EP0951554A1 - Proteine de fusion comportant tout ou partie de la proteine pp65 de cmv humain, utile notamment dans la preparation d'un vaccin - Google Patents

Proteine de fusion comportant tout ou partie de la proteine pp65 de cmv humain, utile notamment dans la preparation d'un vaccin

Info

Publication number
EP0951554A1
EP0951554A1 EP97951322A EP97951322A EP0951554A1 EP 0951554 A1 EP0951554 A1 EP 0951554A1 EP 97951322 A EP97951322 A EP 97951322A EP 97951322 A EP97951322 A EP 97951322A EP 0951554 A1 EP0951554 A1 EP 0951554A1
Authority
EP
European Patent Office
Prior art keywords
protein
cmv
fusion protein
cells
peptide fragment
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP97951322A
Other languages
German (de)
English (en)
French (fr)
Inventor
Eric John Radcliffe Hospital PRIEUR
Jacqueline Lule
Jean-Luc Davignon
Christian Davrinche
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Institut National de la Sante et de la Recherche Medicale INSERM
Original Assignee
Institut National de la Sante et de la Recherche Medicale INSERM
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Institut National de la Sante et de la Recherche Medicale INSERM filed Critical Institut National de la Sante et de la Recherche Medicale INSERM
Publication of EP0951554A1 publication Critical patent/EP0951554A1/fr
Withdrawn legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A61P31/20—Antivirals for DNA viruses
    • A61P31/22—Antivirals for DNA viruses for herpes viruses
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/16011—Herpesviridae
    • C12N2710/16111—Cytomegalovirus, e.g. human herpesvirus 5
    • C12N2710/16122—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes

Definitions

  • CMV human cytomegalovirus
  • Herpes virus family a 230 kbp double-stranded DNA enveloped virus
  • CMV is the largest of the Herpes virus family. Like the other members of this virus family, it is present in latent form and can undergo repeated reactivations leading to viremia several years after the initial infection.
  • CMV is widespread throughout the world and if it is well tolerated by healthy individuals, it is associated with pathologies with often dramatic consequences for the fetus and the immunocompromised (transplant recipients, AIDS, cancer) (for review see (1 )).
  • CMV infection is associated with graft rejection in transplant recipients (allografts of marrow, kidney, heart, liver). It represents one of the most dramatic opportunistic infections in HIV + individuals who, despite chemotherapy with antivirals, are victims of often fatal pathologies. For all these reasons, CMV infection raises an important public health problem.
  • the subject of the present invention is a fusion protein, characterized in that it comprises at least a part of the pp65 protein of the cytomegalovirus (or CMV), or of a protein having at least 80% homology. with the pp65 protein, in combination with at least one second peptide fragment derived from CMV.
  • CMV cytomegalovirus
  • the pp65 protein is a CMV matrix protein, which is internalized in cells and delivered to the cytosol at the same time as the virion, very soon after infection.
  • the peptide fragments entering the chimeric protein preferably have a length greater than or equal to 9 amino acids, and cover different HLA class I restrictions.
  • the Applicant has shown that a peptide of the pp65 protein of a length greater than 9 amino acids can be internalized by a presenting cell and presented by a MHC class I molecule to a specific TCD8 + line.
  • the advantage of constructs including these peptides and the IE 1 protein in vaccination would be linked to the use of antigens capable of entering the presenting cell by a unique endocytosis pathway and of inducing both a TCD4 + response and TCD8 +.
  • the second peptide fragment present in the fusion protein consists of the protein IE 1 or one of its epitopes, or by a protein having at least 80% homology.
  • the polypeptide sequence of IE 1 a major regulatory protein of the viral cycle is very conserved between the different viral strains.
  • the introduction of this protein into a unitary vaccine would allow the induction of memory auxiliary TCD4 + cells capable of cooperating in the induction of anti-pp65 cytotoxic TCD8 + cells and in the production of antibodies against the envelope protein gB, subject greater variability ("cross help").
  • cross help the majority of neutralizing antibodies present in the serum of infected individuals are directed against the viral envelope glycoprotein gB (UL55).
  • the gB protein has been considered one of the most important viral antigens for vaccination.
  • Many protocols using recombinant viruses (Adenovirus, Vaccine, Canaripox ). have been developed (5, 6, 7).
  • e4 or exon 4 which comprises 406 amino acids, is a fragment of the protein IE 1, which contains 491 amino acids.
  • the fusion protein comprises a) the fragment delimited by the amino acid residues 162 and 175 of the sequence of the protein IE 1 or, b) a peptide fragment having at least 90 % homology with said fragment mentioned in a).
  • epitopes are suitable for implementing the invention, such as those mentioned by Davignon et al (8).
  • the fusion protein according to the invention may also contain a peptide fragment derived from a microorganism different from CMV, and / or any polypeptide fragment allowing its subsequent purification of the type of “Tag” sequences; these sequences placed upstream or downstream of the protein of interest make it possible to purify or mark it; by way of example, mention may be made of the use of ⁇ -galactosidase, of histidine hexamers (His ⁇ , etc.), or of GST.
  • the fusion protein comprises a peptide fragment derived from an enzyme with glutathione-S-transferase (or GST) activity.
  • the GST protein will in particular facilitate the purification of the fusion protein from a complex culture medium.
  • the subject of the invention is therefore a chimeric protein GST-IE l-pp65 of 145 kDa, which can be produced in E. coli. Its immunogenicity has been demonstrated in vitro, by the proliferation of cell clones
  • TCD4 + specific for IE 1 TCD4 + specific for IE 1 and by the lysis of target cells incubated in presence of a TCD8 + line specific for pp65.
  • the Applicant has shown that the protein in soluble form and its fragments make it possible to stimulate the TCD4 + and TCD8 + compartments of the specific cellular response in vitro. These results make this protein a reagent of choice for the design of a unitary vaccine.
  • the subject of the invention is a pharmaceutical composition, characterized in that it contains a) at least part of the pp65 protein of CMV, or of a protein having at least 80% homology with the pp65 protein, in association with at least one second peptide fragment derived from CMV, or b) nucleotide sequences coding for the peptides mentioned in a).
  • the subject of the invention is a process for the preparation of a fusion protein, characterized in that the following steps are carried out: a) a first DNA sequence coding for at least part is linked of the pp65 protein of CMV with a second DNA sequence coding for another polypeptide or protein derived from CMV so as to obtain a recombinant DNA sequence coding for a fusion protein, b) the recombinant DNA sequence is introduced in a construct containing the elements necessary for its expression, and possibly sequences coding for other polypeptides, c) the construct obtained in b) is introduced into host cells which are then cultured under conditions in which the system d the expression of the fusion DNA is functional, so that the fusion protein is produced in the host cell, d) the fusion protein produced in the cell is recovered host and we purify it.
  • Figure 2 The protein GST-IEl-pp65 induces a specific proliferation of the clone TCD4 + BeA3G9 in the presence of PBMC.
  • the line TCD8 + ⁇ Val>> generated with the peptide N9V of pp65 was used in a release test of 51 Cr in the presence of U373MG cells either incubated with the peptide N9V, or with the peptide I9Y, or infected with CMV Towne ( 5 months) for 4 hours then incubation with the peptide I9Y.
  • the percentage of specific lysis was calculated as indicated in Materials and Methods.
  • the cells of the ⁇ Val>> line were used in a 51 Cr release test in the presence of autologous B / EBV lymphocytes pretreated or not with chloroquine (Materials and Methods) and the peptides and proteins as indicated.
  • Figure 6 Analysis of the production of the His6-IEl-pp65 protein by insect cells infected with a recombinant Baculovirus.
  • Sf9 insect cells were infected with recombinant Baclovirus IEl-pp65 for 48 h.
  • the cell lysates (1) were centrifuged, the supernatant (2) passed through a Ni-Agarose column and the eluates recovered (3,4).
  • the different fractions were subjected to a
  • FIG. 7 Induction of anti-IEl TCD4 + effectors in a CMV + donor with the BVSM / IEl-pp65 formulation. CMMC + donor PBMCs were stimulated with the protein
  • IE l-pp65 either soluble, or formulated with BVSM (AG form) or in the absence of antigen (Mock).
  • the cells are incubated in the presence of protein solutions containing the IE1 protein or not (col).
  • the proliferation of anti-IE 1 specific T cells was determined by measuring the incorporation of tritiated thymidine.
  • the region of the viral genome containing the sequence coding for the protein IEI located in the C-Hind III fragment of the strain CMV-Towne was cloned in a plasmid named pRL103.
  • This plasmid was used to transfect cells of the U373 MG astrocyte line (designated A2 (gift from R. Lafemina, Merck Sharp and Dohme, WestPoint, PA, USA). These cells were cultured in RPMI-SVF (RPMI 1640 Glutamax, 1 mM sodium pyruvate, 200 u / ml penicillin, 100 ⁇ g / ml streptomycin, 10% calf serum decomplemented) until confluence.
  • RPMI-SVF RPMI 1640 Glutamax, 1 mM sodium pyruvate, 200 u / ml penicillin, 100 ⁇ g / ml streptomycin, 10% calf serum decomplemented
  • the viral particles were collected by centrifugation (31000g, 4 ° C, 90 min) and the capsids were degraded by treatment with proteinase K (BOEHRINGER) (150 ⁇ g) in 250 ⁇ l of lysis buffer (10 mM TrisCl pH 7.5, ImM EDTA, 2% sarcosyl) for 30 min at room temperature.
  • the viral DNA was extracted with phenol / chloroform and then precipitated with absolute ethanol.
  • the DNA pellet was dried and dissolved in 20 ⁇ l of water.
  • a fragment corresponding to the pp65 cDNA was obtained by PCR on an aliquot of 2 ⁇ l of viral DNA using the primers C3: CCCGGGGAGATCTCGGATATCCGTACTGGGTCCC and C4: GAATTCGGATCCTCAACCTCGGTGCTrmGG complementary to the 5 ′ and 3 ′ ends of the pp65 gene and containing respectively EcoRI and BamHI sites.
  • the PCR product (1670 bp) was purified on an S400-HR column (PHARMACIA).
  • the degree of purity of the protein was checked on SDS-PAGE followed by staining with Coomassie blue.
  • the antigenicity of GST-IE1- pp65 was analyzed in western blot using goat antibodies directed against GST (PHARMACIA, dilution 1/400), and mouse antibodies directed against IE I (supernatant E 13 diluted 1 / 10, gift from Dr. Mazeron, H al Lariboisière, Paris) and pp65 (NEA 20 diluted 1/250, DUPONT). Secondary antibodies coupled to the peroxidase RAG / PO, RAM / PO (Nordic) were used at 1/500. Proteins have been measured according to the Bradford method with the "Bio-Rad Protein Assay" kit (BIORAD). The recombinant protein GST was produced and purified.
  • I-Lymphoproliferation test Cells (2 x 10 4 ) of a CD4 + T clone (BeA3G9) restricted by HLA DR8 and specific for an epitope located at position 162-175 of the protein IE I were incubated in 100 ⁇ l of RPMI medium.
  • 1 ⁇ Ci of [ 3 H] -thymidine (AMERSHAM) per well was added to the culture.
  • the stimulator cells (10 x 10 6 cells / ml) were incubated in RPMI in the presence of 30 ⁇ g of a peptide presented by HLA-A2 (peptide N9V, Figure 5, Neosystem, France) for 1 hour at 37 ° C. and were irradiated (2500 rads). The effector cells were restimulated under the same conditions every 7 days. The cytotoxicity of the “Val” line thus obtained was tested on day 14. The CD8 + phenotype of the line was determined by cytofluorimetry with the mouse monoclonal antibody OKT8.
  • III-Cytotoxicity test III- 1 In the context of CMV infection
  • U373MG astrocytoma cells of HLA-A2 haplotype (2 x 10 5 ) at 80% confluence in RPMI / SVF were infected with CMV-Towne virus at a rate of 5 pfu / cell in 6-well plates (10 cm2). After 4 hours of infection, the cells were marked with 100 ⁇ Ci of Na 2 51 Cr0 4 (ICN, France) and washed in RPMI.
  • the autologous effector cells of the TCD8 + line were incubated with 10 4 target cells in RPMI / 10% FCS (500 ⁇ l) for 4 hours at 37 ° C. Varying amounts of effector cells were added to the targets to obtain different effector / target ratios.
  • the cells were preincubated overnight at 37 ° C. with either the N9V peptide or a peptide recognized by HLA-B35 (peptide 19 Y, FIG. 4, Neosystem, France) at a final concentration of 100 nM.
  • the spontaneous release rate was determined by measuring the radioactivity released by target cells maintained in culture for 4 hours. The percentage of specific lysis was calculated using the following formula ([measured radioactivity - spontaneous release / total radioactivity - spontaneous release] x 100). Radioactivity is measured on a ⁇ Cobra counter (PACKARD). Each measurement is performed in duplicate.
  • the cells (50,000 / ml) were labeled with 100 ⁇ Ci of Na 2 51 Cr0 4 and washed in RPMI.
  • the effector cells of the TCD8 + line were added under the same conditions as for the astrocytoma cells.
  • FIG. 2 shows the results of the proliferation of the anti-IE l clone BeA3G9 in the presence of PBMCs incubated with the purified recombinant antigen GST-IE l-pp65.
  • the clone proliferated specifically since in the presence of the GST protein no incorporation of thymidine was observed.
  • This proliferation was of the same order as that obtained with the fusion protein GST-e4 (80% C-terminal of IE 1) or GST-IE 1.
  • These results show that the protein GST-IE 1- pp65 has been properly primed by the HLA-DR8 antigen presenting cells so as to present an IE I epitope recognized by the cells of the clone BeA3G9.
  • II-TCD8 + anti-pp65 cells of the “Val” line lyse targets incubated in the presence of the protein GST-IE1-pp65 directed by trypsin
  • FIG. 6 shows the SDS-PAGE analysis of the HiscIE l-pp65 protein produced by cells infected with recombinant Baculoviruses and purified by Ni chromatography. These results show that the protein represents an important part of the total cellular proteins and is obtained with a high degree of purity after chromatography.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Virology (AREA)
  • Organic Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Biochemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biotechnology (AREA)
  • Communicable Diseases (AREA)
  • Oncology (AREA)
  • Engineering & Computer Science (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Peptides Or Proteins (AREA)
EP97951322A 1996-12-13 1997-12-12 Proteine de fusion comportant tout ou partie de la proteine pp65 de cmv humain, utile notamment dans la preparation d'un vaccin Withdrawn EP0951554A1 (fr)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
FR9615344 1996-12-13
FR9615344A FR2757169B1 (fr) 1996-12-13 1996-12-13 Proteine de fusion comportant tout ou partie de la proteine pp65 de cmv humain, utile notamment dans la preparation d'un vaccin
PCT/FR1997/002285 WO1998026074A1 (fr) 1996-12-13 1997-12-12 Proteine de fusion comportant tout ou partie de la proteine pp65 de cmv humain, utile notamment dans la preparation d'un vaccin

Publications (1)

Publication Number Publication Date
EP0951554A1 true EP0951554A1 (fr) 1999-10-27

Family

ID=9498647

Family Applications (1)

Application Number Title Priority Date Filing Date
EP97951322A Withdrawn EP0951554A1 (fr) 1996-12-13 1997-12-12 Proteine de fusion comportant tout ou partie de la proteine pp65 de cmv humain, utile notamment dans la preparation d'un vaccin

Country Status (7)

Country Link
US (1) US6605467B2 (ja)
EP (1) EP0951554A1 (ja)
JP (1) JP2001506494A (ja)
AU (1) AU5489298A (ja)
CA (1) CA2275340A1 (ja)
FR (1) FR2757169B1 (ja)
WO (1) WO1998026074A1 (ja)

Families Citing this family (15)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6562345B1 (en) 1996-11-12 2003-05-13 City Of Hope Immuno-reactive peptide CTL epitopes of human cytomegalovirus
FR2757169B1 (fr) * 1996-12-13 1999-03-05 Inst Nat Sante Rech Med Proteine de fusion comportant tout ou partie de la proteine pp65 de cmv humain, utile notamment dans la preparation d'un vaccin
DE19910044A1 (de) * 1999-03-08 2000-09-14 Bodo Plachter Virale Partikel, die nach Infektion durch humanes Cytomegalovirus freigesetzt werden und ihre Verwendung als Impfstoff
ATE497971T1 (de) 1999-06-04 2011-02-15 Florian Kern Peptide zur vakzinierung gegen das humane cmv
CA2403681A1 (en) * 2000-03-21 2001-09-27 Genzyme Corporation Therapeutic anti-cytomegalovirus compounds
EP1612217A3 (en) * 2000-03-27 2006-01-18 City of Hope Immuno-reactive peptide CTL epitopes of human cytomegalovirus
AU2001264764A1 (en) 2000-05-31 2001-12-11 Genzyme Corporation Therapeutic anti-melanoma compounds
AU2002214624A1 (en) 2000-10-20 2002-05-06 City Of Hope Immunoreactive peptide ctl epitopes of human cytomegalovirus pp150
AU2004257214B2 (en) * 2003-07-11 2010-04-22 Alphavax, Inc. Alphavirus-based cytomegalovirus vaccines
EP1799255A4 (en) * 2004-06-25 2008-10-01 Medimmune Vaccines Inc RECOMBINANT HUMANESE CYTOMEGALOVIRUS AND HETEROLOGIST ANTIGENS CONTAINING VACCINES
WO2006110728A2 (en) * 2005-04-12 2006-10-19 The Uab Research Foundation Immunogenic cmv tegument aggregates
AU2008266807B2 (en) * 2007-06-21 2012-08-16 Alphavax, Inc. Promoterless cassettes for expression of alphavirus structural proteins
US10611800B2 (en) 2016-03-11 2020-04-07 Pfizer Inc. Human cytomegalovirus gB polypeptide
US11629172B2 (en) 2018-12-21 2023-04-18 Pfizer Inc. Human cytomegalovirus gB polypeptide
TWI810589B (zh) 2020-06-21 2023-08-01 美商輝瑞股份有限公司 人巨細胞病毒糖蛋白Ｂ（ｇＢ）多肽

Family Cites Families (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1994000150A1 (en) * 1992-06-25 1994-01-06 City Of Hope Induction of cytolytic t-lymphocytes with cytomegalovirus polypeptides
US5997878A (en) * 1991-03-07 1999-12-07 Connaught Laboratories Recombinant poxvirus-cytomegalovirus, compositions and uses
IT1266740B1 (it) * 1994-07-01 1997-01-14 Maria Paola Landini Materiale proteico ricombinante legante anticorpi contro il citomegalovirus umano, reagenti diagnostici derivati da tale
EP0702083A3 (de) * 1994-07-26 1997-01-15 Biotest Ag Polypeptide und Fusionsproteine bestehend aus dem UL 57 Leserahmen bzw. dem C-terminalen Bereich des Tegumentproteins pp150 aus HCMV, entsprechende Oligonucleotide und Nachweis reagentien
DE4426453C1 (de) * 1994-07-26 1995-11-02 Biotest Ag Rekombinant hergestellte Fusionsproteine des Cytomegalievirus und diese enthaltende diagnostische Testkits
FR2723849B1 (fr) * 1994-08-31 1997-04-11 Biovector Therapeutics Sa Procede pour augmenter l'immunogenicite, produit obtenu et composition pharmaceutique
US5800981A (en) * 1996-02-22 1998-09-01 University Of Limburg Human cytomegalovirus antigen and its use
FR2757169B1 (fr) * 1996-12-13 1999-03-05 Inst Nat Sante Rech Med Proteine de fusion comportant tout ou partie de la proteine pp65 de cmv humain, utile notamment dans la preparation d'un vaccin

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO9826074A1 *

Also Published As

Publication number Publication date
WO1998026074A1 (fr) 1998-06-18
AU5489298A (en) 1998-07-03
FR2757169A1 (fr) 1998-06-19
FR2757169B1 (fr) 1999-03-05
JP2001506494A (ja) 2001-05-22
US20020156251A1 (en) 2002-10-24
US6605467B2 (en) 2003-08-12
CA2275340A1 (fr) 1998-06-18

Similar Documents

Publication Publication Date Title
EP0799893B1 (fr) Utilisation de plasmides pour la fabrication d'une composition destinée à la mise en oeuvre d'une méthode de traitement vaccinal chez l'homme ou l'animal
EP0951554A1 (fr) Proteine de fusion comportant tout ou partie de la proteine pp65 de cmv humain, utile notamment dans la preparation d'un vaccin
EP2566957B1 (en) Vaccine against beta-herpesvirus infection and use thereof
Öhlschläger et al. An improved rearranged Human Papillomavirus Type 16 E7 DNA vaccine candidate (HPV-16 E7SH) induces an E7 wildtype-specific T cell response
US9737597B2 (en) Attenuated recombinant vesicular stomatitis virus vaccine vectors comprising modified matrix proteins
JP2001524531A (ja) 予防的および治療的ワクチン接種用のＨＩＶ−１のＴａｔまたはその誘導体
CA2089497A1 (en) Self-assembling replication defective hybrid virus particles
JP2018019692A (ja) ワクチン接種目的のためのエプスタイン・バーウイルス由来の第二世代ウイルス様粒子（ｖｌｐ）
US20110014221A1 (en) Hiv combination vaccine and prime boost
Plaksin et al. Effective anti‐metastatic melanoma vaccination with tumor cells transfected with MHC genes and/or infected with Newcastle disease virus (NDV)
WO1993019092A1 (fr) Adenovirus recombinants defectifs exprimant des proteines caracteristiques du virus epstein-barr
US7655235B2 (en) Vaccine
KR20160022919A (ko) 수포성 구내염 바이러스의 변형된 기질 단백질
Báez-Astúa et al. Low-dose adenovirus vaccine encoding chimeric hepatitis B virus surface antigen-human papillomavirus type 16 E7 proteins induces enhanced E7-specific antibody and cytotoxic T-cell responses
EP0871738B1 (fr) Pseudo-particules virales recombinantes et applications vaccinales et antitumorales
US5833991A (en) Glycine-containing sequences conferring invisibility to the immune system
CA3179213A1 (en) Mers-cov vaccine
Azizi et al. A combined nucleocapsid vaccine induces vigorous SARS-CD8+ T-cell immune responses
Pordanjani et al. Engineered dendritic cells-derived exosomes harboring HIV-1 Nefmut-Tat fusion protein and heat shock protein 70: A promising HIV-1 safe vaccine candidate
JP2002501369A (ja) Ｆｉｖワクチン
CN114277039B (zh) 呼吸道合胞病毒mRNA疫苗及其制备方法和应用
AU2017204774B2 (en) Vaccine against beta-herpesvirus infection and use thereof
de Vries et al. Measles virus-specific murine T cell clones: characterization of fine specificity and function.
Hanley et al. Vaccines and Immunotherapy
Vasilakos Cytotoxic T-lymphocyte activation in vivo using a herpes simplex virus class I-restricted epitope

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 19990712

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AT BE CH DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20060620