EP0946740A1

EP0946740A1 - Novel constructs and vectors for the targeted and inducible expression of genes

Info

Publication number: EP0946740A1
Application number: EP97913264A
Authority: EP
Inventors: Abderrahim Mahfoudi; Patrick Benoit; Didier Branellec; Patrice Denefle; Nicolas Duverger; Laurence Berthou; Johan Auwerx; Bart Staels
Original assignee: Rhone Poulenc Rorer SA
Current assignee: Aventis Pharma SA
Priority date: 1996-11-08
Filing date: 1997-11-06
Publication date: 1999-10-06
Also published as: FR2755699A1; NO992153D0; CZ163399A3; HUP9904235A2; WO1998021349A1; SK61499A3; IL129593A0; US20020144302A1; ZA9710114B; NO992153L; KR20000053163A; BR9713981A; AU5057898A; JP2001503279A; FR2755699B1; HUP9904235A3; CA2269864A1

Abstract

The invention concerns novel constructs and novel vectors for the targeted and inducible expression of genes. It describes in particular novel hybrid promoters and their use for the expression of genes in hepatic cells, in vitro, ex vivo or in vivo.

Description

NEW CONSTRUCTIONS AND VECTORS FOR TARGETED AND INDUCTIBLE GENE EXPRESSION

The present invention relates to the field of biology, and in particular to the field of regulation of gene expression. It describes in particular new constructions and new vectors allowing a targeted and inducible expression of genes. The present invention can be used in many fields, and in particular for the production of recombinant proteins, for the creation of transgenic animal models, for the creation of cell lines, for the development of screening tests, or even in gene therapy. and cellular.

The ability to control and direct gene expression is a very important issue in the development of biotechnology. In vitro, it improves the conditions for the production of recombinant proteins, for example by decoupling the cell growth phase and the production phase. Still in vitro, it also makes it possible to create cell lines capable of producing certain molecules at selected times. Thus, it is conceivable to construct cell lines producing, in a regulated manner, proteins transcomplementing defective viral genomes. Still in vitro, a regulated expression system allows the development of screening tests for molecules acting on the control of gene expression. The control of gene expression is also very important for ex vivo or in vivo therapeutic approaches, in which the possibility of selectively controlling the production of a therapeutic molecule is essential. In fact, depending on the applications, depending on the gene to be transferred, it is important to be able to target certain tissues or only certain parts of an organism in order to concentrate the therapeutic effect and limit dissemination and side effects.

This targeting can be carried out using vectors having a specific cell specificity. Another approach is to use expression signals specific for certain cell types. In this regard, so-called specific promoters have been described in the literature, such as the promoter of the genes coding for pyruvate kinase, villin, GFAP, the promoter of the intestinal fatty acid binding protein, the promoter α-actin from smooth muscle cells, or the promoter of the human albumin gene for example. However, if these promoters have a certain tissue specificity, they are not regulable and therefore offer limited possibilities of control. Other, more complex systems have been described in the literature. Thus, application WO96 / 01313 describes a gene expression system regulated by tetracyc ne. Likewise, Wang et al. (PNAS 91 (1994) 8180) described a gene expression system regulated by RU486. Evans et al have described a system based on the receptor to the insect hormone ecdysone (PNAS 93 (1996) 3346). However, these different systems, although inducible, do not have any tissue specificity. in fact, they do not by themselves make it possible to target expression at the level of desired organs or tissues, but simply to induce or repress expression in a ubiquitous manner In addition, the tetracycline system has a relatively level of regulation weak, less than a factor of five. Furthermore, these systems work with hybrid molecules and require the cotransfection of at least 2 constructs. In addition, they use heterologous elements and therefore risk generating immune reactions.

The invention now describes new constructs allowing targeted and regulated expression of genes The invention describes in particular recombinant vectors allowing expression of inducible and hepatospecific genes The invention also describes new promoter constructs having improved regulatory levels La The present invention thus provides a particularly efficient means for targeting the expression of genes in hepatic cells, in vivo or in vitro, and for regulating this expression.

The present application is based in particular on the use of the promoter of the human gene for apolipoprotein Ail Apolipoprotein Ail (apoAII) is one of the major protein constituents of high density lipoproteins (HDL) ApoAII is mainly synthesized in the liver, although contradictory results suggest a synthesis also in the intestine The human apoAII gene has been cloned and sequenced (Tsao et al, J Biol Chem 260 (1985) 15222) The promoter region extends sure approximately 1 kb upstream of the transcription initiation codon. It includes regulatory elements located at the nucleotide -903 to -680 level, as well as additional multiple sites located at the intermediate (nucleotide -573 to -255) and proximal (-126 to -33) region. Optimal expression is obtained when nuclear factors are linked to the proximal and distal regulatory elements of the promoter.

The sequence of the promoter of the human apoAII gene, from residue - 911 to +29 is shown in the sequence SEQ ID No. 1.

Conflicting apoAII promoter regulatory mechanisms have been observed in humans and rodents In one case, stimulation by fibrates has been observed, in the other, inhibition Fibrates, often used as hypolipidemic agents, belong to the chemical family of peroxisome proliferators, insofar as they induce hepatomegaly linked to the proliferation of peroxisomes in rodents Their action is mediated by activated receptors (PPAR "Peroxisome Proliferator Activated Receptor"), a group of 4 nuclear receptors distinct (α, β, γ, δ). PPARs belong to the nuclear hormone receptor superfamily which binds to specific response elements called PPRE ("Peroxisome Proliferator Response Element") PPREs have been identified in many genes coding for enzymes involved in the β-oxidation pathway , which have been shown to be inducible by fibrates

The applicant has now developed a system of expression of hepatospecific genes inducible by fibrates, usable in vitro and in vivo. More particularly, the applicant has constructed for the first time a vector having a tropism for the liver allowing expression of genes selectively in the liver or liver cells, and inducibly by fibrates The Applicant has also constructed new promoters derived from the promoter of the human apoAII gene, having improved inducibility and strength properties

A first object of the invention resides in a recombinant vector for the inducible and hepatospecific expression of a characterized molecule in that it comprises, an expression cassette consisting of a nucleic acid encoding said molecule placed under the control of the promoter of the gene for human apolipoprotein Ail.

According to a particularly preferred variant, the recombinant vector is a viral vector derived from adenoviruses, comprising, inserted into its genome, said expression cassette.

In a particularly remarkable manner, the Applicant has indeed shown that such an adenovirus makes it possible to express a gene specifically in the liver, that this expression was highly inducible in vivo by fibrates, and that the levels of expression obtained were comparable to those described previously with the strongest constitutive promoters.

The hepatospecific nature of the viruses of the invention means that these viruses allow the expression of a gene very selectively in hepatic cells, in vitro, ex vivo or in vivo. Low non-specific expression in other tissues or cell types can be tolerated, as long as a majority expression is observed in liver cells (preferably more than 80% of cells expressing the transgene are liver cells. more preferably, more than 90%) In particular, contrary to the contradictory indications noted in the prior art, the virus according to the invention does not induce any detectable expression in the intestine and therefore offers a particularly high selectivity. This is very important for toxic gene transfer and expression approaches, for which a very high level of selectivity is necessary. Furthermore, as indicated previously, the inducible systems described in the prior art have a medium inducibility, a factor of about five. The results presented in the examples demonstrate that the adenovirus of the invention is inducible by a factor of about ten. The level of inducibility is also very important for obtaining control over the quantity of molecules delivered in vivo. This is particularly sensitive in the case of immunogenic molecules or molecules capable of generating inflammatory responses. This is also particularly interesting for the expression of molecules whose biological efficiency involves high concentrations. On the other hand, another characteristic The particularly remarkable vector of the invention resides in the high levels of expression obtained. In fact, inducible systems generally have, on the other hand, medium or even low levels of expression. Surprisingly and advantageously, the applicant has shown that the system of the invention makes it possible to obtain expression levels in vivo comparable to those described for the strongest constitutive promoters. The system of the invention therefore combines for the first time remarkable properties of selectivity, inducibility, and strength. One of the aspects of the invention therefore resides in the use of the promoter of the human apoAII gene. Another aspect of the invention lies in the construction of vectors derived from adenoviruses. The vectors according to the invention combine remarkable properties of gene transfer, safety, tissue specificity, inducibility and strength. Advantageously, the promoter used in the viruses of the invention comprises the regulatory elements of the promoter of the apoAII gene. More particularly, these elements are located at the level of nucleotides -903 to -680; -573 to -255; and -126 to -33 of the human apoAII gene. In this regard, according to a particular variant, the promoter comprises the residues -91 1 to +29 of the apoAII gene (sequence SEQ ID π ° 1).

It is understood that shorter or longer forms of the promoter can be used. Thus, on the 3 ′ side, it is important that the promoter understands the site of initiation of the transcription of the apoAII gene (numbered +1 on SEQ ID No. 1). On the other hand, it is preferable that this promoter does not contain the first intron of the apoAII gene, which begins at nucleotide +38. Thus, advantageously, the fragment used has a 3 ′ end comprised between the residues +5 and +35, more preferably +10 and +30 of the apoAII gene. With regard to the 5 'end, it is preferable, in order to obtain high levels of expression in the liver, to retain at least part of the hepatic factor binding site. This site is located at nucleotides -903 to -680. Therefore, advantageously, the fragment used has a 5 ′ end located upstream of the nucleotide -903. This end can be located for example in the region -950 to -910. Furthermore, for reasons of capacity cloning, it is advantageous to use a promoter region of reduced size. Therefore, it is preferred to use a fragment whose 5 'end is located in the region -925 to -910.

According to an advantageous variant of the invention, the promoter comprises the regulatory elements located at the nucleotides -903 to -680 (or - 903 to -720) and -126 to -33, but not the intermediate elements located at the nucleotides -573 to -255. In particular, the promoter used advantageously comprises a deletion in the region between the residues -710 and -150. As a specific example, the promoter can advantageously consist of a variant of the sequence SEQ ID No. 1 obtained by deletion of residues 708-210. Even more preferably, the promoter used comprises a deletion in the region between the residues -670 and -210. As a specific example, the promoter can advantageously consist of a variant of the sequence SEQ ID No. 1 obtained by deletion of the residues; 653-210.

The results presented in the examples indeed show that this type of construction has a high strength and an inducibility by fibrates greater than the native promoter of apoAII, in an adenoviral context. These constructions are therefore advantageous in terms of regulatory properties, as in terms of the cloning capacity of the vector, since the promoter region is reduced

According to another embodiment, the adenoviruses according to the invention comprise as promoter a variant of the promoter of the apolipoprotein Ail gene comprising a repetition of J motifs. Multiplication of the J region advantageously also makes it possible to increase the character inducible by promoter fibrates. Region J consists of the sequence TCAACCTTTACCCTGGTAG (SEQ ID No. 2, underlined on SEQ ID No. 1) It is localized in the Ail promoter at the level of nucleotides -734 to -716 of the promoter. The Applicant has now constructed recombinant viruses comprising promoters modified at the level of the J region. These viruses have particularly advantageous properties for the transfer and expression of genes, in vitro and in vivo. Preferably, the promoter comprises from 2 to 5 J units. Even more preferably, it comprises 3 J units. For the construction of these variants, the repetition of J units can be positioned 5 ′ of the promoter, 3 ′ of the promoter, or inserted into the promoter sequence, preferably at the level of the native J sequence. Furthermore, the multiplication of patterns J can advantageously be combined with a deletion as described above. This makes it possible to obtain a promoter having properties which are further improved in terms of power and of gene expression control.

These different constructions can be produced according to molecular biology techniques known to those skilled in the art. Thus, starting from the sequence SEQ ID No. 1, a person skilled in the art can carry out different deletions by selecting appropriate restriction enzymes. Deletions can also be carried out by site-directed mutagenesis or by PCR. On the other hand, the J regions can be synthesized artificially using nucleotide synthesizers, then inserted into or fused to the promoter by PCR or by cleavage and ligation using appropriate enzymes. These different approaches are illustrated in the examples.

As indicated above, the remarkable capacities of the vectors of the invention derive from the promoter used, as from the choice of the vector. The demonstration of the functionality of the promoters in an adenoviral context in vivo has indeed made it possible to produce these very vectors. efficient.

Adenoviruses are linear double-stranded DNA viruses around 36 (kilobases) kb in size. There are different serotypes, the structure and properties of which vary somewhat, but which have a comparable genetic organization. More particularly, the recombinant adenoviruses can be of human or animal origin. As regards adenoviruses of human origin, mention may preferably be made of those classified in group C, in particular adenoviruses of type 2 (Ad2), 5 (Ad5), 7 (Ad7) or 12 (Ad12). Among the various adenoviruses of animal origin, mention may preferably be made of adenoviruses of canine origin, and in particular all the strains of the adenovirus CAV2 [Manhattan strain or A26 / 61 (ATCC VR-800) for example]. Other adenoviruses of animal origin are cited in particular in application WO94 / 26914 incorporated herein by reference.

The adenovirus genome includes in particular a repeated inverted sequence (ITR) at each end, an encapsidation sequence (Psi), early genes and late genes. The main early genes are contained in the E1, E2, E3 and E4 regions. Among these, the genes contained in the E1 region in particular are necessary for viral propagation. The main late genes are contained in regions L1 to L5. The genome of the Ad5 adenovirus has been fully sequenced and is accessible on the database (see in particular Genebank M73260). Likewise, parts or even all of other adenoviral genomes (Ad2, Ad7, Ad12, etc.) have also been sequenced.

For their use as recombinant vectors, various constructs derived from adenoviruses have been prepared, incorporating different therapeutic genes. In each of these constructions, the adenovirus was modified so as to render it incapable of replication in the infected cell. Thus, the constructions described in the prior art are deleted adenoviruses from the E1 region, essential for viral replication, at the level of which heterologous DNA sequences are inserted (Levrero et al., Gene 101 (1991) 195; Gosh-Choudhury et al., Gene 50 (1986) 161). Furthermore, to improve the properties of the vector, it has been proposed to create other deletions or modifications in the genome of the adenovirus. Thus, a thermosensitive point mutation was introduced into the mutant ts125, making it possible to inactivate the DNA binding protein of 72kDa (DBP) (Van der Vliet et al., 1975). Other vectors include a deletion of another region essential for viral replication and / or spread, the E4 region. The E4 region is in fact involved in the regulation of the expression of late genes, in the stability of late nuclear RNA, in the extinction of the expression of proteins of the host cell and in the efficiency of replication of l 'Viral DNA. Adenoviral vectors in which the E1 and E4 regions are deleted therefore have very reduced transcription background and expression of viral genes. Such vectors have been described by example in the applications WO94 / 28152, WO95 / 02697, WO96 / 22378). In addition, vectors carrying a modification in the IVa2 gene have also been described (WO96 / 10088).

In a preferred embodiment of the invention, the recombinant adenovirus is a human adenovirus of group C. More preferably, it is an adenovirus Ad2 or Ad5.

Advantageously, the recombinant adenovirus used in the context of the invention comprises a deletion in the E1 region of its genome. Even more particularly, it comprises a deletion of the regions E1 a and E1 b. As a specific example, mention may be made of deletions affecting the nucleotides

454-3328; 382-3446 or 357-4020 (with reference to the Adδ genome).

According to a preferred variant, the recombinant adenovirus used in the context of the invention further comprises a deletion in the E4 region of its genome. More particularly, the deletion in the E4 region affects all of the open phases. As a specific example, the deletions 33466-35535 or 33093-35535 can be cited. Other types of deletions in the E4 region are described in applications WO95 / 02697 and WO96 / 22378, incorporated herein by reference.

The expression cassette can be inserted at different sites of the recombinant genome. It can be inserted at the E1, E3 or E4 region, replacing the deleted or surplus sequences. It can also be inserted at any other site, apart from the sequences necessary in cis for the production of viruses (ITR sequences and packaging sequence).

Recombinant adenoviruses are produced in an packaging line, that is to say a cell line capable of complementing in trans one or more of the deficient functions in the recombinant adenoviral genome. One of these lines is for example the line 293 in which a part of the adenovirus genome has been integrated. More specifically, line 293 is a cell line human embryonic kidney containing the left end (approximately 11 -12%) of the genome of the adenovirus serotype 5 (Ad5), comprising the left ITR, the encapsidation region, the E1 region, including E1 a and E1 b , the region coding for the protein pIX and part of the region coding for the protein plVa2. This line is capable of trans-complementing recombinant adenoviruses defective for the E1 region, that is to say devoid of all or part of the E1 region, and of producing viral stocks having high titers. This line is also capable of producing, at permissive temperature (32 ° C.), stocks of virus further comprising the thermosensitive E2 mutation. Other cell lines capable of complementing the E1 region have been described, based in particular on human lung carcinoma cells A549 (WO94 / 28152) or on human retinoblasts (Hum. Gen. Ther. (1996) 215). Furthermore, lines capable of transcomplementing several functions of the adenovirus have also been described. In particular, there may be mentioned lines complementing the E1 and E4 regions (Yeh et al., J. Viral. 70 (1996) 559, Cancer Gen. Ther. 2 (1995) 322, Krougliak et al., Hum. Gen. Ther. 6 (1995) 1575) and lines complementing the E1 and E2 regions (WO94 / 28152, WO95 / 02697, WO95 / 27071).

Recombinant adenoviruses are usually produced by the introduction of viral DNA into the packaging line, followed by lysis of the cells after approximately 2 or 3 days (the kinetics of the adenoviral cycle being 24 to 36 hours). For the implementation of the method, the viral DNA introduced may be the complete recombinant viral genome, optionally constructed in a bacterium (WO96 / 25506) or in a yeast (WO95 / 03400), transfected in the cells. It can also be a recombinant virus used to infect the packaging line. The viral DNA can also be introduced in the form of fragments each carrying a part of the recombinant viral genome and a zone of homology making it possible, after introduction into the packaging cell, to reconstitute the recombinant viral genome by homologous recombination between the different fragments . After the lysis of the cells, the recombinant viral particles are isolated by centrifugation in a cesium chloride gradient. An alternative method has been described in application FR96: 08164 incorporated herein by reference.

The recombinant vector having a tropism for the liver can also be constructed from a non-viral vector of the plasmid type, in particular as described in applications WO96 / 26270 and PCT / FR96 / 01414.

As indicated above, the vectors of the invention allow the regulated, high-level and hepatospecific production of molecules of interest. The molecule of interest is advantageously a therapeutic molecule. It can be a protein or a nucleic acid (tRNA,

Antisense RNA, etc.).

In a particularly preferred manner, the therapeutic molecule is a protein secreted into the circulation. By way of example, mention may be made of enzymes, blood derivatives, hormones, interleukin lymphokines, interferons, TNF, etc. (FR 9203120), growth factors, neurotransmitters or their synthetic precursors or enzymes, trophic factors : BDNF, CNTF, NGF, IGF, GMF, aFGF, bFGF, NT3, NT5, etc; apolipoproteins: ApoAl, ApoAIV, ApoE, etc. (WO94 / 25073), dystrophin or a minidystrophin (WO93 / 06223), tumor suppressor genes: p53, Rb, Rapl A, DCC, k-rev, etc. (W094 / 24297), the genes coding for factors involved in coagulation: Factors VII, VIII,

IX, etc, or even all or part of a natural or artificial immunoglobulin (Fab, ScFv, etc, WO94 / 29446).

To ensure the secretion of the protein, the expression cassette advantageously comprises an appropriate signal sequence. It may in particular be the natural signal sequence of the secreted protein, if it is functional in a hepatic cell. It can also be any suitable heterologous sequence. By way of example, mention may be made of the signal sequence of apolipoprotein A1. In addition, the cassette generally comprises a region situated at 3 ′ which specifies a signal for termination of transcription and for polyadenylation. We use for example the polyA site of SV40 virus. It is understood that the choice of these signals falls within the general competence of a person skilled in the art.

The invention also relates to a pharmaceutical composition comprising a vector as described above. The pharmaceutical compositions of the invention can be formulated for topical, oral, parenteral, intranasal, intravenous, intramuscular, subcutaneous, intraocular, transdermal, etc. administration.

Preferably, the pharmaceutical composition contains pharmaceutically acceptable vehicles for an injectable formulation. They may in particular be saline solutions (monosodium phosphate, disodium phosphate, sodium chloride, potassium, calcium or magnesium, etc., or mixtures of such salts), sterile, isotonic, or dry compositions, in particular lyophilized, which, by addition, as appropriate, of sterilized water or physiological saline, allow the constitution of injectable solutes. Other excipients can be used such as for example a hydrogel. This hydrogel can be prepared from any biocompatible and non-cytotoxic polymer (homo or hetero). Such polymers have for example been described in application WO93 / 08845. Some of them, such as in particular those obtained from ethylene oxide and / or propylene, are commercial. The doses of virus used for the injection can be adapted according to various parameters, and in particular according to the mode of administration used, the pathology concerned, the gene to be expressed, or even the duration of the treatment sought. In general, the recombinant adenoviruses according to the invention are formulated and administered in the form of doses of between 10 ⁴ and 10 ^{1 4} pfu, and preferably 10 ^ to 10 ¹ 0 pfu. The term pfu ("plaque forming unit") corresponds to the infectious power of an adenovirus solution, and is determined by infection of an appropriate cell culture, and measures, generally after 15 days, the number of plaques of infected cells. The techniques for determining the pfu titer of a viral solution are well documented in the literature. Due to their hepatospecific nature, the vectors (in particular adenovirus) according to the invention can also be used for the creation of animal models of hepatic pathologies.

Furthermore, the invention also relates to any cell modified by a vector (in particular an adenovirus) as described above. These cells can be used for the production of recombinant proteins in vitro. They can also be intended for implantation in an organism, according to the methodology described in application WO95 / 14785. These cells are preferably liver cells. The subject of the present invention is also a process for the production of recombinant proteins comprising the infection or the transfection of a cell population with a vector, a recombinant adenovirus or the corresponding viral genome comprising an expression cassette coding for a desired protein, culturing said recombinant cell population, and recovering said protein produced. Advantageously, for the implementation of the method of the invention, cells of hepatic origin are used. These can be established lines or primary cultures.

The invention also relates to novel variants of the human apolipoprotein Ail gene promoter having improved expression characteristics. These variants according to the invention comprise in particular a repetition of J motifs as described above. In addition, these variants advantageously comprise a deletion in the region between the residues -710 and -150 of the native promoter. The invention also relates to hepatospecific and inducible promoters derived from the promoter of the human apolipoprotein Ail gene comprising a regulatory region composed of one or more J motifs of the apolipoprotein Ail promoter and a hepatospecific promoter region derived from another promoter. Advantageously, the hepatospecific promoter region is derived from a hepatospecific promoter other than the promoter of the human gene for apolipoprotein Ail. Preferably, it is composed of a promoter chosen chosen from the promoter of serum albumin, the promoter of apolipoprotein A1, the promoter of apolipoprotein Cs. the promoter of apolipoprotein B100, the fibrinogen gamma chain promoter (JBC 270 (1995) 28350), the human phenylalanine hydroxylase gene promoter (PNAS 93 (1996) 728), the AMBP gene promoter (NAR 23 (1995) 395), the factor X gene promoter (JBC 271 (1996) 2323), the cytochrome P450 1A1 promoter (PNAS 92 (1995) 11926), the hepatitis B virus promoter (Biol. Chem. 377 (1996) 187) or also the α-antitrypsin promoter. The promoter region used preferably consists of the region necessary and sufficient for hepatic expression (minimum promoter). This region generally includes the TATA box, and can be prepared according to conventional molecular biology techniques, as indicated in the cited references. Thus, the first 209 base pairs of the promoter of the factor X gene are sufficient to confer hepatic expression (JBC cited above). Likewise, fragments -20 to -23; -54 to -57 and -66 to -77 of the fibrinogen gamma chain promoter constitute a minimal promoter allowing hepatospecific expression. These regions can be joined to regions J (preferably 1 to 5) according to the methodology described above and illustrated in the examples, to generate hepatospecific and inducible promoters. In addition, these promoters can carry additional regulatory sequences of the "enhancer" type, making it possible to improve the levels of expression.

The hepatospecific promoter region can also be composed of a ubiquitous promoter coupled to an enhancer element conferring hepatospecific expression. In this regard, the enhancer element conferring the hepatospecific character can be chosen from the enhancer of apolipoproteins E / Cl (J. Biol. Chem., 268 (1993) 8221 -8229 and J. Biol. Chem, 270 (1995) 22577-2255), the albumin enhancer (Gene therapy, 3 (1996) 802-810), the transthyretin enhancer (Mol. Cell Biol. 15 (1995) 1364-1376), the enhancer of hepatitis B virus (Biol. Chem. 377 (1996) 187) or even artificial enhancers containing HNF sites (hepatic nuclear factors), orphan receptor binding sites, members of receptors for steroid hormones (Human gene therapy, 7 (1996) 159-171). The ubiquitous promoter can be any nonspecific promoter of a tissue. It may in particular be a viral promoter or a domestic promoter ("housekeeping"). Among the viral promoters, there may be mentioned more particularly the SV40 promoter (Mol Cell Biol 1982; 2: 1044-1051); RSV LTR, Rous sarcoma virus long terminal repeat (PNAS USA, 1982; 79: 6777-6781); CMV-IE, human cytomegalovirus (Gene 1986; 45: 101-105); MoMLV LTR, Moloney murine leukemia virus (Gene Therapy 1996; 3: 806-810) and the promoter of the HSV-TK gene, Thymidine Kinase (Nucleic Acid Res 1980; 8: 5949-5964). Among the domestic promoters, there may be mentioned the promoter of the Human EF-1 alpha genes, elongation factor (Gene 1993, 134: 307-308), Chicken Beta Actin (Nucleic Acids Res 1983; 11: 8287-8301), POL II promoter, mouse RNA polymerase II (Mol Cell Biol 1987; 7: 2012-2018); PGK, Phosphoglycerate Kinase (Gene 1987; 61: 291-298); Histone H4 (Mol Cell Biol 1985; 5: 380-398), HMG, Hydroxymethylglutaryl CoA: human reductase (Mol Cell Biol 1987; 7: 1881 -1893), HK2, Hexokinase II of rats (J. Biol. Chem. 1995; 270: 16918-16925) and PRP, Prion (Virus genes 1992; 6: 343-356). Any other ubiquitous promoter known to those skilled in the art can also be used.

The hepatospecific promoter region can be obtained by coupling, according to conventional molecular biology techniques, all or a functional part of a ubiquitous promoter with the above enhancer element. In particular, the oligonucleotides corresponding to the J sites containing the bases -737 to -715 of the human apoA-ll promoter can be cloned into the BamHI / GglII sites of plC20H (Gene 1984; 32: 481 -485), digested with HindIII, and subclones 5 ′ of the ubiquitous promoter chosen, for example of the promoter of Thymidine Kinase (TK) in the plasmid pBLCAT4 (Nucl Acid Res 1987; 15: 5490), to generate a vector containing the J sites and a promoter ubiquitous in front of a gene of interest. The hepatic enhancer can be added either 5 'to the promoter or 3' to the polyadenylation site. These variants are particularly advantageous because they combine the properties of expression force, tissue specificity, and inducibility. These different variants can be used for the expression of genes of interest, in vitro and in vivo as indicated above and illustrated in the examples. The invention also relates to recombinant vectors comprising an expression cassette composed of a gene of interest under the control of a promoter as described above.

The invention also relates to a composition comprising a recombinant vector as described above and a PPAR activator, for simultaneous or spread over time use.

The recombinant vector is advantageously a recombinant adenovirus as defined above, and the activator of PPAR is advantageously an activator of PPARα. Among the activators of PPARα, it is possible to use more particularly fibrates as well as any compound increasing the expression of transcription factors which bind to the J sites.

As preferred examples of fib ^r ates, mention may be made, for example, of fibric acid and its analogs such as in particular gemfibrozil (Atherosclerosis 114 (1) (1995) 61), bezafibrate (Hepatology 21 (1995) 1025) , ciprofibrate (BCE & M 9 (4) (1995) 825), clofibrate (Drug Safety 11 (1994) 301), fenofibrate (Fenofibrate Monograph, Oxford Clinical Communications, 1995), clinofibrate (Kidney International. 44 (6) (1993) 1352), pirinixic acid (Wy-14,643) or 5,8,1 1, 14-eicosatetranoic acid (ETYA). These different compounds are compatible with biological and / or pharmacological use in vitro or in vivo.

As examples of compounds increasing the expression of transcription factors which bind to the J sites, mention may be made in particular of retinoids, which activate the expression of RXR and HFN4. Furthermore, the compositions according to the invention may comprise several activators of PPAR in combination, and in particular a fibrate or a fibrate analog associated with a retinoid.

As indicated above, the vector and the activator can be used simultaneously or spaced over time. In addition, they can be packaged separately. According to a preferred embodiment, the vector and the activator are packaged separately and used spaced over time. In particular, the vector is advantageously used first, then, in a second step, the activator from PPAR. The term used designates bringing said vector or activator into contact with cells, in vitro, ex vivo or in vivo. In vitro or ex vivo, the contact can be carried out by incubation of a cell population as mentioned above with the vector (for example from 0.01 to 1000 μg of vector per 10 ⁶ cells, or of virus at a Multiplicity of Infection (MOI) from 0.1 to 1000), followed by incubation with the activator (generally, in a concentration range between 10 ^{~ 3} mM and 10 mM, preferably between 10 μM and 500 μM ). In vivo, for example for the creation of transgenic animals or for the hepatospecific expression of genes of interest, contacting generally comprises the administration of the vector (under the conditions described above) followed by the administration of the activator. In this regard, the activator can be administered orally, for example in food (for animals in particular) or in the form of capsules (for humans). The daily doses administered to animals are of the order of 0.01 to 1% (weight / weight), preferably 0.2 to 0.5% (weight / weight). A typical daily dose in mice for example is 50 mg. A typical daily dose of fenobibrate in humans varies between 100 and 300 mg, preferably around 200 mg, which corresponds to a plasma concentration of approximately 15 μg / ml (Vidal, 1996). In addition, repeated administrations / incubations of vector and / or activator can be performed.

The present invention will be more fully described with the aid of the following examples, which should be considered as illustrative and not limiting.

Legend of figures

Figure 1: Structure of the apoAII promoter and deleted forms. Figure 2: Region J duplication strategy. Figure 3: Structure of apoAII promoters including region 5 'J duplication, possibly combined with internal deletions.

Figure 4: Structure of the apoAII promoters comprising a duplication of the J region internally, possibly combined with internal deletions. Figure 5: Representation of the recombinant adenovirus.

Figure 6: Inducibility and strength of the recombinant adenovirus in vivo.

General molecular biology techniques

Methods conventionally used in molecular biology such as preparative extractions of plasmid DNA, centrifugation of plasmid DNA in cesium chloride gradient, electrophoresis on agarose or acrylamide gels, purification of DNA fragments by electroelution, the extraction of proteins with phenol or phenol-chloroform, the precipitation of DNA in a saline medium with ethanol or isopropanol, the transformation in Escherichia coli, etc. are well known in the art. skilled in the art and are abundantly described in the literature [Maniatis T. et al., "Molecular Cloning, a Laboratory Manual", Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, 1982; Ausubel F. M. et al. (eds), "Current Protocols in Molecular Biology", John Wiley & Sons, New York, 1987].

The pBR322, pUC and phage plasmids of the M13 series are of commercial origin (Bethesda Research Laboratories). For the ligations, the DNA fragments can be separated according to their size by electrophoresis in agarose or acrylamide gels, extracted with phenol or with a phenol / chloroform mixture, precipitated with ethanol and then incubated in the presence of the DNA ligase from phage T4 (Bioiabs) according to the supplier's recommendations. The filling of the protruding 5 ′ ends can be carried out by the Klenow fragment of DNA Polymerase I of E. coli (Bioiabs) according to the supplier's specifications. The destruction of the protruding 3 ′ ends is carried out in the presence of the DNA polymerase of phage T4 (Bioiabs) used according to the manufacturer's recommendations. The destruction of the protruding 5 ′ ends is carried out by gentle treatment with nuclease S1.

Mutagenesis directed in vitro by synthetic oligodeoxynucleotides can be carried out according to the method developed by Taylor et al. [Nucleic

Acids Res. 13 (1985) 8749-8764] using the kit distributed by Amersham.

The enzymatic amplification of DNA fragments by the technique known as PCR [Polymerase-catalyzed Chain Reaction, Saiki RK et al., Science 230 (1985) 1350-1354; Mullis KB and Faloona FA, Meth. Enzym. 155 (1987) 335-350] can be performed using a "DNA thermal cycler" (Perkin Elmer Cetus) according to the manufacturer's specifications. Verification of the nucleotide sequences can be carried out by the method developed by Sanger et al. [Proc. Natl. Acad. Sci. USA, 74 (1977) 5463-5467] using the kit distributed by Amersham.

Examples

Example 1: Cloning of the promoter of the human apolipoprotein Ail gene.

This example describes the cloning of the promoter gu human apoAII II gene It is understood that any other technique can be used to recloner this promoter. Furthermore, it is also possible, from the cloned fragments, to prepare shorter conventional 5 ′ and / or 3 ′ versions according to conventional molecular biology techniques.

1 1. Cloning of a fragment -911 / + 29

The promoter of human apophpoprotein Ail was cloned by PCR from human genomic DNA Primers ATC GAA GCT TCT GAT ATC TAT TTA ACT GAT (SEQ ID No. 3) and CGT CTC TGT CCT TGG TGT CTG GAT CCA TCG (SEQ ID No. 4) which introduce, for the first, a HindIII site 5 'to the promoter, and for the second, a BamHI site at 3', made it possible to clone the promoter from the position -911 to the position + 29 The promoter sequence was confirmed by sequencing (SEQ ID No. 1) and the HindIII-BamHI fragment introduced into the vector pBLCATδ for verification of the transcriptional activity

1 2. Cloning of a fragment -911 / + 160

A fragment comprising the apoAII promoter of residues -91 1 / + 160 was also obtained from the genomic library, then cloned into the vector pBLCATδ.

Example 2 Construction of AH Promoter Variants 2.1. Creation of long shapes

This example describes the construction of variants of the apoAII promoter comprising an internal deletion, in the region between the regulatory elements located at the nucleotides -903 to -720, and -126 to -33. These variants were constructed from the fragments -911 / + 29 and -911 / + 160 described in example 1.

From the pBLCAT5 vectors comprising the complete promoter in the form of a fragment -911 / + 29 or -911 / + 160, the region -210 to +29 or -210 to +160 was obtained by PCR using as primer a oligonucleotide -210 / - 198 of sequence 5'-GACTCTAGATGTACCCCCTTA-3 '(SEQ ID No. 5) and an oligonucleotide internal to the CAT gene. The fragment obtained was cloned into a plasmid pBLCAT5 to generate the plasmids -210 / + 160AII-CAT and - 210 / + 29AII-CAT. The distal region -91 1 to -653 (Nl) was obtained by digestion of the fragment -911 to +29 using the enzyme alul, then cloning of the fragment obtained in the plasmids -210 / + 160AII-CAT and -210 / + 29AII- CAT. The distal region -911 to -708 (N-J) was obtained by PCR using as an primer an oligonucleotide -708 / -722 of sequence 5'- GGAAGCTGCAGAGGCTTCTACCAG-3 '(SEQ ID No. 6). The fragment obtained was then cloned into plasmids -210 / + 160AII-CAT and -210 / + 29AII-CAT.

The structure of the promoters is shown in Figure 1.

2.2. Duplication of site J

This example describes the construction of Ail Promoter variants in which the J region has been repeated.

The following two oligonucleotides, corresponding to site J. were synthesized using a DNA synthesizer.

Oligo 1: 5'-gatcctTCAACCTTTACCCTGGTAGa-3 '(SEQ ID No. 7) Oligo 2: 5'-gatctCTACCAGGGTAAAGGTTGAag-3' (SEQ ID No. 8)

These oligonucleotides reconstitute, at the 3 'end, a BamHI site and at the 5' end, a BglII site. These oligonucleotides were hybridized together and the fragment obtained was cloned at the BamHI-BglII sites in the vector plC20H (Figure 2). The resulting plC20H-J plasmids were analyzed to determine the number of copies of J sites inserted, as well as their respective orientation.

The following plasmids have been selected:

- a plasmid carrying a single copy of the J site,

- a plasmid carrying 2 copies of site J in the same orientation,

- a plasmid carrying 2 copies of site J, in reverse orientation.

To construct the variants of the apoAII promoter comprising J motifs repeating in 5 ′, the inserts contained in the above plasmids were excised in the form of HindIII fragments and clones in 5 ′ of the apoAII promoter (Example 1) or variants described in Example 2.1, at a HindIII site. The structure of the resulting promoters is given in FIG. 3.

To construct the variants of the apoAII promoter comprising J motifs internally repeated, the inserts contained in the above plasmids were excised in the form of appropriate restriction fragments, then cloned into the apoAII promoter (Example 1) or into the variants described in Example 2.1, at a corresponding site located between the native J region and the regulatory region -126-33 of the native promoter. The structure of the resulting promoters is given in FIG. 4.

The number of copies of region J in the final construct is determined by the choice of the plasmid.

Example 3: Study of the functionality of the variants of the apoAII promoter.

The functionality of the promoters was studied by transfection into a hepatic cell line, the HepG2 cells. A control experiment was carried out in a non-hepatic cell line, the Hela cells.

Transfections in HepG2 cells were performed at 50-60% confluence by the calcium phosphate precipitation method. The cells were co-transfected with a mixture of plasmids comprising: - the test plasmid a PPARα expression plasmid (PBK-CMV-PPARα) or the corresponding empty plasmid (PBK-CMV), and,

- 0.5 μg of a β-Gal expression plasmid (CMV-β-Gal) as a control of the transfection efficiency.

All transfections were performed with the same amount of total DNA. 4 h after transfection, the cells are washed in PBS buffer, then incubated for 24 hours with fibrate (Wy-14643, 1 μM). The CAT activity is then determined according to the method of Gorman et al (Mol. Cell. Biol. 2 (1982) 1044). The results are then related to the transfection efficiency as measured by the expression of β-Gal.

The results obtained for two series of experiments are presented in Tables 1 and 2 below.

Table 1: Promoters' activity on liver cells

Table 2: Promoters' activity on liver cells

These results clearly show that the duplication of the J motif in the promoter does not alter the strength of the promoter, and very significantly increases its inducibility by fibrates. Furthermore, in a control experiment carried out in cells

Unfortunately, no inducibility by fibrates or by PPAR was observed. This demonstrates that the promoters according to the invention retain their tissue specificity.

These results therefore demonstrate that the promoters according to the invention are strong, highly inducible, and specific for hepatic cells. In addition, the promoters phA-ll N-I (J3); phA-11 'N-I (J3); phA-ll N-J (J3), phA-ll 'N- J (J3), phA-ll N-1 (J3ι); phA-ll 'Nl (J3ι), phA-ll NJ (J3ι) and phA-ll' NJ (J3ι) have the advantage of being small, compared to the native apoAII promoter This therefore advantageously allows, in a vector of gene transfer and / or expression, to have a higher cloning capacity

Example 4 Construction of inducible and hepatospecific adenoviruses.

This example describes the construction of inducible and hepatospecific adenoviruses, and giving very high expression levels These adenoviruses are useful for the expression of genes in vitro, ex vivo or in vivo The adenoviruses described were constructed from the serotype Ad5 It is understood that any other serotype can be used, and in particular the serotypes Ad2, Ad7, Ad12 and CAV2. The adenoviruses were constructed by homologous recombination, in a packaging line, between a shuttle vector bringing the left part of the viral genome and the DNA of a linearized adenovirus, bringing the right part of the viral genome

4 1 Constructi on of shuttle vectors

The shuttle vector constructed carries an expression cassette consisting of an apoAII promoter and a nucleic acid coding for a secreted molecule apolipoprotein Al (apoAl) This vector also brings the left part of the viral genome, that is to say the left ITR and a region allowing recombination.

The shuttle vectors used for the construction of the adenovirus were constructed from a plasmid pC05 (WO96 / 22378), a plasmid plC20H-Alb-U-AI-SV40 which contains the first intro of apoAl and The apoAl cDNA under the control of a promoter of albumin from Rat, and of a plasmid pBLAIICATδ which contains an apoAII promoter as described in example 1 or a variant according to example 2.

a) Construction of plC20H-Alb-U-AI-SV40

The two primers GCG GCC GCT TCG AGC AGA CAT GAT AA (SEQ ID No. 9) and CGA TCT CAA GGG CAT CGG TCG ACG G (SEQ ID No. 10) allowed the amplification of the polyadenylation sequences of SV40 in the late orientation. The 5 'primer introduces a NotI site upstream of this sequence and the 3' primer introduces a half site Nrul. The PCR fragment obtained is treated with klenow to obtain blunt ends and cloned in the vector plC20H cleaved by Smal and Nrul, in the orientation which regenerates a Nrul site. The resulting plasmid is called plC20H-SV40.

The construction pXL2336 containing a minigene of apolipoprotein A1 has been described previously (WO94 / 25073). A PCR fragment is amplified from pXL2336 using the primers GGG ATC CGC TGG CTG CTT AGA GAC TGC (SEQ ID No. 11) and GGC GGC CGC CGG GAA GGG GGG CGG CGG (SEQ ID No. 12) respectively BamHI upstream of the first ApoAl exon and a NotI site downstream of the ApoAI coding sequence. The PCR fragment is cloned into pCRI1 (Invitrogen) and its sequence verified. The BamHI / NotI fragment containing the cDNA and the first intron of apoA-1 is then cloned at the same sites of the plasmid plC20H-SV40 to generate the plasmid plC20H-AI-SV40.

The oligonucleotides CAC GTG CTT GTT CTT TTT GCA GAA GCT CAG AAT AAA CGC TCA ACT GTG GC (SEQ ID n ° 13) and CGT GGC CAC AGT TGA GCG TTT ATT CTG AGC TTC TGC AAA AAG AAC AAG CA (SEQ ID n ° 14) are then hybridized with each other and cloned at the Dsal site of plC20H-AI-SV40 so that the Pmll site created during this cloning is on the side of the intron and the Dsal site is regenerated at other end. These oligonucleotides make it possible to introduce a fragment of the 5 'untranslated part of the messenger RNA of β Globin. The plasmid obtained is called plC20H-U-AI-SV40.

Finally, the Hindlll / Bglll fragment of the rat albumin promoter described by F. Troche et al (Mol. Cel. Biol, 1989, 4759-4766) treated with Klenow was cloned in the appropriate orientation into the plasmid plC20H-U-AI-SV40 cleaved with BamHI and also treated with klenow to generate the plasmid plC20H-Alb-U-AI-SV40.

b) Construction of shuttle vectors

The oligonucleotides CGT GGC AGG CAG CAG GAC GCA CCT CCT TCT CGC AGT CTC TAA GCA GCC TTC GAA GCA TG (SEQ ID n ° 15) and CTT CGA AGG CTG CTT AGA GAC TGC GAG AAG GAG GTG CGT CCT GCT GCC TGC CA (SEQ ID n ° 16) are hybrid between them which creates a cohesive end Sphl and a cohesive end Hpall. This fragment is introduced into a three-partner ligation with an Hpall / Dralll fragment (476/1518) of the plasmid plC20HAIb-U-AI-SV40 containing the cDNA of ApoAl and a Dralll / Sphl fragment (1518/239) of the same plasmid. . The resulting plasmid is called pXL2699. This construction creates a BstBI site compatible with ClaI upstream of the cDNA + intron fragment of apoAl. The BstBI / SalI fragment of pXL2699, containing the ApoAl cDNA, is cloned into the plasmid pCO5 cleaved by ClaI and SalI. The resulting plasmid is called pCO5-U-AI-SV40.

The apoAII promoter selected (complete promoter or variants) is excised from the corresponding plasmid pBLAIICAT5 in the form of a Hindlll-BamHI fragment, cloned after treatment with Klenov at the EcoRV site of the plasmid pC05- U-AI-SV40 to generate the shuttle vectors pXLPromAII /HAVE. The following vectors are thus obtained:

These vectors are validated for the expression of human apoAl by transient transfection in lines 293 or Cos1. It is understood that the nucleic acid coding for human apolipoprotein A1 can be easily replaced in the shuttle vectors by any other nucleic acid coding for a molecule of interest.

4.2. Construction of adenoviruses

The adenoviruses were produced by homologous recombination, after co-transfection, into the appropriate cells, of two DNA fragments, one bringing the left part of the genome of the recombinant virus (shuttle vector described in example 4.1., Having a deletion in the E1 region), the other bringing the right part of the genome of the recombinant virus (possibly having a deletion in the E4 and / or E3 region).

a) Construction of defective adenoviruses for the E1 region

The Ad-AII / AI adenovirus was obtained by homologous in vivo recombination between the DNA of the Ad-RSV-βGal virus and the pXL AII / AI shuttle vector, according to the following protocol: the pXL AII / AI shuttle vector linearized by BstXI and the DNA of the Ad-RSV-βGal virus linearized by the enzyme Clal, were co-transfected in line 293 in the presence of calcium phosphate, to allow homologous recombination. The recombinant adenoviruses generated were then selected by plaque purification. After isolation, the DNA of the recombinant adenovirus was amplified in the cell line 293, which which leads to a culture supernatant containing the unpurified recombinant defective adenovirus having a titer of approximately 10 ¹⁰ pfu / ml. The viral particles are then purified by centrifugation on a cesium chloride gradient according to known techniques (see in particular Graham et al., Virology 52 (1973) 456), or by chromatography (FR96 08164). The Ad-AII / AI adenovirus can be stored at -80 ° C in 20% glycerol. The structure of the recombinant genome is presented in Figure 5.

The same strategy is followed to construct the adenoviruses carrying the different forms of Ail promoters, starting from the shuttle vectors described in Example 4.1.

b) Construction of defective adenoviruses for the E1 and E4 regions

The IGRP2 cells (Yeh et al., J. Virol 70 (1996) 559), capable of transcomplementing the E1 and E4 functions of the adenovirus, are cotransfected with 5 mg of the shuttle vector digested with BstXI, and 10 mg of the DNA of the virus providing the functional deletion of the E4 region (for example Ad2dl808, Ad5dl1004, Ad5dl1007 or Ad5dl1014) digested with the enzyme ClaI. After the appearance of the cytopathic effect, the viruses are purified by at least two consecutive cycles of spreading in solid for the formation of plaques on IGRP2. The ranges corresponding to the infection of the virus sought (DNA analysis demonstrating the double deletion E1 and E4) are then amplified by consecutive infection cycles. High titer stocks are prepared by purification on a cesium chloride gradient. Viruses are stored at -80 ° C according to conventional techniques of those skilled in the art.

EXAMPLE 5 In Vivo Activity of Recombinant Adenoviruses

This example describes the functional properties of the adenoviruses of the invention, after administration in vivo.

5 x 10 ⁹ pfu of the Ad viruses (ApoAllprom-ApoAI-SV40 and Ad (RSV-ApoAI-bGH) were injected respectively into 8 and 3 C57bl6 mice. Four of the mice injected with the Ad (ApoAllprom-ApoAI-SV40) were fed with fenofibrate at a dose of 0.5% (w / w) mixed with their diet. Plasma concentrations of human apoA-1 and HDL-cholesterol were measured weekly. The results obtained are presented in FIG. 6. The plasma apoA-1 levels are below the detection threshold (10 mg / dl) for the mice injected with the Ad virus (ApoAllprom-ApoAI-SV40), 81 ± 0.17 mg / dl for mice injected with Ad virus (ApoAllprom-ApoAI-SV40) treated with fenofibrate and 84 115 mg / dl for mice injected with Ad virus (RSV-ApoAI-bGH) which shows an induction of at least 8 times of the apoA-ll promoter under these conditions.

The level of HDL-cholesterol is not modified for mice injected with the Ad virus (ApoAllprom-ApoAI-SV40) (52 ± 2 mg / dl): identical level to untreated animals. On the other hand, the level of HDL-cholesterol is increased on day 7 up to 88,114 mg / dl and 121,122 mg / dl for respectively for the mice injected with the Ad virus (RSV-ApoAI-bGH) and the mice injected with the virus Ad (ApoAllprom-ApoAI-SV40) treated with fenofibrate (Figure 6).

These results demonstrate in vivo the strong, inducible and hepatospecific nature of the promoters of the invention in an adenoviral context. Combined with the remarkable gene transfer properties of adenoviruses, the vectors of the invention exhibit very advantageous performances for the transfer and expression of genes.

LIST OF SEQUENCES

SEQ ID No. 1: Sequence of the human apoAII promoter (-911 +29).

AGCTTCTGAT ATCTATTTAA CTGATTTCAC CCAAATGCTT TGAACCTGGG -911 -901

AATGTACCTC TCCCCCTCCC CCACCCCCAA CAGGAGTGAG ACAAGGGCCA

GGGCTATTGC CCCTGCTGAC TCAATATTGG CTAATCACTG CCTAGAACTG -811

ATAAGGTGAT CAAATGACCA GGTGCCTTCA ACCTTTACCC TGGTAGAAGC

-734 -716 ÇTCTTATTCA CCTCTTTTCC TGCCAGAGCC CTCCATTGGG AGGGGACGGG -711 CGGAAGCTGT TTTCTGAATT TGTTTTACTG GGGGTAGGGT ATGTTCAGTG

ATCAGCATCC AGGTCATTCT GGGCTCTCCT GTTTTCTCCC CGTCTCATTA -611

CACATTAACT CAAAAACGGA CAAGATCATT TACACTTGCC CTCTTACCCG

ACCCTCATTC CCCTAACCCC CATAGCCCTC AACCCTGTCC CTGATTTCAA -511 TTCCTTTCTC CTTTCTTCTG CTCCCCAATA TCTCTCTGCC AAGTTGCAGT

AAAGTGGGAT AAGGTTGAGA GATGAGATCT ACCCATAATG GAATAAAGAC

-411

ACCATGAGCT TTCCATGGTA TGATGGGTTG ATGGTATTCC ATGGGTTGAT

ATGTCAGAGC TTTCCAGAGA AATAACTTGG AATCCTGCTT CCTGTTGCAT

-311

TCAAGTCCAA GGACCTCAGA TCTCAAAAGA ATGAACCTCA AATATACCTG AAGTGTACCC CCTTAGCCTC CACTAAGAGC TGTACCCCCT GCCTCTCACC -211 CCATCACCAT GAGTCTTCCA TGTGCTTGTC CTCTCCTCCC CCATTTCTCC

AACTTGTTTA TCCTCACATA ATCCCTGCCC CACTGGGCCC ATCCATAGTC -111

CCTGTCACCT GACAGGGGGT GGGTAAACAG ACAGGTATAT AGCCCCTTCC

TCTCCAGCCA GGGCAGGCAC AGACACCAAG GACAGAGACG -11 +1 +10

SEQ ID n ° 2: Sequence of region J

TCAACCTTTA CCCTGGTAG

SEQ ID # 3: ATCGAAGCTT CTGATATCTA TTTAACTGAT SEQ ID # 4

CGTCTCTGTC CTTGGTGTCT GGATCCATCG

SEQ ID # 5 GACTCTAGATGTACCCCCTTA

SEQ ID # 6

GGAAGCTGCAGAGGCTTCTACCAG

SEQID No 7

gatcctTCAACCTTTACCCTGGTAGa

SEQ ID # 8 gatctCTACCAGGGTAAAGGTTGAag

SEQ ID # 9

GCG GCC GCT TCG AGC AGA CAT GAT AA

SEQID No. 10 CGA TCT CAA GGG CAT CGG TCG ACG G

SEQID # 11

GGG ATC CGC TGG CTG CTT AGA GAC TGC

SEQ ID # 12

GGC GGC CGC CGG GAA GGG GGG CGG CGG

SEQID # 13

CAC GTG CTT GTT CTT TTT GCA GAA GCT CAG AAT AAA CGC TCA ACT GTG GC

SEQ ID # 14 CGT GGC CAC AGT TGA GCG TTT ATT CTG AGC TTC TGC AAA AAG AAC AAG CA

SEQID # 15

CGT GGC AGG CAG CAG GAC GCA CCT CCT TCT CGC AGT CTC TAA GCA GCC TTC GAA GCA TG

SEQID No. 16

CTT CGA AGG CTG CTT AGA GAC TGC GAG AAG GAG GTG CGT CCT GCT GCC TGC CA

Claims

1. recombinant vector for the inducible and hepatospecific expression of a molecule characterized in that it comprises an expression cassette consisting of a nucleic acid coding for said molecule placed under the control of the promoter of the gene for human apolipoprotein Garlic .

2. Recombinant vector according to claim 1 characterized in that the promoter comprises the regulatory elements located at the level of nucleotides -903 to -680; -573 to -255 and -126 to -33 of the promoter of the human apolipoprotein AH gene.

3. Recombinant vector according to claim 1 or 2 characterized in that the 3 'end of the promoter is between residues +5 and +35, more preferably +10 and +30 of the apoAII gene.

4. Recombinant vector according to one of claims 1 to 3 characterized in that the 5 'end of the promoter is between the residues -950 to -905, preferably -925 to -910 of the apoAII gene.

5. Recombinant vector according to claim 1 characterized in that the promoter comprises the sequence SEQ ID No. 1 (residues -91 1 to +29).

6. Recombinant vector according to one of claims 1, 3 or 4 characterized in that the promoter comprises the regulatory elements located at the nucleotides -903 to -680, or -903 to -720, and -126 to -33 of the promoter of the human apolipoprotein Ail gene, but not the intermediate elements located at the nucleotides -573 to -255.

7. Recombinant vector according to claim 6 characterized in that the promoter comprises a deletion in the region between the residues -

670 and -210, preferably a deletion of the residues - 653-210.

8. Recombinant vector according to claim 6 characterized in that the promoter comprises a deletion in the region between the residues

-710 and -150.

9. Recombinant vector according to claim 8 characterized in that the promoter comprises a deletion of the residues - 708-210.

10. Recombinant vector according to one of the preceding claims, characterized in that the promoter comprises a repetition of J motifs.

11. Recombinant vector according to claim 10 characterized in that the promoter comprises from 2 to 5 units J.

12. Recombinant vector according to claim 10 characterized in that the repetition of patterns J is positioned 5 'to the promoter.

13. Recombinant vector according to claim 10 characterized in that the repetition of patterns J is positioned 3 'to the promoter.

14. Recombinant vector according to claim 10 characterized in that the repetition of J motifs is inserted into the promoter sequence.

15. Recombinant vector according to claim 10 characterized in that the promoter comprises a regulatory region composed of one or more J units and a hepatospecific promoter region.

16. Recombinant vector according to claim 15 characterized in that the hepatospecific promoter region is composed of a hepatospecific promoter chosen from the serum albumin promoter, the apolipoprotein A1 promoter, the apolipoprotein Cs promoter, the promoter apolipoprotein B100, the fibrinogen gamma chain promoter, the human phenylalanine hydroxylase gene promoter, the AMBP gene promoter, the factor X gene promoter and the α-antitrypsin promoter .

17. Recombinant vector according to any one of claims 1 to 16 characterized in that it is a recombinant adenovirus.

18. Recombinant adenovirus according to claim 17 characterized in that it comprises a deletion in the E1 region of its genome.

19. Recombinant adenovirus according to claim 18 characterized in that it comprises a deletion of the E1a and E1 b regions.

20. Recombinant adenovirus according to claim 18 characterized in that it further comprises a deletion in the E4 region of its genome.

21. Recombinant adenovirus according to claim 20 characterized in that the deletion in the E4 region affects all of the open phases.

22. Recombinant adenovirus according to claims 18 to 21 characterized in that the expression cassette is inserted at the E1 region, replacing the deleted sequences.

23. Recombinant adenovirus according to claims 18 to 21 characterized in that the expression cassette is inserted at the E4 region, replacing the deleted sequences.

24. Recombinant adenovirus according to claims 18 to 21 characterized in that the expression cassette is inserted at the E3 region.

25. Recombinant vector according to claim 1 characterized in that the molecule is a therapeutic protein.

26. Recombinant vector according to claim 25 characterized in that the therapeutic molecule is a protein secreted in the circulation.

27. Recombinant vector according to claim 25 characterized in that the therapeutic protein is chosen from hormones, lymphokines, growth factors, neurotransmitters or their synthetic precursors or enzymes, trophic factors, apolipoproteins, tumor suppressors and the factors involved in coagulation.

28. Adenoviral vector comprising an expression cassette consisting of a nucleic acid coding for a molecule of interest placed under the control of the promoter of the gene for human apolipoprotein Ail.

29. Variant of the promoter of the human apolipoprotein Ail gene comprising a repeat of J motifs.

30. Variant according to claim 29 characterized in that it comprises from 2 to 5 patterns J.

31. Variant according to claim 29 or 30 characterized in that the additional patterns J are positioned 5 'to the promoter.

32. Variant according to one of claims 29 to 31 characterized in that it further comprises a deletion in the region between the residues - 710 and -150 of the native promoter.

33. Variant of the promoter of the human apolipoprotein Ail gene, characterized in that it comprises a regulatory region composed of one or more motifs J of the apolipoprotein Ail promoter and a hepatospecific promoter region derived from another promoter.

34. Variant according to claim 33 characterized in that the hepatospecific promoter region is composed of a hepatospecific promoter other than the promoter of the gene for the apolipoprotein Ail human.

35. Variant according to claim 33 characterized in that the hepatospecific promoter region is composed of a ubiquitous promoter coupled to an enhancer element conferring hepatospecific expression.

36. Cell modified by a vector according to one of claims 1 to 28.

37. Pharmaceutical composition comprising an adenovirus according to claim 17 and a pharmaceutically acceptable vehicle.

38. Process for the production of a desired recombinant protein comprising:

- infection or transfection of a cell population with a recombinant vector according to claim 1 or a viral genome comprising an expression cassette coding for said desired protein,

the culture of said recombinant cell population, and,

- recovery of said protein produced.

39. Use of an adenovirus according to claim 17 for preparing a transgenic non-human animal model.

40. Composition comprising a recombinant vector according to one of claims 1 to 28 and a PPAR activator, for simultaneous or spread over time use.

41. Composition according to claim 40 characterized in that the vector is a recombinant adenovirus according to claim 17.

42. Composition according to claim 40 or 41 characterized in that the activator of PPAR is an activator of PPARα.

43. Composition according to claim 42 characterized in that the activator of PPARα is chosen from fibrates and compounds increasing the expression of transcription factors which bind to the J sites.

44. Composition according to claim 43 characterized in that the fibrate is chosen from fibric acid, gemfibrozil, bezafibrate, ciprofibrate, clofibrate, fenofibrate and clinofibrate.