptors share 90% and 85%> identity in the C and E domain. CAR also shows significant similarity to the Drosophila melanogaster ecdysone receptor (62% in the C domain, 29% in the E domain), making it the third member of a divergent subgroup in the superfamily.
  • Southern blot analysis (by standard techniques) indicated that CAR may not be a member of a closely related subgroup like the TRs and the RARs. Like a number of other members of the superfamily, CAR has a relatively long 5' untranslated region that contains several AUGs upstream of the start of the open reading frame. The function of this region is unknown.
  • Northern blot analysis (using standard techniques) indicated that CAR mRNA is expressed in a variety of human tissues, but is most abundant in liver. Multiple RNA species were observed, but the nature of these different species is not clear. Based on the multiple products expressed by genes encoding other superfamily members, it may well reflect alternative splicing or promoter utilization.
  • CAR mRNA is also observed in a number of human cell lines, including HepG2 (hepatoma), JEG-3 (choriocarcinoma), and HeLa.
  • Ligand-independent transcriptional activation by the human CAR ligand/dimerization domain To study the function of the putative ligand binding domain of the orphan, a chimeric receptor consisting of the C-terminal D, E and F domains of CAR (i.e., approximately amino acids 76-172, 173-319, and 320-348 of the CAR sequence, respectively) fused to the N-terminal A/B and C domains of TR ⁇ was generated (termed TR CAR), along with a control hybrid with the A/B and C domains of TR and the D, E and F domain of the glucocorticoid receptor (TR GR).
  • TR CAR glucocorticoid receptor
  • T3REs i.e., of sequence AAAGGTAAGATCAGGGACGTGACCGCAG; SEQ ID NO: 3
  • GREs from the MMTV promoter as described in Chandler et al., Cell 33 :489, 1989
  • Transfections were carried out in the presence of serum treated with activated charcoal to remove T3 as well as other low molecular weight hydrophobic compounds that could act as CAR ligands.
  • TR and the TR/GR chimera behaved as ligand-dependent transactivators, as expected.
  • the relatively low but reproducible level of activation conferred by TR/GR is consistent with a previous report, and is thought to be a consequence of the absence from this hybrid of transcriptional activation domains present in the A/B domain of the intact GR and the F domain of the intact TR.
  • the TR CAR chimera activated expression of the T3RE containing reporter in the absence of any added ligand.
  • This effect was not altered by addition of T3, astraddle, testosterone, resinoid acid, or dexamethasone, or by the addition of the orphan receptor ligand 25-hydroxy cholesterol.
  • the constitutive activation conferred by this hybrid was substantial, corresponding to greater than 50% of the response of the intact TRY. Similar results were observed with an analogous GO/CAR chimera in cotransfections with an MMTV/CAT reporter.
  • the activation conferred by the TR/CAR chimera in the presence of charcoal-stripped serum could be a consequence of either a direct, constitutive transcriptional activation function in the D, E or F domains of the orphan, or the presence of an uncharacterized ligand in the medium of the growing cells.
  • the transfections were repeated in the absence of serum.
  • Such conditions substantially reduced the level of both control and T3-activated expression, but did not prevent the constitutive activation function conferred by the TR CAR chimera.
  • the significance of the apparent decrease in constitutive activity relative to the level of activation conferred by TRY in the presence of hormone is uncertain. This apparent decrease may reflect the absence of some specific stimulator of CAR function present in serum or could be a less specific effect associated with the unfavorable growth conditions.
  • RAREs which were not transactivated by CAR included a potent up mutant version of the rat growth hormone gene T3 RE/RARE (i.e., of sequence
  • T3RE/RARE i.e., of sequence
  • the rat malic enzyme T3RE i.e., of sequence AGGACGTTGGGGTTAGGGGAGGACAGTG; SEQ ID NO: 9
  • the rat ⁇ - myosin heavy chain T3RE i.e., of sequence AGGACGTTGGGGTTAGGGGAGGACAGTG
  • CAR activation is not affected by several treatments that activate or inactivate signal transduction pathways mediated by protein kinases A or C. Thus, CAR activation was not altered by addition of dibutyryl cyclic AMP, by short or long term treatments with phorbol esters, or by cotransfections with vectors expressing the specific protein kinase A inhibitor peptide.
  • the constitutive activity of CAR may be due to either a truly constitutive transcriptional activation function or the presence of some ubiquitous ligand.
  • the former possibility is supported by its activity in serum free media and in distinct cell types.
  • the existence of a ligand may be favored by the somewhat lower relative activity observed with serum free medium compared to medium containing charcoal stripped serum.
  • Negative results have been obtained by several approaches designed to determine whether the constitutive activation of CAR is associated with various second messenger pathways. Evidence obtained to date indicates that CAR function is not affected by activation or repression of the activity of protein kinases A or C.
  • CAR plays two important roles in the complex, interlocking set of proteins that determines responses to RA, T3 and vitamin D.
  • the first is to maintain a basal level of expression of a subset of RA responsive genes in the absence of the ligand. In the case of a cell expressing only RAR ⁇ , for example, this could allow expression of sufficient levels of the receptor to allow autoactivation of the RA- dependent positive feedback loop that regulates RAR ⁇ expression upon addition of ligand.
  • the second potential function is based on the interaction of CAR with RXR. Increasing expression of CAR would be expected to decrease the amount of RXR available for interaction with other heterodimeric partners.
  • mice CAR cDNA clones were isolated by standard techniques from a liver cDNA library using an hCAR (MB67) probe. Of 9 independent clones examined in detail, 4 had an intact ligand binding domain, as judged by comparisons to hCAR and other superfamily members. 3 had an internal deletion of 107 amino acids. Representative sequences of these clones have been submitted to GenBank. One additional clone included 188 bp of intron derived sequences; it is unclear whether this clone corresponded to an authentic variant or a contaminating nuclear precursor. The mCAR2 sequence used for further experiments corresponded to the cDNA clone with the most extensive 5' untranslated sequences, and the internal deletion.
  • mCAR2 was identical to mCARl except for an out-of- frame 107 bp deletion in the ligand binding/dimerization domain. As a consequence of this deletion, only 6 new amino acids in mCAR2 substituted for the last 78 residues of mCARl.
  • This C-terminal region of mCARl included both the heterodimerization interface referred to as the 9th heptad (Forman et al., Mol. Endocrinol. 4:1293-1302, 1990, Forman et al., Mol. Endocrinol. 3: 1610-1626, 1987) or the I box (Perlmann et al., Mol. Endocrinol. 10:958-966, 1996), and the AF-2 transactivation domain (Danielian et al., EMBO J. 11: 1025-1033, 1992).
  • hCAR and mCAR belong to a small, rather divergent subgroup within the nuclear hormone receptor superfamily that also includes an orphan receptor from Xenopus laevis (Smith et al., Nucl. Acids Res. 22:66-71, 1994) and the mammalian vitamin D receptor.
  • hCAR and mCAR also showed relatively strong similarity with the insect ecdysone receptor in the DNA binding domain, but not other domains (Fig. 3B).
  • Two lines of evidence demonstrated that mCAR2 was not a cloning artifact. The first was simply that this 107 bp segment was missing in more than 5 independently isolated cDNAs.
  • a single clone containing the mCAR gene was obtained from a screen of a mouse genomic library.
  • a NotI fragment containing the entire mCAR gene and 5' and 3' flanking regions was subcloned and sequenced in its entirety. This sequence has been submitted to GenBank.
  • Figure 5 A the murine mCAR gene was interrupted by eight introns. Exon 8 was absent in mCAR2, demonstrating that this variant was generated by alternative mRNA splicing.
  • the 5' end of the mCAR transcript was mapped by primer extension (Fig. 5B).
  • a Northern blot containing 2 ⁇ g of polyA + mRNA from a variety of tissues was obtained from Clontech, Inc. and hybridized sequentially with either a full length mCAR probe or smaller probes generated by PCR.
  • the N-terminal probe, consisting of 167 bp from the 5' untranslated region, and the C-terminal probe, consisting of the last 200 bp of the mCARl coding region, were generated by PCR using the mCARl cDNA as a template.
  • Standard conditions (Ausubel et al, Current Protocols in Molecular Biology, Greene Pub. Assoc: New York, 1997) were used for mRNA based PCR with mouse liver mRNA as a template and primers from exons 7 and 9.
  • probes corresponded to a restriction fragment containing the mCARl ligand binding domain, or a shorter segment derived solely from exon 8.
  • Standard conditions (Ausubel et al., Current Protocols in Molecular Biology, Greene Pub.
  • mCARl, mCAR2, RAR, and RXR proteins were expressed using coupled in vitro transcription and translation (Promega, Inc.). Standard conditions were used for electrophoretic mobility shift assays with the DR-5 response element from the RAR ⁇ 2 promoter (the ⁇ RARE) as the probe, as described for hCAR (MB67).
  • ⁇ RARE the DR-5 response element from the RAR ⁇ 2 promoter
  • mCARl/RXR heterodimers bound with high affinity to the RARE from the RAR ⁇ 2 isoform promoter (Sucov et al., Proc. Natl. Acad. Sci. USA 87:5392- 5396, 1990; de The et al., Nature 343:177-180, 1990) (Fig. 7).
  • this construct was cotransfected with a luciferase reporter plasmid in which 3 copies of the ⁇ RARE were inserted upstream of the TK promoter.
  • a luciferase reporter plasmid in which 3 copies of the ⁇ RARE were inserted upstream of the TK promoter.
  • HepG2 cells were maintained and transfected using calcium phosphate or DEAE dextran (Ausubel et al., Current Protocols in Molecular Biology, Greene Pub. Assoc: New York, 1997).
  • mCARl and mCAR2 expression vectors were generated by inserting appropriate fragments into the vector CDM8 (Seed, Nature 329:840-842, 1987), as previously described for hCAR.
  • the luciferase reporter plasmid (Gulick et al., Proc. Natl. Acad. Sci. USA 91:11012-11016, 1994) contained three copies of the ⁇ RARE upstream of the TK promoter.
  • the reporter plasmids with wild type and mutant versions of the RAR ⁇ 2 promoter have been described (Moghal et al., Mol. Cell. Biol. 15:3945-3959, 1995).
  • Transfections also included the pTKGH control plasmid which directed expression of human growth hormone (Selden et al., Mol. Cell. Biol. 6:3173-3179, 1986). Luciferase activities were normalized using levels of growth hormone expression.
  • TK reporter pairs of 30 mm dishes were each transfected with 2 ⁇ g of reporter and pTKGH, and a total of 2 ⁇ g of mammalian expression vector.
  • RAR ⁇ 2 reporters pairs of 30 mm dishes were each transfected with 1.5 ⁇ g of the reporter and of the mammalian expression vector, and 2 ⁇ g of the pTKGH control. Transfections were carried out in media containing 10% charcoal stripped serum, and luciferase activity was determined using the Promega luciferase assay system as described by the manufacturer. Luciferase values were normalized using the growth hormone expression directed by the TKGH internal control. The results of these experiments are shown in Figures 8 A and 8B.
  • hCAR transactivated this reporter approximately 20-100 fold, while mCARl was somewhat more effective, conferring a 50 to 300 fold activation (Fig. 8A).
  • RAR was an even more potent transactivator of this reporter.
  • the apparently constitutive transactivation by mCARl was observed in the presence of serum treated with charcoal to remove retinoids or other potential ligands, and in several different cell types.
  • mCAR2 did not transactivate this element, and also did not affect transactivation by hCAR or mCARl . Similar results were obtained with higher ratios of mCAR2.
  • mCARl but not mCAR2
  • mCARl was able to transactivate a reporter containing the intact RAR ⁇ 2 promoter, but not a mutant version in which the ⁇ RARE element was inactivated by point mutations (Fig. 8B).
  • mutations were introduced into the mCARl AF-2 region. These mutations included both simple deletions and point mutants that were chosen based on comparisons of this region of mCAR to the analogous region in other receptors. As indicated in Figures 9A, the D8 mutation and the point mutants L353A and E355A specifically affected the AF-2 motif. The larger D27 mutation extended into the region homologous to helix 10 of RXR (Bourget et al., Nature 375:377-382.
  • the mCARl and hCAR sequences contained a good match to the AF-2 transcriptional activation domain at their extreme C-termini.
  • This conserved motif is present in many conventional receptors and orphans (Danielian et al., EMBO J. 11:1025-1033, 1992), and has been directly associated with ligand dependent transcriptional activation in several conventional receptors (e.g., (Barettino et al, EMBO J. 11:3039-3049, 1994; Tone et al., J. Biol. Chem. 269:31157-31161, 1994, Tate et al., Mol. Cell. Biol. 14:2323-2330, 1994; and vom Baur et al., EMBO J.
  • the mCAR2 variant was missing an additional conserved motif near the C-terminus of the ligand binding/dimerization domain, which has been called the 9th heptad (Forman et al., Mol. Endocrinol. 4:1293-1302, 1990; Forman et al., Mol. Endocrinol. 3:1610-1626, 1987) or the I-box (Perlmann et al., Mol. Endocrinol. 10:958-966, 1996).
  • RXR e.g., Au-Fliegner et al, Mol. Cell. Biol. 13:5725-5737, 1993.
  • mCAR2 Since heterodimerization is required for high affinity DNA binding, it is not surprising that the mCAR2 variant did not bind the ⁇ RARE or other elements. Particularly since mCAR2 was also missing the conserved AF-2 transactivation motif, it should not compete for coactivator binding, and should not inhibit transactivation by mCARl , a prediction borne out in appropriate transfections. This leaves the function of the mCAR2 variant undefined, though it is possible that it could compete with the mCARl form for interaction with other, as yet undefined, proteins.
  • mCARl could have more complex effects in the presence of retinoids. Since it is a less potent transactivator than RAR, it could act to decrease overall expression by competing for occupancy if both proteins were present at high levels. If both CAR and RAR were present at subsaturating levels, however, additional occupancy of RAREs by CAR might augment RAR action.
  • the apparent ability of endogenous RARs to fully occupy specific RAREs under at least some in vivo conditions suggests that competition for binding could be an important aspect of CAR function.
  • CAR and RAR on a particular element are clearly dependent, not only on their relative levels of expression, but also on their relative DNA binding affinities.
  • mCARl/RXR heterodimers like hCAR/RXR heterodimers, bound the ⁇ RARE with an affinity indistinguishable from that of RAR/RXR heterodimers, and CAR/RXR complexes can also bind with high affinity to other DR-5 and DR-2 RAREs.
  • affinity of CAR/RXR heterodimers, but not RAR/RXR heterodimers, for DR-5 sites is strikingly dependent on the sequence of the 5 base pair spacer. This suggests that CAR targets only a subset of retinoid responsive genes, and provides yet another example of the complexity of the overlapping network of regulatory effects of the nuclear hormone receptors.
  • Polypeptides according to the invention may be produced by transformation of a suitable host cell with all or part of a CAR receptor- encoding cDNA fragment (e.g., the cDNA described above) in a suitable expression vehicle.
  • a CAR receptor- encoding cDNA fragment e.g., the cDNA described above
  • the CAR receptor may be produced in a prokaryotic host (e.g., E. coli) or in a eukaryotic host (e.g., Saccharomyces cerevisiae or mammalian cells, e.g., COS 1, NIH 3T3, and JEG3 cells).
  • a prokaryotic host e.g., E. coli
  • a eukaryotic host e.g., Saccharomyces cerevisiae or mammalian cells, e.g., COS 1, NIH 3T3, and JEG3 cells.
  • Such cells are available from a wide range of sources (e.g., the American Type Culture Collection, Rockland, MD; also, see, e.g., Ausubel et al.
  • pMAMneo provides: an RSV-LTR enhancer linked to a dexamethasone- inducible MMTV-LTR promotor, an SV40 origin of replication which allows replication in mammalian systems, a selectable neomycin gene, and SV40 splicing and polyadenylation sites.
  • DNA encoding a CAR receptor polypeptide would be inserted into the pMAMneo vector in an orientation designed to allow expression.
  • the recombinant receptor protein would be isolated as described below.
  • pMAMneo expression vehicle examples include COS cells and CHO cells (ATCC Accession Nos. CRL 1650 and CCL 61, respectively).
  • a CAR receptor polypeptide is produced by a stably- transfected mammalian cell line.
  • cDNA encoding the receptor polypeptide is cloned into an expression vector which includes the dihydrofolate reductase (DHFR) gene.
  • DHFR dihydrofolate reductase
  • Integration of the plasmid and, therefore, the CAR receptor-encoding gene into the host cell chromosome is selected for by inclusion of 0.01-300 ⁇ M methotrexate in the cell culture medium (as described in Ausubel et al, supra K This dominant selection can be accomplished in most cell types. Recombinant protein expression can be increased by DHFR-mediated amplification of the transfected gene. Methods for selecting cell lines bearing gene amplifications are described in Ausubel et al. (supra): such methods generally involve extended culture in medium containing gradually increasing levels of methotrexate.
  • DHFR-containing expression vectors commonly used for this purpose include pCVSEII-DHRF and ⁇ AdD26SV(A) (described in Ausubel et al, supra).
  • Any of the host cells described above or, preferably, a DHFR- deficient CHO cell line e.g., CHO DHFR cells, ATCC Accession No. CRL 9096 are among the host cells preferred for DHFR selection of a stably- transfected cell line or DHFR-mediated gene amplification.
  • the recombinant CAR receptor polypeptide is expressed, it is isolated, e.g., using affinity chromatography.
  • a CAR binding site e.g., the ⁇ RARE site described above
  • an anti-CAR receptor antibody e.g., produced as described below
  • Lysis and fractionation of receptor-harboring cells prior to affinity chromatography may be performed by standard methods (see, e.g., Ausubel et al, supra).
  • the recombinant protein can, if desired, be further purified, e.g., by high performance liquid chromatography (see, e.g., Fisher, Laboratory Techniques In Biochemistry And Molecular Biology, eds. Work and Burdon, Elsevier, 1980).
  • Receptors of the invention can also be produced by chemical synthesis (e.g., by the methods described in Solid Phase Peptide Synthesis, 2nd ed, 1984 The Pierce Chemical Co, Rockford, IL).
  • one aspect of the invention features a screening assay for the identification of compounds which specifically bind to the CAR receptors described herein. Such an assay may be carried out using a recombinant receptor protein.
  • the CAR receptor component is produced by a cell that naturally produces substantially no receptor or by a cell which produces functionally deficient receptor (i.e., a cell which apparently expresses CAR receptor mRNA as measured by Northern blotting but which does exhibit reporter gene induction, in the absence of recombinantly-produced CAR receptor, in a transactivation assay, see below); suitable cells are, e.g., those discussed above with respect to the production of recombinant receptor, most preferably, mammalian cells such as JEG3 cells.
  • Host cells are transfected with (1) a vector which expresses a nucleic acid encoding the CAR receptor component (i.e., the "producer vector") and (2) a vector which includes a CAR receptor binding site (e.g., the ⁇ RARE sequence
  • a target gene which may be assayed (e.g., a CAT gene or a ⁇ -galactosidase gene) (i.e., the "reporter vector").
  • CAR receptor activity is assayed by measuring CAR binding site-dependent target gene expression.
  • CAR ligands are identified as those compounds which, when added to the host cell medium, effect a change in CAR receptor- directed gene expression (as detected using any CAR reporter vector); a CAR ligand according to the invention may either increase CAR receptor activity or decrease CAR receptor activity.
  • CAR receptor-encoding producer vector Any suitable transactivation technique, CAR receptor-encoding producer vector, and CAR receptor binding site-containing reporter vector may be used.
  • Descriptions of transactivation assays and generally useful vectors for the identification of ligands which bind other nuclear hormone receptors are described, e.g., in Evans et al. (U.S. Pat. No. 4,981,784, 1991); Evans et al. (WO 90/07517); Evans et al. (WO90/01428); and WO88/03168; all hereby incorporated by reference.
  • CAR receptor polypeptides which may be used to screen for CAR ligands include wild-type molecules as well as any appropriate chimeric receptor, for example, the GR/CAR and TR/CAR receptors described above.
  • Candidate ligands may be purified (or substantially purified) molecules or the ligand may be one component of a mixture of ligands (e.g., an extract or supernatant obtained from cells; Ausubel et al, supra).
  • the CAR ligand is identified by testing progressively smaller subsets of the ligand pool (e.g., produced by standard purification techniques, e.g., HPLC or FPLC) until a single ligand is finally demonstrated to modulate the CAR receptor gene stimulatory activity.
  • Candidate CAR ligands include peptide as well as non-peptide molecules.
  • a ligand may be identified by its ability to bind a CAR receptor polypeptide using affinity chromatography.
  • Recombinant receptor is purified by standard techniques, from cells engineered to express the receptor (e.g., those described above); the recombinant receptor immobilized on a column (e.g., a Sepharose column or a streptavidin-agarose column by the immunoaffinity method of Ausubel et al, supra) and a solution containing one or more candidate ligands is passed through the column.
  • Such a solution may be, e.g., a cell extract, mammalian serum, or growth medium on which mammalian cells have been cultured and into which the cells have secreted factors (e.g., growth factors) during culture; again, candidate CAR ligands include peptide as well as non-peptide molecules.
  • a ligand specific for a recombinant receptor is immobilized on the column (because of its interaction with the receptor). To isolate the ligand, the column is first washed to remove non-specifically bound molecules, and the ligand of interest is then released from the column and collected.
  • CAR ligands isolated by the above methods may, if desired, be further purified (e.g., by high performance liquid chromatography; see above).
  • a novel peptide ligand may be partially sequenced (by standard amino acid sequencing techniques). From this partial amino acid sequence, a partial nucleic acid sequence is deduced which allows the preparation of primers for PCR cloning of the ligand gene (e.g., by the method of Ausubel et al, supra). Identification of CAR Receptor DNA Binding Sites
  • CAR receptor DNA binding sites may be identified using a transactivation assay, e.g., as described above for the identification of the binding site of sequence GGGTAGGGTTCACCGAAAGTTCACTCG (SEQ ID NO: 5). Briefly, candidate DNA binding sites are inserted upstream of a target gene (whose expression may be assayed, e.g., those genes described above) and the ability of a CAR receptor polypeptide to bind the DNA site is assayed as its ability to activate downstream gene expression.
  • a target gene whose expression may be assayed, e.g., those genes described above
  • a DNA binding site may be identified by selectively retaining a receptor-bound DNA fragment on a nitrocellulose filter.
  • This approach relies on the ability of nitrocellulose to bind proteins but not double- stranded DNA.
  • Purified CAR receptor polypeptide e.g., purified by standard techniques from cells engineered to express the receptor, e.g., those described above
  • labelled double-stranded DNA e.g., a random pool of DNA fragments
  • the mixture is suction filtered through nitrocellulose, allowing unbound DNA to pass through the filter while retaining the protein and any DNA specifically bound to it.
  • Bound DNA fragments are then eluted from the filter and analyzed by gel electrophoresis or amplification and cloning. A detailed description of this technique is published in Ausubel et al, supra).
  • Candidate DNA fragments for either approach may be derived from a randomly cleaved or sonicated genomic DNA library and/or may be derived from known nuclear hormone response elements (see, e.g., Evans et al, WO90/11273).
  • CAR receptor DNA binding sites facilitates a search for the presence of such sites upstream of known or yet unidentified genes (e.g., by an examination of sequences upstream of known genes or by standard hybridization screening of a genomic library with binding site probes). CAR- mediated transcriptional control of genes bearing the binding site upstream may then be investigated (e.g., by transactivation experiments as described above), potentially leading to the elucidation of novel CAR receptor functions.
  • the functional domains of the CAR receptor may be swapped with the domains of other members of the nuclear hormone receptor family (see, e.g., Evans et al, WO 90/11273; Evans, Science 240:889, 1988) in order to produce receptors having novel properties.
  • the DNA binding domain of the glucocorticoid receptor were fused to the gene activation domain of the CAR receptor, a novel receptor would be produced which could bind genes bearing an upstream glucocorticoid response element and activate gene expression in the absence of hormone.
  • fusion of the CAR DNA binding domain to the ligand-binding and gene activation domains of glucocorticoid receptor would confer hormonal regulation on genes downstream of CAR binding sites.
  • CAR receptor domains are as follows: DNA binding domain, approximately amino acids 11-76; and gene activation and potential ligand binding domain, approximately amino acids 76- 348. Examples of receptor domains which may be included in a chimeric CAR receptor are described in Evans et al. (WO 90/15815) and in Evans et al. ⁇ Science 240:889, 1988). Dominant Negative Mutants
  • Mutants of the CAR receptor may be generated which interfere with normal CAR receptor activity. Such mutants are termed "dominant negative” and fall into at least two classes: (a) ones which bind to their DNA binding site (thereby interfering with the ability of wild-type receptor to bind the same site) and which do not activate gene expression and (b) ones which heterodimerize with other receptors (e.g., RXR) but which do not promote the biological response associated with the wild-type heterodimer.
  • the first class of CAR dominant negative mutants include those receptor polypeptides which contain a wild-type DNA binding domain and a mutant gene activation domain.
  • Such mutants are unable to transactivate a reporter gene (e.g., as measured using a CAT reporter gene with an upstream ⁇ RARE and the standard methods described above) but retain the ability to bind a CAR DNA binding site (as evidenced, e.g., by DNA footprint analysis using a ⁇ RARE DNA sequence; Ausubel et al, supra).
  • the second class of CAR dominant negative mutants include those receptor polypeptides which contain a wild-type heterodimerization domain. Such a mutant interacts with its heterodimer partner and disrupts the partner's function.
  • a dominant negative CAR receptor polypeptide may be overproduced (e.g., by directing its expression from a very strong promoter); the abundant CAR receptor polypeptide forms heterodimers with cellular RXR protein, soaking up available RXR and thereby preventing RXR homodimer formation as well as RXR heterodimer formation with other partner proteins (e.g., RAR, VDR, and T3R). Wild-type CAR receptor polypeptide may function as a dominant negative mutant if overproduced in this manner. However, a mutant CAR receptor lacking a gene activation domain (e.g., as identified above) and/or a DNA binding domain (e.g., as identified by DNA footprint analysis, above) is preferred.
  • Any of the above mutants may be generated by any method of random or site-directed DNA mutagenesis (see, e.g., Ausubel et al, supra). Identification of Molecules which Modulate CAR Receptor Expression
  • Isolation of CAR receptor genes also facilitates the identification of molecules which increase or decrease CAR receptor expression, and which may be useful as therapeutics, e.g., for treatment of cancers such as lung cancer, or for treatment of thyroid disorders such as Graves' disease.
  • candidate molecules e.g., peptide or non-peptide molecules found, e.g., in a cell extract, mammalian serum, or growth medium on which mammalian cells have been cultured
  • CAR receptor mRNA e.g., HepG2, JEG-3, or HeLa cells
  • CAR receptor expression is then measured by standard Northern blot analysis (Ausubel et al, supra) using CAR receptor cDNA as a hybridization probe.
  • the level of CAR receptor expression in the presence of the candidate molecule is compared to the level measured for the same cells in the same culture medium but in the absence of the candidate molecule.
  • a molecule which promotes an increase or decrease in CAR receptor expression is considered useful in the invention.
  • Human or murine CAR receptor may be used to raise antibodies useful in the invention; such polypeptides may be produced by recombinant or peptide synthetic techniques (see, e.g., Solid Phase Peptide Synthesis, supra: Ausubel et al, supra).
  • the peptides may be coupled to a carrier protein, such as KLH as described in Ausubel et al, supra.
  • KLH-peptide is mixed with Freund's adjuvant and injected into guinea pigs, rats, or preferably rabbits.
  • Antibodies may be purified by peptide antigen affinity chromatography.
  • Monoclonal antibodies may be prepared using the CAR polypeptides described above and standard hybridoma technology (see, e.g., Kohler et al. Nature 256:495, 1975; Kohler et al, Eur. J. Immunol. 6:511, 1976; Kohler et al, Eur. J. Immunol. 6:292, 1976; Hammerling et al. In Monoclonal Antibodies and T Cell Hybridomas, Elsevier, NY, 1981; Ausubel et al, supra).
  • polyclonal or monoclonal antibodies are tested for specific CAR receptor recognition by Western blot or immunoprecipitation analysis (by the methods described in Ausubel et al, supra).
  • Antibodies which specifically recognize a CAR receptor polypeptide are considered to be useful in the invention; such antibodies may be used, e.g., in an immunoassay to monitor the level of CAR receptor produced by a mammal. Therapy
  • CAR receptor polypeptides may also find therapeutic use in the treatment of Graves disease, a disease resulting from an increase in thyroid hormone receptor function.
  • RXR protein plays a role in thyroid hormone receptor expression.
  • dominant negative CAR mutants which heterodimerize with RXR protein may act to decrease the cellular levels of available RXR and thereby decrease thyroid hormone receptor function.
  • ligands which increase heterodimerization efficiency could also be administered as a treatment for Graves' disease.
  • the appropriate CAR receptor polypeptide is administered as a therapeutic preparation (e.g., in physiological saline) in accordance with the condition to be treated.
  • a therapeutic preparation e.g., in physiological saline
  • it will be administered intravenously, at a dosage effective to increase retinoic acid receptor expression (as a cancer treatment) or effective to decrease thyroid hormone receptor function (as a treatment for Graves' disease).
  • it may be convenient to administer the therapeutic orally, nasally, or topically, e.g., as a liquid or a spray. Again, the dosages are as described above. Treatment may be repeated as necessary for alleviation of disease symptoms.
  • the methods of the invention may be used to reduce the disorders described herein in any mammal, for example, humans, domestic pets, or livestock.
  • the CAR receptor polypeptide or the antibody employed is preferably specific for that species
  • Other Embodiments Polypeptides according to the invention include the entire human or murine CAR receptor sequences (as described in Figs. 1 and 2; SEQ ID NOS: l, 10, 11, and 12) as well as any analog or fragment of the human or murine CAR receptors which include either a DNA binding domain or gene activation domain; or which include a heterodimerization domain (as identified using the techniques described above).
  • Polypeptides of the invention also include all mRNA processing variants (e.g., all products of alternative splicing or differential promoter utilization) as well as CAR receptor proteins from other mammals.
  • Specific receptor fragments or analogues of interest include fiill- length or partial (see below) receptor proteins including an amino acid sequence which differs only by conservative amino acid substitutions, for example, substitution of one amino acid for another of the same class (e.g., valine for glycine, arginine for lysine, etc.) or by one or more non-conservative amino acid substitutions, deletions, or insertions located at positions of the amino acid sequence which do not destroy the receptors' ability to either bind DNA and activate transcription; or to interact with CAR receptor's heterodimerization partners (as assayed above).
  • conservative amino acid substitutions for example, substitution of one amino acid for another of the same class (e.g., valine for glycine, arginine for lysine, etc.) or by one or more non-conservative amino acid substitutions, deletions, or insertions located at positions of the amino acid sequence which do not destroy the receptors' ability to either bind DNA and activate transcription; or to interact with C
  • Analogs also include receptor polypeptides which are modified for the purpose of increasing peptide stability; such analogs may contain, e.g., one or more desaturated peptide bonds or D- amino acids in the peptide sequence or the peptide may be formulated as a cyclized peptide molecule.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Immunology (AREA)
  • General Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Cell Biology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Toxicology (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Endocrinology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Peptides Or Proteins (AREA)

Abstract

L'invention concerne un A D N purifié codant des récepteurs CAR et les protéines de recombinaison exprimées depuis cet A D N. On utilise les polypeptides de recombinaison de ce récepteur afin d'identifier des ligands de CAR et des sites de liaison du récepteur CAR, ainsi que de préparer des produits thérapeutiques. Elle concerne également des anticorps spécifiques pour des polypeptides du récepteur CAR.
EP98944876A 1997-09-19 1998-09-17 Recepteurs car, molecules et procedes apparentes Withdrawn EP1017716A4 (fr)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US934388 1997-09-19
US08/934,388 US6989242B1 (en) 1992-02-26 1997-09-19 Car receptors and related molecules and methods
PCT/US1998/019365 WO1999015555A1 (fr) 1997-09-19 1998-09-17 Recepteurs car, molecules et procedes apparentes

Publications (2)

Publication Number Publication Date
EP1017716A1 true EP1017716A1 (fr) 2000-07-12
EP1017716A4 EP1017716A4 (fr) 2001-01-03

Family

ID=25465488

Family Applications (1)

Application Number Title Priority Date Filing Date
EP98944876A Withdrawn EP1017716A4 (fr) 1997-09-19 1998-09-17 Recepteurs car, molecules et procedes apparentes

Country Status (2)

Country Link
EP (1) EP1017716A4 (fr)
WO (1) WO1999015555A1 (fr)

Families Citing this family (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001051045A2 (fr) * 2000-01-13 2001-07-19 Tularik Inc. Modulateurs de car : criblage et traitement de l'hypercholesterolemie
AU2001266936A1 (en) * 2000-06-14 2001-12-24 Deltagen, Inc. Transgenic mice containing nuclear hormone receptor gene disruptions
US7186879B2 (en) 2000-09-21 2007-03-06 Baylor College Of Medicine Screening systems and methods for identifying modulators of xenobiotic metabolism
AU2001291192B2 (en) 2000-09-21 2006-11-30 Baylor College Of Medicine Screening systems and methods for identifying modulators of xenobiotic metabolism
EP1371661A1 (fr) * 2002-06-13 2003-12-17 LION Bioscience AG Variants du récepteur CAR au niveau de son domaine de liaison du ligand
TWI654206B (zh) 2013-03-16 2019-03-21 諾華公司 使用人類化抗－ｃｄ１９嵌合抗原受體治療癌症
SG10202109752XA (en) * 2014-04-07 2021-10-28 Novartis Ag Treatment of cancer using anti-cd19 chimeric antigen receptor
DK3280729T3 (da) 2015-04-08 2022-07-25 Novartis Ag Cd20-behandlinger, cd22-behandlinger og kombinationsbehandlinger med en cd19-kimær antigenreceptor (car)-udtrykkende celle

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1998033819A1 (fr) * 1997-01-30 1998-08-06 New York University Recepteurs cellulaires des adenovirus du sous-groupe c et des virus coxsackie du groupe b

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5756448A (en) * 1992-02-26 1998-05-26 The General Hospital Corporation Constitute activator of retinoid (CAR) receptor polypeptides

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1998033819A1 (fr) * 1997-01-30 1998-08-06 New York University Recepteurs cellulaires des adenovirus du sous-groupe c et des virus coxsackie du groupe b

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
BAES, MYRIAM ET AL.: "A new orphan member of the nuclear hormone receptor superfamily that interacts with a subset of retinoic acid response elements" MOLECULAR AND CELLULAR BIOLOGY, vol. 14, no. 3, March 1994 (1994-03), pages 1544-1552, XP000613954 *
DATABASE EMBL [Online] Database Entry MMAF9327, 22 July 1997 (1997-07-22) CHOI H.S. ET AL.: "Mus musculus orphan nuclear hormone receptor isoform mCAR1 mRNA, complete cds. " Database accession no. AF009327 XP002152126 -& HUENG-SIK CHOI ET AL.: "Differential transactivation by two isoforms of the orphan nuclear hormone receptor CAR" JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 272, no. 38, 19 September 1997 (1997-09-19), pages 23565-23571, XP002152125 MD US *
RICHARD P. TOMKO ET AL.: "HCAR and MCAR: The human and mouse cellular receptors for subgroup C adenoviruses and group B coxsackieviruses" PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF USA, vol. 94, April 1997 (1997-04), pages 3352-3356, XP002911143 WASHINGTON US *
See also references of WO9915555A1 *

Also Published As

Publication number Publication date
WO1999015555A1 (fr) 1999-04-01
EP1017716A4 (fr) 2001-01-03

Similar Documents

Publication Publication Date Title
US5756448A (en) Constitute activator of retinoid (CAR) receptor polypeptides
EP0579758B1 (fr) Recepteur d'hormone parathyroidienne et adn codant ce recepteur
US6307030B1 (en) Androgen receptor proteins, recombinant DNA molecules coding for such, and use of such compositions
Hedvat et al. The isolation and characterization of MINOR, a novel mitogen-inducible nuclear orphan receptor.
US20060287503A1 (en) Retinoid X receptor-interacting polypeptides and related molecules and methods
US5886148A (en) Parathyroid hormone receptor
EP1017716A1 (fr) Recepteurs car, molecules et procedes apparentes
US7132260B2 (en) DNA encoding parathyroid hormone receptor
US7150974B1 (en) Parathyroid hormone receptor binding method
US7081528B2 (en) Isolated nucleic acid molecules encoding T cell derived inducible factors
WO1994004675A2 (fr) Sequence d'adn codant un nouvel element de la famille des recepteurs d'hormoes steroides et thyroidiennes
US6989242B1 (en) Car receptors and related molecules and methods
JP2006511194A (ja) テネウリンｃ末端関連ペプチド（ｔｃａｐ）並びにこれらに関連する方法および使用
US6586581B1 (en) Prolactin regulatory element binding protein and uses thereof
JPH11127872A (ja) 新規核内レセプター蛋白質、遺伝子及びその用途
US6485921B1 (en) UBCLP and uses thereof
AU2003276167A1 (en) Genes whose expression is increased in response to stimulation by corticotropin-releasing hormone
Lu Molecular cloning and characterization of the chicken vitamin D receptor gene and its promoter
JP3759899B2 (ja) 新規ヒトアンドロゲンレセプター変異体
JPWO2003080668A1 (ja) 核内受容体ＲＸＲαアイソフォーム
WO1998056908A1 (fr) Proteines isoformes du recepteur de la vitamine d
JP2002529053A (ja) Ｌｄｌ関連タンパク質およびその使用
WO1997047172A1 (fr) Proteine isoforme du recepteur de la vitamine d
JP2002518061A (ja) Ｔ１１０関連タンパク質ファミリーの新規な分子及びその使用

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20000418

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE

A4 Supplementary search report drawn up and despatched

Effective date: 20001122

AK Designated contracting states

Kind code of ref document: A4

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE

17Q First examination report despatched

Effective date: 20010820

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20031016