EP0948637A1

EP0948637A1 - Live recombinant avian vaccine, using the infectious laryngotracheitis avian virus as vector

Info

Publication number: EP0948637A1
Application number: EP97952066A
Authority: EP
Inventors: Jean-Christophe Francis Audonnet; Michel Joseph Marie Bublot; Eliane Louise Françoise LAPLACE
Original assignee: Merial SAS
Current assignee: Boehringer Ingelheim Animal Health France SAS
Priority date: 1996-12-16
Filing date: 1997-12-15
Publication date: 1999-10-13
Also published as: AU5562798A; CO4650231A1; MA24422A1; AU734085B2; US6033670A; TNSN97207A1; ZA9711247B; FR2757061A1; WO1998027215A1; JP2001510338A; AR010086A1; FR2757061B1

Abstract

The invention concerns a live recombinant avian vaccine containing, as vector, an ILTV virus comprising and expressing at least a heterologous nucleotide sequence, said sequence being inserted in the insertion locus formed by the IRES (internal ribosome entry site) located between the stop coding units of COL B and COL C of the ILTV and which, in a particular ILTV strain, is defined between nucleotides 908 and 994 at the SEQ ID NO: 1.

Description

Avian recombinant live vaccine, using avian infectious laryngotracheitis virus as a vector.

The present invention relates to vaccines for avian use based on infectious laryngotracheitis virus (ILTV), into which has been inserted, by genetic recombination, at least one heterologous nucleotide sequence, in particular coding for and expressing, an antigenic polypeptide of an avian pathogen, under conditions ensuring immunization leading to effective protection of the animal vaccinated against said pathogen.

Infectious laryngotracheitis virus (ILTV) is an alphaherpesvirus (B. Roizman, Arch. Virol. 1992. 123. 425-449) which causes an important respiratory pathology (infectious laryngotracheitis or ILT) in chicken (LE Hanson and TJ Bagust, Diseases of Poultry 9th edn 1991. pp 485-495. Ames, lowa State University Press). The vaccines currently available against this condition contain an attenuated strain which can be administered by different routes including the intranasal, conjunctival, cloacal ⁱⁿ ^the drinking water and aerosol (LE and T Hanson. Bagust, Diseases of Poultry 9th Edition 1991. pp 485-495. Ames, Iowa State University Press).

Molecular biology studies ILTV have characterized the viral genome (MA Johnson et al., Arch. Vlrot. 1991. 119. 181-198) and iden _t ify some virus genes (AM Griffin, J. Gen. Virol. 1989. 70. 3085-3089) including the genes coding for thy idine inase (UL23) (AM Griffin and MEG Boursnell, /. Gen. Virol. 1990. 71. 841-850; CL. Eeier et al ., Avion Dis. 1991. 35. 920-929), the glycoprotein gB (UL27) (AM Griffin, /. Gen. Virol. 1991. 72. 393-398;. Kongsuwan et al., Virology 1991. 184. 404 -410; DJ Poulsen et al. Virus G nes 1991. 5. 335-347), the glycoprotein gC (UL44) (DH Kingsley et al., Virology 1994. 203. 336-343), the capsid protein p40 ( UL26) (AM Griffin, Nucl. Acids Res. 1990. 18. 3664), the protein homologous to the ICP4 protein of herpes simplex (HSV-1) (MA Johnson et al., Virus Research 1995. 35. 193- 204), proteins homologous to proteins ICP27 (UL54), glycoprotein gK (UL53) and DNA helicase (UL52) of HSV-1 (MA Johns on and ai, Arch Virol. 1995. 140. 623-634), ribonuciéotide reductase (AM Griffin, /. Gen. Virol. 1989. 70. 3085-3089, OA-90/02802), the UL1 to UL5 genes (W. Fuchs and TC Mettreleiter, /. Gen. Virol. 1996. 77. 2221-2229), the genes present in the unique short genome sequence (U,) (MA Johnson et ai, DNA S quence- The Journal of Sequencing and Mapping 1995. Vol. 5 . pp 191-194; K. Kongsuwan et al., Arch. Virol. 1995. 140. 27-39; K. Kongsu an et al. Virus Research 1993. 29. 125-140; K. Kongsuwan et al. Virus G ne 1993. 7. 297-303; MA Wild et al. Genes Virus 1996. 12. 107-116; WO-A-92/03554; WO-A-95/08622).

The aim of the present invendon is to develop an avian vaccine based on a recombinant ILTV virus expressing a heterologous gene, this virus being capable of replicating and of inducing immunity in the vaccinated host while maintaining good safety.

Another objective of the invention is to provide such a vaccine which is at the same time particularly effective against infectious laryngotracheitis (ILT).

Another objective of the invention is to propose such a vaccine which can be used in mass vaccination by mucosal route, for example by aerosol route or in drinking water, in such a way that the replication of the virus at the mucosal level allows ^to induce mucosal and systemic immunity. Such mucosal immunity will be particularly effective against respiratory diseases and con _t re other diseases for which the input poπe pathogen is mucosal.

Another object of the invention is to provide such a vaccine which can be used both in adults and in young animals.

A specific objective is to propose such a vaccine usable in mass vaccination by mucosal route of very young animals such as day-old chicks. Another objective of the invention is to provide a vaccine against the ILT which has an increased efficacy compared to the parental strain and which may even possibly allow the insertion and expression of a heterologous gene.

In the course of their work on the ILTV virus, the inventors have found a genomic region which has proved quite suitable as a site for the insertion of heterologous genes. This has made it possible to develop a recombinant live vaccine based on an ILTV vector into which is inserted at least one sequence coding for an avian immunogen, in particular the HN and F proteins of Newcastle disease virus (NDV), and / or the Mare Disease Virus gB glycoprotein (MDV), and / or the Gumboro Disease Virus VP2 protein (IBDV), and / or the Infectious Bronchitis Virus S and M proteins (IBV) ). Such a vaccine incorporating a sequence coding for NDV, MDV and / or IBV proteins provides satisfactory protection of animals against Newcastle disease, against Marek's disease, against Gumboro disease, and against bronchitis infectious respectively.

The present invention therefore relates to a live recombinant avian vaccine comprising, as a vector, the ILTV virus comprising at least one heterologous nucleotide sequence, in particular coding for and expressing, an antigenic polypeptide of an avian pathogenic agent, inserted into the locus d 'inseπion formed of the intergene located between the stop codons of COL-B and COL-C of the ILTV virus and which, in a particular ILTV strain, is defined between nucleotides 908 and 994 with the sequence SEQ ID NO: l . If the specific sequence described in the request (SEQ ID NO: 1) comes from the ILTV vaccine strain T-20 12-8-66 from Select Laboratories (10026 Main

Street P.O. Box 6 Berlin, Maryland 21811, USA), it is obvious that a person skilled in the art will be able to use the other strains of ILTV, taking into account the information given herein on the vaccine strain.

The COL-B and COL-C correspond respectively to the UL3.5 and UL4 genes described in the article by W. Fuchs and T.C. Mettreleiter (/. Gen. Virol. 1996. 77. 2221-

2229) of a pathogenic strain from D. Lutticken, Boxmeer, Netherlands. This article in no way suggests that this intergene can be used as a locus of inclusion.

The sequence referenced SEQ ID NO: 19 reproduces for this pathogenic strain, the sequence equivalent to SEQ ID NO: 1. The intergene serving as insertion locus according to the invention is included in SEQ ID NO: 19 between nucleotides 908 and 994. By heterologous sequence is meant a sequence which does not originate from this insertion locus, c '' is to say both a sequence not originating from the ILTV virus, as well as a sequence originating from another genomic region of this virus, or also originating from another ILTV strain, in particular a virulent strain.

By insertion into the insertion region is meant in particular simple insertion or after total or partial deletion of the insertion locus.

One or more expression cassettes can be inserted, each comprising at least one sequence to be expressed.

To express the inserted sequence, it is preferred to use a strong eukaryotic promoter such as the immediate early CMV promoter (IE), the Rous sarcoma virus LTR (RSV), and the early promoter of the SV40 virus. By immediate early CMV promoter (IE) is meant in particular the fragment given in the examples as well as its subfragments retaining the same promoter activity. The CMV IE promoter can be the human promoter (HCMV IE) or the murine promoter (MCMV IE), or else a CMV IE promoter from another origin, for example from monkeys, rats, guinea pigs or pigs.

Other promoters of viral or cellular origin can also be used.

Among the promoters of viral origin, mention may also be made of promoters of genes for ILTN virus (genes considered to be early-immediate (ICP4, ICP27, ...), early fthymidine kinase, DΝA helicase, ribonucleotide reductase, ...), or late (gB, gD, gC, gK, ...)) . Marek's disease virus (MDV) (gB, gC, pp38, ppl4, ICP4, Meq, ... genes) or hβ ès turkey virus (heφèsvirus of rurkey) (gB, gC genes, ICP4, ...).

The nucleotide sequence inserted into the ILTN vector to be expressed can be any sequence coding for an antigenic polypeptide, of an avian pathogenic agent, capable, once expressed under the favorable conditions provided by the invention, of ensuring immunization leading to effective protection of the animal vaccinated against the pathogen. It will therefore be possible to insert, under the conditions of the invention, the nucleotide sequences coding for the antigens of interest for a given disease.

This nucleotide sequence inserted into the ILTV vector can also code for an immunomodulatory polypeptide, and in particular a cytokine. Remarkably, the vaccines according to the invention can be used for vaccination in ovo, day-old chicks or more and adults. Different routes of administration could be used: the parenteral route, or the mucosa routes such as oronasale (drinking water, aerosol), conjunctival (drop in the eye) or cloacale, with a preference for the routes allowing a mucosal vaccination of mass (drinking water, aerosol).

The invention proves to be particularly useful both for protection against respiratory pathologies and against systemic pathologies by blocking the natural pathways of entry of the pathogenic agent.

The invention can in particular be used for the insertion of a nucleotide sequence suitably coding for an antigenic protein of the ΝDV virus and in particular, the glycoprotein HΝ or the glycoprotein F. This gives a recombinant live vaccine ensuring, in addition to protection against infectious laryngotracheitis, satisfactory protection against castleewcastle disease.

The recombinant Νewcastle disease vaccine will preferably contain 10 to 10 ⁴ PFU / dose.

Other preferred cases of the invention are the insertion of nucleotide sequences coding for antigens of other avian pathogens, and in particular, but not limited to, antigens of the ïarek disease virus, in particular genes gB, gC, gD, and gH + gL (WO-A-90 / 02803), the Gumboro disease virus, in particular the VP2 gene, the infectious bronchitis virus (IBV), in particular the S and M genes (M. Binns et al., J. Gen. Virol. 1985. 66. 719-726; M. Boursnell et al., Virus Research 1984. 1. 303-313), chicken anemia virus (CAV), in particular VP1 (52 kDa) + VP2 (24 Da) (NHM Notebom et al., J. Virol. 1991. 65. 3131-3139), of the ILTN virus, in particular the genes coding for gB (AM Griffin, /. Gen. Virol.

1991. 72. 393-398), or for gD (M.A. Johnson et al., DNA Sequence-The Journal of Sequencing and Mapping 1995. Vol. 5. ppl91-194. Harwood Académie Publishers

GmbH), or for gp60 (KK Kongsuwan et al., Genes Virus 1993. 7. 297-303), and the swelling head syndrome virus (swollen head syndrome) or chicken pneumovirus or turkey rhinotracheitis vires ( TRTV) of turkey; pneumovirus), in particular the fusion glycoprotein F (Q. Yu et al., J. Gen. Virol. 1991. 72. 75-81), or the attachment glycoprotein G (R. Ling et al., J. Gen. Virol.

1992. 73. 1709-1715; K. Juhasz and J. Easton, J. Gen. Virol. 1994. 75. 2873-2880). The doses will preferably be the same as those for the castewcastie vaccine.

In the context of the present invention, it is of course possible to insert more than one heterologous sequence into the same ILTV virus, in particular in this locus. In particular, it is possible to insert sequences therefrom from the same virus or from different viruses, which also includes the insertion of sequences from ILTV and from another avian virus. It is also possible to associate therewith sequences coding for immunomodulators, and in particular cytokines.

For example, the promoter CMV IE is associated with another promoter so that their 5 'ends are adjacent (which implies transcriptions in opposite directions), which makes it possible to insert, in the insertion zone, two nucleotide sequences , one under the control of the CMV IE promoter, the other under that of the associated promoter. This construction is remarkable by the fact that the presence of the CMV IE promoter, and in particular of its activating part (enhancer), activates the transcription induced by the associated promoter. The associated promoter may in particular be a promoter of a gene of the ILTN virus or of the MDV or HVT virus. An interesting case of the invention is a vaccine comprising a nucleotide sequence coding for HN of NDV and a nucleotide sequence coding for F of

NDV or an antigen of another avian disease, in particular those mentioned above, one of the genes being under the control of the CMV IE promoter, and the other under the control of the associated promoter.

It is also possible to mount two CMV IE promoters of different origins with their adjacent 5 ′ ends.

The expression of several heterologous genes inserted into the insertion locus can also be made possible by insertion between the open reading frames of these genes of a sequence called "IRES" (Internai Ribosome Entry Site) originating in particular from a picomavirus such as swine vesicular disease virus (SVDV; B.-F. Chen et al., J. Virology, 1993, 67, 2142-2148), encephalomyocarditis virus (EMCV; RJ Kauftnan et al., NucleicAcids Research, 1991, 19, 4485-4490), the foot-and-mouth disease virus (FMDV; N. Luz and E. Beck, J. Virology, 1991, 65, 6486-6494), or d 'another origin. The content of the 3 cited articles is incoφonî by reference. The expression cassette for two genes would therefore have the following minimum structure: promoter - gene 1 - IRES - gene2 - polyadenylation signal. The recombinant live vaccine according to the invention may therefore comprise, inserted into the insertion locus, an expression cassette successively comprising a promoter, two or more genes separated in pairs by an IRES, and a polyadenylation signal.

In addition to insertion into the locus according to the invention, one or more other insertions, one or more mutations, or one or more deletions can be made elsewhere in the genome; if the parental strain is virulent, it is possible, for example, to inactivate (by deletion, insertion or mutation) of the genes involved in virulence such as the thymidine kinase gene, the ribonucleotide reductase gene, the gE gene, etc. In all cases, insertion into another locus than that described in the invention makes it possible to express other genes,

The subject of the present invention is also a vaccine against ILT comprising a recombinant ILTV virus in which genes coding for major immunogens of ILTV have been inserted upstream, preferably the genes coding for gB (AM Griffin, J. Gen. Virol. 1991. 72. 393-398), or for gD (MA Johnson et ai, DNA Séquence- Journal of Sequencing and Mapping 1995. Vol. 5. ppl91- 194. Harwood Académie Publishers GmbH), or for gp60 (KK Kongsuwan and ai , Virus Genes 1993. 7. 297-303), an exogenous promoter, in particular a strong promoter as described above. This increases the level of expression of one or more of these genes and thus leads to a vaccine with increased efficacy against ILT. One can of course combine this with a construction as described above comprising the insertion of a heterologous sequence into the insertion locus.

The present invention also relates to a multivalent vaccine formula, comprising, as a mixture or to be mixed, a vaccine as defined above with another vaccine, and in particular another live recombinant avian vaccine as defined above, these vaccines comprising different inserted sequences, in particular of different pathogens.

The present invention also relates to a method for preparing the vaccines according to the invention, as it emerges from the description.

The present invention also relates to a method of avian vaccination comprising the administration of a recombinant live vaccine or of a multivalent vaccine formula as defined above. It relates in particular to such a method for vaccination in ovo, day-old chicks and adults. Different routes of administration of the vaccine can be used (see above) with a preference for the routes allowing mass vaccination by mucosal route (aerosol, drinking water), the dose of vaccine being preferably chosen between 10 * and 10 * per animal.

The present invention also relates to an ILTV virus comprising at least one heterologous nucleotide sequence as described above inserted into the insertion locus as defined above. The present invention also relates to all or part of the sequence SΞQ ID NO: 1; by parts of this sequence is meant not only the characterized COLs taken individually or their fragments, but also the intergene located between the COL B and COL C and the fragments located on either side of this intergene, which may possibly include a part of this intergene, and which can serve as flanking arms for homologous recombination, a technique which is moreover well known to those skilled in the art. In general, but without being limiting, the flanking arms can have from 100 to 800 base pairs.

The invention will now be described in more detail at. _¬ have examples of non-limiting embodiments taken referen _¬ this drawing, in which:.

7215

- 10 -

Figure 1 Restriction cane of the cloned fragment and position of the COLs

Figure 2: Sequence of 4161 bp and translation of COLs A, B, C and D of the T-20 vaccine strain from Select Laboratories ⁽ LT BLEN vaccine)

Figure 3: Scheme for obtaining the plasmid pEL157

Figure 4: Scheme for obtaining the plasmid pEL024

Figure 5: Scheme for obtaining the plasmid pEL027

Figure 6: Diagram of the plasmid pEL158

Figure 7: Scheme for obtaining the plasmid pCD009

Figure 8: Scheme for obtaining the plasmid pEL070

Figure 9: Diagram of the plasmid pEL159

Figure 10 NDV HN gene sequence

Figure 11 Scheme for obtaining the plasmid pEL030

Figure 12 Diagram of plasmid pEL160

Figure 13 Diagram of plasmid pEL033

Figure 14 Diagram of the plasmid pEL106

Figure 15 Diagram of double expression cassette

Figure 16 Diagram of the plasmid pCDOll

Figure 17 Diagram of plasmid pEL163

Figure 18 Sequence of 4161 bp and translation of UL3, 3.5, 4 and 5 from the pathogenic strain of Lϋtticken

List of sequences

SEQ ID NO: l Sequence of the Kpnl-Kpnl fragment (4161 bp, see FIG. 2) SEQ ID NO: 2 OHgonuciéotide EL001 SEQ ID NO: 3 Oligonucleotide EL002 SEQ ID NO: 4 Oligonuciéotide EL003 SEQ ID NO: 5 Oligonucleotide EL004 SEQ ID NO : 6 Oligonucleotide MB070 SEQ D NO: 7 Oligonucleotide MB071 215

- 11-

SEQ ED NO: 8 Sequence of the HN gene of NDV (see Figure 10) SEQ ED NO: 9 Oligonucleotide EL071 SEQ ED NO: 10 Oligonucleotide EL073 SEQ ED NO: 11 Oligonucleotide EL074 SEQ ED NO: 12 Oligonucleotide EL075 SEQ ED NO: 13 Oligonucleotide EL076 SEQ ED NO: 14 Oligonucleotide EL077 SEQ ED NO: 15 Oligonucleotide CD001 SEQ ED NO: 16 Oligonucleotide CD002 SEQ ED NO: 17 Oligonucleotide CD003 SEQ ED NO: 18 Oligonucleotide CD004 SEQ ED NO: 19 Sequence of the fragment Kpnl-Kpnl (41 , see figure 18)

EXAMPLES

All the plasmid constructions were carried out using the standard molecular biology techniques described by Sambrook J. et al. (Molecular Cloning:

A Laboratory Manual. 2 ⁿ Edition. Cold Spring Harbor Laboratory. Cold Spring Harbor.

New York. 1989). All the restriction fragments used for the present invention were isolated using the "Geneciean" kit (BIO101 Inc. La Jolla, CA).

The virus used as parental virus can be chosen from the vaccine strains described in J.R. Andreasen et al. (Avion Diseases 1990. 34. 646-656) or the strain T-20 12-8-66 from Select laboratories 10026 Main Street P.O. Box 6 Berlin, Maryiand 21811, USA. It is also possible to use virulent strains such as the Lûtticken strain (see above), the N-71851 strain (ATCC VR-783) or the USDA strain 83-2, which can be attenuated by known techniques, for example that described in WO-A-95/08622.

Example 1: Culture of the ELTV virus:

The ILTV virus (strain T20 from Select Laboratories) is cultured on primary chicken kidney cells (CRP); these cells are cultured in MEM medium supplemented with 3% fetal calf serum (S VF) in culture flasks of 75 cm ² (2 10 ³ cells / cm ² ) one or two days before inoculation.

The day of ^inoculation, one vial of lyophilized 1000 doses of vaccine is resuspended in 10 ml of MEM medium supplemented with 1% FCS; about 0.5 ml of this solution _tt e is then deposited on the culture of CRP. The next day, the medium is changed, and the day after, when the cytopathogenic effect (ECP) becomes generalized, the culture flasks are frozen at -70 "C.

The culture of the ILTN virus can also be done on immortalized chicken liver cells, and in particular on the LMH line (.M. Schnitzlein et al. Avion Diseases 1994. 38. 211-217).

Example 2: Preparation of the genomic ADΝ of ILTV:

After 2 freeze / thaw cycles, the culture of ILTV (2 flasks of 75 cm ² ) is harvested and centrifuged at low speed (5000 rpm in a rotor 20, Beckman JA21 centrifuge, for 5 minutes) to remove large cellular debris. The supernatant is then ultracentrifuged (100,000 rpm TLA100.3 rotor, Beckman TL100 centrifuge, for 1 hour). The pellet is then taken up in 1.6 ml of TEΝ-SDS (Tris pH 8.0 lOmM; EDTA ImM; ΝaCI 0.5M; sodium dodecyl sulfate 0.5%), and 35 μ \ of a proteinase K solution at 20 mg / mi are then added; the solution is incubated 3 to 4 hours in a water bath at 37 "C, and the ADΝ is then extracted 3 times with phenol / chloroform and 1 time with chloroform, then it is precipitated with emanol at -20 ^β C. After centrifugation, the pellet is rinsed with 70% ethanol, dried and resuspended in 200 μl TE (Tris pH8.0 10 mM; EDTA ImM). The nucleic acid concentration is then determined using a spectrophotometer (DO ₂₆₀ ). be directly digested with the appropriate restriction enzymes, and then be cloned into the plasmid pBlue Script II SIC; likewise, it can also be used in transfection experiments for obtaining a recombinant virus.

Example 3: Isolation and purification of recombinant ELTN virus

The donor plasmid composed of an expression cassette for a polypeptide inserted between two flanking regions of the insertion locus is digested with a restriction enzyme _{Λ Λ} „ _^ , ^ O 98/27215

1 3

allowing the linearization of the plasmid, then it is extracted with a phenol / chloroform mixture, precipitated with absolute ethanol, and taken up in sterile water. Primary 24-hour CRP cells are then transfected with the following mixture: 0.2 to 1 μg of linearized donor plasmid + 2 to 5 μg of ILTV viral DNA (prepared as in Example 2) in 300 μ \ of OptiMEM ^' medium (Gibco BRL Cat # 041-01985H) and 100 μg of LipofectAMINE diluted in 300 μl of medium (final volume of the mixture ≈ 600 μl). These 600 μl are then diluted in 3 ml (final volume) of medium and spread on 5.10 * CRP. The mixture is left in contact with the cells for 5 hours, then eliminated and replaced with 5 ml of culture medium. The cells are then left in culture for 3 to 8 days at + 37 ^° C, and then, when cyropathogène effect appeared, they are frozen at -70 ^° C. After thawing and possibly sonication, the viral population is cloned dilution limit in microplates (96 wells) in order to isolate a homogeneous population of recombinant virus. These plates are left in culture for 1 to 3 days, then the supernatant is collected in an empty 96-well plate and the plate containing the supernatants is placed at 4 ^β C or at -70 ° C. The cells remaining in the other plates are then fixed with 95% acetone for 20 to 30 minutes at -20 ° C., or for 5 minutes at room temperature. An indirect immunofluoresceπce (IFT) reaction is carried out with a monoclonal antibody directed against the expressed polypeptide to search for the ranges expressing this polypeptide. A new cloning is then carried out in the same manner (in dilution limit in 96-well plates) from the supernatant present in the wells of the plates set at 4 ^e C or at -70 "C and corresponding to the wells having positive plaques in IFT In general, 4 successive isolation cycles (limiting dilution, receiving the supernatant, cell control by IFT, limiting dilution from the supernatant, etc.) are sufficient to obtain recombinant viruses whose entire progeny exhibit specific fluorescence. The genomic DNA of these recombinant viruses is characterized at the molecular level by conventional PCR and Southern blot techniques using the appropriate oligonucleotides and DNA probes. The isolation of recombinant virus can also be done by hybridization with a specific probe of the inserted expression cassette. To do this, the viral population harvested after transfection is diluted and deposited on cells. s CRP (grown in Petri dish) so as to obtain isolated areas. After contact for 1 hour at 37 ^β C, the medium of ^infection is removed and replaced with 5 ml of MEM medium containing 1% agarose, maintained molten at 42 ° C. When the agarose is solidified, the dishes are incubated 48 to 72 hours at 37 ^β C in a CO ₂ oven until the appearance of plaques, the agarose layer is then eliminated and a transfer of the viral plaques is carried out on a sterile membrane. nitrocellulose of the same diameter as the Petri dish used for the culture. This membrane is itself transferred to another nitrocellulose membrane so as to obtain an inverted "copy" of the first transfer. The plaques transferred to this last copy are then hybridized, according to the usual techniques known to those skilled in the art, with a DNA fragment of the expression cassette labeled with digoxigenin (DNA Labeling Kit, Boehringer Mannheim, CAT # 1175033). After hybridization, washing and contact with the development substrate, the nitrocellulose membrane is brought into contact with an autoradiographic film. The positive hybridization images on this membrane indicate which plaques contain recombinant ILTV viruses which have inserted the expression cassette. The plaques corresponding to these positive plaques are cut sterile on the first nitrocellulose membrane, placed in an Eppendorf tube containing 0.5 ml of MEM medium and sonicated to release the virions from the membrane. The medium contained in the Eppendorf tube is then diluted in MEM medium and the dilutions thus obtained are used to infect new cultures of CRP cells.

Example 4 Cloning and Characterization of an ELTN Genomic Region

The ADΝ extracted from the ILTN virus was digested with the restriction enzyme Kpn1 for 2 hours at 37 ° C. The restriction enzyme was then removed by extraction with phenol / chloroform, followed by precipitation with ethanol. The fragments resulting from this digestion were then ligated (overnight at 14 ^β C) with the plasmid pBlueScriptlI SK + (pBS SK +; Stratagene) digested with Kpnl and treated with alkaline phosphatase; analysis of the clones obtained after transformation of bacteria E coli DH5α and culture on dishes of medium supplemented with ampicilin made it possible to identify Kpnl-Kpnl inserts of different sizes, including a fragment of approximately 4.2 kb (plasmid pEL112). 15

The complete sequencing of the insert present in pEL112 (see Figure 1) made it possible to highlight two complete open reading frames (COLs) (COL B and COL C), and a large part of two other COLs (COL A and COL D). The restriction map of this cionated and sequenced genomic region is shown in Figure 1; the sequence of 4161 bp (SEQ ID NO: 1) is shown in FIG. 2. The position and the amino acid sequence of COLs A, B, C and D are also shown in FIGS. 1 and 2 respectively.

The sequence between the COL B and C STOP codons (position 908 to 994 on SEQ ID NO: 1) can be used to insert polypeptide expression cassettes into the ILTV genome. This sequence is called the insertion locus. The insertion can be done with or without deletion in the intergenic region (see example 5).

Example 5: Construction of the donor plasmid pEL157 for insertion into the intergenic region between COLs B and C

The plasmid pEL112 (7116 bp), was digested with the enzymes Not1 and Spel to isolate the fragment Notl-Spel of 4.5 kb. The fragment thus digested was then treated with DNA poiymerase (Klenow fragment) in the presence of dNTP to make the ends blunt; after ligament and transformation of the E. coli bacteria, the clone pEL156 (4503 bp) was obtained.

The oligonucleotides EL001 (SEQ ID No: 2) and EL002 (SEQ ID No: 3) served as a primer for a first chain amplification by Taq poymerase (PCR). The oligonucleotides EL003 (SEQ ID No: 4) and EL004 (SEQ ID No: 5) served as a primer for a second chain amplification by Taq poymerase (PCR).

EL001 (SEQ ID No: 2): 5 'TATTσCTTTCTACCσσAAGTCGG 3'

EL002 (SEQ ID No: 3): 5 'ACGCσAATTCAAATACGAGCATTTAATTATTGCG 3'

EL003 (SEQ ID No: 4): 5 'TCTCCAGAATCGCTGGAGTGTCC 3'

EL004 (SEQ IDNσ: 5): 5 'TGCGCGAATCGTAAGCTTTGATATCCAGTCGACA ~ „., _F. ~ _E O 98/27215

16

TAAτTTσGτσ TTATTACTTTTA 3 '

The PCRs were carried out in the presence of PCR buffer, of dNTP, of DNA of the plasmid pEL156, of Taq poymerase, and for the first PCR, of oligonucleotides EL001 and EL002, and for the second PCR, of oligonucleotides EL003 and EL004.

For the two PCRs, 25 cycles were performed (30 seconds at 94 "C; 30 seconds at 60 ° C and 30 seconds at 72 ° C). The products of the two PCRs were purified by phenol / chloroform extraction, followed purification by ethaπol. The product of the first PCR (EL001 / EL002) was then digested with the restriction enzymes Xbal and EcoRI for 2 h at 37 ^β C to give a DNA fragment of Xbal-EcoRl of 120 bp which was eluted after agarose gel electrophoresis The product of the second PCR (EL003 / EL004) was then digested with the restriction enzymes Xhol and £? RI for 2 h at 37 ^β C to give a fragment p7iσI- £ ccRI DNA of 85 bp which was eluted after agarose gel electrophoresis. The plasmid pEL156 was digested with the enzymes Xbal and Xhol. The two fragments of PCR-XEβ1-EcoI (120 bp) and Λ7ιoI -E> RI (85 bp) were ligated overnight at 14 ° C. with the plasmid pEL156 digested with Xbal and Xhol. mation of E. coli bacteria, and culture on boxes of medium supplemented with ampicillin, the clone pEL157 (4531 bp), comprising an EcoRl - Hindlll - EcoRV - Sali polylinker was obtained (see diagram for obtaining pEL157 in FIG. 3 ).

Example 6 Construction of the Donor Plasmid pEL158 for the Insertion of an EBDV VP2 Gene Expression Cassette Under the Control of the HCMV EE Promoter in the Intergenic Site Between COLs B and C, and Isolation of vELTV8:

6.1 - Cloning of the VP2 gene from the Gumboro disease virus (IBDV) and construction of a VP2 expression cassette under the control of the HCMV IE promoter The plasmid pEL004 (see FIG. 4; ≈ plasmid pGH004 described in the patent application French 92.13109) containing the IBDV VP2 gene in the form of a BamHI-HindIII cassette was digested with BamHI and Xbal to isolate the BamHI-Xbal fragment (truncated VP2 gene) of 1104 bp. This fragment was cloned into the vector pBS SK +, previously digested with Xbal and BamHI to give the plasmid pEL022 of 4052 bp (FIG. 4. The vector pBS-SK-f- was digested with £ cσRV and Xbal, then ligated on itself to give pBS-SK * (modified) The plasmid pEL004 was digested with Kpnl and Hindlll to isolate the Kpnl-Hindlll fragment of 1387 bp containing the complete IBDV VP2 gene. This fragment was cloned in the vector pBS-SK *, previously digested with Kpnl and Hindlll, to give plasmid pEL023 of 4292 bp (FIG. 4). Plasmid pEL022 was digested with BamKL and NotI to isolate the BamHI-NotI fragment of 1122 bp (fragment A). Plasmid pEL023 was digested with BamHI and NotI to isolate the fragment BamHI-NotI of 333 bp (fragment B). The fragments A and B were ligated together with the vector pBS-SK +, previously digested with NotI and treated with alkaline phosphatase, to give the plasmid pEL024 of 4369 bp (FIG. 4) Plasmid pEL024 was digested with NotI to isolate the f ragment Notl-Notl of 1445 bp. This fragment was ligated with the plasmid pCMVβ (Clontech Ca 6177-1, FIG. 5), previously digested with Notl, to give the plasmid pEL026 of 5095 bp (FIG. 5).

The plasmid pEL026 was digested with JS σRI, Sali and Xmnl to isolate the EcoKl-SalI fragment of 2428 bp. This fragment was ligated with the vector pBS-SK +, previously digested with ϋcσRI and SalI, to give the plasmid pEL027 of 5379 bp (FIG. 5).

6.1 - Construction of the donor plasmid p ELI 58 The plasmid pEL027 was digested with £ cσRI, S Λ and Xmnl to isolate the £? RI-Sall fragment of 2428 bp. This fragment was ligated into the plasmid pEL157 (see example 5 and FIG. 3), previously digested with £ cσRI and SalI, to give the plasmid pEL158 of 6950 bp (FIG. 6).

6.3 - Isolation and purification of the vILTVS recombinant virus The vILTV8 virus was isolated and purified after cotransfection of the DNA of the plasmid pEL158 previously linearized with the enzyme Kpnl and of the viral DNA, as described in Example 3. This recombinant contains an HCMV-IE / IBDV VP2 cassette in the intergenic site between the COLs B and C of the ILTV virus (see example 5). Example 7: Construction of the donor plasmid pEL159 for the insertion of an expression cassette for the VP2 gene of EBDV under the control of the MCMN EE promoter in the intergenic site between the COLs B and C and isolation of vELTN9:

7.1 • Construction of pEUOJO containing an expression cassette for the IBDV VP2 gene under the control of the immediate early (IE) promoter of MCMV (Mouse CytoMegalo Virus)

The plasmid pCMVβ (Clontech Catf 6177-1, FIG. 7) was digested with Sali and Smal to isolate the Sall-Smal ragment of 3679 bp containing the lacZ gene as well as the poiy-adenylation signal of the late gene of the SV40 virus. This fragment was inserted into the vector pBS-SK +, previously digested with SalI and EcσRV, to give the plasmid pCD002 of 6625 bp (FIG. 7). This plasmid contains the lacZ reporter gene but no promoter is located upstream of this gene.

The MCMI virus Smiui strain was obtained from the American Type Culture Collection, Rockville, Maryland, USA (ATCC Ν "VR-194). This virus was cultured on Balb / C mouse embryo cells and viral AD of this virus was prepared as described by Ebeling A. et al. (J. Virol. 1983. 47. 421-433) This viral genomic DNA was digested with Pstl to isolate the Pstl-Pstl fragment of 2285 bp. fragment was cloned into the vector pBS-SK, previously digested with Pstl and treated with alkaline phosphatase, to give the plasmid pCD004 (FIG. 7). The plasmid pCD004 was digested with Hpal and Pstl to isolate the Hpal-Pstl fragment from 1389 bp which contains the promoter / activator region of the Immediate-Early gene of the murine cytomegalovirus (Murine CytoMegalo Virus ≈ MCMV) (Dorsch-Hâsler K. et al. Proc. Natl. Acad. Sci. 1985. 82. 8325-8329, and request WO-A-87/03905). This fragment was cloned into the plasmid pCD002, previously digested with Pstl and Smal, p or give the plasmid pCD009 of 8007 bp (Figure 7).

A double-stranded oligonucleotide was obtained by hybridization of the following two oligonucleotides:

MB070 (SEQ ID NO: 6)

5 'CG AATTCACTAGτGTGTGTCTGCAGGCGGCCσCGTGTGτσTCσ ACGGTAC 3 '

MB071 (SEQ ID NO: 7)

5 'CGTCGACACACACGCGGCCGCCTGCAGAC ACAC ACTAGTGAATTCG AGCT 3' This double-stranded oligonucleotide was ligated with the vector pBS-SK-H, previously digested with Kpn1 and Sac1, to give the plasmid pEL067 (Figure 8). Plasmid pCD009 was digested with Pstl and Spel to isolate the Pstl-Spel fragment of 1396 bp. This fragment was ligated with the plasmid pEL067, previously digested with Pstl and Spel, to give the plasmid pEL068 of 4297 bp (FIG. 8). The plasmid pEL024 (see example 6, paragraph 6.1 and FIG. 5) was digested with HindIII and NotI to isolate the HindIII-NotI fragment of 1390 bp (fragment A). The plasmid pEL027 (see example 6, paragraph 6.1 and FIG. 5) was digested with HindIII and SalI to isolate the HindIII-SalI fragment of 235 bp (fragment B). Fragments A and B were ligated together with the plasmid pEL068, previously digested with NotI and SalI, to give the plasmid pEL070 of 5908 bp (FIG. 8). This plasmid therefore contains a casseπe expression consisting of the IE promoter of MCMV, the VP2 gene and the polyA signal of SV40.

7.2 - Construction of the donor plasmid pEL1 59

The plasmid pEL070 was digested with JE oRI, Sali and Xmnl to isolate the EcoTU.- Sali fragment of 3035 bp. This fragment was ligated into the plasmid pEL157 (see example 5 and FIG. 3), previously digested with EcoRL and SalI, to give the plasmid pEL159 of 7545 bp (FIG. 9). This plasmid allows the insertion of the MCMV-IE / IBDV-VP2 expression cassette into the intergenic site between the COLs B and C of the ILTV virus.

7.3 - Isolation and purification of the recombinant virus vILTV9 The vILTN9 virus was isolated and purified after cotransfection of the ADΝ of the plasmid pEL159 previously linearized with the enzyme BgR and the viral DNA, as described in Example 3. This recombinant contains an MCMV-IE / IBDV VP2 cassette in the intergenic site between the COLs B and C of the ILTN virus (see example 5). Example 8: Construction of the donor plasmid pEL160 for the insertion of an expression cassette for the NDV HN gene into the intergenic site between COLs B and C and isolation of vELTN10:

8.1 - Cloning of the HN gene of the Newcastle disease virus (NDV) The constitution of a DNA library complementary to the genome of the Newcastle disease virus (NDV), Texas strain, was carried out as described by Taylor J . et al. (J. Virol. 1990. 64. 1441-1450). A pBR322 clone containing the end of the fusion (F) gene, the entire hemagglutinin- neuraminida.se (HN) gene and the start of the poiymerase gene was identified pHNOl. The sequence of the NDV HN gene contained in this clone is presented in FIG. 10 (SEQ ID NO: 8). The plasmid pHNOl was digested with Sphl and Xbal to isolate the Sphl-Xbal fragment of 2520 bp. This fragment was ligated with the vector pUC19, previously digested with Sphl and Xbal, to give the plasmid pHN02 of 5192 bp. The plasmid pHN02 was digested with ClaI and Pstl to isolate the Clάl-Pstl fragment of 700 bp (fragment A). A PCR was carried out with the following oligonucleotides:

EL071 (SEQ ID NO: 9) 5 'CAGACCAAGCTTCTTAAATCCC 3'

EL073 (SEQ ID NO: 10) 5 'GTATTCGGGACAATGC 3' and the pHN02 matrix to produce a PCR fragment of 270 bp. This fragment was digested with HindIII and Pst1 to isolate a HindIII-Pst1 fragment of 220 bp (fragment B). Fragments A and B were ligated together with the vector pBS-SK- previously digested with ClaI and HindIII, to give the plasmid pEL028 of 3872 bp (FIG. 11). The plasmid pHN02 was digested with Bsphl and ClaI to isolate the Bsp l-ClaI fragment of 425 bp (fragment C). A PCR was carried out with the following oligonucleotides: EL074 (SEQ ID NO: 11) 5 'GTGACATCACTAGCGTCATCC 3' EL075 (SEQ ID NO: 12)

5 'CCGCATCATCAGCGGCCGCGATCGGTCATGGACAGT 3' and the pHN02 matrix to produce a PCR fragment of 465 bp. This fragment was digested with Bsphl and Notl to isolate the Bsphl-Notl fragment of 390 bp (fragment D). Fragments C and D were ligated together with the vector pBS-SK +, previously digested with ClaI and NotI, to give the plasmid pEL029bis of 3727 bp (FIG. 11). The plasmid pEL028 was digested with ClaI and SacIl to isolate the ClaI-SacII fragment of 960 bp (fragment E). The plasmid pEL029bis was digested with ClaI and NotI to isolate the ClaI-NotI fragment of 820 bp (fragment F). Fragments E and F were ligated together with the vector pBS-SK-, previously digested with NotI and Sacll, to give the plasmid pEL030 of 4745 bp (FIG. 11).

8.2 - Construction of the plasmid pEL160 containing an NDV HN expression cassette in the intergenic site between COLs B and C The plasmid pEL030 was digested with NotI to isolate the NotI-NotI fragment of 1780 bp (whole NDV HN gene) . This fragment was inserted into the NotI sites of the plasmid pEL159 (Example 7, FIG. 9) in place of the NotI-NotI fragment of 1405 bp containing the gene coding for the protein VP2 of IBDV; this cloning made it possible to isolate the plasmid pEL160 of 7921 bp (FIG. 12). This plasmid allows the insertion of the MCMV-IE / NDV-HN expression cassette into the intergenic site between the COLs B and C of the ILTN virus.

8.3 • Isolation and purification of the recombinant virus vILTVIO

The vILTVIO virus was isolated and purified after cotransfection of the ADΝ of the plasmid pEL160 previously linearized with the enzyme BgH and of the AD virai, as described in Example 3. This recombinant contains an MCMV-IE / ΝDV HΝ cassette in the intergenic site between COLs B and C of the ILTV virus (see example 5).

Example 9: Construction of the donor plasmid pEL161 for the insertion of an expression cassette for the ΝDV F gene into the intergenic site between COLs B and C and isolation of ylLTVll:

9.1 - Cloning of the Newcastle disease virus (NDV) F gene A clone originating from the DNA bank complementary to the genome of the Newcastle disease virus (see example 8, paragraph 8.1) and containing the fusion gene (F ) in its entirety was called pNDV81. This plasmid has been described previously and the sequence of the NDV F gene present on this clone has been published (Taylor J. et al. J. Virol., 1990, 64, 1441-1450). The plasmid pNDV81 was digested with Narl and Pstl to isolate the Narl-Pstl fragment of 1870 bp (fragment A). A PCR was carried out with the following oligonucleotides:

EL076 (SEQ ID N ° 13) 5 'TGACCCTGTCTGGGATGA 3' EL077 (SEQ ID N "14)

5 'GGATCCCGGTCGACACATTGCGGCCGCAAGATGGGC 3' and the matrix pNDVδl to produce a 160 bp fragment. This fragment was digested with Pstl and SalI to isolate the Pstl-SalI fragment of 130 bp (fragment B). Fragments A and B were ligated together with the vector pBS-SK +, previously digested with ClaI and SalI, to give the plasmid pEL033 of 4846 bp (FIG. 13).

9.2 - Construction of the plasmid pEL161 containing an expression cassette for the NDV F gene in the intergenic site between COLs B and C

Plasmid pEL033 was digested with NotI to isolate the 1935 bp NotI-NotI fragment (whole F gene). This fragment was inserted into the NotI sites of the plasmid pEL159 (Example 7, FIG. 9) in place of the NotI-NotI fragment of 1405 bp containing the gene coding for the protein VP2 of ITBDV; this cloning made it possible to isolate the plasmid pEL161 from 8074 bp (FIG. 14). This plasmid allows the insertion of the MCMV-IE / NDV-F expression cassette into the intergenic site between the COLs B and C of the ILTN virus.

9.3 - Isolation and purification of the recombinant virus vILTVll The vILT ll virus was isolated and purified after cotransfection of the ADΝ of the plasmid pEL161 previously linearized with the enzyme BgΛ and of the viral ADΝ, as described in Example 3. This recombinant contains an MCMV-IE / ΝDV F cassette in the intergenic site between the COLs B and C of the ILTV virus (see example 5).

Example 10: Construction of a donor plasmid for the insertion of a double cassette for expression of the HΝ and F genes of ΝDV in the intergenic site between the COLs B and C and isolation of a recombinant ELTN virus:

A double expression cassette for two genes, for example the HΝ and F genes of the ΝDV virus, can be constructed. Such a construction is shown schematically in Figure 15. In this construction, the 5 ′ end of the two promoters are adjacent so that the transcription of the two genes takes place in opposite directions. One of the two promoters is the MCMV IE promoter and the other promoter (called associated promoter) is the SV40 promoter (present in the plasmid pSVbeta, Clontech Laboratories, Palo Alto, California 94303-4607, USA). In this configuration, the associated promoter is activated by the activating region of the CMV IE promoter.

This double expression cassette can then be inserted into the donor plasmid described above (pEL157 described in Example 5 and represented in FIG. 3). The isolation of the recombinant viruses is done in the same way as above (see example 3).

Example 11: Construction of the donor plasmid pEL163 for the insertion of an MDV gB gene expression cassette into the intergenic site between COLs B and C and isolation of vILTV12:

11.1 • Cloning of the Marek disease virus gB gene The 3.9 kbp EcoRI-Scui fragment of the genomic DNA of the MDV virus strain RB1B containing the MDV gB gene (sequence published by Ross N. et al. J. Gen. Virol. 1989. 70, 1789-1804) was ligated with the vector pUC13, previously digested with RI and SalI, to give the plasmid pCD007 of 6543 bp (FIG. 16). This plasmid was digested with SacI and Xbal to isolate the SacI-Xbal fragment of 2260 bp (central part of the gB gene ≈ fragment A). A PCR was carried out with the following oligonucleotides: CD001 (SEQ ID O: 15)

5 'GACΓGGTACCGCGGCCGCATGCACΠTΠΆGGCGGAATTG y

CD002 (SEQ ID NO: 16) 5 'TτCGGGACATTTTCGCGG 3' and the matrix pCD007 to produce a PCR fragment of 222 bp. This fragment was digested with Kpnl and Xbal to isolate a Kpnl-Xbal fragment of 190 bp (5 'end of the gB gene = fragment B). Another PCR was carried out with the following oligonucleotides:

CD003 (SEQ ID NO: 17) 5 'TATATGGCGTTAGTCTCC 3'

CD004 (SEQ ID NO: 18)

5 'TTσcσAGCTCGCGGCCGCTTATTACACAGCATCATCTTCτG 3' and the matrix pCD007 to produce a PCR fragment of 195 bp. This fragment was digested with Sacl and Sacll to isolate the Sacl-Sacll fragment of 162 bp (3 'end of the gene gB ≈ fragment C). Fragments A, B and C were ligated together with the vector pBS-SK +, previously digested with Kpnl and Sacl. to give the plasmid pCDOi l of 5485 bp (FIG. 16).

11.2 • Construction of the plasmid pEÎΛ 63 containing an expression cassette for the MDV gB gene in the intergenic site between the COLs B and C of the ILTV virus The plasmid pCDOil was digested with NotI to isolate the NotI-NotI fragment of 2608 bp ( whole MDV gB gene). This fragment was inserted into the NotI sites of piasmide pEL159 (Example 7, FIG. 9) in place of the NotI-NotI fragment of 1405 bp containing the gene coding for the protein VP2 of EBDV; this cloning made it possible to isolate the plasmid pEL163 from 8749 bp (FIG. 17). This plasmid allows the insertion of the MCMV-IE / MDV-gB expression cassette into the intergenic site between the COLs B and C of the ILTN virus.

11.3 - Isolation and purification of the vILTV11 recombinant virus The vILTV12 virus was isolated and purified after cotransfection of the ADΝ of the plasmid pELlόl previously linearized with the enzyme BgH and of the viral ADΝ, as described in Example 3. This recombinant contains an MCMV-IE / MDV gB cassette in the intergenic site between the COLs B and C of the ILTV virus (see example 5).

Example 12 Construction of a Donor Plasmid for the Insertion of an EBV Gene Expression Cassette into the Intergenic Site Between COLs B and C and Isolation of Recombinant ILTV Virus:

According to the same strategy as that described above for the insertion of simple cassenes (examples 6, 7, 8, 9 and 11) or for the insertion of double cassettes (example 10), in the site described above (example 5), it is possible to make recombinant ILTV viruses expressing at a high level the Membrane (M) or Spike (S) proteins, or part of Spike (SI or S2), or Nucleocapsid (N) of the infectious bronchitis virus avian (IBV). A double expression cassette is produced in particular with the S gene under the control of the CMV IET promoter and the M gene under the control of the associated promoter. 215

25

Example 13 Construction of Donor Plasmids for Insertion of Cassette Expression of Gene (s) of Other Avian Pathogens or Immunomodulatory Peptide into the Site Described and Isolation of Recombinant ELTV Viruses: According to the Same Strategy as That described above for the insertion of single cassettes (examples 6, 7, 8, 9 and 11) for the insertion of double cassettes (example 10), in the site described above (example 5), it is possible to make recombinant ILTV viruses expressing at a high level CAV immunogens (and in particular a double expression cassette for genes coding for VP1 and for VP2), chicken pneumovirus virus, or other avian pathogens, or still immunomodulatory peptides and in particular cytokines.

Example 1: Production of vaccines:

The recombinant viruses obtained according to the invention are produced on embryonated eggs.

The harvested viral solution is then diluted in a stabilizing solution for lyophilization, distributed at the rate of 1000 vaccine doses per vial, and finally lyophilized.

Claims

1 - Live recombinant avian vaccine comprising, as vector, an ILTN virus comprising and expressing at least one heterologous nucleotide sequence, this nucleotide sequence being inserted into the insertion locus formed by the intergene located between the stop codons of COL B and COL C of ILTV and which, in a particular ILTN strain, is defined between nucleotides 908 and 994 at SEQ ID ΝO: l.

2 - Recombinant live vaccine according to claim 1, characterized in that the nucleotide sequence or sequences are inserted by simple insertion, or after total or partial deletion of the insertion locus.

3 - Recombinant live vaccine according to any one of claims 1 to 2, characterized in that, to express the inserted nucleotide sequence, the vector comprises a strong eukaryotic promoter.

4 - Recombinant live vaccine according to claim 3, characterized in that the strong promoter is chosen from the group consisting of: immediate-early CMV promoter, preferably murine or human immediate-early CMV promoter, LTR promoter of the Sarcoma virus Rous (RSV), early promoter of the SV40 virus.

5 - Recombinant live vaccine according to any one of claims 1 to 4, characterized in that it comprises at least two nucleotide sequences inserted into the insertion locus under the control of different eukaryotic promoters.

6 - Recombinant live vaccine according to claim 5, characterized in that the eukaryotic promoters are immediate-early CMV promoters of different animal origins.

7 - A live recombinant vaccine according to claim 5, characterized in ^that it comprises a first nucleotide sequence associated with the CMV immediate promoter early and another promoter under the control of which is another nucleotide sequence, these two promoters being arranged so that their 5 'ends are adjacent.

8 - Recombinant live vaccine according to any one of claims 1 to 7, characterized in that it comprises, inserted into the insertion locus, an expression cassette successively comprising a promoter, two or more genes separated in pairs by an IRES, and a polyadenylation signal.

9 - Recombinant live vaccine according to any one of claims 1 to 8, characterized in that it comprises a nucleotide sequence coding for an antigenic polypeptide of an avian pathogenic agent, this sequence being inserted into the insertion locus.

10 - Recombinant live vaccine according to claim 9, characterized in that it comprises a sequence coding for an antigen of an avian pathogenic agent chosen from the group consisting of Newcastle disease virus (NDV), the virus of Gumboro disease (IBDV), Marek's disease virus (MDV), infectious bronchitis virus (EBV), chicken anemia virus (CAV), chicken pneumovirus virus

11 - Recombinant live vaccine according to claim 10, characterized in that it comprises a nucleotide sequence, chosen from the nucleotide sequences coding for the F and HN polypeptides of the NDV virus.

12 • Recombinant live vaccine according to claim 10, characterized in that it comprises a nucleotide sequence, chosen from the nucleotide sequences coding for the gB, gC, gD, gH + gL polypeptides of the MDV virus.

13 - A live recombinant vaccine according to claim 10, characterized in that ^it comprises at least one nucleotide sequence selected from the sequences of the group corresponding to the IBDV VP2 antigens, to the S antigens, or part of S, M and N of the IBV virus, to the VP1 and VP2 antigens of the CAV, to the G and F antigens of the chicken pneumovirus virus.

14 - Recombinant live vaccine according to any one of claims 1 to 13, characterized in that it comprises a nucleotide sequence coding for an immunomodulatory polypeptide, this sequence being inserted into the insertion locus.

15 - Live recombinant vaccine according to claim 14, characterized in that this nucleotide sequence is chosen from the group of sequences coding for cytokines.

16 - Multivalent vaccine formula comprising, as a mixture or as a mixture, at least two recombinant live vaccines as defined in any one of claims 1 to 15, these vaccines comprising different inserted sequences.

17 - An ELTV virus comprising at least one heterologous nucleotide sequence inserted into the insertion locus formed by the intergene located between the stop codons of COL B and COL C of ILTV and which, in a particular ILTV strain, is defined between nucleotides 908 and 994 at SEQ ID NO: 1.