Classifications

• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
  • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
  • C12N15/1131—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against viruses
  • C12N15/1132—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against viruses against retroviridae, e.g. HIV
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07H—SUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
  • C07H21/00—Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K38/00—Medicinal preparations containing peptides
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2310/00—Structure or type of the nucleic acid
  • C12N2310/10—Type of nucleic acid
  • C12N2310/15—Nucleic acids forming more than 2 strands, e.g. TFOs
  • C12N2310/151—Nucleic acids forming more than 2 strands, e.g. TFOs more than 3 strands, e.g. tetrads, H-DNA
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2310/00—Structure or type of the nucleic acid
  • C12N2310/10—Type of nucleic acid
  • C12N2310/18—Type of nucleic acid acting by a non-sequence specific mechanism
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2310/00—Structure or type of the nucleic acid
  • C12N2310/30—Chemical structure
  • C12N2310/31—Chemical structure of the backbone
  • C12N2310/315—Phosphorothioates
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2310/00—Structure or type of the nucleic acid
  • C12N2310/30—Chemical structure
  • C12N2310/33—Chemical structure of the base
  • C12N2310/335—Modified T or U

Definitions

• the present invention relates generally to the field of oligonucleotide chemistry and anti-viral pharmacotherapy. More specifically, the present invention relates to therapeutically active guanosine- rich intramolecular tetrad forming oligonucleotides, to methods of treating viral diseases using said oligonucleotides, and to pharmaceutical compositions containing the novel oligonucleotides. Description of the Related Art General In Vitro Studies
• oligodeoxycytidine inhibits HTV-1. Marshall et al, PNAS (1992) 89:6265-6269, discussed the potential mechanism (competitive inhibition) by which oligodeoxycytidine directly inhibits viral reverse transcriptase.
• Poly SdC also inhibited AMV reverse transcriptase and Pol I (Klenow fragment) and polymerase ⁇ , ⁇ and ⁇ .
• That patent discloses a method for making synthetic guanosine-rich oligonucleotides which are targeted to specific sequences in duplex DNA and which form collinear triplexes by binding to the major groove of the DNA duplex.
• HTV-1 human immunodeficiency virus type 1
• AIDS acquired immunodeficiency syndrome
• the infection may manifest itself in several ways including a latent infection in which viral replication is not measurable until the cell becomes activated or through a chronic infection in which dividing or non-dividing cells persistently release virus in the absence of any cytopathic effect.
• recent reports on the kinetics of virus production (and clearance) indicate a dynamic process in which virtually a complete replacement of wild- type virus by drug-resistant virus in plasma can occur after only two to four weeks of drug therapy. Ho, et al., Nature 373:123-126 (1995); Wei, et al., Nature 373:117-122 (1995). For this reason it is of utmost importance to develop new anti-FflV-l agents which can complement, by additive or synergistic activity, current therapies.
• Two events which are characteristic of the life cycle of retroviruses can be utilized for therapeutic intervention.
• One is reverse transcription, whereby the single-stranded RNA genome of the retrovirus is reverse transcribed into singled-stranded cDNA and then copied into double-stranded DNA.
• the next event is integration, whereby the double-stranded viral DNA generated by reverse transcriptase is inserted into a chromosome of the host cell, establishing the proviral state. Integration is catalyzed by the retroviral enzyme integrase which is encoded at the 3'-end of the pol gene. Varmus, et al. Mobile DNA, pp. 53-108, Am. Soc. Microbiol, Washington, D.C. (1989).
• Integrase first catalyzes the excision of the last two nucleotides from each 3'-end of the linear viral DNA, leaving the terminal conserved dinucleotide CA-3'-OH at these recessed 3' ends (Fig. 23A). This activity is referred to as the 3'- processing or dinucleotide cleavage. After transport to the nucleus as a nucleoprotein complex, Varmus, et al. Mobile DNA, pp. 53-108, Am. Soc. Microbiol, Washington, D.C. (1989), integrase catalyzes a concerted DNA strand transfer reaction by nucleophilic attack of the two viral ends onto a host chromosome.
• oligonucleotides composed of deoxyguanosine and thymidine have been reported to inhibit HTV-1 replication. Rando, et al, J. Biol. Chem. 270, 1754-1760 (1995); Wyatt, et al, Proc. Natl. Acad. Sci. U.S.A. 91, 1356-1360 (1994). Oligonucleotides forming intramolecular G4s did not block virus adsorption but rather inhibited viral-specific transcripts. Rando, et al, J. Biol. Chem. 270, 1754- 1760 (1995); Ojwang et al. J. Aids 7:560-570 (1994).
• G-rich nucleic acid sequences can fold, in the presence of Na + or K + ion, to form orderly structures stabilized by guanosine tetrads.
• dimers Smith, F. W, & Feigon, J. (1992) Nature (London) 144, 410-414, Sundquist, W. I. & Klug, A. (1989) Nature (London) 334, 364-366; Kang, et al. (1992) Nature (London) 356, 126131; Balaguumoorthy, P.
• Antisense, triple-helix, duplex decoy, and protein-binding (aptamer) oligonucleotides have been shown to have potential as drugs for the treatment of a variety of human clinical disorders (Stein and Cheng, 1993; Marshall and Caruthers, 1993, Science 259: 1564-1570; Chubb and Hogan, 1992, Trends in Biotechnology 10: 132-136; Stull and Szoka, 1995, Pharm. Res. 12: 465-483.
• a number of oligonucleotides have undergone pre-clinical testing, and several are in human clinical trials. One finding that has aroused some concern (Black et al, 1994, Antisense Res. Dev.
• Oligonucleotides have advanced to the stage that they are now considered as potential therapeutics for the treatment of a variety of human diseases, and several are presently in clinical trials. Pre-clinical studies have generally shown that doses up to approximately 50 mg/kg are safe, but that higher doses can cause kidney and liver damage, and death (Srinivasan and Iversen, 1995, J. Clin. Lab. Analysis 9:129-137) Bolus intravenous administration has posed a particular concern since it has been shown to sometimes result in serious hypotensive events in primates (Cornish et al, 1993; Galbraith et al, 1994; Black et al, 1995).
• oligonucleotide compositions useful in treating pathophysiological states caused by viruses comprising administering a pharmacological dose of an oligonucleotide, the dose being sufficient to inhibit production of the virus, wherein the oligonucleotide contains a high percentage of guanosine bases.
• the oligonucleotide has a three dimensional structure and this structure is stabilized by guanosine tetrads.
• the oligonucleotide compositions of the invention have two or more runs of two contiguous deoxyguanosines.
• the target virus is either herpes simplex virus, human immunodeficiency virus, human papilloma virus, human cytomegalovirus, adenovirus, and hepatitis B virus.
• guanosine-rich oligonucleotides having a tiiree dimensional structure, wherein the three dimensional structure is stabilized by guanosine tetrads or at least two runs of two contiguous deoxyguanosines and wherein these oligonucleotides exhibit anti-viral activity.
• the oligonucleotides of the present invention have partially or fully phosphorothioated internucleoside linkages (backbones) or other chemical modifications.
• the oligonucleotides of the present invention have chemically modified or unnatural (synthetic) bases.
• oligonucleotides that include the sequence 5'-GTGGTGGGTGGGTGGGT-3' (SEQ ID NO 87) are disclosed.
• This nucleic acid sequence has at least one phosphodiester or phosphorothioate internucleoside linkage and is capable of forming a stable intramolecular stacked tetrad structure.
• the oligonucleotide may also have a 5' and/or 3' end that is modified by a moiety which is capable of increasing cellular uptake, or of modifying the tissue or subcellular distribution, or of increasing the biological stability of the oligonucleotide.
• Such a modifier may be propylamine, polyamine, poly-L-lysine, cholesterol, a C2-C24 fatty acid, or vitamin E or similar moieties that behave in the same way.
• Some oligonucleotides of the present invention have the sequence 5'- GNGGNGGGNGGGNGGGN-3' (SEQ ID NO 88), where N I7 (the 17th nucleotide located at the 3' end) is either omitted entirely (making it a 16 nucleotide long ODN instead of 17), or is thymidine or another pyrimidine or modified pyrimidine.
• N 2 , N 5 , N 9 and N n are each, independently, either has the base missing from the nucleoside, is thymidine, or is another pyrimidine or modified pyrimidine.
• Each internucleoside linkage may be, independently, either phosphodiester or phosphorothioate.
• the oligonucleotide backbone may be either ribophosphate, deoxyribophosphate or modified ribo- or deoxyribophosphate backbone.
• a modified backbone might be, for example, a 2'-0-methyl ribophosphate.
• Certain preferred embodiments of the new oligonucleotides have the base omitted from N 2 , and
• N ⁇ is either omitted entirely, is thymidine or C-5 propynyl-dU.
• N 5 , N 9 and N ⁇ 3 independently, either abasic, thymidine or C-5 propynyl-dU and have internucleoside linkages that are either phosphodiester or phosphorothioate.
• N 5 is C-5 propynyl- dU
• N 9 , N ⁇ 3 or N ]7 is C-5 propynyl-dU.
• N 5 , N 9 and N ⁇ 3 are all C-5 propynyl-dU.
• oligonucleotides of the present invention have phosphorothioate linkages between the ultimate and penultimate nucleosides, i.e., the final nucleotide linkages at the 5' and 3' ends are phosphorothioate.
• an oligonucleotide of 16 or 17 nucleotide length is synthesized following the general sequence 5'-GNGGNGGGNGGGNGGGN-3' (SEQ ID NO 88).
• N ⁇ may be omitted entirely or the nucleoside is choosen from the group consisting of an abasic riboside, deoxyriboside or modified ribo- or deoxyriboside, thymidine and another pyrimidine or modified pyrimidine riboside, deoxyriboside or modified ribo- or deoxyriboside.
• the N at positions 2, 5, 9 and 13 is independently selected from the group that includes an abasic riboside, deoxyriboside or modified ribo- or deoxyriboside, thymidine and another pyrimidine or modified pyrimidine riboside, deoxyriboside or modified ribo- or deoxyriboside.
• the type of internucleoside linkage used is selected from the group consisting of phosphodiester and phosphorothioate.
• the resulting oligonucleotide is one that is capable of spontaneously folding into a stable four-stranded oligonucleotide structure containing two stacked G quartets.
• the present invention also provides a pharmaceutical composition that contains one of the new oligonucleotides, together with a pharmacologically acceptable carrier.
• Still another embodiment of the invention provides a method of inhibiting the production of a virus, such as a retrovirus.
• the method includes contacting a virus-infected cell or organism with one or more of the oligonucleotides or pharmaceutical compositions of the invention.
• Viruses that are susceptible to inhibition may include herpes simplex virus, human papilloma virus, Epstein Barr virus, human immunodeficiency virus, adenovirus, respiratory syncytial virus, hepatitis B virus or human cytomegalovirus.
• the virus is a human immunodeficiency virus such as HTV- 1.
• Another method provided by the present invention is a method of inhibiting the production of a virus by contacting the virus itself with a new oligonucleotide or pharmaceutical composition.
• Yet another method provided by the present invention is a method of inhibiting the production of a virus by contacting a protein encoded by the virus with a new oligonucleotide or pharmaceutical composition.
• a viral protein may be, for example, an enzyme that is associated with the integration of viral nucleic acid into a host genome.
• Also comprehended by the present invention is a method of treating a viral disease in a human comprising administering a pharmacological dose of one of the new pharmaceutical compositions to a person in need of treatment for the disease.
• the viral disease might be, for example, a result of infection by herpes simplex virus, human papilloma virus, Epstein Barr virus, human immunodeficiency virus, adenovirus, respiratory syncytial virus, hepatitis B virus or human cytomegalovirus.
• a suitable regime for treating a person infected with human immunodeficiency virus includes doses of at least about 3.0 mg kg of body weight administered intravenously in seven equal doses over 14 days.
• Figure 1A shows a 1973 base pair Hind III to Eco Rl sub fragment of the Friend Murine
• FIG. 1B shows a 172 base pair (Hind ⁇ I to Stul) fragment which is an expanded portion of the 1973 base pair fragment. Within this fragment is the purine rich target to which triple helix forming oligonucleotides are directed.
• Figure IC shows the entire Hind Tfl/Eco Rl FMLV fragment cloned into the pT7-2 plasmid (United States Biochemical Corporation) yielding p275A. In this recombinant the Hind III site is 10 base pairs downstream of the T7 mRNA start site.
• the 5' portion of the triple helix target region is 63 base pairs downstream of the mRNA start and the Dde I site is 131 base pairs downstream of the mRNA start site.
• Figure ID shows the Hind TII/Eco Rl FMLV fragment was cloned into pBS (Stratagene) yielding pBSFMLV.
• the Hind III site, triple helix target site and Dde I site are respectively 50, 103 and 171 base pairs downstream from the mRNA start site.
• Figure 2 shows that G-Rich phosphorothioated-oligonucleotides induced reduction in HSV-2 viral titer.
• the filled square (B106-62) (SEQ. ID. NO. 5) represents a single concentration point (20 IM) for this oligonucleotide.
• B 106-96 is the fully phosphorothioated version of B 106-62 (SEQ. ID. NO. 5).
• B 106-97 is the fully phosphorothioated version of B 106-71 (SEQ. ID. NO. 6).
• ACV (4a and 4b) is acyclovir tested against two different stock concentrations of HSV-2 strain HG52.
• the cells were rinsed with a pH 3 buffer in order to remove all virus not yet internalized (96p3 and 97p3).
• FIG. 3 shows MT-2 cells infected with 0.01 m.o.i. of HTV-1 and then treated with various concentrations of oligonucleotide or AZT or ddC.
• the data represents the number of viable cells remaining in the culture dish, i.e., not undergoing virus induced cytopathic effects (CPE). In this graph, 100% is the level of CPE occurring in cultures infected with virus but not treated with any drug.
• Figure 4 shows the culture media taken from NTH3T3 cells chronically infected with FMLV was mixed with various concentrations of 1100-51 (SEQ. YD. NO. 29) or 1100-12 (SEQ. D. NO. 27) (fully phosphorothioate version of 1100-00 (SEQ.
• FIG. 5A, 5B and 5C show the radio-labelled ( 32 P) full-length or truncated mRNA transcripts were analyzed by polyacrylamide gel electrophoresis, and then quantitated by cutting out the specific transcript and measuring the radioactivity in a scintillation counter.
• Figure 5A shows that the reduction in full length transcripts directed by the T7 and T3 promoter when 1100-51 (SEQ. ID. NO.
• G101-50 was added to each reaction except the control (no oligo) with or without various concentration of 1100-01 or 1100-11 (SEQ. YD. NO. 26) (26% G-ctl).
• Figure 5C shows the analysis of truncated (63 base pair) transcript.
• Figure 6 shows inhibition of HTV-1 induced syncytia formation four days post-infection.
• SUP TI cells were infected with HTV-l D v for four hours and then treated with various concentrations of oligonucleotides.
• Four days post-infection cells were scored for syncytium formation. All assays were performed in quadruplicate and the average values used to plot this graph. The legend to the right of the graph indicates the symbol used for each oligonucleotide tested.
• Figure 7 shows continued suppression of HTV-1 p24 production seven days post removal of oligonucleotide.
• Four days post-infection with HTV-1 D the media from infected cells treated with oligonucleotides (2.5 TM) was removed and replaced with fresh media without oligonucleotide.
• the presence of viral p24 antigen was then assayed 7 and 11-days post infection. All samples were assayed in quadruplicate and the average values used to plot this graph.
• 1100-07 SEQ. YD. NO. 24: 1100-15 (SEQ. ID. NO. 33); 1100-18 (SEQ. YD. NO. 36); 1-10021 (SEQ. YD. NO. 39).
• the legend to the right of the graph indicates the symbol used for each oligonucleotide tested.
• Figure 8 shows a Dixon Plot of random oligonucleotide 1232 (SEQ. YD. NO. 41) obtained from kinetic analysis of inhibition of HTV-RT with respect to dNTP.
• the inhibition constant K was determined by simultaneously varying dNTP (without dATP) concentrations at the same time as inhibitor (oligonucleotide 1232).
• the K; determination was performed at 0.125 mM, 0.25 mM and 0.5 mM dNTP concentrations with constant Primer-Template concentration of 0.2 pM.
• HTV-RT was used at 1 unit in each reaction. The reported values are the result of simultaneous independent duplicates determinations.
• Figure 9A reveals PBMCs derived from HTV-1 positive patients were mixed with HTV-1 negative PBMCs in culture medium containing drug 1100-15 (SEQ. YD. NO. 33). On day 7 the cocultures were washed and resuspended in fresh medium containing drug. The p24 levels in medium collected on day 7 (before medium change) and day 10 were assayed for p24.
• Figure 9B HTV-1 negative PBMCs from two different donors were infected with HTV-1 Dv and then incubated in the presence of drug for 10 days at which time the culture medium was assayed for the presence of p24 antigen.
• Figures 10A and 10B show inhibition of binding of V3 loop specific Mabs to HTV-1 gpl20 by phosphorothioate containing oligonucleotides.
• Matched sequence oligonucleotides with either phosphodiester (PD) or phosphorothioate (PT) backbones were assayed for their ability to inhibit the interaction of V3 loop specific Mabs with the gpl20 molecule: SEQ. ID. NOS. 31 (1173) and 32 (1174); SEQ YD. NOS. 24 (1100-07) and 39 (1100-21); or SEQ. YD. NOS. 42 (1229) and 43 (1230).
• immobilized gpl20 was preincubated with oligonucleotides before washing and the addition of Mab NEA 9284 (10 A) or Mab NEA 9301 (10 B).
• Figure 11 shows a schematic diagram of the HTV-1 genome not drawn to scale.
• Fig. 11 A shows DNA primers.
• Fig. 1 IB shows RNA primers.
• Figure 12 shows analysis of DNA (PCR) and RNA (RT-PCR) extracted from SUP TI cells three days post-infection with HTV-1. (Top Panel). PCR analysis of HTV-1 infected drug treated SUP TI cell DNA used 0.1 Tg of total extracted DNA for each reaction. In this experiment either AZT, at 0.3 TM which is 10 fold over the IC 50 value (lane 1) or 1100-15 (SEQ. ID. NO. 33) at 5.0 (lane 2) or 0.3 TM (lane 3) were added to SUP TI cells at the same time as HTV-1. Lanes 4 (AZT), 5 (5.0 TM 1100-15 (SEQ. LD. NO.
• Lanes 8 to 10 contain 10, 100 or 1000 ng of DNA extracted from HTV-1 infected control SUP TI cells.
• the band corresponding to 220 bp is the predicted size of the internal ⁇ - actin control and the 200 bp fragment is the predicted size for the amplified portion of the HTV-1 genome.
• the bottom panel contains RT-PCR analysis of extracted RNA (1 Tg reaction) obtained from cells treated in an identical fashion as those described in lanes 1-6 of the top panel.
• Lanes 7 and 8 are control HTV-1 infected cell mRNA and lanes 9 and 10 are the results obtained using uninfected untreated SUP TI cell mRNA.
• Figure 13 shows the results of three oligonucleotides (10 "5 M) incubated with increasing concentrations (0,7.5,15,30,60 and 120 mM) of KCl (lanes 1-6 for 1100-15 (SEQ. YD. NO. 33), 7-12 for 1100-18 (SEQ. YD. NO. 36) and 13-18 for Z106-50).
• the nucleotide markers are poly dT.
• Figure 14 shows a line model for 1100-15 (SEQ. YD. NO. 33) folded into an intramolecular tetrad of the Oxytricha class is depicted.
• the 5!-end of the molecule is in the bottom left hand side.
• the bases D (Gs) are stacked on top of each other with the 4 bases in each plane stabilized through their hydrogen bonding with each other and their interaction with the K + ion complex in the center of the tetrad.
• Figure 15 displays a one dimensional NMR analysis of a KCl titration and thermal melting parameters for 1100-15 (SEQ. YD. NO. 33).
• FIG. 16 Dose responsive profile for T30177, AZT and ddC. CEM-SS cells were infected with HTV-1 RF (0.01 MOI) and treated with various concentrations of each drug for six days at which time the degree of HTV-1 -induced syncytium formation (cytopathic effect, cpe) was addressed. The results shown are the averages of three or more experiments with the standard deviations indicated. Figure 17. Effect of T30177 on HTV-1 replication in primary macrophages. Primary macrophages were obtained from PBMC preparations and infected with HTV-1 D for 24 hours in the presence of the indicated amount of drug.
• MT4 cells infected with HTV-I I ⁇ B at a MOI of 1, were treated at various times during (time 0) or post-virus-infection with the test compounds at a concentration 100-fold higher than their respective IC 50 values. Viral p24 levels in the culture medium were monitored 29 hour post-infection. The results shown are the averages of three or more experiments.
• Figure 19. HeLa-CD4- ⁇ -galactosidase cell assays.
• Figure 19A HeLa-CD4- ⁇ -galactosidase cells were incubated in medium containing drug for one hour before virus was added to the culture medium. One hour after the addition of virus the cells were washed extensively to remove unbound virus and extracellular test material.
• FIG. 20 Long term suppression of HTV-1 nm after treatment of infected cell cultures with T30177.
• A MT4 cells were infected with 0.01 MOI of HTV-lm B and then cultured for 4 days int eh presence of T30177, AZT, DS5000, JM2763 or JM3100 using a concentration of drug equivalent to 100- fold over the respective IC 50 value. After 4 days the cells were washed extensively and further incubated in drug free medium. The level of viral p24 antigen in the culture medium was monitored at various times after removal of drug from the infected cell cultures. The values given are the averages of three or more experiments.
• Figures 21A-B Single cycle analysis of viral DNA. CEM-SS cells infected with HTV-1 S ⁇ at an
• MOI of 1 were treated with T30177, UC38, CSB or ddC at the indicated time post-viral infection.
• Time ft 0 indicates the treatment of cell cultures with drug during virus infection. After 12 hours the DNA was extracted from the infected cells and used as a template for PCR. The concentration of drug used in each assay is equivalent to 10 to 100-fold over their respective IC2 50 values.
• FIG. 22 Analysis of replicated viral DNA.
• CEM-SS cells were infected with HTV-1 S ⁇ at an MOI of 1 and then treated with T30177.
• the drug concentrations used were 0.0, 0.01, 0.1, 1 and 10 IM corresponding to lanes 1 to 5 respectively.
• the unlabeled lane in each panel contains molecular size marker control DNA.
• FIG. 23 Inhibition of HTV-1 integrase 3 -processing and strand transfer and HTV-1 RF cytopathicity by guanosine quartets.
• Fig. 23A Schematic diagram showing 3'-processing (3'P, which liberates a GT dinucleotide) and strand transfer (ST, which results in the insertion of one 3'-processed oligonucleotide into another target DNA), with 5'-end labeled (asterisk), blunt-ended oligonucleotide.
• FIG. 23B Left panel, concentration-response obtained from a typical experiment. The DNA substrate (21mer), 3'-processing product (19mer), and strand transfer products (STP) are shown.
• Lane 1 DNA along; lane 2, with integrase; lanes 3-6, with integrase in the presence of the indicated concentrations of T30177.
• Right panel graph derived from quantitation (see Materials and Methods) of the dose response in the left panel showing inhibition of integrase-catalyzed 3'-processing (open squares) and strand transfer (filled squares).
• Fig. 23C Structures of guanosine quartets oligonucleotides.
• Fig. 23D IC 50 values for several G4 oligonucleotides against both activities of FflV integrase and HTV-1 pj in cell culture.
• Insertions into the parent compound T30177 are shown by an italicized and underlined nucleotide while mutations are designated by a lower case nucleotide.
• the guanosines involved in the quartets are shaded and the loops are designated by the corresponding numbers (see panel C, left).
• Figure 24 Inhibition of strand transfer and 3'-processing activities of HTV-1 integrase by the guanosine quartet T30177.
• FIG. 24A Left, schematic diagram depicting the strand transfer assay using the precleaved oligonucleotide (19mer substrate). Right Phosphorimager picture showing inhibition of strand transfer with T30177. The DNA substrate (19mer) and strand transfer products (STP) are shown.
• Lane 1 DNA alone; lane 2, plus integrase; lanes 3-6, plus integrase in the presence of the indicated concentrations of T30177.
• B Left, schematic diagram depicting the 3 '-processing assay using the oligonucleotide labeled at the 3'-end with 32 P-cordycepin (*A) (22mer substrate).
• Right phosphorimager picture showing inhibition of HTV-1 integrase-catalyzed 3'-processing with T30177.
• Lane 1 DNA alone; lane 2, with integrase; lanes 3-6, in the presence of the indicated concentrations of T30177.
• FIG. 25 Inhibition of the DNA binding activity of HTV-1 integrase by guanosine quartets. DNA binding was measured after UV crosslinking of reactions in which integrase was preincubated for 30 minutes at 300C with the guanosine quartet prior to addition of the DNA substrate.
• FIG. 25A Phosphorimager picture showing differential inhibition of DNA binding with T30177 and T30659. Lane 1, DNA alone (20 nM); lanes 2, 8, and 14, with integrase (200 nM); lanes 3-7, in the presence of the indicated concentrations of T30177; lanes 9-13, in the presence of the indicated concentrations of T30659. The mitigations of proteins of known molecular weight are shown to the right of the gel.
• FIG. 25B Graph derived from quantitation of the does response in (Fig. 25 A) showing inhibition of integrase binding by T30177 (open squares) but not by T30659 (filled squares).
• FIG. 26 Differential activities of T30177 on wild-type and deletion mutants of HTV integrase.
• Fig. 26 A Schematic diagram showing the three domains of HTV-1 integrase.
• B Inhibition of wild- type IN 1"288 (open squares), IN 1"212 (closed squares), and TN 50"212 (open triangles) in the disintegration assay.
• Fig. 26C Binding of HTV-1 integrase wild-type (TN 1"288 ) and deletion mutants at a final concentration of 1 IM to 32 P-end labeled guanosine quartet T30177 at a final concentration of 250 nM.
• Lane 1 T30177 alone; lanes 8-9, binding to wild-type, full-length HTV-1 integrase (TN 1"288 ) in the presence of the indicted metal; lanes 2-3, binding to IN 1"212 in the presence of the indicated metal; lanes 6-7, binding to TN 50"212 in the presence of the indicated metal are lanes 4-5, binding to TN 50"288 .
• FIG. 27 DNA binding activity of the zinc finger domain of HTV-1 integrase. Binding of TN 1"55 to T30177 or the viral DNA substrate (see Fig. 23A, 21mer). Lanes 1, DNA alone (50 nM); lanes 2, TN 1" 55 (2 IM) with no metal; lanes 3, TN 1"55 with manganese (7.5 mM); lanes 4, TN 1"55 with magnesium (7.5 mM); lanes 5, TN 1"55 with manganese (7.5 mM) and zinc (4.2 mM); lanes 6, TN 1"55 with magnesium (7.5 mM) and zinc (4.2 mM); lanes 7-10, TN 1"55 in the presence of the indicated concentration of zinc alone.
• FIG. 28A Phosphorimager picture showing DNA binding of wild-type integrase to radiolabeled T30177. Lane 1, DNA alone (27 nM); lanes 2-5; binding of integrase (200 nM) in manganese buffer to the indicated concentration of T30177; lanes 6-9, binding of integrase (200 nM) in magnesium buffer to the indicated concentration of T30177. The migrations of proteins of known molecular weight are shown to the right of the gel.
• FIG. 28B Structures of T30177 and two analogs in which the internucleotidic linkages have been changed.
• FIG. 29 Competition of binding to either U5 viral oligonucleotide (see Fig. 23 A, 21mer) (Fig. 29A) or guanosine quartet T30177.
• Fig. 29B Lanes 1, DAN alone; lanes 2, with wild-type, full-length HTV-1 integrase. Lanes 3-6 in panel (Fig. 29A), with integrase in the presence of the indicated concentrations of T30177 added after a 5 minute preincubation with the U5 viral DNA oligonucleotide. Lanes 3-6 in panel (Fig. 29B), with integrase in the presence of the indicated concentrations of viral U5 DNA oligonucleotide added after a 5 minute preincubation with the guanosine quartet T30177.
• FIG. 30 Inhibition of the related retroviral integrases.
• FIG. 30 A Inhibition of 3'-processing and strand transfer catalyzed by HTV-1 (lanes 2-8), HTV-2 (lanes 9-15), FTV (lanes 16-22), and STV (lanes 23-29) integrases in the presence of T30177.
• Lane 1 DNA alone; lanes 2, 8, 9, 15, 16, 22, 23, and 29, with integrase; lanes 3-7, 10-14, 17-21, and 24-28, with integrase in the presence of the indicated concentrations of T30177.
• FIG. 30B Graph derived from quantitation (see Materials and Methods) of the dose responses in (Fig.
• FIG. 30A Three-dimensional drawings of certain guanosine tetrad forming oligonucleotides referred to in Tables C-l and C-2. Halosubstituted, end modified, and intermolecular guanosine quartets are shown.
• Figure 32 Three-dimensional drawings of certain guanosine tetrad forming oligonucleotides referred to in Tables C-l and C-2. Unless otherwise specified, all oligonucleotides have phosphorothiodiester linkages between the ultimate and penultimate bases at both the 5' and 3' ends. (*) denotes the position of the phosphorothiodiester linkages.
• Figure 33 Percentage inhibition of 3' processing by certain oligonucleotides in Table C-l.
• Figure 34 Inhibition of syncytium formation by certain oligonucleotides in Table C-l .
• Figure 35 Mutations in the loops of T30177. Three-dimensional drawings of certain guanosine tetrad forming oligonucleotides referred to in Tables C-l and C-2.
• Figure 36 Mutations, deletions and insertions in G quartets. Three-dimensional drawings of certain guanosine tetrad forming oligonucleotides referred to in Tables C-l and C-2. IC50 for 3' proc/str. tra. is indicated to the right of each tetrad.
• Figures for Section D Figure 37 Structure Models. Fig. 37A. The sequence and a structure model for oligonucleotides used in this study presented All four oligomers have been modified so as to include a single phosphorothioate linkage at the 5' and 3' terminus. Proposed sites of G-quartet formation have been identified by dotted lines.
• Fig. 37B A two step kinetic model for ion induced folding of oligomers in this study. It is proposed that binding a first K + or Rb + ion equivalent, marked as a (+), occurs within the central G-octet, which has been identified by dotted lines. This first step is relatively fast, and is associated with higher apparent ion binding affinity. It is also associated with formation of unstacked loop domains, and the resultant net loss of UV hypochromism, as compared to the initial random coil state.
• the second step in the process involves as many as two additional K + or Rb + ion equivalents, (+), at the junction between the core octet and flanking loop regions.
• Tm values for T30695 (curve a), T30177 (curve b), T30376 (curve c), and T30677 (curve d) obtained as a function of added 12 KCl concentration.
• Fig. 38B The Tm Of T30695 obtained as a function of KCl, RbCl, NaCl or CsCl concentration.
• Fig. 38C The strand concentration dependence of Tm has been measured at 1 mM of added KCl.
• FIG. 39 Oligomer Folding Monitored by Circular dichroism (CD).
• CD data have been obtained at 250C in 20 rnM Li3P04 as a function of added ion concentration. Data have been presented as molar ellipticity in units of dmole bases.
• Fig. 39A The CD spectrum of T30695 in the presence of 0 mM (curve a), 0.05 mM (curve b), or 10 mM (curve e) of added KCl.
• Fig. 39B The CD spectrum of T30695 in the presence of 0 mM (curve a), 0.05 mM (curve b), or 10 mM (curve e) of added KCl.
• Fig. 39B The CD spectrum of T30695 in the presence of 0 mM (curve a), 0.05 mM (curve b), or 10 mM (curve e) of added KCl.
• Fig. 39B
• the change in ellipticity at 264 nm, relative to that measured in the absence of added ion is presented as a function of added KCl concentration for T30695 (curve a), T30177 (curve b) and T30676 (curve c).
• the overall midpoint of the measured KCl induced transition has been plotted for each oligomer: 0.02 mM, 0.15 mM and 0.27 mM, respectively.
• T30695 has been treated with increasing concentration of several different cations.
• the change in ellipticity at 264 nm was then measured as described in part B as a function of added KCl (curve a), RbCl (curve b) or NaCl (curve e).
• FIG. 40 The Kinetics of Ion Induced Folding. Ion was added to oligomers at time zero in the standard 20 mM Li3P04 assay buffer. Data have been presented as absorbance (A) vs. time after addition of metal ion.
• Fig. 40A Kinetics for T30177 were measured at three added KCl concentrations: 0.2 mM (curve a); 1.0 mM (curve b); and 10 mM (curve e).
• Figures 41A-D Mean arterial pressure of cynomolgus monkeys pAor to, during and following intravenous administration of AR177 over ten minutes. Blood pressure was continuously monitored via an indwelling femoral artery catheter. The values are the mean ⁇ s.d. of three monkeys at each dose.
• Figures 42A-D Neutrophil levels in blood of cynomolgus monkeys prior to, during and following intravenous administration of AR177 over ten minutes. Neutrophil levels were determined pre-dose (-10 minutes), and at 10, 20, 40, 60,120 and 1440 minutes following the initiation of the ten-minute infusion of AR177 into cynomolgus monkeys. The values are the mean ⁇ s.d. of three monkeys at each dose.
• FIG 43 aPTT versus time profile following a ten-minute infusion of AR177 to cynomolgus monkeys. aPTT was determined before and at various time after intravenous infusion of AR177 as described in the Methods section. aPTT levels returned to baseline by 24 hours in all groups. Certain aPTT values in monkeys at the 20 and 50 mg/kg dose time points, denoted by asterisks, exceeded the upper limit of the assay.
• Figure 44 Complement factor Bb concentration versus time profile following a ten minute infusion of AR177 to cynomolgus monkeys. Bb was determined before and at various times after intravenous infusion of AR177 as described in the Methods section. Bb levels returned to baseline by 24 hours in all groups.
• FIG. 45 CH50 levels in blood of cynomolgus monkeys prior to, during and following intravenous administration of AR177 over ten minutes. CH50 levels were determined pre-dose (-10 minutes), and at 10, 20, 40, 60,120 and 1440 minutes following the initiation of the ten-minute infusion of AR177 into cynomolgus monkeys. The values are the mean of two monkeys in the saline and 50 mg/kg groups, and three monkeys in the 20 mg/kg group. Data for the third monkey in the saline and 50 mg/kg groups, and for all of the 5 mg/kg group was not available.
• FIG. 46 Plasma C m a of AR177 in cynomolgus monkeys administered AR177 as a ten-minute intravenous infusion.
• the plasma concentration of AR177 was determined by anion-exchange HPLC as described in the Methods section.
• FIG. 47 AR177 plasma concentration versus time profiles following a ten-minute intravenous infusion to cynomolgus monkeys.
• the plasma concentration of AR177 was determined by anion-exchange HPLC as described in the Methods section.
• the plasma AR177 concentration at 24 hours for the 5, 20 and 50 mg/kg groups were O.020 g/mL for the 5 and 20 mg/kg groups, and 0.24 ⁇ 0.42 1/mL for the 50 mg/kg group.
• Figure 48 The relationship between plasma AR177 and aPTT in cynomolgus monkeys following a ten-minute intravenous infusion of 5 mg AR177/kg.
• the plasma concentration of AR177 was determined by anion-exchange HPLC as described in the Methods section.
• the baseline aPTT level (at 10 minutes prior to dosing) was 32.1 ⁇ 4.4 seconds (mean ⁇ s.d.).
• Figure 49 The relationship between plasma AR177 and aPTT in cynomolgus monkeys following a ten-minute intravenous infusion of 20 mg AR177/kg.
• the plasma concentration of AR177 was determined by anion-exchange HPLC as described in the Methods section.
• the baseline aPTT level (at 10 minutes prior to dosing) was 41.6 ⁇ 6.7 seconds (mean ⁇ s.d.).
• Figure 50 The relationship between plasma AR177 and aPTT in cynomolgus monkeys following a ten-minute intravenous infusion of 50 mg AR177/kg.
• the plasma concentration of AR177 was determined by anion-exchange HPLC as described in the Methods section.
• the baseline aPU level (at 10 minutes prior to dosing) was 33.2 ⁇ 4.8 seconds (mean ⁇ s.d.).
• FIG 51 AR177 plasma concentration after bolus TV dose 1 or 12 versus dose amount in Cynomolgus monkeys. Cynomolgus monkeys were given intravenous doses of 2.5, 10 or 40 mg/kg/day every other day for a total of 12 doses. Blood was obtained 5, 30 and 240 minutes following doses 1 and 12. The concentration of AR177 in the plasma of every monkey was determined by anion-exchange HPLC as described in the Methods section. There were six monkeys in the 10 and 40 mg/kg groups, and eight monkeys in the 40 mg/kg group. There was a linear relationship between each dose and the plasma concentration that was achieved at each of the sampling times.
• FIG 52 AR177 plasma concentration versus time profile following a bolus TV injection (dose 12) to Cynomolgus monkeys. Cynomolgus monkeys were given intravenous doses of 2.5, 10 or 40 mg/kg/day every other day for a total of 12 doses. This figure shows the concentration of AR177 in the plasma 5, 30 and 240 minutes following dose 12. The concentration of AR177 in the plasma was determined in every monkey by anion-exchange HPLC as described in the Methods section. There were six monkeys in the 2.5 and 10 mgkg groups, and eight monkeys in the 40 mg/kg group. There were no apparent difference between the disappearance of AR177 from the plasma following the 1st ( Figure F-3) and 12th doses.
• FIG. 53 The relationship between the plasma AR177 concentration and aPTT in Cynomolgus monkeys following a bolus TV injection of 2.5 mg AR177 kg. Cynomolgus monkeys were given intravenous doses of 2.5 mg/kg/day every other day for a total of 12 doses. This figure shows the plasma AR177 concentration versus aPTT levels 5, 30 and 240 minutes following doses 1 and 12. The concentration of AR177 in the plasma was determined in every monkey by anion-exchange HPLC as described in the Methods section. There were six monkeys in the 2.5 mg/kg group. The baseline aPTT levels just prior to (pre-dose) doses 1 and 12 were 24.1 ⁇ 3.4 seconds and 22.1 ⁇ 2.2. There was no change in the aPTT levels at any of the time points after the 1st or 12th doses ofARl 77 at 2.5 mg/kg.
• FIG 54 The relationship between the plasma AR177 concentration and aPTT in cynomolgus monkeys following a bolus TV injection of 10 mg AR177/kg. Cynomolgus monkeys were given intravenous doses of 10 mg/kg/day every other day for a total of 12 doses. This figure shows the plasma AR177 concentration versus aPTT levels 5, 30 and 240 minutes following doses 1 and 12. The concentration of AR177 in the plasma was determined in every monkey by anion-exchange HPLC as described in the Methods section. There were six monkeys in the 10 mg/kg group. The baseline aPTT levels just prior to (pre-dose) doses 1 and 12 were 23.3 ⁇ 1.8 seconds and 21.6 ⁇ 2.2. There was a close correlation between the aPTT] levels after the 1st or 12th doses of AR177 at 10 mg/kg and the aPTT levels.
• FIG. 55 The relationship between the plasma AR177 concentration and aPTT in cynomolgus monkeys following a bolus TV injection of 40 mg AR177/kg. Cynomolgus monkeys were given intravenous doses of 10 mg/kg/day every other day for a total of 12 doses. This figure shows the plasma AR177 concentration versus aPTT levels 5, 30 and 240 minutes following doses 1 and 12. The concentration of AR177 in the plasma was determined in every monkey by anion-exchange HPLC as described in the Methods section. There were eight monkeys in the 40 mg/kg group. The baseline aPTT levels just prior to (pre-dose) doses 1 and 12 were 24.8 ⁇ 3.3 seconds and 22.5 ⁇ 2.5.
• aPTT] f values in monkeys at the 20 and 50 mg/kg dose time points at five minutes following doses 1 or 12, denoted by asterisks, exceeded the upper limit of the assay. There was a close correlation between the aPTT levels after the 1st or 12th doses of AR177 at 40 mg/kg and the aPTT levels.
• HIV-positive human patients were administered AR177 at 0.75 mg/kg as a two-hour intravenous (TV) infusion.
• Blood samples were collected in EDTA-coated tubes at various time points during and following the TV infusion.
• Plasma was obtained following low speed centriguation of the blood.
• the concentration of AR177 in the plasma was determined using a validated anion-exchange HPLC method.
• HIV-positive human patients were administered AR177 at 1.5 mg/kg as a two-hour intravenous (TV) infusion.
• Blood samples were collected in EDTA-coated tubes at various time points during and following the TV infusion.
• Plasma was obtained following low speed centriguation of the blood.
• the concentration of AR177 in the plasma was determined using a validated anion-exchange HPLC method.
• Figure 58 AR177 pharmacokinetics following a single TV dose o 3.0 mg/kg to humans.
• HIV-positive human patients were administered AR177 at 3.0 mg/kg as a two-hour intravenous (TV) infusion. Blood samples were collected in EDTA-coated tubes at various time points during and following the TV infusion. Plasma was obtained following low speed centriguation of the blood. The concentration of AR177 in the plasma was determined using a validated anion-exchange HPLC method. Figure 59. AR177 pharmacokinetics following a single TV dose of 0.75, 1.5 or 3.0 mg/kg to humans. Ten HIV-positive human patients were administered AR177 at 0.75, 1.5 or 3.0 mg/kg as a two- hour intravenous (TV) infusion. Blood samples were collected in EDTa-coated tubes at various time points during and following the TV infusion. Plasma was obtained following low speed centriguation of the blood. The concentration of AR177 in the plasma was determined using a validated anion-exchange HPLC method.
• FIG 60 AR177 TV. and C MAX following single doses to humans. HIV-positive human patients were administered AR177 at 0.75, 1.5 or 3.0 mg/kg as a two-hour intravenous infusion. The concentration of AR177 was determined in the plasma using a validated anion-exchange HPLC method. The C MAX (maximal plasma concentration of AR177) and plasma VA (half-life of AR177 in plasma) were determined using PKAnalyst software (Micro Math, Salt Lake City, UT).
• FIG 61 AR177 clearance following single doses to humans. HIV-positive human patients were administered AR177 at 0.75, 1.5 or 3.0 mg/kg as a two-hour intravenous infusion. The concentration of AR177 was determined in the plasma using a validated anion-exchange HPLC method. The plasma clearance was determined using PKAnalyst software (Micro Math, Salt Lake City, UT). Figures for Section H
• Figure 62A FACS data plot for mouse #1 treated with AR177 at 100 mg/kg/day showing forward- and side scatter characteristics.
• IP Figure 62B FACS data plot for mouse #1 treated with AR177 at 100 mg/kg/day showing thymocyte depletion.
• Figure 62C FACS data plot for mouse # 1 treated with AR177 at 100 mg/kg/day showing mean channel fluorescence of CD4+CD8+ cells.
• Figure 62D FACS data plot for mouse #2 treated with AR177 at 100 mg/kg day showing forward- and side scatter characteristics.
• Figure 62E FACS data plot for mouse #2 treated with AR177 at 100 mg/kg/day thymocyte depletion.
• Figure 62F FACS data plot for mouse #2 treated with AR177 at 100 mg/kg/day showing mean channel fluorescence of CD4+CD8+ cells.
• Figure 63 An electrophoretogram showing HTV-l DNA detection of PCR amplified samples for animals 1-42.
• Figure 64 Another electrophoretogram showing HTV-1 DNA detection of PCT amplified samples for animals 1-42, assayed after 30 days.
• Figure 65 Bar graph showing implant p24, W632 expression, viral titer and viral RNA load in HTV-1 (NLA-3)-Infected SCID-hu Thy/Liv Mice treated intraperitoneally with AR177 at 10, 30 and 100 mg/kg/day, compared to ddl-treated or mock-infected animals.
• oligonucleotide as used herein is defined as a molecule comprised of two or more deoxyribonucleotides or ribonucleotides, preferably more than ten. Some embodiments of the inventive oligonucleotides are 10-45 nucleotides in length, and certain preferred embodiments are
• Oligonucleotide includes ribonucleic acids, deoxyribonucleic acids and modified ribo- or deoxyribonucleic acids.
• bases herein include pyrimidines and purines, or modified or derivatized versions thereof.
• A refers to adenine, but depending on the context, may also refer to its ribose, deoxyribose or modified ribose or deoxyribose form.
• T refers to thymine or thymidine
• U refers to uracil or uridine
• G refers to guanine or guanosine
• C refers to cytosine or cytidine.
• the term "inhibition" of viral replication is meant to include partial and total inhibition of viral replication as well as decreases in the rate of viral replication.
• the inhibitory dose or "therapeutic dose” of the compounds in the present invention may be determined by assessing the effects of the oligonucleotide on viral replication in tissue culture or viral growth in an animal. The amount of oligonucleotide administered in a therapeutic dose is dependent upon the age, weight, kind of concurrent treatment and nature of the viral condition being treated. PHARMACOLOGICAL DOSE.
• pharmacological dose refers to the dose of an oligonucleotide which causes a pharmacological effect when given to an animal or human.
• the pharmacological dose introduced into the animal or human to be treated will provide a sufficient quantity of oligonucleotide to provide a specific effect, e.g., (1) inhibition of viral protein or enzymes, (2) inhibition of viral-specific replication, (3) preventing the target site from functioning or (4) damaging the duplex DNA at the specific site or (5) ablating the DNA at the site or (6) inhibiting the transcription/translation of the gene under the regulation of the site being bound or (7) internal inhibition of transcription or translation of the gene containing the sequence.
• the dose will be dependent upon a variety of parameters, including the age, sex, height and weight of the human or animal to be treated, the organism or gene location which is to be attacked and the location of the target sequence within the organism. Given any set of parameters, one skilled in the art will be able to readily determine the appropriate dose.
• GTO pathophysiological state
• pathophysiological state refers to any abnormal, undesirable or life-threatening condition caused directly or indirectly by a virus.
• GTO means an oligonucleotide in which there is a high percentage of deoxyguanosine, or contains two or more segments (runs) of two or more deoxyguanosine residues per segment.
• GUANOSINE TETRAD As used herein, the term "guanosine tetrads" refers to the structure that is formed of eight hydrogen bonds by coordination of the four O 6 atoms of guanine with alkali cations believed to bind to the center of a quadruplex, and by strong stacking interactions.
• telomere sequence repeat T 4 G 4 Of particular interest to the 1100-15 class of GTO is the structure of the telomere sequence repeat T 4 G 4 , first detected in Oxytricha. The oxytricha repeat has been studied in oligonucleotides by NMR and by crystallographic methods. See Smith et al. Nature, 1992, 356:164-68, and Kang et al. Nature, 1992 356:126-31.
• the present invention provides methods and compositions for treating a pathophysiological state caused by a virus, comprising the step of administering a pharmacological dose of an oligonucleotide, the dose being sufficient to inhibit the replication of the virus, wherein the oligonucleotide contains sufficient contiguous guanosines so that a guanosine tetrad (inter- or intra- molecular) can form, and the three dimensional structure of the oligonucleotide is stabilized by guanosine tetrads formed at strategic locations.
• this method of treating a virus-induced pathophysiological state may be useful against any virus.
• the methods of the present invention may be useful in treating pathophysiological states caused by viruses such as herpes simplex virus, human papilloma virus, Epstein Barr virus, human immunodeficiency virus, adenovirus, respiratory syncytial virus, hepatitis B virus, human cytomegalovirus and HTLV I and II.
• viruses such as herpes simplex virus, human papilloma virus, Epstein Barr virus, human immunodeficiency virus, adenovirus, respiratory syncytial virus, hepatitis B virus, human cytomegalovirus and HTLV I and II.
• the oligonucleotides of the present invention contain a percentage of guanosine bases high enough to ensure anti-viral efficacy.
• the guanosine is important in forming tetrads which stabilize the three dimensional structure of the oligonucleotides.
• the oligonucleotides of the present invention may have any percentage of guanosine bases which will allow for tetrad formation provided that the oligonucleotide exhibits anti-viral activity.
• the oligonucleotides of the present invention contain two or more segments of two or more guanosine bases, and an overall high percentage of G in order to enable the oligonucleotide to form at least one quanosine tetrad.
• the oligonucleotides of the present invention may be capped at either the 3' or the 5' terminus with a modifier.
• the modifier is selected from the group consisting of polyamine or similar compounds that confer a net positive charge to the end of the molecule, poly-L-lysine or other similar compounds that enhance uptake of the oligonucleotide, cholesterol or similar lipophilic compounds that enhance uptake of the oligonucleotide and propanolamine or similar amine groups that enhance stability of the molecule.
• the phosphodiester linkage of the oligonucleotides of the present invention may be modified to improve the stability or increase the anti-viral activity.
• a phosphodiester linkage of the oligonucleotide may be modified to a phosphorothioate linkage.
• Other such modifications to the oligonucleotide backbone will be obvious to those having ordinary skill in this art.
• the present invention also provides specific methods of treating viral states.
• the present invention provides a method of treating a pathophysiological state caused by a virus (in preferred embodiments, as specific virus such as, herpes simplex virus, human papilloma virus, Epstein Barr virus, human immunodeficiency virus, adenovirus, respiratory syncytial virus, hepatitis B virus, human cytomegalovirus and HTLV I and II), comprising the step of administering a pharmacological dose of an oligonucleotide, the dose being sufficient to inhibit the replication of the virus, wherein the three dimensional structure of the oligonucleotide is stabilized by the formation of guanosine tetrads.
• a virus in preferred embodiments, as specific virus such as, herpes simplex virus, human papilloma virus, Epstein Barr virus, human immunodeficiency virus, adenovirus, respiratory syncytial virus, hepatitis B virus, human cytomegalovirus and HTLV I and II
• oligonucleotides and especially G-rich oligonucleotides, work is not completely known, although the inventors have at least narrowed the sites of action as to certain oligonucleotide drugs as will be seen below.
• G-rich oligonucleotides were able to significantly reduce virus production in each. More importantly, actual human clinical studies have demonstrated the efficacy of the drug in reducing viral replicons in AIDS patients.
• the present invention is also drawn to oligonucleotides that have three dimensional structures stabilized by the formation of guanosine tetrads.
• the present invention demonstrates poly and/or oligonucleotides inhibit growth of HTV-1, HSV1, HSV2, FMLV and HCMV and other viruses if the molecule contains a high percentage of ribo- or deoxyriboguanosine.
• the rest of the molecule is composed of thymine, cytosine, xanthosine or adenine nucleotides (ribo- or deoxyribo-), their derivatives, or other natural or synthetic bases.
• the 5' and 3' termini of the oligonucleotide can have any attachment which may enhance stability, uptake into cells (and cell nuclei) or anti-viral activity.
• the backbone which connects the nucleotides can be the standard phosphodiester linkage or any modification of this linkage which may improve stability of the molecule or anti-viral activity of the molecule (such as a phosphorothioate linkage).
• HSV-2 CULTURE ASSAY In viral yield reduction assays, Vero cells (4 x 10 4 cells/tissue culture well) were incubated with oligonucleotide(s) for 14 hours before the oligonucleotide was removed and virus (HSV-2 strain HG52) was added to the cells at a multiplicity of infection (m.o.i.) of 0.1 to 1.0 (4 x 10 3 to 4 x 10 4 PFU). The infection was allowed to proceed for 10 minutes after which the cells are washed and fresh media, containing the same oligonucleotide was added for an additional 14 hours. Then, the cells were subjected to a freeze/thaw lysis after which the released virus was titered.
• m.o.i. multiplicity of infection
• the SUP TI T lymphoma cell line was infected with HTV-1 strain DV at a multiplicity of infection (m.o.i.) of 0.1 for one hour at 37°C. After the infection, free virus was washed off and the newly infected cells were plated (5 x 10 4 cells) in quadruplicate in 96 well plates that had been prepared ? 3 with various dilutions of oligonucleotide. The final concentration of drug varied between 0.1 and 20 ⁇ M. After 3 days of incubation at 37°C, the plates were scored for the presence of multinucleated giant cells (syncytia).
• oligonucleotides In assays designed to inhibit syncytia formation, a number of oligonucleotides exhibited anti-HTV- 1 activity.
• the oligonucleotides and their IC50 are listed in Table A-2.
• 1100-05 is the same as 1100-01 with a cholesterol group attached to the 3' end via a triglycyl-linker.
• 1100-08 is the same as 1100-00 with a cholesterol group attached to die 3' end via a triglycyl-linker.
• 1100-07 was designed as a sequence isomer to 1100-01 and 1100-06 is the cholesterol derivative of 1100-07.
• a 100-00 is the same sequence in the opposite orientation to HLB38p (A 100-50).
• the HTV-1 strain LAV was used to infect MT-2 cells at an m.o.i of 0.01. After 7 days, tiiese cells were scored for cytopathic effects (CPE).
• CPE cytopathic effects
• anti-HTV- 1 assays in which MT-2 cells were infected at an m.o.i. of 0.01 several G-Rich oligonucleotides were able to inhibit viral-induced cytopathic effects with effective dose 50's (IC50s) in the 0.5-1.0 uM range ( Figure 3).
• oligonucleotides shown in Figure 3 were effective in the 0.5 to 1.0 uM range, including A 100-00 (HTV38p) and A 100-50 (HTV38ap), AlOl-00 (HTV38ctl), HTV-26ctl.
• the oligo-nucleotide HTV-26ap exhibited less efficacy in this assay with an IC50 in the 5 to 10 uM range.
• TE represents buffer alone, i.e., no drug, while AZT and ddC are control drugs.
• IC 50 for oligonucleotides in an anti-HTV- 1 syncytia formation assay IC 50 for oligonucleotides in an anti-HTV- 1 syncytia formation assay.
• Friend Murine Leukemia Virus was grown in a chronically infected murine fibroblast cell line (pLRB215) or was propagated in an acute assay system by infection of NTH3T3 cells.
• pLRB215 cells were split (1 x 10 5 ) into 24 well culture dishes and incubated 16 to 20 hours at 37°C. The media was then removed and replaced with media containing various concentrations of oligonucleotide. After 1, 3 or 5 days, culture media was assayed for the presence of the viral reverse transcriptase enzyme.
• NTH3T3 cells were split (1 x 10 4 ) into 96 well dishes and allowed to incubate for 16-20 hours.
• culture media was removed and concentrated virus stock (10 ⁇ l) was added to each well in 100 ul of completed media containing 2 ⁇ g/ml polybrene.
• the virus infection was allowed to proceed for 18 hours at which time the virus containing media was removed and complete media containing various concentrations of oligonucleotide was added. After 4 to 7 days, the culture media was assayed for the presence of viral reverse transcriptase.
• HCMV CULTURE ASSAY Human cytomegalovirus was cultured in the human diploid lung fibroblast cell line MRC-5. These cells were split and placed into 24 well culture dishes and preincubated for 24 hours with various concentrations of oligonucleotide (0.5 to 20 ⁇ M) in complete media. The oligonucleotide was then washed off and virus was added to the cells (approximately 0.1 m.o.i.) for 2 hours at 37°C. The virus was then removed and complete media containing the same concentration of oligonucleotide was added. Cells were then placed at 37°C for 10-12 days at which time virus in the culture media was titered using a standard agar overlay procedure. BACTERIAL T3 AND T7 ASSAYS
• reverse transcriptase (either MMLV or FMLV from pLRB215 culture media) was incubated with various concentrations of oligonucleotide and then assayed using the enzyme linked oligonucleotide sorbent assay (ELOSA), the ELOSA kit which is commercially available from New England Nuclear.
• ELOSA enzyme linked oligonucleotide sorbent assay
• the oligonucleotide B 106-62 was originally designed to form a triple helix structure with a portion of the promoter region of the major immediate early protein of HSV-2 (YE 175).
• the phosphorothioate derivative of two oligonucleotides were synthesized and tested for anti-viral activity against HSV-2.
• Figure 2 shows that the B 106-62 oligonucleotide at 20 ⁇ M was able to reduce viral titers by approximately 20% whereas the phosphorothioate version (B 106-96) reduced virus by 50% in the submicromolar concentration range.
• control oligonucleotide (B 106-97), the phosphorothioate backbone derivative of B 106-71, was also able to inhibit virus at the same levels as B 106-96. Even when an extensive washing procedure at a pH of 3.0 was employed to remove excess virus not internalized during the infection, incubation with both B 106-96 and B 106-97 was able to significantly reduce virus yield. Thus, the inventors concluded that the mechanism of anti-viral activity was not merely a blocking of the adsorption of HSV-2 virions to cells.
• Figure 2 also shows the results of acyclovir in the same molar range as the oligonucleotides. Acyclovir was tested against two different stocks of HSV-2 strain HG52, as illustrated in Figure 4.
• oligonucleotides were synthesized with an amino modified 3 '-terminal, which resulted in the covalent attachment of a propanolamine group to the 3 '-hydroxyl group or resulted in a cholesterol moiety attached to the 3'- terminal via a triglycyl-linker. Oligonucleotides used in this example were capped at their 3 '-terminal with either a propanolamine or a cholesterol moiety to reduce degradation by cellular exonucleases. Phosphorothioate containing oligonucleotides were prepared using the sulfurizing agent TETD or beaucauge reagent. The 3 '-cholesterol modified oligonucleotides were prepared and purified as described by Vu et al. (in Second International Symposium on Nucleic Acids Chemistry, Sapporo, Japan, 1993).
• the concentration of oligonucleotide needed to reduce cell proliferation by 50% (TC 50 ) of selected compounds, based on the dye metabolism assay was approximately 40 to 50 ⁇ M for oligonucleotides with PD backbones and 15 to 40 ⁇ M for those compounds containing a PT backbone.
• the TC 50 for selected oligonucleotides are presented in Table A- 3. Stability and toxicity tests were replaced as described below
• oligonucleotides listed were synthesized with phosphodiester backbones except 1100-12 which had phosphorothioate (PT) linkages. ?
• the capping group at the 3'-end of the oligonucleotide was either a propanolamine or cholesterol moiety.
• the cytotoxicity of selected oligonucleotides was assayed using the CellTiter 96TM Aqueous Non-Radioactivity Cell Proliferation Assay (Promega). This is a colormetric method for determining the number of viable cells in proliferation or chemosensitive assays using a solution if MTS. Dehydrogenase enzymes found in metabolically active cells convert MTS into a formazan product. The SUP TI cells used in the cytotoxicity assays were in log phase growth at the time of the assay. Cytotoxicity profiles for GTOs with PD backbones such as 1100-15 (SEQ. YD. NO.
• TC 50 s (50% cytotoxic concentration) in the range of 30 to 50 ⁇ M while GTOs with PT backbones such as 1100-15 had TC 50 s in the 10 to 30 ⁇ M range.
• the TC 50 for AZT in this assay format was approximately 10 ⁇ M .
• Blockage of the hydroxyl terminus of oligonucleotides has been shown by many investigators to greatly reduce degradation by cellular exonucleases. Therefore, all oligonucleotides used in these studies were modified at their 3'- end with either a propanolamine group or a cholesterol group.
• 10 ⁇ M of GTOs were incubated in MEM (GIBCO) supplemented with 10% FBS.
• oligonucleotide 1100-07 was 10 fold more active at inhibiting HTV-1 induced syncytium formation than the other motifs tested (e.g. 1100-00 shown in Table A-l). 1100-07 and its derivatives (length and chemical modifications) were further tested for their ability to inhibit virus in a dose-dependent fashion by measurement of syncytium formation and viral p24 production.
• HrV-l DV was used to infect the SUP TI lymphoblastoid cell line at an m.o.i. of 0.1 TCID50 for one hour at 37°C prior to washing and resuspension in increasing concentrations of GTOs.
• the cells (2 x 10 4 cells/well) were inoculated in triplicate in 200 ul of RPMI 1640 containing 10% fetal calf serum.
• the number of syncytia per well or the level of p24 in the medium was determined.
• the results of these assays are presented in Table A-4. which results indicated that GTOs with simple PD linkages were capable of inhibiting HTV-1 syncytia formation and p24 production in culture.
• these compounds suppressed virus at least 7 days post-removal of drug. All other compounds at 5 uM were the same as AZT 7 days after removal of drug.
• the duration of the viral suppression was assayed by changing the medium in HTV-1 infected cultures containing 2.5 uM of various oligonucleotides to complete media without added oligonucleotide on day 4 post-viral infection.
• the production of viral p24 antigen was then assayed on day 7 and day 11 post-infection.
• the results of this experiment indicated that the shorter variants of 1100-07 (1100-15 and
• PT phosphorothioate backbone linkages
• AZT (4 ⁇ M) was also replaced on day 4 post-infection with drug free media.
• two days after removal of AZT from the culture medium the presence of syncytium was observed in the HTV-1 infected cell cultures and by day 4 all cells were visibly infected with HTV-1.
• SUP TI cells were counted for all treated samples 7 days after removal of the oligonucleotides from the infected cell cultures. The results indicated that for cells treated with 2.5 ⁇ M of drug there was no difference in the number of cells when compared with control cultures (uninfected, untreated) of SUP T 1 cells.
• PBMCs peripheral blood mononuciear cells
• 1100-15 was assessed for activity in PBMC cultures derived from AIDS patients. Briefly, PHA activated uninfected PBMCs were added to 4PBMC's derived from patients with HTV infection in the presence of varying concentrations of oligonucleotide. Anti-HTV activity was assessed by analyzing supematants, collected every three days from these mixed cultures, for the presence of HTV p24. The PHA activated PBMCs were grown in the presence of 10 units/ml of IL-1 and medium was exchanged every three days for a period of three weeks. HTV p24 antigen production was assayed in drug-treated as compared to untreated control specimens. It should be noted that the results in these experiments
• 1100-07 In order to determine whether 1100-15 or its parent molecule, 1100-07 (or the PT version 1100-
• DNA polymerase activity of the RT enzyme by competitive inhibition at the active site of the enzyme.
• the K, value for all of the oligonucleotides tested is presented in Table A-7.
• the data indicate that for all oligonucleotides tested the presence of the sulfur group in the backbone greatly enhanced the interaction between the oligonucleotides and the enzymes.
• the median inhibitory dose (TD 5 o) for these oligonucleotides were also calculated (Table A-7).
• the ⁇ D 50 results are based on the ability of these compounds to inhibit 10 nM of HTV RT.
• Short oligonucleotides (18 mers) with PD or PT backbones were assayed to determine whether the nature of the nucleotide sequence contributed to inhibition of HTV-1 RT in this assay system.
• Comparison of the effects of the PD versions of a GTO (1173 or 1100-15), poly dC (1229) or a random nucleotide sequence (1231) suggested that at this length none of the sequence motifs inhibited RT (Table A-7).
• Enzyme inhibition monitored by both Ki and ID 5 o was observed for the PT versions of these same 18 mer oligonucleotides (Table A-7).
• the degree of enhancement of observed enzyme inhibition for all oligonucleotides tested when the sulfur group was present in the backbone was between one to three orders of magnitude (Table A-7).
• oligonucleotides 1232 (GATC) 18 PT 0.56 0.045 a
• Each pair of oligonucleotides contain the same sequence and differ only in the nature of their backbone linkage.
• Oligonucleotides 1229 and 1230 were poly dC while the 1231 and 1232 oligonucleotides were a random sequence of all four bases (GATC).
• the backbone modifications are denoted as PD for phosphodiester and PT for phosphorothioate.
• the outer envelope glycoprotein gpl20 of HTV-1 mediates viral attachment to the cell surface glycoprotein CD4 in the initial phase of HTV-1 infection.
• the effects of both PD and PT modified oligonucleotides on this interaction were examined using a gpl20 capture ELISA kit.
• the concentration of the gpl20 used in these studies (125 ng/ml) was determined to be within the linear range of the detection assay.
• the ability of oligonucleotides to inhibit gpl20/CD4 interactions by binding to gpl20 was determined by preincubation of the test compounds with soluble gpl20 before addition to the immobilized CD4.
• the results of this experiment (Table A-8) are presented as the concentration of oligonucleotide needed to reduce by 50% CD4 bound gpl20 (ID 50 [gpl20]).
• the reciprocal experiment was then performed to measure the ability of the oligonucleotides to inhibit these interactions by binding to immobilized CD4.
• a fixed length (18 mer) set of oligonucleotides with either PD or PT backbones were assayed to determine whether the nature of the nucleotide sequence contributed to inhibition of gpl20/CD4 interactions.
• the PD versions of these molecules had little or no measurable effects on the binding of gpl20 with CD4.
• the PT versions of these oligonucleotides did yield measurable inhibitory activity.
• the 18 mer GTO (1174) interrupted
• RNA oligonucleotide interactions with the v3 loop was conducted using a v3 loop specific murine Mab, NEA-9284 ( Figure A- 10).
• PT oligonucleotides were able to inhibit binding of NEA-9284 to gpl20.
• the presence of bound gpl20 specific Mab was determined using a HRP-labeled goat-I-mouse antibody.
• the ID 50 for the most active oligonucleotide (1100-21) was approximately 4 to 7 ⁇ M.
• FIG. 11 A schematic diagram of the positions of the PCR primers used in the DNA and RNA analysis is shown in Figure 11.
• Total extracted DNA was analyzed using a PCR primer set which would amplify a 200 bp portion of the viral genome spanning the repeat element (R) into the gag gene.
• the primer set detected full-length or nearly completely synthesized viral DNA. This is the last region of the minus strand of viral DNA that is synthesized.
• two template-switching events have occurred and contiguous 5'LTR to gag sequences must be present on either the minus or plus strand of DNA.
• RNA extracted from HTV-l infected cells was analyzed by RT-PCR.
• the antisense primer of the PCR primer pairs was used with MMLV RT and extracted mRNA to synthesize cDNA strand.
• the resultant cDNA was then used as a template in PCR reactions.
• Two RNA primer sets were used to analyze unspliced (primers rl and r2) and spliced (primers rl and r3) HTV-1 transcripts. Predicted sizes of the amplified products were 101 bp and 214 bp for the unspliced and spliced species respectively.
• the same ⁇ -actin primers used for the analysis of the DNA samples were used as controls in this experiment.
• the G- tetrad formation involves the formation of eight hydrogen bonds by coordination of the four O 6 atoms of guanine with alkali cations believed to bind to the center of a quadruplex, and by strong stacking interactions.
• the oligonucleotides purified using anion exchange chromatography then have an opportunity to form inter- or intra-molecular tetrads.
• the tetrad structure can be strengthened by replacing the sodium ion with potassium.
• Nondenaturing gel analysis 1100-15 (17 mer, Table A-5) was analyzed using nondenaturing polyacrylamide gel electrophoresis. In this experiment, trace concentrations of radiolabeled oligonucleotide (10 "7 M) was incubated with increasing concentrations of cold oligonucleotide (up to 10 " 5 M) before gel analysis in the presence of monovalent cation. Under the gel conditions used, 1100-15 migrated as a unique band faster than a random coiled (denatured) 17 mer oligonucleotide would and it was shown to do so in a concentration independent fashion (data not shown).
• T 2 G 4 the structure of the telomere sequence repeat T 2 G 4 , first detected in Oxytricha.
• the Oxytricha repeat has been studied in oligonucleotides by NMR, Smith et al., Nature 1992, 356:164-68, and by crystallographic methods, Kang et al. Nature, 1992, 356:126-31.
• both the NMR and crystallographic studies suggested that folding is mediated by square planar Hoogsteen H-bonding among G residues, with overall antiparallel orientation of the four strand equivalents comprising the tetrad fold.
• the crystallography has shown that the structure is selectively stabilized by tight binding of a small monovalent cation to the O 6 oxygen of guanosine.
• both NMR and crystallography confirm that the folded structure possess alternating syn/anti glycosidic bond angles (as opposed to all anti for most duplex structures).
• Intrabase H8-C1' and interbase H7-C2" NOE connectivity which demands a pattern of alternating syn-anti glycosidic bond angle throughout the "tetrad stem" of the folded structure.
• G-tetrad comprising the surface of the tetrad core. Based upon this structure, it appeared likely that interaction with cellular macromolecules would be heavily dominated by the structures of these surface loops. In that regard, the inventors believe that it may be inappropriate to think of such interactions as "tetrad binding.” The inclusion of G-tetrads in such a structure may not be important as a recognition element per se, but instead provides a latticework upon which an orderly loop array is positioned.
• loop regions did not appear to be under mechanical stress, they were short enough so that they possessed very high configurational freedom. Because of those severe length constraints, it was found that all feasible loop models display a distinct "rabbit ears" structure, wherein the two base planes of the loop region are unstacked, and point outward from the center of the octet core. Such rigid, unstacked, single strand loop character was very distinctive as compared to other known folded nucleic acid structures. Therefore, varying the sequence or chemical structure of these loops, one at a time, was necessary to determine if bonding interactions between these loops and cellular macromolecules are important to the observed anti-HTV activity.
• the structures described above possessed a single G-octet core, which was known to be the minimum structure required for nucleation of tetrad formation. Therefore, when paired with the observed short loop size, the intramolecular tetrad structure proposed for 1100-15 is best described as meta-stable, relative to other more robust tetrads which have been described in the literature.
• An increase of the core from 2 to 3 stacked tetrads, or an increase in the length of flexibility of one or more loops would be expected to increase the thermodynamic and/or kinetic stability of this structure significantly.
• the observed anti-HTV activity can be improved by sequence modification which enhances the stability of the underlying tetrad latticework.
• 1100-15 and homologues display profound resistance to cellular nucleases.
• One interesting aspect of the proposed structure was that, even in the loop domains, phosphodiester linkages are generally buried from interaction with large solutes, such as a nuclease.
• the structure analysis proposed defined local phosphodiester backbone structure at low resolution. When paired with explicit biochemical analysis of phosphodiester cleavage rate, it is possible to define sites for selective introduction of backbone modification in 1100-15 homologies, for the purpose of extending the biological half life in vivo.
• the gel electrophoresis data described above suggested that 1100-15 spends very little time as a random coil at 25°C, under native salt conditions. Although the gel data rules out intermolecular associations, the data do not constrain the oligomer to any particular folded monomeric structure.
• NMR NMR was measured in H 2 0, employing a Redfield pulse sequence to saturate the water resonance, as described previously, Dittrich et al., Biochemistry, 1994 33:4111-4120.
• Figure 15 a KCl titatation is displayed.
• imino proton signals cannot be resolved in the 10-12 ppm region.
• substantial narrowing of imino signals was obtained, saturating at an added KCl concentration of 3mM, which is very close to one added K + equivalent per octet.
• thermal melting analysis at 2.7 mM in strands, 6mM KCl, 20mM LiCl, pH 6.0 over the range from 3000K to 3450K was performed.
• the imino proton spectrum undergoes an abrupt transition, which is likely to be representative of cooperative unfolding of the octet. Stability of this kind, accompanied by apparently high thermal cooperativity is very striking indeed, and is generally indicative of a single, well-defined folded oligonucleotide structure.
• oligonucleotides reduced HCMV titers in tissue culture. Each of the oligonucleotides contained a different percentage of guanosine residues and a different number of total nucleotides in the polymer. The results of this assay are depicted in Table A-9. All oligonucleotides were capable of reducing viral titer in culture including G 101-50 which contained only 53% G residues
• oligonucleotides In NIH3T3 cells chronically infected with FMLV, oligonucleotides (Fig. 1) were capable of inhibiting virus production. However, oligonucleotide controls in this experiment were capable of inhibiting virus production in culture.
• full length transcripts directed by the T7 promoter would be 131 bases long while full length transcripts directed by the T3 promoter would be 171 bases long (position of the Dde I site relative to the mRNA start site).
• the truncated transcript analyzed in Figure 5C was approximately 63 bases long and matched the predicted size fragment when p275A was used as a template (T7 promoter).
• G101-50 (53% G) inhibited T7, but not T3 directed, transcription by a mechanism other than attenuation (Figure 5A) since no truncated transcripts were observed when this oligonucleotide was used alone.
• 1100-11 (26% G) increased the level of specific transcripts directed by the T7 promoter ( Figure 4).
• both specific and control G-Rich oligonucleotides were capable of inhibiting eukaryotic transcription when a HeLa cell extract system was used.
• the oligonucleotides used were B133-54; B133-55 and B107-51 as specific inhibitors via potential triple helix mechanism of action and G101-50 and 1100-11 as the low G-content control oligonucleotides.
• T30177 is an oligonucleotide composed of only deoxyguanosine and thymidine, it is 17 nucleotides in length is the same sequence as 1100-15 (SEQ. ID. NO. 33), and it contains single phosphorothioate internucleoside linkages at its 5' and 3' ends for stability. This oligonucleotide does not share significant primary sequence homology with, or possess any complementary (antisense) sequence motifs to the HTV-1 genome. As shown below, T30177 inhibited replication of multiple laboratory strains of HTV-1 in human T-cells lines, peripheral blood lymphocytes, and macrophages.
• T30177 was also shown to be capable of inhibiting multiple clinical isolates of HTV-1 and preventing the cytopathic effect of HTV-1 in primary CD4 + T-lymphocytes.
• IC 50 median inhibitory concentration
• T30177 was a potent inhibitor of HTV-1 integrase reducing enzymatic activity by 50% at concentrations in the range of 0.01 to 0.10 ⁇ M.
• T30177 was also able to inhibit viral reverse transcriptase activity, however, the 50% inhibitory value obtained was in the range of 1-10 ⁇ M depending upon the template used in the enzymatic assay. No observable inhibition of viral protease was detected at the highest concentration of T30177 used (10 IM).
• T30177 was removed from infected cell cultures 4 days post-HTV-1 infection, total suppression of virus production was observed for more than 27 days. Polymerase chain reaction analysis of DNA extracted from cells treated in this fashion was unable to detect the presence of viral DNA 11 days after removal of drug from the infected cell cultures.
• the ability of T30177 to inhibit both laboratory and clinical isolates of HTV-1 and the experimental data suggested to the inventors that T30177 represented a novel class of integrase inhibitors, indicating that this compound was a viable candidate against evaluation as a therapeutic agent for HTV-1 in humans.
• T30177 a variant of 1100-15
• T30177 is a potent and selective inhibitor of HTV-1 via at least two mechanisms.
• One mechanism involves interfering with CD4- and gpl20-mediated cell fusion events.
• T30177 is 100-fold less effective in inhibiting gp 120-induced cell fusion events than it is at inhibiting an early event in the viral life cycle, suggesting a specific point of interdiction distinct from that of blocking virus/cell interactions.
• T30177 is a potent inhibitor of the HTV-1 integrase enzyme in vitro and that by blocking these events in the viral life cycle T30177 is able to suppress virus production for prolonged periods after an initial short treatment regimen with the drug.
• Oligonucleotides The deoxyguanosine-rich and other oligodeoxynucleotides used in this study were synthesized, purified, and characterized as previously reported. Ojwang, et al., J. AIDS 7:560-570 (1994); Rando, et al, J. Biol Chem. 270:1754-1760 (1995). The sequence and phosphorothioate (PT) pattern of the oligonucleotides used in antiviral assays is shown in Table B-7.
• Zidovudine (3'-azido-3'-deoxythymidine, AZT) and the nucleoside analogs 2',3'- dideoxyionsine (ddl) and 2',3'-dideoxycytidine (ddC) were obtained from the AIDS Research and Reference Reagents Program, National Institute of Allergy and Infectious Diseases.
• Dextran sulfate (DS5000) was purchased from Sigma, and the bicyclam derivatives JM2763 and JM3100 (De Clereq, et al., Antimicrob. Agents Chemother. 38:668-674 (1994)) were obtained from Johnson Matthey
• cytotoxicity Analysis The cytotoxicity of T30177 was assayed as described above. The concentration of drug necessary to give one-quarter (TC 25 ), one-half (TC 50 ) or 95% (TC 95 ) of the maximum inhibition of growth response was then determined. The degree of cell proliferation was determined according to the manufacturer's instructions.
• HTV-1 infection assays using cell lines Laboratory strains of HTV-1, HTV-2, simian immunodeficiency virus (STV), or the low passage isolate HrV-l DV (Ojwang, et al., J. AIDS 7:560-570 (1994)), were used to infect established cell lines using the indicated multiplicity of infection (MOI) of virus, for one hour at 37°C prior to washing and resuspension in medium containing increasing concentrations of drug.
• MOI multiplicity of infection
• the infected cells (2 x 10 4 cells/well) were inoculated in triplicate in 200 ⁇ of complete medium which contains RPMI 1640 (Life Technologies) supplemented with 10% FBS, penicillin (50 U/mL), streptomycin (50 ⁇ g/mL) and L-glutamine, (2 mM).
• RPMI 1640 Life Technologies
• penicillin 50 U/mL
• streptomycin 50 ⁇ g/mL
• L-glutamine (2 mM.
• drug treated and control wells were analyzed for HTV-1 induced cytopathic effects, for the presence of viral reverse transcriptase (RT) or viral p24 antigen in the culture medium.
• RT viral reverse transcriptase
• Cytopathic effects were monitored by either direct counting of HTV-1 inducted syncytium formation or by staining cells with the tetrazolium dye XT or MTT. Buckheit, et al., AIDS Research and Human Retroviruses 7:295-302 (1991).
• the AZT resistant strain of HTV- 1 was kindly provided by Dr. Brendan Larder and the AIDS Directed Programme Reagent Project, Medical Research Council, England.
• PBMCs Peripheral blood mononuclear cells
• HTV-1 negative and hepatitis B virus (HBV) negative (healthy) donors by Ficoll/Hypaque density gradient centrifugation, cultured as described by Gartner and Popovic (Gartner et al., In Techniques in HTV Research, p. 59-63 (1990)), then activated with phytohemagglutinin (2 ⁇ g/mL) and cultured in RPMI 1640 medium supplemented with 15% fetal bovine serum (FBS) and human recombinant interleukin 2 (TL-2, 30 units/mL).
• FBS fetal bovine serum
• TL-2 human recombinant interleukin 2
• HTV-1 replication was analyzed using the Coulter p24 antigen-capture assay.
• PBLs Human peripheral blood lymphocytes
• HTV-1 infection of PBLs Human peripheral blood lymphocytes (PBLs) were isolated from blood drawn from HTV-1 and HBV seronegative donors. PBLs were isolated by Ficoll-Hypaque density gradient centrifugation. The PBLs were suspended in culture medium (RPMI 1640 medium supplemented with 2 mM L-glutamine, 20% FBS and 50 ⁇ g/mL gentamicin) and the cells counted using the trypan blue exclusion technique. After adjustment of cell density to 1 x 10 7 cells per mL with culture medium, the suspension was placed in a T-75 culture flask and incubated flat at 37°C in a humidified atmosphere of 5% C0 2 for 2 hours.
• culture medium RPMI 1640 medium supplemented with 2 mM L-glutamine, 20% FBS and 50 ⁇ g/mL gentamicin
• the non-adherent cell population was decanted into a sterile disposable flask.
• Phytohemagglutinin (PHA-P) was added to the PBL suspension at a concentration of 2 ⁇ g/mL and the PBI preparation was then further incubated at 37°C for 48 hours. At this time an aliquot of the culture was used for virus infectivity studies.
• PBLs (5 x 10 5 cells/well) were infected with HTV-1 isolates at an MOI of 0.2. This level of infection yielded a satisfactory virus control RT activity value result at day 7 post-infection (Buckheit, et al., id. (1991)).
• HTV-1 replication was analyzed using either the RT or p24 assay systems. Data was obtained in the p24 assays by spectrophotometric analysis at 450 nm using a Molecular Devices Vmax plate reader. Inhibition of acute infection of primary human macrophages. Human macrophage cultures were established as described by Crow et al.
• PBMCs isolated from HTV-1 and HBV seronegative donors was allowed to adhere to glass at 37°C for two hours in calcium and magnesium free PBS (pH 7.4).
• the non- adherent cells were aspirated and the adherent cells were washed three times with cold PBS.
• the adherent macrophages were scraped free from the plate, counted, and inoculated into 96 well plates at a concentration of 10 5 cells/well in RPMI 1640 medium supplemented with 10% human serum.
• the macrophages were cultivated in RPMI 1640 with 10% human serum.
• the macrophages were infected with HrV-l DV at a multiplicity of infection of 0.1 for 24 hours at 37°C in the presence of the indicated amount of drug. Unabsorbed virus was then washed off and the cells were further incubated for 7 days at 37°C in complete medium supplemented with the indicated amount of drug. On day 7 post-infection the adherent macrophages were washed extensively with PBS and lysed with detergent. Cytoplasmic HTV p24 levels were then quantitated and percent inhibition were calculated and compared to control infected but untreated cells. Long term suppression studies.
• Respiratory syncytial virus (RSV strain A2), and influenza A (FLUA strain H3N2) virus assays were performed as described by Wyde et al. (Wyde, et al., Drug. Dev. Res. 28:467-472 (1993)) while Herpes Simplex viruses types 1 and 2 (HSV-1, HSV-2) plaque reduction assays were performed as previously described. Lewis, et al, Antimicrob. Agents Chemother. 38:2889-2895 (1994).
• VSV Vesicular stomatitis virus
• Sindbis virus Sindbis virus
• Coxsackie virus B4 Polio virus-1
• Semliki forest virus assays were performed as described by De Clereq (De Clereq, E., Antimicrob. Agents Chemother. 28:84-89 (1985).
• the arenaviridae assays (Junin and Tacaribe viruses) were performed as described by Andrei and De Clereq (Andrei, et al., Antiviral Res. 14:287-299 (1990).
• Punta Toro virus ATCC VR-559
• Yellow fever virus vaccine strain 17D
• HTV-1 infected lymphocytes Seven days post-HTV-l infection of PBMCs, the infected cell culture medium was analyzed for HTV-1 production using the p24 antigen- capture assay. In addition, cells from both the drug treated and control wells were analyzed for CD4 and CD8 antigens by cytofluorometry. Briefly, cells were washed and treated with fluorochrome-labeled monoclonal antibodies to CD4 or CD8 (Becton Dickinson). The cells were washed again and fixed with 2% paraformaldehyde before analysis. Crissman, et al., Flow Cytometry and Sorting, p. 229-230 (1990) and Crowe et al., AIDS Res. Hum. Retroviruses 3:135-145 (1987).
• HTV-1 cDNA Single cycle analysis of HTV-1 cDNA.
• CEM-SS cells (2 x 10 6 cells/well) in 0.5 mL of complete medium were infected with HTV-I SKI at a MOI of 1.0 for 45 minutes on ice at which time complete culture medium (10 mL) was added to the cells.
• the infected cells were then pelleted (1000 RPM for 10 min. at 4°C), washed twice and aliquoted into a 24-well flat bottom plate (2 x 10 5 cells/well). The indicated amount of drug was added to the infected cell cultures at various times during or post- infection.
• the cells were harvested 12 hours post-infection at which time cell pellets were lysed in 100 ⁇ polymerase chain reaction (PCR) lysis buffer (50 mM KCl, 10 mM Tris-HCl (pH8.3), 2.5 mM MgCl 2 , 0.1 mg/mL gelatin, 0.45% Nonidet P40, 0.45% Tween 20 and 75 ⁇ g mL Proteinase K) at 500C for one hour followed by 95°C for 10 minutes. The lysate was stored at -2°C until use.
• PCR polymerase chain reaction
• PCR analysis of viral cDNA was performed using 10 ⁇ L of total cell lysate in a 100 ⁇ L reaction buffer as previously described (Rando, et al, J. Biol. Chem. 270:1754-1760 (1995)).
• the primers used were 5'-ATAATCCACCTATCCCAG TAGGAGAAAT-3' and 5'-TTTGGTCCTTGTCTTATGTCCAGAATCG-3' which will amplify a 115 bp segment of the T ⁇ V-1 genome.
• the cycle conditions used were 95°C for 10 minutes to denature the DNA, followed by 30 cycles of 95°C for 75 seconds, 60°C for 75 seconds, and a final extension step at 60°0C for 10 minutes.
• CEM-SS cells (2 x 10 7 ) were infected with HTV-I SKI (MOI of I) for 45 minutes at 37°C with gentle mixing. Following virus attachment, the cells were gently pelleted, washed twice and resuspended in complete tissue culture medium.
• PCR primer sets included control primers for the amplification of mitochondrial DNA (sense, 5'-GAATGTCTGCACAGCCACTTT-3'; antisense, 5'-ATAGAAAGGCTAGGACCAAAC-3'; amplified product, 427 bp); primers for the detection of early viral transcription events (M667 and AA55 primers as described by Zack et al.
• PCR products were separated by agarose gel electrophoresis and visualized by ethidium bromide staining.
• Reverse transcriptase enzyme inhibition assays Purified recombinant RT (HTV-I BHIO ) was obtained from the University of Alabama, Center for AIDS research. The enzyme assays utilized three different template:primer systems, primed ribosomal RNA, gapped duplex DNA, and poly(rA)p(dT) ⁇ 2- ⁇ g to evaluate the inhibition of HTV-1 RT as described by White et al. (White, et al., Antiviral Res. 16:257- 266 ( 1991 ), and Parker et al. (Parker, et al, J. Biol Chem.
• Integrase enzyme assays Purified recombinant HTV-1 integrase enzyme (wild-type) was a generous gift from Dr. R. Craigie, Laboratory of Molecular Biology, National Institute of Diabetes and Digestive and Kidney Diseases. The enzyme (0.25 ⁇ M) was preincubated in reaction buffer at 30°C for 30 minutes. All 3'-processing and strand-transfer reactions were performed as described previously by Fresen et al. (Fresen, et al, Proc. Natl. Acad. Sci. USA 90:2399-2403 (1993)) and Mazumder et al. (Mazumder, et al, Proc. Natl.
• HTV-1 protease enzyme (Bachem) was diluted to 166 ug mL in 50 mM NaOAc, 5 mM DTT, 2 mM EDTA, and 10% glycerol (pH 5.0) and stored as 10 ul aliquots at -20°C.
• HTV protease substrate I (Molecular Probes) was diluted to a working concentration of 0.32 nmol TL. Enzyme (20 ⁇ L), substrate (20 ⁇ L) and drug (20 ⁇ L) were added to each well of a microtiter plate. Positive and negative controls were evaluated in parallel. Fluorescence was quantitated on a Labsystems Fluoroskan II using 355 nm for excitation and 460 nm emission wavelengths at 370C at time zero and at 30 minute intervals for 2 hours.
• HeLa-CD4- ⁇ -galactosidase cell assays Two different assays using genetically engineered HeLa cells were performed as described previously. Buckheit, et al, AIDS Research and Human Retroviruses 10:1497-1506 (1994). These assays utilized the HeLa-CD4-LTR- ⁇ -galactosidase cell line (Kimpton, et al, J. Virol. 66:2232-2239 (1992)), which employ a tat protein-induced transactivation of the ⁇ - galactosidase gene driven by the HTV-1 long terminal repeat (LTR).
• LTR long terminal repeat
• the HL2/3 cells express both the HTV-1 envelope glycoprotein and tat gene product so that co-cultivation of these cells with the HeLa-CD4- LTR- ⁇ -galactosidase cells would allow for CD4- and gp 120— mediated cell fusion.
• the extent of cell fusion can then be monitored by the degree of tat transactivation of LTR-driven ⁇ -galactosidase expression.
• the anti-HTV- 1 activity in cell culture assays of the oligonucleotide (1100- 15) composed entirely of G and T was established by the inventors. See also, Ojwang, et al, J. AIDS 7:560-570 (1994); Rando, et al, J. Biol. Chem. 270:1754-1760 (1995). 1100-15 was found to inhibit HTV-I D V in SUP TI cells with a median inhibitory concentration (IC 50 ) of 0.125 ⁇ M. 1100-15 was synthesized with an unmodified (natural) PD internucloeside linkage and a propanolamine group attached to the 3'-terminus to increase the stability of the oligonucleotide.
• T30177 a modified variant of 1100-15, has the same sequence as 1100-15 but contains an hydroxyl moiety at its 3 '-terminus and a single PT internucleoside linkage at both the 5'- and 3 '-ends. Cytotoxicity Assays. The cytotoxicity of T30177 was determined using several different cell lines and primary human cells as described above. The TC 25 , TC 50 and TC 95 values obtained are shown in Table B-1.
• the cytotoxicity profile obtained for log phase growing cells was variable depending upon the cell line used, while the slower growing PBMCs, PBLs, and macrophages all tolerated the compound at concentrations exceeding 100 ⁇ M as monitored using the trypan blue exclusion, [ 3 H]thymidine uptake, or [ 3 H]leucine uptake techniques.
• Table B-1 Cytotoxicity of T30177 in established cell lines and primary cells.
• TC 2 5, TC 5 0, and TC95 values are the concentrations of T30177 required to inhibit 25%, 50% and 95% of growth (cell lines) or cell survival (primary human cells).
• the cytotoxicity of T30177 in human cell lines was determined using log phase growing cells.
• the cytotoxicity of T30177 in primary human cells was determined using trypan blue exclusion technique or by measuring the uptake of [ 3 H]thymidine or [ 3 H]leucine on slow growing primary cells.
• CEM-SS cells were infected with HTV-I RF at an MOI of 0.01 and treated with T30177, AZT or ddC for six days.
• T30177 inhibited HTV-I RF replication in a dose-dependent manner with an IC 50 value of 0.075 ⁇ M while the control drugs, AZT and ddC, had IC 50 values of 0.007 and 0.057 ⁇ M respectively ( Figure B-1).
• T30177 was then assayed against additional strains of HTV- 1 in a variety of different cell lines.
• the IC50 value is the concentration of drug required to inhibit virus production by 50%.
• the results presented are the averages of three or more experiments.
• the IM units are an approximation based upon the average molecular weight (5000) of the material used in these studies.
• T30177 was also tested for its ability to inhibit laboratory strains of HTV-2 and STV.
• the results (Table B-2) from these assays indicate that T30177 is more active against the strains of HTV-1 and STV tested than against the two strains of HTV-2 tested (ROD and EHO).
• T30177 was found to be inactive against a variety of enveloped and nonenveloped viruses tested (Table B-3) with IC 5 o values found to be greater than the highest concentration of drug tested (200 ⁇ g/mL or 37 ⁇ M). This is in contrast to DS5000 which was found to be a potent inhibitor of all of the enveloped viruses tested except Vaccinia and Semliki forest viruses (Table B-3).
• DS5000 5 ⁇ g/mL is approximately equal to 1 ⁇ M.
• MCC normal cell morphology
• HTV-1 Replication in Peripheral Blood Cells The primary targets of HTV-1 infection in vivo are CD4 + T lymphocytes and macrophages. Therefore in the following set of experiments the inventors tested the efficacy of T30177 on HTV-1 replication in PBMCs, PBLs and macrophages.
• Activated PBMCs were infected with laboratory strains of HTV-1 and cultured in the presence of T30177, AZT or ddl. Treatment of infected PBMCs with T30177 inhibited the replication of the all four HTV-1 isolates tested with IC 50 values ranging from 0.12 to 1.35 ⁇ M (Table B-4). In this assay AZT was more efficacious against all HTV-1 isolates tested, on a molar scale, than T30177 while at the same time T30177 was more potent than ddl against the two HTV-1 strains tested. It is also interesting to note that HTV-I I ⁇ B was more susceptible to T30177 in assays performed using PBMCs than in assays using T-cell lines (Tables B-2 and B-4).
• PBMCs syncytium inducing
• SI syncytium inducing
• NBI non-syncytium inducing
• any anti-HTV drug is dependent upon its ability to inhibit clinical isolates of the virus obtained from different geographical locations. Therefore, the inventors evaluated the ability of T30177 to inhibit the infection of PBLs using a variety of clinical isolates of HTV-1 which were both syncytium inducing (SI) and non syncytium inducing (NSI) strains of HTV-1. In addition, the isolates used in this study had their origins in different geographic regions. After infection with HTV-1 the PBLs were cultured in the presence of T30177, AZT or ddl for seven days. T30177 inhibited the viral replication of all the HTV-1 isolates tested with IC 50 values ranging from 0.23 to 3.08 ⁇ M (Table B- 4).
• AZT and ddl had IC 50 values ranging from 0.01 to 1.65 ⁇ M and 0.41 to 2.61 ⁇ M, respectively. It is important to note that T30177 was active against both NSI and SI isolates and was very active against he JOGA isolate which was obtained from a pediatric patient. The JOGA isolate was also observed to be relatively resistant to AZT treatment (Table B-4). Another major target cell of HTV-1 infection is the macrophage. Fully differentiated macrophages were infected with HTV-1 DV and treated with T30177 or AZT. T30177 significantly inhibited HTV-1 replication in macrophages ( Figure B-2). However, due to the long exposure of cells to virus (24 hours), T30177 and AZT worked best when administered at concentrations above the IC 50 values obtained for these drugs in assays performed in established cell lines.
• Multiplicity IC50/IC90 Effect of changes in viral multiplicity of infection (MOI) on the anti-HTV- 1 activity of T30177 and AZT. Multiplicity IC50/IC90
• T30177 on CD4 and CD8 T-cell Subsets.
• One of the principal immunological markers correlated with progression to AIDS is the decline in T lymphocytes which express the CD4 cell determining marker (CD4).
• the change in CD4 + T-lymphocytes is usually monitored by noting changes in the ratio of CD4 + to CD8 + lymphocytes in the blood.
• CD4 and CD8 antigen expression was analyzed on the surface of cultured PBMCs seven days post-infection with either laboratory strains or clinical isolates of HTV-1. In these
• the percentage of CD4 and CD8 antigen bearing T-cells in the HIV-1 infected PBMC population was determined by flow cytometric analysis of cells treated with fluorescein labeled a-CD4 or a-CD8 monoclonal antibodies.
• HTV-1 isolates infect CD4 + lymphocytes, shed infectious virus into the culture medium but do not cause destruction of the infected cells (Garry, R.F., AIDS 3:683-694 (1989). This may explain results obtained when the inventors used the North American isolate number 1 (N. Amer. #1, Table B-5). When this virus was used to infect PBMCs, in the absence of drug, a CD4/CD8 ratio of 0.35 was observed 7 days post-infection. At the same time analysis of the culture medium from cells infected with this isolate revealed the presence of viral p24 antigen (Table B-4) which suggested that a productive viral infection had occurred.
• T30177, DS5000 or AZT was added to MT-4 cells infected with HTV- l ⁇ m (MOI of 1) at various times post-infection.
• Test compounds were added at a concentration 100-fold higher than the determined IC 50 value for each drug in the standard assay performed using MT-4 cells and the IIIB strain of HTV-1 (Table B-2).
• Viral p24 antigen levels were monitored 29 hour post- infection.
• the results of this assay indicate that postponing the addition of T30177 for one hour was enough to dramatically reduce the inhibitory effects of this compound in a fashion similar to that of DS5000 and clearly different from AZT which lost its protective capacity when added to the cell culture medium 3 or 4 hours post-infection ( Figure 18).
• the first protocol monitored the effects of the drug on the ability of HTV-I RF to infect and/or replicate within HeLa-CD4-LTR- ⁇ -galactosidase cells and was performed as described in Methods.
• drug interdiction at any step in the viral life cycle through the production of the tat gene product would cause a decrease in expression of the ⁇ -galactosidase gene, the transcription of which is regulated by the HTV-1 LTR.
• the results show that T30177 is a potent inhibitor of ⁇ -galactosidase production in this assay with an IC 50 value of 0.009 ⁇ M, while the IC 50 value obtained for CSB in the same experiment was 0.26 ⁇ M ( Figure 19A).
• T30177 had no observable direct effect on ⁇ - galactosidase enzyme activity at concentrations up to 10 ⁇ M (data not shown).
• the second protocol used was a virus-free assay designed to monitor CD4- and gp 120- mediated cell fusion events.
• T30177 was able to interfere with the fusion process ( Figure 19B).
• the observed IC 50 value (1 ⁇ M) was approximately 100-fold higher than that needed to interfere with S-galactosidase production in the virus infection assay ( Figure 19A).
• the IC 50 value observed for CSB increased approximately 3-fold to 0.8 ⁇ M over the concentration needed to interrupt ⁇ -galactosidase production in the virus infection assay ( Figure 19).
• T30526 an oligonucleotide in which a dA has been substituted for a dG at a position that would interrupt the formation of one of the two tetrads involved in the G-octet.
• T30526 has the same partial PT patterns as T30177 (Table B-7).
• T30526 has the same partial PT pattern as T30177 (Table B-7).
• T30526 was found to be approximately 100-fold less potent that T30177 in inhibiting HTV-I RF production in culture assays (Table B-7), 10- 15-fold less potent at inhibiting virus- infected cell ⁇ -galactosidase production (Figure 19A) and did not inhibit cell fusion at the highest concentration of drug tested (20 ⁇ M, Figure 19B).
• Antiviral Assay Anti-Integrase Assay b
• GGTTGGTGTGGTTGG - 3' pPT > 20.0 2.81 > 20.0 >0.50 >0.5
• TCTTCCTCTCTCTCTACCCACGCTCIC -3' PT 0.17 - - 0.030 0.036
• c Oligonucleotides were synthesized with either total phosphodiester (PD) backbone, total phosphorothioate (PT) backbone, or partial phosphorothioate (pPT) backbone, in which the 5'- and 3 '-penultimate internucleoside linkages were phosphorothioate.
• PD total phosphodiester
• PT total phosphorothioate
• pPT partial phosphorothioate
• HTV-l ⁇ m infected MT-4 cells were treated with T30177, AZT, DS5000, or the bicyclam compounds JM2763 or JM3100 for four days using drug concentrations equivalent to 1, 10 or 100-fold over their respective IC 50 values (Table B-7).
• the IC 50 values used for JM2763 and JM3100 were from previously reported results, (De Clereq, et al., Antimicrob. Agents Chemother. 38:668-674 (1994)). After four days in culture the cells were washed and then further cultured in complete medium without drug.
• the cells were monitored daily for the appearance of viral-induced syncytium formation and every second or third day for viral p24 antigen in the culture medium.
• T30177 In cells treated with T30177, at 100-fold over the IC 5 o value (approximately 10 ⁇ M), suppression of virus P24 production was observed for at 1st 27 days after removal of drug from the infected cell culture ( Figure 20).
• UC38 is an analog of oxathiincarboxanilide.
• the inventors have previously reported on the presence of viral cDNA in T30177 treated SUP TI cells 36 hour post infection with a lower MOI of HTV-1 DV . Rando, et al, J. Biol. Chem. 270:1754-1760 (1995). As described above, viral cDNA was also detected in T30177
• T30177 was also tested for its ability to inhibit HTV-1 protease and integrase enzymes. When concentrations of T30177 up to 10 IM were used in protease inhibition assays no effect on the viral enzyme was observed (data not shown). However, when assayed for its effect on HTV-1 integrase,
• T30177 was able to reduce both the 3'-processing and strand transfer activities of the integrase enzyme with IC 50 values of 0.092 and 0.046 ⁇ M, respectively (Table B-7).
• T30177 To determine if the sequence, three dimensional structure, chemical composition of the backbone or a combination of these parameters contributed to the observed anti-integrase activity of T30177, the inventors synthesized and tested for enzyme inhibitory activity the oligonucleotides shown in Table B-7.
• T30038, T30175, and T30526 are variations of T30177.
• T30340, T30341 and T30659 are variations of the thrombin-binding aptamer sequence reported by Bock et al. Bock, et al., Nature 355:564-566 (1992).
• IC 50 values for each of these oligonucleotides tested in the integrase assay are shown in Table B-7.
• the results of this experiment indicate that any of the sequence motifs tested were potent inhibitors of the HTV-1 integrase enzyme when the oligonucleotides were synthesized with a PT backbone.
• the thrombin binding aptamer (T30559) and the antisense sequence (T30662) no longer displayed anti-integrase activity while the level of inhibition observed using T30177 was relatively the same as that observed using the total PT version of this molecule (T30038).
• T30177 sequence motif was able to inhibit viral integrase with IC50 values of 170 and 125 nM for the 3'processing and strand transfer enzyme activities, respectively.
• T30526 the tetrad-disrupted mutant version of T30177, was still able to inhibit viral integrase protein in this assay, albeit at a concentration 2-to 3 -fold higher than that observed using T30177.
• T30177 was found to have a wide range of therapeutic indices (TIs) depending upon the viral strain and cell line used in a given assay. For example, when T30177 was used to inhibit HTV-1 SKI in CEM-SS cells a TI of 3680 was obtained. However, when measuring the effect on HTV-I RF in MT2 cells, the TI for T30177 was only 226.
• T30177 The variability in efficacy of T30177 in PBMCs and PBLs, which depended upon the clinical isolate tested, was very similar to the variation in activity observed for the nucleoside analogs AZT and ddl. It is interesting to note that an approximately 20 fold variation in the IC 50 value was observed for T30177 when used to inhibit H-TV-l ⁇ m in CEM-SS cells (2.8 ⁇ M) versus PBMSc (0.12 ⁇ M) (Tables B-2 and B-3). An explanation for this observation may be that when viruses are propagated continuously in homogeneous cell lines the "adapt" to those cells and begin to display phenotypes different from low passage clinical isolates.
• results obtained using clinical isolates to infect heterogeneous populations of primary cells may be more predictive of in vivo efficacy than data generated using laboratory strains of HTV-1 in established cell lines. It is unlikely that HrV-l mB is a resistant strain of HTV-1 since T30177 was more effective against this virus in PBMCs than in cell lines. However, given the well documented ability of HTV-1 to mutate and thus develop resistance to known
• T30177 displayed some antiviral which indicated a mechanism of action similar to the known blockers of virus adsorption or virus mediated cell fusion such as dextran sulfate and CSB ( Figures 18 and 19). Like CSB and DS5000, T30177 needed to be added to cells at the time of or soon after virus infection. However, T30177 is 100-fold less effective in inhibiting gp 120-induced cell fusion events than it is at inhibiting early events in the viral life cycle, suggesting a specific point of interdiction with virus distinct at least from that of CSB. In addition, the antiviral profile of T30177 also displayed other characteristics which distinguished T30177 from DS5000 and CSB. For example, while DS5000 is active against a wide range of enveloped viruses, T30177 appears to be a more selective inhibitor of retroviruses with maximum efficacy displayed when used to inhibit strains of HTV-1 (Tables B-2 and B-3).
• T30177 is a potent inhibitor of HTV-1 integrase function in vitro (Table B-7) and by the observed accumulation of circularized proviral DNA in the low-molecular weight Hirt DNA fractions ( Figure 22).
• T30177 While the time of drug addition studies would suggest interference with virus internalization as a key mechanism of action for T30177 it is also clear that readily detectable viral nucleic acids do enter the cells. It is quite possible that T30177 inhibits HTV-1 via several different mechanisms of action. Another possibility is that T30177 is carried into the cell along with the infecting virus or is slow to accumulate within cells (Bishop et al. 1996 J. Biol. Chem. 271:56988-5703) hence the need to add drug during virus infection. Experiments designed to address these possibilities are underway. The recently reported emergence rate of drug-resistant virus to current approved therapies for
• HTV-1 T ⁇ /2 of approximately 2 days
• T30177 may not be via either inhibition of virus binding/internalization or inhibition of viral integration, however, it is unlikely that this oligonucleotide is acting via the same mechanism as drugs currently in use for HTV-l.
• T30177 is stable in serum and within cells, with a half-life measured in days (Bishop, et al. J. Biol. Chem. 1996 271:5698-5703). This information taken together with the ability of T30177 to suppress HTV-1 for over four weeks after an initial treatment regimen, in culture, makes this class of compounds an attractive candidate for development of oligonucleotide-based therapeutic agents for HTV-1.
• oligonucleotide substrates and inhibitors Preparation of oligonucleotide substrates and inhibitors.
• the following HPLC purified oligonucleotides were purchased from Midland Certified Reagent Company (Midland, TX): AE117, 5'-ACTGCTAGAGATTTTCCACAC-3 , ; AE118, 5'-GTGTGGAAAATCTCTAGCAGT-3*; AE157, 5'-GAAAGCGACCGCGCC-3';
• AE118S 5'-GTGTGGAAAATCTCTAGCA-3'; RM22M, 5'-TACTGCTAGAGATTTTCCACAC-3'.
• the AE117, AE118, and the first 19 nucleotides of AE156 correspond to the U5 end of the HTV-1 long terminal repeat (LTR).
• LTR long terminal repeat
• AE118 was 5'-end labeled using T 4 polynucleotide kinase (Gibco BRL) and ⁇ -[ 32 P]-ATP (Dupont- NEN). The kinase was heat-inactivated and AE117 was added to the same final concentration.
• T 4 polynucleotide kinase Gibco BRL
• ⁇ -[ 32 P]-ATP Downont- NEN
• ⁇ mixture was heated at 95°C, allowed to cool slowly to room temperature, and run on a G-25 Sephadex quick spin column (Boehringer Mannheim) to separate annealed double-stranded oligonucleotide from unincorporated label.
• AE118S was 5'-end labeled, annealed to AE117, and column purified as above.
• AE118 was 3'-end labeled using ⁇ -[ 32P ]-cordycepin triphosphate (Dupont-NEN) and terminal transferase (Boehringer Manheim).
• AE157 was 5'-end labeled, annealed to AE156, AE146, and AE117, annealed, and column purified as above.
• Oligonucleotides composed of deoxyguanosine and thymidine were synthesized, purified, and incubated with potassium ion to generate the G4s.
• the guanosine quartet (G4) forming structures were then purified as previously described. Rando, et al, J. Biol. Chem. 270, 1754-1760 (1995).
• Integrase proteins and assays Purified recombinant wild-type HTV-l integrase, deletion mutants TN 1"
• HTV-1 integrase A plasmid encoding the HTV-2 integrase was generously provided by Dr. R.H.A. Plasterk (Netherlands Cancer Institutes). Purified recombinant wild- type FTV and STV integrases were generous gifts of Drs. S. Chow (UCLA) and R. Craigie (NIDDK), respectively.
• Integrase was preincubated at a final concentration of 200 (for HTV-1 and HTV-2) or 600 nM (for FTV and STV) with inhibitor in reaction buffer (50 mM NaCl, 1 mM HEPES, pH 7.5, 50 ⁇ M dithiothreitol, 10% glycerol (wt vol), 7.5 mM MnCl 2 or MgCl 2 (when specified), 0.1 mg/mL bovine serum albumin, 20 mM 2-mercaptoethanol, 10% dimethyl sulfoxide, and 25 mM MOPS, pH 7.2) at 30°C for 30 minutes.
• reaction buffer 50 mM NaCl, 1 mM HEPES, pH 7.5, 50 ⁇ M dithiothreitol, 10% glycerol (wt vol), 7.5 mM MnCl 2 or MgCl 2 (when specified), 0.1 mg/mL bovine serum albumin, 20 mM 2-mercaptoethanol, 10% dimethyl
• Electrophoresis and quantitation Reactions were quenched by the addition of an equal volume (18 ⁇ L) of loading dye (98% deionized formamide, 10 mM EDTA, 0.025% xylene cyanol, 0.025% bromophenol blue). An aliquot (5 ⁇ L) was electrophoresed on a denaturing 20% polyacrylamide gel (0.09 M Tris-borate pH 8.3, 2mM EDTA, 20% acrylamide, 8M urea). Gels were dried, exposed in a Molecular Dynamics Phosphorimager cassette, and analyzed using a Molecular Dynamics phosphorimager (Sunnyvale, CA).
• Percent inhibition was calculated using the following equation: 100 X[l - (D - C)/(N - C)], where C, N, and D are the fractions of 21 mer substrate converted to 19mer (3 '-processing product) or strand transfer products for DNA alone, DNA plus integrase, and integrase plus drug, respectively.
• IC 50 was determined by plotting the drug concentration versus percent inhibition and determining the concentration which produced 50% inhibition. UV crosslinking experiments. The method used has been described by Engleman et al. Engelman, et al, J. Virol. 68, 5911-5917 (1994). Briefly, integrase (at the indicated concentration) was incubated with substrate in reaction buffer as above for 5 minutes at 300C.
• integrase (200 nM) was preincubated with the guanosine quartet (at the indicated concentration) for 30 minutes at 30°C prior to the subsequent addition of the radiolabeled viral DNA substrate (20 nM).
• integrase (200 nM) was preincubated with either the radiolabeled viral DNA substrate (20 nM) or T30177 (20 nM) for 5 minutes at 30°C prior to the addition of competitor DNA at the indicated concentration.
• Oligonucleotides T30177 and T30659 fold upon themselves into structures stabilized by two G4s stacked upon each other to form a guanosine octet (Rando, et al, J. Biol Chem. 270, 1754-1760 (1995); Schultze, et al, J. Mol Biol. 235, 1532-1547 (1994)).
• T30177 is active against HTV-1 in cell culture and against purified TTTV-l integrase in vitro (Ojwang, et al, Antimicrob. Agents Chemother. 39, 2426-2435 (1995)) while T30659 is not.
• T30659 inhibition of both the 3'-processing and strand transfer activities of HTV-1 integrase (Fig. 23 A) by T30177 was observed in the nanomolar range (see Fig. 23B).
• T30177 was effective and T30659 was not, the inventors made a series of compounds to incrementally change one compound into the other.
• the structures of these compounds are shown in panels C and D of Figure 23.
• the differences between T30177 and T30659 i.e., the presence of additional bases at both ends, different sequences in all three loops, and extension of loop 2 manifest themselves in dramatic increases in the IC50 values (Fig. C-1D).
• the inventors first added the same 5'- and 3 '-nucleotides to T30659 as are present on T30177, yielding T30674 (Fig. 23C). These changes did not confer potency (Fig. 23 D).
• G4 oligonucleotides inhibit both steps of the integrase reactions: 3 '-processing and strand transfer.
• T30177 (with IC 50 s of 270 and 600 nM, respectively) while neither TN 50 - 212 (Fig. 26B) nor IN 50-288 (data not shown) showed more than 30% inhibition at a 3 IM concentration of T30177.
• concentration of T30177 required for inhibition of disintegration was higher than that required for inhibition of either 3'- processing or strand transfer.
• HTV-1 integrase may tolerate drug-induced protein or DNA distortion during the disintegration reaction, consistent with the relative tolerance of integrase to mutagenesis of either substrate features (Chow & Brown, 1994) or protein structural domains (Bushman et al, 1993) in this reaction.
• T30177 was the same as that required for complex formation using the viral U5 DNA substrate (i.e., in the 20 nM range).
• UV crosslinking assays Engelman, et al, J. Virol. 68, 5911-5917 (1994), showed that TN 1"288 formed a DNA-protein complex of the expected molecular weight in the absence or presence of added manganese (Fig. 26C, lanes 8 and 9).
• the TN 1"212 protein which has previously been shown to bind to linear viral DNA only at high concentrations (approximately 2.56 ⁇ M) and only in the presence of divalent metal ion, (Engelman, et al, J. Virol. 68, 5911-5917 (1994)), was able to crosslink to T30177 with the same efficiency as wild-type integrase in the absence or presence of added manganese (lanes 2 and 3).
• the TN 50"288 protein which contains a nonspecific DNA-binding domain, was also able to crosslink to T30177 with the same efficiency as wild-type integrase in the absence or presence of added manganese (lanes 4 and 5), consistent with its ability to bind to viral U5 DNA (Engelman et al, 1994).
• the extent of crosslinking was significantly diminished in the case of the core mutant TN 50"212 compared to IN 1"212 in the absence or presence of manganese (compare lanes 2 and 3 with 6 and 7, faster migrating complex).
• the higher molecular weight species in lane 6, having the expected molecular weight of a dimer has been reproducibly observed, but its density has not been confirmed.
• T30175 has the same base sequence as T30177 but is composed entirely of phosphorothiodiester internucleotidic linkages.
• the inhibition of 3'- processing catalyzed by TTTV-l integrase by these guanosine quartets is shown in Fig. 28C.
• Both T30175 and T30177 showed four to five-fold increases in potency when magnesium was used as the divalent metal instead of manganese.
• T30038 showed no significant increase in potency when magnesium was used as the ion (Fig. 28D).
• the T30177-integrase complex has a molecular weight of 37,000. Neither complex could not be competed off by either competitor DNA even at concentrations where the competitor was in 500-fold excess (Fig. 29A, lane 6). Similar results were seen when the In 1'212 and TN 50"212 proteins were used in competition experiments (data not shown). Therefore, the stability of the G4 oligonucleotide DNA-integrase complex is comparable to that of the viral DNA-integrase complex is comparable to that of the viral DNA-integrase complex. Ellison, et al, Proc. Natl. Acad. Sci. USA. 91, 7316-7320 (1994); Vink, et al, Nuc. Acids Res.
• G4 structures have previously been shown in inhibit HTV replication. Rando, et al, J. Biol. Chem. 270, 1754-1760 (1995); Wyatt, et al, Proc. Natl. Acad. Sci. U.S.A. 91, 1356-1360 (1994). Two mechanisms have been invoked. First, some oligonucleotides have been shown to bind to the V3 loop of the envelope protein gpl20 and subsequently inhibit virus adsorption and cell fusion. Wyatt, et al, Proc. Natl. Acad. Sci. USA. 91, 1356-1360 (1994).
• oligonucleotides such as those described in the present study also inhibit viral-specific transcripts, Rando, et al, J. Biol. Chem. 270, 1754-1760 (1995), presumably by inhibiting viral integration. Ojwang, et al, Antimicrob. Agents Chemother. 39, 2426-2435 (1995).
• the present finding that inhibition of the HTV-I RF strain in cell culture parallels that of purified integrase in vitro in the series of G4 oligonucleotides tested (Fig. C-1D) further demonstrates the possibility that HTV- 1 integrase can be targeted by some G4 oligonucleotides.
• G4 oligonucleotides differ from previously published HTV-1 integrase inhibitors in several ways.
• Table C-l First, they are among the most potent inhibitors to date with IC50's in the nanomolar range. Their potency range is comparable to flavone, Fesen, et al, Biochem. Pharmacol. 48, 595-608 (1994), and tyrophostin derivatives, Mazumder, et al, Biochemistry 34, in press (1995), which, however, generally fail to show antiviral activity.
• HTV-1 integrase contributes to the inhibition by G4 oligonucleotides, as truncation mutant enzymes lacking this domain are resistant to the G4 oligonucleotides.
• This property is unique, as all the other inhibitors to date are active against the HTV integrase catalytic core domain.
• Table C-2 Mazumder, et al, Proc. Natl. Acad. Sci. 91, 5771-5775 (1994); Mazumder, et al, Mol Pham. submitted (1995); Fesen, et al, Biochem. Pharmacol. 48, 595-608 (1994); Mazumder, et al, Biochemistry 34, in press (1995).
• G4 oligonucleotides form stable enzyme complexes that cannot be displaced by excess viral DNA oligonucleotide.
• T30177 5' gtggtgggtgggtgggt -3' pPT version of parent compound 1100-15 17 mer (SEQ ID NO 87) T30038 5' gtggtgggtgggtgggt -3' PT, Total PT version T30177 17 mer (SEQ ID NO 87) T30340 5' ggttggtgtggttgg -3' PD version of thrombin binding aptamer 15 mer (SEQ ID NO 53) T30341 5' ggttggtgtggttgg -3' pPT version of thrombin binding aptamer 15 mer (SEQ ID NO 53) T30659 5' ggttggtgtggttgg -3' PT version of thrombin binding aptamer 15 mer (SEQ ID NO 53) T30673 5' gtggttggtgtggtgg -3' pPT variant T30177 17 mer (SEQ ID NO
• T30696 5' gtgggtggtgggtgggtgggt -3' pPT variant invert loop 1 17 mer (SEQ ID NO 61)
• T30697 5' gtggtggggtggtgggt -3' pPT variant invert loop 2 17 mer
• T30698 5' gtggtgggtggggtggt -3' pPT variant invert loop 3 17 mer
• T30699 5' gtgggtggtggggtggtggt -3' pPT variant invert loops 1 and 3 17 mer (SEQ ID NO 64)
• T30745 5' gtggtgggtgggCgggt -3' pPT version C cytosine 17 mer (SEQ ID NO 81)
• T30746 5' gtggCgggCgggCgggt -3' pPT version C cytosine 17 mer (SEQ ID NO 82)
• the propynyl dU building blocks contain uracil bases in which a propynyl group has been added to the c-5 position.
• the propynl dC building blocks contain cytosine bases in which a propynyl group has been added to the c-5 position.
• These reagents are commercially available from Glen Research Reagent Co.
• Other unusual bases used such as dl (inosine) and iodo and bromo dU are also commercially available.
• pPT is shorthand for ODNs in which the linkage between the ultimate and penultimate bases has been changed from phosphodiester to phosphorothioate. PT is shorthand to indicate that all linkages are phosphorothiaiote. PD indicates that all linkages are phosphodiester.
• RNA sugars or 2'-0-methyl RNA sugars as indicated instead of 2'-deoxy sugars as found in DNA.
• the thrombin binding aptamer sequence used was the first described by Bock et al. [Nature 1992 355:564-566] and reported to fold into an structure stabilized by an intramolecular tetrad by Want et al. Biochemistry 1993 32:1899-1904].
• T30747 A/B contain only natural phosphodiester linkages.
• T30747B is 3'-modif ⁇ ed in that the dimethoxy trityl capping group was left attached after removal of the oligonucleotide from the solid support and subsequent purification. Usually this group is removed after synthesis of the molecule.
• Compound S935833 has the following pattern of phosphorothioate (PT) linkages where * denotes the PT linkage:
• Compound T30754 has a pPT pattern in which only the 5' and 3' linkages are PT: 5' - g*cggggctccatgggggtcg- 3'.
• T30743 5' gtggCgggtgggtgggt -3' 0.055 0.060 (SEQ ID NO 79)
• T30744 5' gtggtgggCgggtgggt -3' 0.105 0.060 (SEQ ID NO 80)
• T30745 5' gtggtgggtgggCgggt -3' 0.100 0.100
• SEQ ID NO 81 T30746 5' gtggCgggCgggCgggt -3' 0.150 0.150
• SEQ ID NO 82 5' gtggCgggCgggCgggt -3' 0.150 0.150
• T30747A 5' tgggaggtgggtctg -3' >0 250 >0.250
• T30747B 5' tgggaggtgggtctg -3' 0.120 0.120
• T30748 5' tgggaggtgggtctg -3' 0.125 0.125 (SEQ ID NO 83)
• Integrase inhibition assays monitor two different enzymatic activities, the 3'-processing (3'-process) activity and the strand transfer (stran trans) activity of the enzyme.
• the units for the enzyme assays are in nM while the units for the cell culture inhibition assays are in ⁇ M.
• HTV-1 Integrase Zinc Finger Region Mutation and deletion analyses show that the zinc finger motif (H-H-C-C) of retroviral integrases is required for integration (3'-processing and strand transfer) activity. Engelman, et al., J. Virol 66, 6361-6369 (1992). However, the structural role of this region has not been elucidated. It has been postulated too provide DNA sequence-specificity, Bushman, et al., Proc. Natl. Acad. Sci. U.S.A. 90, 3428-3432 (1993), stabilize DNA-enzyme, Vink, et al., Nuc. Acids Res. 22, 4103-4110 (1994), and enzyme multimer complexes.
• HTV-1 integrase may have two separate binding sites, one for viral DNA and one for target or "host" DNA. This scenarios would be expected if integrase were to bind both the viral and host DNA at sites which were instinct but in close proximity in vivo. Vincent, et al., J. Virol.
• the ⁇ subunit of the Oxytrichia telomere binding protein has bene proposed as a molecular chaperone for the formation of G4s at the end of chromosomes by enhancing the rate of a thermodynamically favored transition. Fang, et al., Cell 74, 875-885 (1993).
• the nucleocapsid protein may also act as a molecular chaperone to enhance dimer formation. Sundquist, et al, Proc. Natl Acad. Sci. U.S.A. 90, 3393-3397 (1993). In this manner, it may facilitate the formation of and bind to the G4.
• G4s can bind to purified nucleocapsid protein (data not shown).
• G4s may be structurally important as molecular scaffolds in both retroviral preintegration complexes and telomeres, and these structures may have associated chaperones in both cases.
• a G4 containing structure may act as a negative regulator of telomere elongation in vivo due to its ability to inhibit telomerase in vitro.
• G4 structures may act to inhibit integrase (Fig. 23A-D) and thereby act as a block to auto integration or digestion of the viral DNA prior to insertion into the host chromosome.
• G4s in vivo has not been demonstrated. However, they have been shown to form in vitro in telomeric sequences, Sundquist, et al., Nature 342, 825-829 (1989); Smith, et al., Nature 356, 164-168 (1992); Kang, et al., Nature 356, 126-131 (1992), HTV-1 RNA sequences, Sundquist, et al, Proc. Natl Acad. Sci. U.S.A. 90, 3393-3397 (1993); Awang, et al., Biochemistry 32, 11453-11457 (1993), fragile X syndrome nucleotide repeats, Fry, et al., Proc. Natl. Acad.
• G4 binding protein Another G4 binding protein, KEM1 has been isolated and implicated in recombination-type reactions in vivo. Liu, et al., Cell 77, 1083-1092 (1994). The catalytic activities of this protein and of the integrase protein are DNA endonucleolytic cleavage and strand transfer. However, unlike KEM1, integrase does not catalyze endonucleolytic cleavage reactions on G4s (data not shown). Thus, G4s may be mechanistically relevant in a diverse set of biological processes involving enzymes with similar activities.
• oligonucleotides containing intramolecular G4s are potent inhibitors of HTV-1 integrase. Inhibition is dependent on the zinc finger region of integrase and on the structure and sequence of the G4s. These findings also suggest that novel AIDS therapies could be based upon G4s as inhibitors of HTV-1 integrase. D. Structure-Function Studies
• T30177 forms an intramolecular fold which is stabilized by a pair of G-tetrads, connected by three single stranded loops, with a 1-2 base tail to either side of the fold.
• the inventors undertook studies to determine sequence dependence of the intramolecular folding mechanism, in a set of four closely related 16-17 base oligonucleotide homologues, with sequences in the range G10-12-T4-7.
• the original T30177 compound was included, along with three derivatives which were designed so as to alter the structure of loop domains, while keeping the pair of G-tetrads intact.
• the inventors were able to show that a single base alteration within the loop or tail domains can produce a very large change in folding stability.
• the K + ion dependence of these data suggested a preliminary model wherein the loop and tail domains interact to form stable metal ion-binding sites.
• T30695 A l ⁇ mer derivative (T30695) was designed within the context of that model, with the intent of enhancing the interaction between K + and the 5' terminus of the oligomer.
• the inventors showed that T30695 folding is indeed more stable than other members of the group and is highly specific for K + , as assessed from the ion dependence of thermal denaturation, CD spectra and UV detected folding kinetics.
• the inventors compared tertiary structure stability at three K + concentrations with the capacity of the folded oligomers to inhibit the HTV-1 integrase enzyme in vitro, or HTV-1 infection in cell culture.
• DNA synthesizer model 380B or 394, using standard phosphoramidite chemistry, or fast deblocking Expedite chemistry on a Milligen synthesizer. All oligomers possessed 2 phosphorothioate linkages (one on each terminus) which were introduced by the H-phosphonate method. Oligonucleotides were purified by preparative anion exchange HPLC, on Q-Sepharose. Chain purity was confirmed by analytical Q-sepharose chromatography, and by denaturing electrophoresis of 32 P labeled oligomers on a 20% polyaerylamide (19:1), 7M urea gel matrix (Rando et al., (1994) J. Biol. Chem.
• oligomer folding was monitored by native gel electrophoresis on 15% acrylamide (19:1) matrix in TBE. Folded, 32P labeled samples were loaded subsequent to annealing in 20 mM Li 3 P0 4 , pH 7.0, 10 mM KCl at 7 uM in strands, as described below.
• oligonucleotides Prior to UV, CD or kinetic analysis, oligonucleotides were annealed at 20 mM Li 3 P0 , pH 7 at 3-15 uM in strands. Samples were heated to 900C for 5 min and then incubated for 1 hour at 37°C. Metal ion could be added as the chloride either before or after the 37°C incubation, with no measurable difference in final state, as assessed by UV, CD or gel analysis. As assessed by native gel electrophoresis (not shown), this annealing method was found to produce a single product with mobility consistent with a folded monomer over the strand concentration range from 3-15 uM, at all ion concentrations described.
• UV measurements were obtained on a HP 8452A diode array spectrometer, using a HP 89090A temperature regulator. Except where noted, thermal denaturation profiles were obtained at a rate of 1.25°C/min over the range from 20°C-80°C, on samples at 20 mM Li 3 P0 4 , pH 7, at 7 uM in strands. Absorbance was monitored at 240 , nm, which was determined to be the point of maximal temperature induced change. For melting analysis, metal ion was added to the desired concentration, followed by a one hour pre-incubation at 37°C, to ensure compete annealing.
• Tm values for T30177 are consistently higher, by 1030°C, than has been seen for other small intramolecular folds (Smith, F. W., & Feigon, J. (1992) Nature (London) 344, 410-414; Schultze, et al., J. (1994) J. Mol. Biol 235, 1532-1547). Since T30177 differs from these other homologues only in terms of the proposed loop domains, the inventors have synthesized homologues of T30177 where the central G-octet remains constant, but where the loop domains to either side have been modified by addition or replacement of a single base.
• the T30676 homologue is identical to T30177, but has been modified so as to add an additional G into the topmost loop of the structure.
• line c this one base addition produces a 20°C decrease in Tm over the entire range of K + ion tested.
• the T30677 homologue was prepared (Figure 37A), which is identical to T30177, but has been modified so as to convert a pair of Gs in the bottommost loop domain.
• line d this two base loop substitution produces a 30°C decrease in Tm over the range of K + ion tested.
• T30695 ( Figure 37A). As seen in Figure 38A, line a, even though T30695 is one base shorter than the T30177 homologue, it was found to melt at approximately 10°C higher temperature, over the entire K + range tested. As for the other homologues, Tm values for T30695 were found to be strand concentration independent, confining the general similarity of the folding process (Figure 38C).
• Tm values have been measured for alkaline metal ions with differing radius: Na + (0.99A), K + (1.38A), Rb" (1.49A), and Cs+ (1.69 A).
• K + ion selectivity is detected.
• Rb + is very similar to K + in general chemical properties, and differs by only +0.11 A in ion radius, it is seen that the Rb + complex with T30695 melts at approximately 20-30°C lower temperature over the entire concentration range studied.
• Na + ion and Cs+ ion which differ from K + in ion radius by -0.37A and +0.29A, respectively, are seen to be even more destabilizing.
• Circular Dichroism In order to explore the nature of these ion binding effects, the inventors monitored the folding of T30695 by circular dichroism (CD) methods. It is known that G-quartet based folding, both intra and intermolecular, gives rise to large induced ellipticity values (Balagurumoorthy, P. & Brahmachari, S. K. (1994) J. Biol Chem. 269, 21858-21869; Jin, et al. (1992) Proc. Natl Acad. Sci. USA 89, 8832-8836; Lu et al.
• CD circular dichroism
• Stable tetrad folds are characterized by nonconservative spectra, with maxima at 264 nm (-1x10+5 deg-cm2/dmol) and 210 rim (-5x10+4 deg-cm2/dmol) and a minima at 240 rim (-4x1044 deg-cm2/dmol).
• the second component is hypochromic, indicative of a net increase in base stacking.
• the first kinetic component becomes nearly too fast to be detected, while the time constant for the second step has decreased from about 60 sec (curve b) to about 16 sec.
• this first ion binding step has rather modest selectivity among the alkaline metal ions (Williamson, J. R. (1994) Annul Rev. Biophys. Biomal. Struct. 27, 703-730).
• the inventors propose that the second step in the folding process involves binding of additional ion equivalents to the loop regions of the structure. It is also proposed that this second process, which occurs at higher added ion concentration ( Figure 39) and which is associated with the slow kinetic step of Figure 40, is coupled to a rearrangement of the loop domains to yield two additional sites for metal ion coordination.
• T m with * were obtained by a calculation according to the linear fitting functions of T m vs. LogfKCl].
• AR177 was synthesized at Aronex on a Milligen 8800 oligonucleotide synthesizer, and made into a stock solution at 25 mg/mL in sterile phosphate-buffered saline. AR177 has a molecular weight of 5793 daltons, and is a fully neutralized sodium salt. The structure of AR177 was characterized by phosphorus and proton NMR, sequencing, base composition, laser Resorption mass spectrometry, anion exchange HPLC and polyacrylamide gel electrophoresis. The AR177 was approximately 94% pure according to HPLC and electrophoretic analysis. All analyses are consistent with the proposed structure.
• Arterial blood samples were drawn at -10, +10, +20, +40, +60 and +120 minutes relative to the initiation of infusion into EDTA-containing tubes for hematology, complement factors, coagulation assay, serum chemistry, and plasma AR177 determination.
• blood was drawn via the femoral vein into EDTA-containing tubes for these same parameters.
• concentration of AR177 in dosing solutions was confirmed post experiment by absorbance at 280 nm on a spectrophotometer.
• the plasma fraction was obtained by low speed centrifugation of blood, and stored at -20°C until used.
• Electrocardiograms ECGs
• central pressure a parameter indicative of central pressure
• heart rate a parameter indicative of central pressure
• Table E-l summarizes the study design. The animals were observed twice daily for pharmacotoxic signs and general health beginning two days before dosing and for seven days following dosing. The monkeys were not necropsied at the end of the study. Serum chemistry parameters.
• Hematology and coagulation parameters The following were determined: red blood cell count and morphology, total and differential white blood cells, hemoglobin, hematocrit, prothrombin time, fibrinogen, mean cell hemoglobin, mean corpuscular volume, mean corpuscular hemoglobin concentration, platelet count, and activated partial thromboplastin time. Hematology parameters were determined at Sierra Nevada Laboratories (Reno, NV).
• Complement factors The complement split product Bb and total hemolytic complement CH50 were determined. The choice of measuring the Bb split product, as opposed to other complement factors, was based on a published study showing the involvement of the alternative pathway in complement activation induced by oligonucleotides (Galbraith et al, 1994). Complement determinations were performed in the laboratory of Dr. Patricia Giclas at the Complement Laboratory, National Jewish Center for Immunology (Denver, CO).
• AR177 was assayed in the plasma using an anion-exchange HPLC method on a Waters HPLC system with a 626 pump, 996 photodiode array detector, 717 autosampler and Millennium system software controlled by an NEC Image 466 computer.
• Buffer A consisted of 0.1 M Tris base, 20% methanol, pH 12
• Buffer B consisted of 0.1 M Tris base, 1.0 M NaBr, pH 12.
• the anion-exchange column (Gen-Pak Fax column) was equilibrated at 80% buffer A/20% buffer B for 30 minutes before each HPLC run. Fifty microliters of 0.2 % filtered, neat plasma were analyzed per run.
• the elusion conditions were: a) five-minute isoaatic run at 80% A/20% B. during which the majority of the plasma proteins eluted, b) 25-minute linear gradient to 30% A/70% B during which AR177 elutes, c) five-minute Socratic run at 30% A/70% B. d) one-minute linear gradient to 100% B. e) two- minute run at 100% B for column clean-up, and fl two-minute linear gradient to 70% A/30% B for the step in the HPLC clean-up.
• the high pH (12) of the elusion buffers was necessary to dissociate AR177 from tissue constituents, which bind AR177 tightly around physiological pH. AR177 is completely stable at pH 12.
• This method can clearly distinguish between the full length AR177 and n-1, n-2, etc. species, which are potential metabolic products.
• the ultraviolet detection wavelength was 260 nm.
• the flow rate was 0.5 mL/minute in all steps.
• Column clean up between runs was performed by a 500 pL bolus injection of 0.1 M Tris base, 2 M NaCl, pH 10.5, followed by: a) ten-minute linear gradient to 60% A/40% B. b) one-minute linear gradient to 100% B. c) a three-minute isocratic run at 100% B and d) one-minute linear gradient to 80% A/20% B.
• a standard curve was generated by spiking AR177 into cynomolgus monkey plasma in order to achieve concentrations of 0.04 to 128 ⁇ /mL.
• the plasma standards and unspiked plasma (control) were
• aPTT in the 20 and 50 mg/kg dose groups at the conclusion of the infusion of AR177 was limited by the range of the assay. (See Figure 43). This change was reversible in both dose groups. The aPTT was increased beyond the upper limit of the assay in the 50 mg/kg group for all or most of the two-hour monitoring period, but had returned to normal by the following day. Baseline aPTT values were reestablished by two hours after termination of dosing with the 20 mg/kg dose. In the 5 mg/kg group, only a small and transient rise in aPPT was observed, and there was no change in prothrombin time (PT).
• PT prothrombin time
• Plasma levels of the complement split product Bb a marker for activation of the alternative pathway, were increased 60-85% over baseline in the 5 mg/kg group, approximately 2-fold over baseline in the 20 mg/kg group, and approximately 2- to 4-fold in the 50 mg/kg group at the end of infusion. (See Figure 44).
• the elevation in Bb persisted through the duration of the 2-hour monitoring period, but the values had returned to normal by the following day. These increases in Bb were small in magnitude.
• Plasma Cmaxs of 83.2 +/- 7.2, 397.8 +/- 30.8, and 804.7 +/- 226.3 ⁇ g/mL were achieved for the 5, 20, or 50 mg/kg doses, respectively, at the end of the infusion (+10 minute time point) (Table E-2; Figure 47).
• the plasma volume would be 147 mL.
• the initial Vd was slightly greater than the plasma volume.
• AR177 caused a two-fold increase in aPTT at a concentration between 30 and 59 ⁇ g/mL of human plasma, whereas the compound caused a two-fold increase in aPTT at a concentration between 118 and 236 ⁇ g/mL of cynomolgus monkey plasma in vitro.
• AR177 had no effect on thrombin time in human plasma, but caused approximately a 2.5-fold increase in thrombin time in cynomolgus monkey plasma at 236 ⁇ g/mL. AR177 had no effect on either fibrinogen or complement CH50 at doses up to 236 ug/mL in human or cynomolgus monkey plasma. AR177 caused a 30% increase in prothrombin time in human plasma and approximately a 15% increase in prothrombin time in cynomolgus monkey plasma at 236 ⁇ g/mL. Discussion. Using an identical dosing regimen to that used in previous experiments that resulted in profound hemodynamic effects, the present study showed that AR177 was very safe.
• AR177 administration resulted in the dose-dependent inhibition of the intrinsic coagulation pathway, reflected by prolongation of aPTT.
• the effect was maximal at the end of infusion and was reversed in parallel with clearance of AR177 from plasma.
• the inhibition of coagulation was significant at the highest dose level, but marginal and not considered clinically significant at the 5 mg/kg dose level.
• An anticoagulant effect has been reported to be a class effect of oligonucleotides (Henry et al., 1994).
• the anticoagulant results with AR177 thus agree with results that have been seen with other oligonucleotides, although AR177 is 40-fold less potent than the thrombin-binding aptamer oligonucleotide that has been reported by Griffin et al. (1993).
• AR177 does not cause mortality, cardiovascular toxicity, or alterations in clinical chemistry in cynomolgus monkeys receiving doses up to 50 mg/kg as a ten-minute intravenous infusion. However, there was a reversible prolongation of coagulation time at doses of 20 and 50 mg/kg. Taken together, the data suggest that AR177 does not have the hemodynamic toxicities that are associated with total phosphorothioate oligonucleotides, and can be administered safely as an intravenous infusion over ten minutes.
• Table E-2 Plasma AR177 C max , aPTT and complement Bb levels.
• the AR177 plasma C MAX , aPTT, and Bb values are the means ⁇ standard deviations of data at the +10 minute tune point (end of the infusion).
• the baseline (10 minutes prior to dosing) aPTT levels were 32.1 ⁇ 4.4, 41.6, 6.7 and 33.2 ⁇ 4.8 seconds for the 5, 20, and 50 mg/kg doses, respectively (mean ⁇ s.d.).
• the baseline (10 minutes prior to dosing) Bb levels were 0.44 ⁇ 0.14, 0.78 ⁇ 0.46 and 0.49 ⁇ 0.21 ⁇ /mL for Me 5, 20, and 50 mg/kg doses.
• Volume of distribution (Vd) dose/plasma C AX , where the dose is the total mg ofAR177.
• Serum chemistry was evaluated at pre-dose, and 1 and 24 hours following initiation of intravenous AR177 infusion. Values represent the mean ⁇ s.d. of 3 monkeys.
• Hematology was evaluated at pre-dose, at 10, 20, 40, 60 and 120 minutes and 24 hours following initiation of intravenous AR177 infusion. Values represent the mean ⁇ s.d. of 3 monkeys.
• AR177 is a 17-mer partial phosphorothioate oligonucleotide with the sequence 5'GTGGTGGGTGGGTGGGT-3', with sulfurs at the terminal internucleoside linkages at the 3' and 5' ends. It is a potent inhibitor of HTV integrase and HTV production in vitro (Rando et al., 1995; Ojwang et al., 1995), and has a long tissue half-life in rodents (unpublished data). AR177 does not have an antisense- or triplex-based mechanism of action.
• AR177 does not cause the characteristic hypotension or neutropenia of other oligonucleotides (Cornish et al., 1993; Galbraith et al., 1994) following a ten-minute intravenous infusion, at doses up to 50 mg/kg (Wallace, T.L., Bazemore, S.A., Korabrust, D.J., Cossum, P.A (1996b) J. Pharmacol Exp. Ther. 278: 1313-7).
• an intravenous toxicity study of AR177 was conducted in cynomolgus monkeys with the objective of establishing the clinical and histopathological changes that occur following repeated doses. Materials and Methods for Repeat Dose Studies
• AR177 was synthesized at Biosearch, a division of PerSeptive Biosystems, on a Milligen 8800 oligonucleotide synthesizer, and vialed at 25 mg/mL in phosphatebuffered saline.
• AR177 has a molecular weight of 5793, and is a fully neutralized sodium salt.
• the structure of AR177 was characterized by phosphorus and proton NMR, sequencing, base composition, laser Resorption mass spectrometry, anion exchange HPLC and polyacrylamide gel electrophoresis. All analyses were consistent with the proposed structure.
• the AR177 was approximately 94% pure according to HPLC and electrophoresis analysis.
• the monkeys used in this study were laboratory bred (C.V. Primates, Indonesia or Yunnan National Laboratory, China) and were experimentally naive prior to the study. The age of the monkeys was 3 to 61/2. Dosing. AR177 was administered intravenously over 1-2 minutes into unsedated monkeys every other day for 23 days (12 doses) by injection into the femoral vein. (See Table E-l). The monkeys were not sedated, but were restrained during dosing. The highest dose level (40 mg/kg/injection) was selected based on observations in a previous single-dose study of pronounced anticoagulant activity of AR177 at a dose of 50 mg/kg infused over 10 minutes (Wallace et al., 1996b).
• the monkeys were observed twice daily for general health, changes in appetite and clinical signs of adverse events. Body weights were measured within a few days prior to the first dose (Day 1) and approximately weekly thereafter. Electrocardiographic (ECG) recordings were obtained from all animals prior to the study and on Day 22, and from recovery animals on Day 35. Blood samples were collected for evaluation of serum chemistry, hematology and coagulation parameters from all animals prior to the initiation of the study, on the first day of dosing (Dose 1; Day 1), and on the last day of dosing (Dose 12; Day 23). The sample collection on Days 1 and 23 was timed relative to dose administration in order to characterize possible acute effects on hematology parameters. An additional clinical pathology evaluation was conducted for all animals on Day 24, as well as for recovery animals on Day 37. Blood was collected from all animals at 5 minutes, 30 minutes and 4 hours post-dosing on Days 1 and 23 for analysis of the plasma AR177 concentration.
• Serum chemistry was determined pre-study, on day 24 (one day after the 12th dose), and on day 37 in the recovery monkeys. The following were determined: sodium, potassium, chloride, carbon dioxide, total bilirubin, direct bilirubin, indirect bilirubin alkaline phosphatase, lactate dehydrogenase, aspartate aminotransferase, alanine aminotransferase, gamma- glutamyltransferase, calcium, phosphorus, glucose, urea nitrogen, creatinine, uric acid total protein, albumin, globulin, cholesterol and triglycerides. Serum chemistry was determined at Sierra Nevada Laboratories (Reno, NV).
• Hematology and coagulation parameters were determined 9-11 days prior to the start of the study, just prior to administering doses 1 (day 1) and 12 (day 23), five minutes after dosing (coagulation only), 30 minutes and 4 hours following dosing, one day after the 12th dose (day 24), and in recovery monkeys at sacrifice (day 37). The following were determined: red blood cell count and morphology, total and differential white blood cells, hemoglobin, hematocrit, prothrombin time, fibrinogen, mean cell hemoglobin, mean corpuscular volume, mean corpuscular hemoglobin concentration, platelet count, activate partial thromboplastin time, and D-dimer. Hematology was determined at Sierra Nevada Laboratories (Reno, NV).
• AR177 plasma HPLC analysis Blood was taken for plasma analysis of AR177 just prior to, and at 5, 30 and 240 minutes following administration of doses 1 and 12. The plasma fraction was obtained by low speed centrifugation of blood, and stored at -20°C until analyzed for the AR177 concentration.
• Plasma AR177 concentrations were assayed using an anion-exchange HPLC method on a Waters HPLC
• Buffer A was 0.1 M Tris base, 20% methanol, pH 12, and Buffer B was 0.1 M Tris base, 1.0 M NaBr, pH 12.
• anion-exchange column tGen-Pak Fax column was equilibrated at 80% buffer A/20% buffer B for 30 minutes before each HPLC run. Fifty microliters of plasma were analyzed per run. The elusion conditions were: a) five-minute isocratic run at 80% A/20% B.
• the W detection wavelength was 260 nm.
• the flow rate was 0.5 mL/minute in all steps. All runs were performed at room temperature. Column clean up between runs was performed by a 500 ⁇ L bolus injection of 0.1 M Tris base, 2 M NaCl, pH 10.5, followed by: a) ten-minute linear gradient to 60% A 40% B. b) one-minute linear gradient to 100% B. c) a three-minute isocratic run at 100% B and d) one-minute linear gradient to 80% A/20% B.
• AR177 was spiked into cynomolgus monkey plasma in order to achieve concentrations of
• necropsy was conducted on all monkeys, and included examination of the external surface of body (body orifices; dosing site; cranial, nasal, paranasal, thoracic, abdominal and pelvic cavities), and the external surface of the brain and spinal cord.
• the organ weights of the adrenals, epididymies, liver, pituitary, spleen, thyroids, parathyroids, brain, heart, lungs, prostate, testes, uterus, cervix, kidney, ovaries, seminal vesicles, and thymus were recorded.
• ECG ECG, clinical chemistry, urinalysis and hematology.
• the relationship between the AR177 plasma concentration and aPTT is also shown in Figures 53, 54, and 55 for doses 2.5, 10, and 40 mg/kg, respectively.
• Doubling of aPTT was observed at plasma AR177 concentrations of approximately 100-220 ⁇ g AR177/mL.
• Tripling of aPTT was observed at plasma AR177 concentrations of approximately 220-300 ⁇ g AR177/mL, after which no correlation was possible because the aPTT values were off-scale.
• AR177 may contribute to its lack of general toxicity.
• AR177 contains only two phosphorothioate bonds at the 3' and 5' termini. These phosphorothioate bonds were designed to help prevent endonuclease-induced cleavage of AR177.
• AR177's three-dimensional shape may also contribute to its lack of toxicity.
• AR177 has been shown to form a structure in which hydrogen bonds form between deoxyguanosine residues to create a "G-tetrad" (Rando et al., 1995).
• This tetrad structure imparts a compact shape which makes it resistant to degradation (Bishop et al., 1996) and may make it relatively non-toxic by minimizing reactive sites.
• the resistance to degradation has been noted in single and repeat dose pharmacokinetics studies in rodents (Wallace et al., 1996a; 1996b), and in a more complete pharmacokinetic study in cynomolgus monkeys which showed a terminal plasma half-life of greater than 24 hours (data not shown).
• oligonucleotide has a G-tetrad structure (Wang et al., 1993), and is active as a short acting anticoagulant in vivo (Griffin et al., 1993; DeAnda et al., 1994).
• a comparison of the anticoagulant properties of these oligonucleotides indicates that the oligonucleotide is approximately 10-100 times more potent than AR177.
• Control monkeys received sterile saline. There were 8 monkeys per group, evenly split between males and females, except for the placebo group, which inadvertently had an extra female. The main group was sacrificed on day 25 following initiation of dosing, which was two days following the twelfth dose on day 23. Two monkeys in the placebo and 40 mg/kg groups were in a recovery group. The recovery group monkeys were sacrificed two weeks (on day 38 after initiation of dosing) after the other monkeys.
• Serum chemistry was evaluated at pre-study, and at days 24 and 37 (recovery monkeys only) following initiation of intravenous AR177 administration. Values represent the mean ⁇ s.d. of 2- monkeys. There were two monkeys per group in the saline and 40 mg kg recovery groups, and six monkeys per group in the non-recovery groups.
• Pharmacokinetic analysis Pharmacokinetic parameters were calculated using PKAnalyst software (MicroMath, Salt Lake City, UT). The pharmacokinetic data best fit a two compartment model for all of the patients. The alpha and beta half-lives were almost identical in each of the patients, based on the software interpretation of the AR177 plasma concentration versus time plot ( Figures 56-59). For this reason, only one half-life is reported. (Note that in monkeys, a third half-life of approximately 24 hours was observed at a dose of 5 mg/kg given as an intravenous infusion over two hours. A third half-life was not evident in human data, except perhaps for patient #10.) For each pharmacokinetic parameter, the mean ⁇ s.d.
• the plasma concentrations of AR177 following intravenous infusion are shown in Figure 56 (0.75 mg/kg), Figure 57 (1.5 mg/kg), Figure 58 (3.0 mg/kg) and Figure 59 (all doses). Analysis of this data indicate that the plasma pharmacokinetics of AR177 are not directly proportional to the dose (Table G-l).
• the increase in the C max and AUC were proportionally much greater than the increase in the dose from 0.75 to 3.0 mg/kg.
• the increase in the C max and AUC were much greater than the increase in the dose.
• the C max value in the 0.75 mg/kg group was 5.1 ⁇ 1.4 Tg/mL and the C max value in the 3.0 mg/kg group was 37.5 ⁇ 0.1 ⁇ g/mL, approximately a seven-fold increase (Figure 60).
• the AUC value in the 0.75 mg/kg group was 703.6 ⁇ 154.7 ⁇ g-min/mL and the AUC value in the 3.0 mg/kg group was 8,277.8 ⁇ 2.937.4 ⁇ g-min/mL, approximately a 12-fold increase (Table 1).
• the plasma clearance and Vd values reflected the C max and AUC data.
• the plasma clearance in the 0.75 mg/kg group was 1.1 ⁇ 0.2 mL/min kg and the clearance in the 3.0 mg/kg group was 0.4 ⁇ 0.2 mL/min kg, approximately a 65% decrease ( Figure 61).
• the initial and steady-state volumes of distribution in the 0.75 mg/kg group were 0.16 ⁇ 0.05 L/kg and 0.14 ⁇ 0.05 L/kg, respectively, whereas the initial and steady-state volumes of distribution (Vd) in the 3.0 mg/kg group were 0.08 ⁇ 0.00 L kg and 0.05 ⁇ 0.03 L/kg, respectively (Table 1).
• the plasma half-life in the 0.75 mg/kg group was 28.0 ⁇ 12.7 minutes, and the half-life in the 3.0 mg/kg group was 120.1 ⁇ 60.7 minutes, approximately a four fold increase (Figure 60).
• ZintevirTM (AR177; T30177) was next used in multiple dosing experiments with AIDS patients. Supporting rationale include:
• RT reverse transcriptase
• protease activity • a novel mechanism of action that does not involve inhibition of either reverse transcriptase (RT) or protease activity.
• Study Design This was an open-label, single-center, study to evaluate the safety, pharmacokinetic profile and virologic/immunologic activity of AR177 in HTV patients. Patients that met the screening criteria received multiple doses of AR177 infused every other day for 14 days (seven doses). Patients were allowed to participate in the study at ONLY one dose level. Patients were confined to the Research Unit from Day 0 through Day 18. Patient activities outside the unit had to be acceptable to, and agreed upon prior to study initiation. Drugs. AR177 was provided by Aronex Pharmaceuticals, Inc. AR177 was obtained from multiple lots during the course of the study. The study drug was available in two vial sizes. These clear glass vials contained 2.2 cc or 15.9 cc of product.
• Each ml of active drug will deliver a 25 mg dose; thus, the expected total mg dose per vial is 55.0 milligrams and 397.50 milligrams, respectively.
• Dosages Patients meeting all entry criteria were given a two-hour continuous infusion of AR177 every other day for a total of seven infusions. The dosing schedule utilized is shown in the following table (G- 2).
• the intravenous infusion of study medication will be administered continuously via an indwelling I.V. catheter at a rate of 2 mL/min for two hours.
• HTV-1 RNA The plasma levels of HTV-1 RNA are an accepted measure of the plasma viral titer and are directly related to the progression of HTV infection to acquired immunodeficiency disease syndrome (AIDS) and death in humans.
• AIDS immunodeficiency disease syndrome
• Striking results were obtained over the course of a 14-day treatment. In each of the three patients given 3.0 mg/kg dosages, viral load was significantly reduced.
• the guanosine-rich oligonucleotide T30177 which is stabilized by an intramolecular guanosine octet, is a potent inhibitor of laboratory strains and clinical isolates of human immunodeficiency virus type 1.
• Rabin et al. (Rabin, L., et al. Antimicrobial Agents and Chemotherapy, 40: 755-762 (March 1996) have disclosed a standardized procedure for infection of SCID-hu thy/liv mice with human immunodeficiency virus type 1. This publication is incorporated herein by reference to the extent that it provides materials and methods not specifically set forth herein. in vivo Anti-HIV-1 Activity of the T30177 ODN
• FIG. 65 A representative ODN, T30177, was tested for its anti-human immunodeficiency virus type 1 activity in vivo using the procedures and materials described below.
• the experimental results are shown in Tables H1-H6 and Fig. 65. Shown in Fig. 65 are the implant p24, W632 expression, viral titer, and viral RNA load in an HTV-1 infected animal model treated intraperitoneally with T30177 (AR177) at doses of 10, 30 and 100 mg/kg/day. Corresponding data for untreated, mock-infected, and ddl treated SCID-hu mice are also shown in Fig. 65.
• Table H-l gives a summary of the results of these studies, which are described in more detail below.
• untreated SCID-hu Thy/Liv mice supported HTV-1 replication after direct inoculation of their human Thy/Liv implants with 630-1300 TCID 50 of HTV-1 (NL4-3).
• Viral replication in the implants was apparent 12 days after inoculation by the presence of p24 antigen (620 pg per 10 6 cells), infectious virus, HTV-1 proviral DNA, HTV-1 RNA (10 6 ' copies per 10 6 cells), and a 5-fold increase in HLA class I (W632) expression by implant thymocytes.
• No depletion of CD4+ CDS+ immature cortical thymocytes and a small reduction in the CD4/CD8 ratio were observed.
• Intraperitoneal administration of AR177 resulted in potent antiviral activity in this model when treatment was initiated 24 h before inoculation.
• Statistically significant, dose-dependent reductions in implant p24 level, viral titer, viral RNA, and W632 expression were observed.
• Implants from 4 of 6 mice treated with AR177 at 100 mg/kg/day had no detectable p24 antigen, infectious virus, HTV-1 RNA, or proviral DNA after 13 days of treatment.
• Treatment with AR177 also prevented virus-induced reduction of the CD4/CD8 ratio in the Thy/Liv implants.
• mice in group G were implanted with tissue from donor #14796 (implanted 6/29/96).
• ⁇ doses were based on oligonucleotide weight alone, excluding the weight contributed by salt.
• the SCID-hu mouse model (McCune, J.M. et al. (1988) Science 241:1632-1639) was developed to study mechanisms of HTV-1 pathogenesis in vivo and to serve as a model for preclinical evaluation and prioritization of compounds possessing anti-HTV-l activity in vitro.
• This model is constructed by transplantation of interactive human lymphoid organs into immunodeficient C.B17 scid/scid mice.
• the SCTD-hu model has been optimized by use of conjoint implants of human fetal thymus and liver to create SCTD-hu Thy/Liv mice.
• the human fetal tissue becomes vascularized and grows when implanted beneath the kidney capsule, eventually reaching a total mass of 10 7 -10 8 human cells in 80-90% of recipients (Namikawa, R., et al. (1988) J. Exp. Med. 172:1055-1063).
• the Thy/Liv implants sustain multilineage human hematopoiesis and provide for a continuous source of human CD4+ T cells for up to 12 months (Krowka, J., et al. (1991) J. Immunol. 145:3751-3756; Namikawa, R., et al. (1988) J. Exp. Med.
• the 17-mer oligonucleotide AR177 (5'-gtggtgggtgggtgggt-3') inhibits replication of multiple laboratory strains and clinical isolates of HTV-1 in human T cell lines, peripheral blood lymphocytes, and macrophages (Bishop, J.S., et al. (1996) J. Biol. Chem. 271:5698-5703; Ojwang, J.O., et al. (1995) Antimicrob. Agents Chemother. 39:2426-2435).
• the molecule contains single phosphorothioate internucleoside linkages at both the 5' and 3' ends for stability and under physiological conditions, the 17-mer folds upon itself to form an intramolecular guanosine octet.
• This oligonucleotide does not possess a sequence complementary (antisense) to the HTV-1 genome, but it is a potent inhibitor of HTV-1 integrase (Ojwang, J.O., et al. (1995).
• This study was designed to evaluate the antiviral activity of AR177 against HTV-1 (NL4-3) infection in SCTD-hu Thy/Liv mice treated by intraperitoneal administration 24 h before virus inoculation.
• PBMC Peripheral blood mononuclear cells
• PBS phosphate-buffered saline
• the interface cells were collected, washed twice with PBS, counted, and adjusted to 2 x 10 6 cells/ml in Dulbecco's modified Eagle medium (Mediatech) supplemented with 10% fetal bovine serum (PBS), 2 mM L-glutamine, 100 U penicillin per ml, 100 ⁇ g streptomycin per ml (complete medium), and 1 ⁇ g PHA-P (Sigma) per ml.
• Cells from individual blood donors were incubated separately in 150-cm 2 flasks at 37°C with 5% CO2 for three days and treated with 50 U IL-2 (human lymphocyte, Boehringer-Mannhiem, Indianapolis, Ind.) per ml during the final 24 h of incubation.
• IL-2 human lymphocyte, Boehringer-Mannhiem, Indianapolis, Ind.
• the cells were then pooled, divided into 1-ml aliquots of 3 x 10 7 cells per vial in 90% FBS-10% dimethysulfoxide, and frozen in liquid N2 for future use.
• Stock virus preparation All procedures using infectious HTV-1 were carried out in a Biosafety Level 3 (BL3) facility or in a restricted animal barrier facility under BL3 guidelines.
• BL3 Biosafety Level 3
• a plasmid containing the molecularly cloned virus pNL4-3 (Adachi, A., et al. (1986) J. Virol 59:284-291) was obtained from the NIH AIDS Research and Reference Reagent Program, National Institute of Allergy and Infectious Diseases.
• Seed virus was prepared by electroporation of 25 ⁇ g of HTV-1 DNA per 5 x 10 6 fresh PHA-activated PBMC (Bio-Rad Gene Pulser) at 960 ⁇ FD and 280 volts.
• Working stocks were prepared by inoculating 10 8 fresh PHA-activated PBMC with 2 x 10 5 TCID50 of virus in 5 ml of complete medium containing 5 ⁇ g polybrene (Sigma) per ml. After 2 h at 37°C, the cells were diluted to a density of 2-3 x 10 6 per ml in complete medium containing 50 U IL-2 per ml (virus culture medium). On day 2 the cells were pelleted, fresh medium was added, and the supernatant was collected 24 hours later.
• Serial 10-fold dilutions of virus were prepared in medium containing 10 ⁇ g polybrene per ml, and 25 ⁇ l of each dilution was added to quadruplicate wells of PBMC. After 2 h at 37°C, 200 ⁇ l of virus culture medium was added to each well, and the plates were incubated at 37°C in a humidified 5% CO2 atmosphere. After 7 days, the plates were centrifuged at 400 x g for 5 min, supematants were removed, and cell pellets were assayed for p24 antigen.
• the TCID 50 is the reciprocal of the dilution at which 50% of the wells contained detectable p24 (>30 pg/ml) and specifies the number of infectious doses per 25 ⁇ l.
• p24 ELISA assay For quantitation of HTV-1 p24 within cells, samples containing 1 x 10 5 to 5 x 10° cells were lysed overnight at 4°C in p24 lysing buffer (1% Triton X-100, 0.5% sodium deoxycholate, 5 mM EDTA, 25 mM Tris Cl, 250 mM NaCl and 1% aprotinin).
• Pellets were lysed in 100 ⁇ l lysing buffer for the TCID 50 assay and in 400 ⁇ l for implant p24 determination. The lysed samples were then transferred into HTV p24 antibody-coated microplates (Dupont) for quantitative ELISA. A standard curve was generated with HXB2-infected H9 cells, and results were calculated as pg p24 per 10 6 cells or per ml. Construction of SCTD-hu Thy/Liv mice.
• mice Homozygous C.B-17 scid/scid mice (SCID) were bred at SyStemix (Palo Alto, Calif.) and treated prophylactically with trimethoprim-sulfamethoxazole (Septra) pellets in the food bin to prevent opportunistic infection with Pneumocystis carinii (McCune, J.M. et al. (1988). For surgical procedures, 8-week-old male mice were anestiietized with 100 mg/kg ketamine and 8 mg/kg xylazine, given intraperitoneally.
• AR177 (lot #IM127-04, 68.5% oligonucleotide) was provided by Aronex Pharmaceuticals, Inc., The Woodlands, Texas and stored in the dark at -4°C.
• the test agent was dissolved in sterile PBS without Ca++ or Mg++ (Digene Diagnostics, Inc., Beltsville, Md.) at 1.5, 4.4, and 15 mg/mi (for dosing at 10, 30, and 100 mg/kg/day, respectively), and the solutions were not filtered. These concentrations were based on oligonucleotide weight alone, excluding the weight contributed by salt.
• ddl (NSC-612049, lot #5 PC2793), was obtained from the NTH AIDS Research and Reference Reagent Program and stored at -20°C.
• the ddl was dissolved in pH 9 sterile water at 15 mg/ml, adjusted to pH 7 with 8% sodium bicarbonate, and sterilized by filtration. All dosing solutions were prepared the day before treatment initiation and were stored in the dark at 4°C until dosing.
• mice were treated with AR177 at 100 mg/kg/day (group A), 30 mg/kg/day (group B), and 10 mg/kg/day (group C) by intraperitoneal injection (200 ⁇ l) witii a 26- gauge x 1 /2-inch needle.
• mice in group D were treated intraperitoneally with ddl at 100 mg/kg day, and mice in group E were not treated.
• Mice were moculated 24 h after the first dose (2 h after the second dose), and dosing was performed once daily at 7:00-10:00 AM for 13 days.
• the untreated mice in group F were mock-infected with medium alone.
• mice were not inoculated and were treated with the AR177 at 100 mg/kg/day for 13 days as described above. Their implants were removed 2 h after the last dose, snap-frozen in liquid N 2 , and stored at -70°C for shipment to Aronex and determination of implant AR177 concentrations. HTV-1 infection of SCID-hu Thy/Liv mice. Inoculations were performed on anesthetized mice in a restricted animal barrier facility under BL3 guidelines (i.e., with mask, eye-covering, gown, etc.). To maximize visual and manual access, teams of three operators worked side-by-side on a bench top.
• the Thy/Liv implant was injected with 25-50 ⁇ l of undiluted stock vims (630-1300 TCTD 50 ) in 1 to 3 places with a 250- ⁇ l Hamilton glass syringe and 30-gauge x 1/2-inch blunt needle.
• a third operator closed the incision with one stitch in the peritoneal lining and one skin staple. For this study, implants were inoculated 17 weeks after tissue implantation.
• Thy/Liv implant tissue processing Mice were euthanized by CO2 inhalation followed by cervical dislocation, and the human Thy/Liv implants were surgically excised and transferred into 6-well tissue culture plates containing sterile PBS/2% FBS at 4 C. A single cell suspension was made by placing the implant into a sterile nytex bag, submerging the bag in PBS/2% FBS in a 60-mm tissue culture dish, and gently grinding the tissue between the nytex layers with forceps. The cells were counted with a Coulter counter, and appropriate numbers of cells were aliquoted for each assay.
• pellets of 2.5 x 10 6 cells were resuspended in 400 ⁇ l of p24 lysis buffer, rotated overnight at 4°C, and stored at -20°C.
• pellets containing 1 x 10 3 cells were processed immediately or stored at -80°C.
• dry pellets of 2 x 10 4 to 5 x 10° cells were frozen and stored at -80°C.
• FACS analysis 10 6 cells per well were placed in a 96-well plate, stained, and analyzed on the same day. Results are shown in Table H-4.
• Implant thymocytes were serially diluted in 5-fold increments in virus culture medium, added to 96-well plates containing 10 5 PHA-activated PBMC per well, and incubated at 37°C. A range of 32 to 100,000 thymocytes per well were cocultivated in duplicate with the PBMC. After 5 days, cell pellets were lysed and assayed for p24, and wells containing detectable p24 (>30 pg/mi) were scored positive for HTV-1 infection. Implant HTV-1 titers are expressed as TCID 50 per 10 6 implant thymocytes, and the logio values were used for calculation of geometric means. The limit of detection was 10 1 ° TCED50 per 10 6 cells.
• Control A should yield a dark HTV-1 DNA band (scored +), control B a light HTV-1 band (+/-), and control C no HTV-1 band (-).
• the limit of HTV-1 DNA detection is therefore one to two HTV-1 -positive cells per 100 input cells.
• the H 2 0 control sample (-) should yield neither human ⁇ -globin nor HTV-1 DNA bands.
• RNA quantitation by bDNA assay Viral RNA quantitation by bDNA assay.
• Cells were disrupted with sterile disposable pestles and a cordless motor grinder (Kontes, Vineland, NJ.) in 8 M guanidine HCl with 0.5% sodium N- lauroylsarcosine.
• the RNA was extracted by adding 5 ml 100% EtOH containing 20 ⁇ g polyadenylic acid (Sigma) per ml, and each sample was vortexed and pelleted at 12,000 x g for 20 mm at 4°C.
• RNA pellets were washed with 5 ml 70% EtOH, placed on dry ice, and digested with reagents supplied by the manufacturer (Quantiplex HTV-1 RNA assay 2.0, Chiron Corporation, Emeryville, Calif.).
• Implant HTV-1 RNA load is expressed as copies per 10 6 implant thymocytes, and the logio values were used for calculation of geometric means. The limit of detection was 10 2 3 RNA copies per 10 6 cells. Results are shown in Table H-4.
• Thy/Liv implants Size and quality of Thy/Liv implants. At the time of inoculation, implants were mostly small or medium in size and were of good quality. As shown in Table H-3, two mice (#4 and #26 were rejected because of lack of implant or insufficient implant size. At termination, implants were mostly small or medium in size and were of good quality.
• Adverse affects in treated mice No significant weight loss occurred in any of the treated groups (Table H-4).
• the apparent reduction in implant cell yield in the high-dose AR177-treated mice (mean of 85 x 10 6 versus 140 x 10 6 for untreated infected mice) is not statistically significant.
• HTV-1 replication induction of HLA class I expression, and thymocyte subsets in Thy/Liv implants of untreated mice.
• Implants from all 8 untreated infected mice (group E) had detectable p24 (mean of 620 pg per 10 6 cells), infectious virus (10 26 TCID 5 0 per 10 6 cells), HTV-1 DNA, HTV-1 RNA (10 6 1 per 10 6 cells), and a mean 5.2-fold increase in HLA class I (W632) expression by implant thymocytes compared to untreated mock-infected mice (Table H-1 and Figure 65).
• Implants from ddl-treated mice had a mean p24 level of 46 pg per 10 6 cells versus 620 pg per 10 6 cells in untreated mice, a mean viral RNA load of 10 5 ' copies per 10 6 cells versus 10 6 ' per 10 6 cells, and W632 mean channel fluoresence of 250 versus 620 in untreated mice. Implants from all four ddl-treated mice were positive for HTV-1 DNA by PCR. (Table H-2).
• Additional novel guanosine-rich oligonucleotides were prepared in the present investigations and have been examined for in vitro anti-viral activity and for inhibition of integrase activity.
• These new anti-viral oligonucleotides which also form intramolecular stacked guanosine quartet structures under physiological conditions, are based on the T30695 motif (SEQ ID NO 87), and are exemplified by T30925, T30926, T30927, T30928, and T30929 (SEQ ID NO 87).
• These ODNs contain a C-5 propynyl-deoxyuridine, variously positioned at 2, 5, 9, 13 and 17, from the 5' end.
• oligonucleotides are even more effective than T30177 in in vitro tests of anti-HTV activity (as shown in Table 1-1) and are expected to demonstrate similar or even greater therapeutic efficacy than T30177 against human immunodeficiency virus type 1 (HTV-1) in a SCID-hu mouse model.
• ODN Synthesis C-5 propynyl-dU protected monomers were obtained from Glen Research or synthesized at Aronex Pharmaceuticals, Inc. and other 5'-protected nucleoside phosphoramidite monomers were obtained from either PerSeptive Biosystems (Framingham, MA) or Glen Research (Sterling, VA). Oligodeoxynucleotides (ODNs) were synthesized using a standard protocol employing amidite monomers synthesized at Aronex, or obtained from Glen Research or PerSeptive Biosystems, on a PerSeptive Biosystems DNA synthesizer Expedite model 8909.
• Phosphorothiolated (PT) ODN linkages were prepared using the Beaucage reagent as described previously (Ojwang et al. 1995). ODNs with phosphodiester and partial PT backbones were cleaved and deprotected in ammonium hydroxide at 56°C for 16 hrs. Propynyl modified pyrimidine ODNs were synthesized using the standard phosphoramidite methods with the following modifications. The coupling time was extended to 300 seconds and the resulting ODN was cleaved from the solid support and deprotected in ammonium hydroxide at room temperature for 48 hours as opposed to 56°C for 16 hrs.
• Crude ODNs were purified by anion-exchange chromatography on a Q-Sepharose column (1.5 x 10 cm) using a Waters high performance liquid chromatography (HPLC) system. Standard sodium chloride (0.5-3 M)/sodium hydroxide (10-15 mM) mobile phases were used depending on the backbone.
• the purified ODNs were desalted on SepPak Plus C J S cartridges purchased from Waters. The purity and integrity of the ODNs was confirmed using one or more of the following procedures on all ODNs synthesized: analytical HPLC, gel electrophoresis in a 20% polyacrylamide gel containing 7M urea, or mass spectroscopy.
• Integrase assays were performed essentially as described by Mazumder et al. (1996). In these assays integrase (HTV-1) was preincubated at a final concentration of 200 nM with inhibitor in reaction buffer [50 mM NaCl, 1 mM HEPES, pH 7.5, 50 ⁇ M EDTA, 50 ⁇ M DTT, 10% glycerol (w/v), 7.5 mM MnCl2 or MgCl2, 0.1 mg/ml BSA, 10 mM 2-mercaptoethanol, 10% DMSO, and 25 mM MOPS, pH 7.2] at 30°C for 30 mm.
• reaction buffer [50 mM NaCl, 1 mM HEPES, pH 7.5, 50 ⁇ M EDTA, 50 ⁇ M DTT, 10% glycerol (w/v), 7.5 mM MnCl2 or MgCl2, 0.1 mg/ml BSA, 10 mM 2-mercaptoethanol,
• the spaces or gaps in these sequences represent a ribonucleotide or deoxyribonucleotide from which the base has been removed ("abasic") without causing a break in the oligonucleotide backbone.
• abasic deoxyribonucleotide
• the T30695, T30925, T30926, T30927, T30928, T30929 oligonucleotides were found to be 10-20 fold more active than T30177. In vivo activity of these new ODNs is expected to be similar or superior to that of T30177.
• T30926 5'- g ggtgggXgggtgggt -3' 33 - 9
• T30927 5'- g ggtgggtgggXgggt -3' 52 30 7
• ADDRESSEE Conley, Rose & Tayon, P.C.
• MOLECULE TYPE DNA (genomic)
• MOLECULE TYPE DNA (genomic)
• MOLECULE TYPE DNA (genomic)
• MOLECULE TYPE DNA (genomic)
• MOLECULE TYPE DNA (genomic)

Applications Claiming Priority (5)

Publications (2)

Family

ID=26714074

Family Applications (1)

Country Status (4)

Citations (3)

Family Cites Families (10)

• 1998
  • 1998-02-03 CA CA002279488A patent/CA2279488A1/en not_active Abandoned
  • 1998-02-03 WO PCT/US1998/001974 patent/WO1998033807A1/en not_active Application Discontinuation
  • 1998-02-03 EP EP98904843A patent/EP0971944A4/de not_active Withdrawn
  • 1998-02-03 AU AU62625/98A patent/AU6262598A/en not_active Abandoned

Patent Citations (3)

Non-Patent Citations (5)

Also Published As

Similar Documents

Legal Events