EP0944727A1

EP0944727A1 - Process for producing transgenic inulin-generating plants

Info

Publication number: EP0944727A1
Application number: EP97921819A
Authority: EP
Inventors: Arnd G. Heyer; Regina Wendenburg
Original assignee: Suedzucker AG; KWS Kleinwanzlebener Saatzucht AG
Current assignee: Suedzucker AG; KWS SAAT SE and Co KGaA
Priority date: 1996-05-03
Filing date: 1997-04-29
Publication date: 1999-09-29
Also published as: DE19617687A1; JP2001517930A; US6255562B1; DE19617687C2; AU2774197A; WO1997042331A1; AU718897B2

Abstract

The present invention relates to a process for producing genically modified, inulin-producing plants, the DNA sequences used therein and the modified plants obtained.

Description

Process for the production of transgenic plants producing inulin

description

The present invention relates to a method for producing genetically modified, high-molecular inulin-producing plants, agents for carrying out this method and the plants obtainable with the aid of these agents and the method, and also the high-molecular inulin contained therein.

High molecular weight, water-soluble, linear polymers, for example polyacrylates and polymethylacrylates, are known. These are used, for example, to increase the viscosity of aqueous systems, as a suspending agent, to accelerate sedimentation and complexation, and in superabsorbers for binding water and lacquers which can be diluted in water. It proves to be disadvantageous that these products are not biodegradable. Derivatized, highly polymeric polysaccharides can be used instead. Such polysaccharides can hitherto be obtained biotechnologically by fermentation and transglycosylation. However, due to economic considerations, polymers produced by fermentation are not suitable for applications on a larger scale. For some time, therefore, attempts have been made to produce linear, water-soluble polymers, such as inulin, in plants. Inulin, a β-2-1 linked polyfructan, is detectable as a storage carbohydrate in some dicotyledonous, higher plants, and is present with a molecular weight of 5-50 kD. A number of gram-positive and gram-negative types of bacteria are also known among the bacteria, which synthesize a related fructan polymer, the β-2-6-linked levan, using so-called levan sucrases. Bacterially formed polyfructans have considerably higher molecular weights of up to 2000 kD. Only one gram-positive bacterium is currently described, Streptococcus mutans, which uses a ftf (fructosyltransferase) gene to form inulin on the basis of sucrose (Shiroza and Kuramitsu, J. Bacteriology (1988) 170, 810 to 816) .

Methods for changing the carbohydrate concentration and / or the composition of the carbohydrates in transgenic plants by means of biotechnological methods are known. PCT / US89 / 02729 describes one possibility for producing carbohydrate polymers, in particular dextran or polyfructose, in transgenic plants, in particular their fruits. The use of levan sucrase or dextran sucrase from various microorganisms is proposed for producing these plants. Neither the formation of the active enzymes, nor that of Levan or Dextran, nor the production of transgenic plants is detected.

PCT / EP93 / 02110 discloses a process for the production of transgenic plants which produce polyfructose and which contain the lsc gene for a levan sucrase from a gram-negative bacterium. PCT / NL93 / 00279 discloses the transformation of plants with chimeric genes which contain the sacB gene from Bacillus subtilis or the ftf gene from Streptococus mutans. In the case of the sacB gene, a modification of the 5'-untranslated region of the bacterial gene is also recommended in order to increase the expression level in transformed plants. No sequence modifications to improve expression are described for the fructosyltransferase gene from Streptococcus mutans. The level of expression of fructosyltransferase is therefore comparatively low.

The present invention is therefore based on the technical problem of providing a method and means for the production of high molecular weight inulin in plants which enable simple and inexpensive production of the inulin in large quantities in plants.

The solution to this technical problem lies in the provision of a modified fructosyl transferase gene, in particular a gene in which one, preferably the amino terminal, region of a known fructosyl transferase gene is replaced by a region of a patatin gene and / or another gene . The preferred modification of the sequence of the known fructosyltransferase gene according to the invention thus consists in an exchange of the coding region of the amino terminal region of a fructosyltransferase gene for the amino terminal region of a patatin gene and / or other gene. The other gene can be, for example, the carboxypeptidase Y gene (cpy gene) or the lacZ gene. An embodiment is preferred in which the amino-terminal region of the fructosyltrans- ferasegens is only replaced by a region of the patatin gene. Surprisingly, a fructosyltransferase gene modified in this way can be efficiently expressed in higher plants, high-molecular inulin being obtained in large quantities. In a particularly advantageous manner, no extensive sequence modification or new synthesis of the original fructosyl transferase gene is necessary.

In the context of the present invention, a fructosyl transferase gene is understood to mean the coding DNA sequence of a gene whose gene product has a sucrose: β-D-fructosyl transferase activity. Such a gene can be of vegetable, animal, microbial or synthetic origin. According to the invention, modified fructosyltransferase genes are understood to mean the coding DNA sequences of modified genes whose gene products have a sucrose: β-D-fructosyltransferase activity and are capable of β-2-1 linked polyfructans, in particular inulins, to build. The gene products of the modified genes therefore have the biological activity of an inulin sucrase defined above. The term modification means all manipulations on a DNA sequence, for example nucleotide substitutions, deletions, inversions or additions. The amino terminal region of a gene is understood to mean the region of the coding DNA sequence which codes the amino terminal region of the gene product, wherein the amino terminal region of a gene can comprise many or a few codons, but also only the start codon alone. A patatin gene is understood to mean a gene belonging to the family of the patatin genes, which is for example a patatin gene can be class I or II (Rocha-Sosa et al., EMBO J (1989) 8, 23-29). A patatin gene is also understood to mean patatin-analogous genes which have sequence homology and / or functionality similar to the patatin genes. The patatin gene used according to the invention preferably originates from the potato, but can also be of synthetic or other origin.

Finally, according to the invention, high-molecular inulin is understood to mean an inulin with a molecular weight of more than 1.5 million daltons.

The solution to the above-mentioned technical problem is achieved in particular by the gene characterized in the main claim, vectors containing this gene, transformation processes using these vectors, the plants and inulins obtained by this process, and processes for obtaining the inulin formed according to the invention from the inventions ¬ appropriate plants provided. The subclaims relate to advantageous refinements of the invention.

In a first embodiment, the invention relates to a modified fructosyltransferase gene in which the amino-terminal region of a fructosyltransferase gene is at least partially replaced by the region of a further gene, namely a patatin gene. In addition to replacing the original amino-terminal region of the fructosyltransferase gene with a region of the patatin gene, preferably the amino-terminal region, the fructosyltransferase gene can of course also have further modifications and / or be produced entirely synthetically. However, the invention also relates to all other modifications of a fructosyl transferase gene if the gene product formed can produce high molecular weight inulin in plants.

In a particularly preferred embodiment of the invention it is provided that the amino-terminal region of the fructosyltransferase gene by segregating from plant or bacterial genes or genes from yeast, in particular the patatin gene from preferably the potato and optionally another gene, for example the cpy Gene from yeast or the lacZ gene from Escherichia coli.

It is particularly preferably provided that the vegetable gene is the patatin B33 gene from the potato. In particular, the invention provides for the amino terminal region of the fructosyltransferase gene to be replaced by signal sequences of the patatin gene which encode signal peptides. Signal sequences of the patin gene, in particular the patatin B33 gene from potato, which can be used according to the invention, encode signal peptides for inclusion in the endoplasmic reticulum or signal peptides which allow the gene product to be located in the vacuole. The invention thus relates to modified fructosyltransferase genes in which the modification of the fructosyltransferase gene can consist in that the amino-terminal region of the fructosyltransferase gene is replaced by signal sequences of plant genes, such as, for example, the patatin gene from potato. The invention also includes modified fructosyltransferase genes in which the amino-terminal region of the fructosyltransferase gene is replaced by regions, in particular amino-terminal regions, of different genes, for example the amino-terminal area of the patatin gene and the lacZ gene. In particular, it is preferred that the amino-terminal region of the lacZ gene encodes the amino-terminal amino acids 21 to 30 of the β-galactosidase. Of course, the invention also includes modified fructosyltransferase genes, in which the amino-terminal region of the modified fructosyltransferase gene is provided by regions of various plant genes and genes from yeast, for example the cpy gene (carboxypeptidase Y) and the patatin gene from potato. In the latter two cases, the signal sequence coding for the signal peptide from the patatin gene is preferably arranged upstream (5 ') from the sequence of the cpy gene or the lacZ gene.

In a further embodiment of the invention it is provided that the fructosyl transferase comes from Streptococcus mutans. Of course, however, the invention also relates to the use of other fructosyltransferases, as long as they can produce inulins in the modified form specified according to the invention.

In a particularly preferred embodiment of the invention, the amino-terminal region of the fructosyltransferase gene to be replaced represents a region coding for its signal peptide. In the context of the present invention, the region coding for a signal peptide is the region between the start of translation and the beginning of the mature, processed protein coding Understand DNA sequence. 31 PC17EP97 / 02195

- 8th -

In one embodiment, the invention relates to a modified fructosyltransferase gene which has a signal sequence which codes a signal peptide for incorporating the modified gene into the endoplasmic reticulum of a eukaryotic cell. The invention therefore provides that a modified gene of the invention can be provided with signal sequences which allow the gene product to be localized in certain compartments of the cell. According to the invention, the signal sequence of a patatin gene, in particular the patatin gene B33, preferably from potato, is particularly preferred. As stated, in addition to a modification of the fructosyltransferase gene that has already taken place, the signal sequence can be fused to the modified fructosyltransferase gene, or the signal sequence is fused directly to the fructosyltransferase gene that is shortened in its amino-terminal region. According to the invention, it is therefore provided in both preferred embodiments that the amino-terminal region of the fructosyltransferase gene is replaced by at least part of the patatin gene and, if appropriate, additionally sequences from other genes, for example the lacZ gene or the cpy gene, in the amino-terminal region of the modified fructosyltransferase gene are present. When the signal sequence encoding the signal peptide for inclusion in the endoplasmic reticulum is used from the amino-terminal area of the patatin B33 gene, the gene product is translocated into the apoplastic space. Consequently, the synthesis of the high molecular weight inulin is carried out there, so that specific changes in the carbohydrate composition of the transgenic plant can be achieved. Of course, other Si signal sequences can be used. Thus, in particular, signal sequences come into consideration which code signal peptides which lead to the inclusion of a protein in the endoplasmic reticulum and which can be demonstrated by the fact that they can be detected in the precursor proteins, but not in processed, mature proteins. As is known, the signal peptides are proteolytically removed during the uptake into the endoplasmic reticulum.

In a further preferred embodiment, the invention provides that the modified fructosyl transferase gene is fused or has a signal sequence which encodes a signal peptide for inclusion in the endoplasmic reticulum of a eukaryotic cell and for forwarding to the vacuole. The use of a signal peptide for the vacuolar localization of the gene product is advantageous insofar as it can also effect specific changes in the carbohydrate composition of the transgenic plants obtained. According to the invention, signal peptides can, for example, be used for the vacuolar localization of lectin from barley (Raikhel and Lerner, Dev. Tague et al., Plant cell (1990) 2,533-546) and signal sequences from a patatin gene from potato.

According to the invention, a modification of the fructosyltransferase gene is preferred in which a signal sequence of the patatin B33 gene, in particular one which contains the 60 amino-terminal amino acids of the Propeptide encoded (Rosahl et al., Mol Gen Genet (1986) 203, 214-220), ie the nt 736 to 855, is used. This signal sequence at least partially replaces the amino-terminal region of the fructosyltransferase gene, possibly together with other genes. In the context of the present invention, this sequence is referred to as an extended B33 signal sequence. This sequence can be obtained both as a fragment of genomic DNA of the potato and from cDNA for the transcript of the B33 gene. The fusion of the extended B33 signal sequence to the modified gene of the invention or to the fructosyltransferase gene to be modified leads to the uptake of its gene product into the vacuole and thus to a specific change in the carbohydrate composition of the transgenic plant obtained.

The invention also relates to the use of this extended B33 signal sequence or the peptide encoded thereby for the transport of any other gene products into plant vacuoles.

The invention also relates to a vector, in particular a plasmid, containing a modified fructosyltransferase gene. In particular, the invention relates to a vector or a plasmid containing a modified fructosyltransferase gene which is under the control of a promoter active in plants, in particular an organ-specific promoter. As is known, sucrose is the substrate for fructosyltransferase, so that the production of high molecular weight inulin is particularly advantageous in those plant tissues or plant organs that store large amounts of sucrose. The beet of the future 1 PC17EP97 / 02195

- 1 1 -

kerrube or the stem of sugar cane. According to the invention, the expression of the modified fructosyltransferase gene in such organs can be achieved by using tissue-specific promoters. Organ-specific expression in potato tubers or beet from sugar beet is possible, for example, with the B33 promoter of the B33 gene from potato.

The invention also relates to a vector or a plasmid in which the 3 'terminus of the modified fructosyltransferase gene is fused to a transcription termination sequence, for example the polyadenylation site of the nos gene from Agrobacterium tumefaciens.

In a particularly preferred embodiment, the invention relates to the plasmids pB33cftf, that is to say a plasmid containing the B33 promoter of the patatin gene, a lacZ-ftf gene fusion and a polyadenylation signal, pB33aftf, that is to say a B33 promoter of the patatin gene, a B33 signal sequence-lacZ-ftf gene fusion and a plasmid containing a polyadenylation signal, pB33vlftf, ie a B33 promoter of the patatin gene, an extended B33 signal sequence-lacZ-ftf gene fusion and a plasmid containing polyadenylation signal and pB33v2ftf, ie a patatin gene B33 promoter, an extended B33 signal sequence-lacZ-ftf gene fusion (without intron in signal sequence) and a plasmid containing polyadenylation signal (FIGS. 1 to 4). Of course, the invention also relates to the gene fusions contained in the aforementioned plasmids without using the lacZ gene sequences located between the patatin sequences and the ftf sequences. The invention also relates to prokaryotic and eukaryotic cells which contain a vector, a plasmid or a DNA sequence of the invention. In particular, the invention relates to the vectors, plasmids or DNA sequences of cells according to the invention, for example bacterial cells or, preferably, plant cells. These can contain the modified fructosyltransferase gene of the invention either transiently or, particularly preferably, stably integrated into their genome. In the context of the present invention, the plant cells according to the invention are understood to be those which either originated directly from the transformation event and accordingly, depending on the chosen transformation method, can be undifferentiated or differentiated or differentiating or differentiated plant cells.

The invention also relates to plants which contain at least one, but preferably a multiplicity, of cells which contain the fructosyl transferase gene according to the invention or vectors or plasmids containing it and, as a result thereof, produce high-molecular inulin. The invention thus makes it possible to provide plants of the most diverse types, genera, families, orders and classes which, owing to the modified fructosyltransferase gene which has been introduced, are able to produce high molecular weight inulin. Since the known plants are not able to produce high molecular weight inulin, the successful implementation of the method according to the invention is easy, for example by antibody tests. Compared to the few known plants producing inulin, there is the advantage that a targeted localization of the inulin formed is possible and that an increase in the expression rate and thus the amount of inulin formed is also achieved. In addition, the inulin according to the invention produced by the gene of bacterial origin according to the invention has a higher molecular weight than vegetable inulin. Here too, the detection of successful transformation with the sequences according to the invention can be demonstrated, for example, by compartment-specific antibody tests, optionally with quantification.

The invention provides in particular that the plant to be transformed is a useful plant, in particular a maize, rice, wheat, barley, sugar beet, sugar cane or potato plant.

The invention also relates to a method for producing the abovementioned plants, comprising the transformation of one or more plant cells with a vector or a plasmid of the invention, the integration of the modified fructosyltransferase gene contained in this vector or plasmid into the genome of the plant cell (s) and the regeneration of the plant cell (s) to intact, transformed, high-molecular inulin-producing plants.

Finally, the invention relates to the high-molecular inulin produced by the plants according to the invention. Compared to inulin naturally occurring in some plants, this is particularly characterized by its high molecular weight of more than 1.5 million daltons. The invention also relates to a method for obtaining inulin from the transformed plants, in particular from their vacuoles.

The figures show:

Figure 1 illustrates the construction of plasmid pB33cftf.

Figure 2 shows the construction of plasmid pB33aftf.

Figure 3 illustrates the construction of plasmid pB33vlftf.

Figure 4 illustrates the construction of plasmid pB33v2ftf.

FIG. 5 shows a Northern blot analysis of the gene expression, ie the ftf-mRNA content, in tubers of selected transformants with the constructs according to the invention.

FIG. 6 shows a thin layer chromatography analysis of the inulin contents of tubers in a series of plants transformed with the plasmid pB33vlftf.

The exemplary embodiments describe the invention in detail.

Embodiment 1 Production of the plasmid pB33cftf and introduction of the corresponding construct into the genome of potato.

The plasmid pB33cftf contains the three fragments A, B and C in the binary vector pBinl9-Hyg (Bevan, Nucl Acids Res (1984) 12, 8711, modified according to Becker, Nucl Acids Res (1990) 18, 203) (cf. 1) .

Fragment A contains the B33 promoter of the potato gene B33 of the potato. It contains a Dral fragment (position: -1512 to position +14) of the patatin gene B33 (Rocha-Sosa et al., EMBO J (1989) 8, 23-29), which is located between the EcoRI and the SacI- Interface of the polylinker of pBin19-Hyg is inserted.

Fragment B is a fusion of nt 780-3191 of the ftf gene from Streptococcus mutans (Genbank EMBL Accession M18954) to a combination of nt 724-716 and nt 759-727 of the plasmid pBluescript KS, which contain the amino terminal amino acids 21-30 which represent ß-galactoside. Due to cloning, an ATG start codon arises before this sequence, which is used for the translation of the fusion product in plants. The sequence up to fusion at nt 780 of the ftf gene is shown below:

AAGCTTGATGTACCGGGCCCCCCCTCGAGGTCGACGGTATCG

724 716 759 727

The nt 780-3191 of the ftf gene were isolated as Earl (filled up with DNA polymerase) / BglII fragment from the plasmid pTS102 (Shiroza and Kuramitsu, J Bacteriol (1988) 170, 810-816). By fusing this fragment of the ftf gene to the DNA Sequence is the exchange of the original N-terminus for the amino-terminal region of the β-galactosidase.

Fragment C contains the polyadenylation signal of gene 3 (octopine synthase gene from Agrobacterium tumefaciens) of the T-DNA of the Ti plasmid pTiAch 5 (Gielen et al., EMBO J. (1984) 3, 835-846), that is to say Nucleotide 11749-11939, which has been isolated as a Pvu II-Hind III fragment from the plasmid pAGV 40 (Herrera-Estrella et al., Nature (1983) 303, 209-213) and after addition of Sph I linkers has been cloned to the Pvu II interface between the Sphl and Hind HI interfaces of the polylinker from pBinl9-Hyg.

The plasmid pB33cftf has a size of approximately 14 kb.

The construct pB33cftf was introduced into potato plants. Intact plants were regenerated from transformed cells. Analysis of the tubers of a number of plants transformed with this gene clearly showed the presence of inulin, which is due to the expression of the gene according to the invention.

Embodiment 2

Production of the plasmid pB33aftf and introduction of the corresponding construct into the genome of potato.

The plasmid pB33aftf contains the three fragments A, B and C in the binary vector pBinl9-Hyg (Bevan, Nucl Acids Res (1984) 12, 8711, modified according to Becker, Nucl Acids Res (1990) 18, 203) (cf. 2). Fragment A contains the B33 promoter of the potato gene B33 of the potato. It contains a Dral fragment (position: -1512 to position +14) of the patatin gene B33 (Rocha-Sosa et al., EMBO J (1989) 8, 23-29), which is between the EcoRI and the SacI- Interface of the polylinker of pBin19-Hyg is inserted.

Fragment B is a fusion of the modified ftf gene from Streptococcus mutans (nt 780-3191, cf. Example 1) to nt 724 to 833 of the patatin gene B33 via a sequence of the nucleotides GTCGACGGTATCG. This sequence (designated as "a" in FIG. 2) contains the coding region for the signal peptide for inclusion in the endoplasmic reticulum (ER) (Rosahl et al., Mol Gen Genet (1986) 203, 214-220; sequence comes from pcT58). Proteins that have such a signal sequence are first included in the ER and then exported to the apoplastic space.

Fragment C contains the polyadenylation signal of gene 3 (octopine synthase gene from Agrobacterium tumefaciens) of the T-DNA of the Ti plasmid pTiAch 5 (Gielen et al., EMBO J (1984) 3, 835-846), that is to say nucleotides 11749 -11939, which was isolated as a Pvu II-Hind III fragment from the plasmid pAGV 40 (Herrera-Estrella et al., Nature (1983) 303, 209-213) and after addition of Sph I linkers to the Pvu II site between the SphI and Hind HI sites of the polylinker from pBinl9-Hyg.

The plasmid pB33aftf has a size of approximately 14 kb. The B33aftf construct was introduced into potato plants. Intact plants were regenerated from transformed cells. Analysis of the tubers of a number of plants transformed with this gene clearly showed the presence of inulin, which is due to the expression of the gene according to the invention.

Embodiment 3

Production of the plasmid pB33vlftf and introduction of the corresponding construct into the genome of potato.

The plasmid pB33vlftf contains the three fragments A, B and C in the binary vector pBinl9-Hyg (Bevan, Nucl Acids Res (1984) 12, 8711, modified according to Becker, Nucl Acids Res (1990) 18, 203) (cf. 3).

Fragment A contains the B33 promoter of the potato gene B33 of the potato. It contains a Dral fragment (position: -1512 to position +14) of the patatin gene B33 (Rocha-Sosa et al., EMBO J (1989) 8, 23-29), which is between the EcoRI and the SacI- Interface of the polylinker of pBin19-Hyg is inserted.

Fragment B is a fusion of the modified ftf gene from Streptococcus mutans (nt 780-3191, see Example 1) to nt 724 to 1399 of the patent gene B33 via a sequence of the nucleotides GTCGACGGTATCG. This sequence (designated as "VI" in FIG. 3) contains the coding region for the signal peptide for inclusion in the ER and the subsequent information for a signal for forwarding into the vacuole (Rosahl et al., Mol Gen Genet (1986) 203, 214-220, sequence comes from pgT5). An intron is inserted into the coding region of this expanded signal sequence. The nucleotide sequence of the intron is removed from the transcript of the chimeric gene by 'splicing'. Proteins that have such a signal peptide are first taken up in the ER and then transported into the vacuole.

Fragment C contains the polyadenylation signal of gene 3 (octopine synthase gene from Agrobacterium tumefaciens) of the T-DNA of the Tl plasmid pTiAch 5 (Gielen et al., EMBO J (1984) 3, 835-846), that is to say nucleotides 11749 -11939, which was isolated as a Pvu II-Hind III fragment from the plasmid pAGV 40 (Herrera-Estrella et al., Nature (1983) 303, 209-213) and after addition of Sph I linkers to the Pvu II site between the SphI and Hind HI sites of the polylinker from pBinl9-Hyg.

The plasmid pB33vlftf has a size of approximately 14 kb.

The construct B33vlftf was introduced into potato plants. Intact plants were regenerated from transformed cells. Analysis of the tubers of a number of plants transformed with this gene clearly showed the presence of inulin, which can be attributed to the expression of the gene according to the invention (see FIG. 6).

Embodiment 4

Production of the plasmid pB33v2ftf and introduction of the corresponding construct into the genome of potato. The plasmid pB33v2ftf contains the three fragments A, B and C in the binary vector pBinl9-Hyg (Bevan, Nucl Acids Res (1984) 12, 8711, modified according to Becker, Nucl Acids Res (1990) 18, 203) (cf. 4).

Fragment B is a fusion of the modified ftf gene from Streptococcus mutans (nt 780-3191, cf. Example 1) to a fragment (designated "V2" in FIG. 4) of the cDNA of the patatin gene B33. The cDNA contains the signal sequence mentioned in embodiment 3 for inclusion in the ER and for forwarding to the vacuole; however, the coding region is not interrupted by an intron (Rosahl et al., Mol Gen Genet (1986) 203, 214-220; nt 724-903 / 1293-1399, sequence comes from pcT58, (payment according to pgT5)). Proteins which have such a signal peptide are first taken up in the ER and then transported into the vacuole.

Fragment C contains the polyadenylation signal of gene 3 (octopine synthase gene from Agrobacterium tumefaciens) of the T-DNA of the Ti plasmid pTiAch 5 (Gielen et al., EMBO J (1984) 3, 835-846), that is to say nucleotides 11749 11939, which has been isolated as a Pvu II-Hind III fragment from the plasmid pAGV 40 (Herrera-Estrella et al., Nature (1983) 303, 209-213) and after addition of Sph I linkers to the Pvu Il interface between the SphI and the Hind HI site of the polylinker from pBinl9-Hyg has been cloned.

The plasmid pB33v2ftf has a size of approximately 14 kb.

The construct B33v2ftf was introduced into potato plants. Intact plants were regenerated from transformed cells. Analysis of the tubers of a number of plants transformed with this gene clearly showed the presence of inulin, which is due to the expression of the gene according to the invention.

Embodiment 5

Evidence of the inulin formed

Tuber material was homogenized in 100 mM sodium acetate, pH 5.6 in the presence of insoluble polyvinylpyrrolidone (1 ml / 100 mg material), incubated for 30 min at 65 ° C. and then filtered at 65 ° C. 15 ml of homogenate were incubated with 15 μl RNAse A (1 mg / ml) and 15 μl DNAse (10 mg / ml) for 30 min at 37 ° C., then with 20 μl ProteinaseK (20 mg / ml) for 30 min at 60 ° C. . Inulin was precipitated from the homogenate by adjusting to 80% ethanol and centrifuged. The sediment was dissolved in 50 μl of water at 75 ° C. and precipitated again with 80% ethanol. The sediment was then dissolved in 30 μl of water at 75 ° C., 4 μl of the solution were analyzed by thin-layer chromatography or treated with an excess of endoinulinase at 56 ° C. for 15 min.

Transformation and regeneration protocol for potatoes The potatoes were grown according to (Potrykus I., Spangen¬berg G. (ed.), 1995, "Genetransfer to plants", Dietze J., Blau A., Willmitzer L., "A Bacteria Mediated Transformation of Potato", Springer Lab Manual, pages 24-39) transformed and regenerated.

Processing and extraction of the inulin formed

Potato tubers are washed and then chopped with a grater (for example from Nivoba) to grater. The friction eggs are then passed with a water stream over hydrocyclones and divided into pulp, solid and amniotic fluid fractions. The solid fraction consisting essentially of inulin is cleaned by washing with water and dried.

Claims

Expectations

1. Modified fructosyltransferase gene in which the amino-terminal region of a fructosyltransferase gene is replaced by at least one region of a patatin gene and which encodes a protein with the biological activity of an inulin sucrase.

2. Modified fructosyltransferase gene according to claim 1, the region of a patatin gene being its amino terminal region.

3. Modified fructosyltransferase gene according to claim 1 or 2, the patatin gene originating from the potato.

4. Modified fructosyltransferase gene according to any one of claims 1 to 3, wherein the patatin gene is the B-33 gene.

5. Modified fructosyltransferase gene according to one of claims 1 to 4, wherein the amino-terminal region of the patatin gene is a signal sequence encoding a signal peptide.

6. Modified fructosyltransferase gene according to one of claims 1 to 5, wherein the signal sequence encodes a signal peptide for incorporating the gene into the endoplasmic reticulum of a eukaryotic cell.

7. Modified fructosyltransferase gene according to one of claims 1 to 6, wherein the signal sequence encodes a signal peptide for taking up the gene in the endoplasmic reticulum of a eukaryotic cell and for forwarding it to the vacuole.

8. Modified fructosyltransferase gene according to one of claims 1 to 7, wherein the signal sequence comprises the extended signal sequence of a patatin gene from potato, in particular the 60 amino terminal amino acids of the propeptide encoded by the patatin B33 gene.

9. Modified fructosyltransferase gene according to one of claims 1 to 8, wherein downstream (3 ') of the region of the patatin gene and upstream (5') of the truncated fructosyltransferase gene are sequences of another gene.

10. Modified fructosyltransferase gene according to one of claims 1 to 9, wherein the other gene is the lacZ gene from Escherichia coli or the carboxypeptidease Y gene.

11. Modified fructosyltransferase gene according to one of claims 1 to 10, wherein the amino-terminal region of the lacZ gene encodes the amino-terminal amino acids 21 to 30 of β-galactosidase.

12. Modified fructosyl transferase gene according to one of claims 1 to 11, wherein the fructosyl transferase gene originates from Streptococcus mutans.

13. Modified fructosyltransferase gene according to one of claims 1 to 12, wherein the amino-terminal region to be replaced of the fructosyltransferase gene is its signal peptide coding sequence.

14. Vector containing a modified fructosyltransferase gene according to one of claims 1 to 13.

15. Vector according to claim 14, containing a modified fructosyltransferase gene according to one of claims 1 to 13, which is under the control of a promoter active in plants, in particular an organ-specific promoter.

16. Vector according to one of claims 14 or 15, wherein the promoter is the B33 promoter of the patatin B33 gene from potato.

17. Vector according to one of claims 14 to 16, wherein the 3 'terminus of the modified fructosyl transferase gene according to one of claims 1 to 13 is based on a transcription termination signal, in particular a polyadenylation site of the nos gene.

18. Plasmids pB33cftf, pB33aftf, pB33vlftf and pB33v2ftf.

19. Cell containing a vector, a plasmid or a modified fructosyltransferase gene according to one of claims 1 to 18.

20. Cell according to claim 19, which is a bacterial or plant cell, in particular a maize, rice, wheat, barley, sugar beet, sugar cane or potato plant cell.

21. Plant containing at least one cell according to claim 20, in particular a maize, rice, Wei¬ zen, barley, sugar beet, sugar cane or potato plant.

22. Seeds and fruits of a plant according to claim 21.

23. A method for producing a genetically modified inulin-producing plant, comprising

a) the transformation of one or more plant cells with a vector or plasmid according to any one of claims 14 to 18,

b) the integration of the modified fructosyl transferase gene contained in the vectors or plasmids into the genome of the transformed cell (s), and

c) the regeneration of intact, high-molecular inulin-producing plants.

24. High molecular weight inulin with a molecular weight of more than 1.5 million daltons, obtainable from a plant according to claim 21.

25. A method for obtaining high molecular weight inulin, this from plants according to claim 21, in particular their vacuoles, is isolated and cleaned.

26. Use of the peptide containing the 60 amino terminal amino acids of the patatin B33 propeptide or of the DNA sequences coding for this peptide for the transport of a gene product into a plant vacuole.