EP0937154A2 - Chimera gene with several herbicide resistant genes, plant cell and plant resistant to several herbicides - Google Patents

Chimera gene with several herbicide resistant genes, plant cell and plant resistant to several herbicides

Info

Publication number
EP0937154A2
EP0937154A2 EP97932879A EP97932879A EP0937154A2 EP 0937154 A2 EP0937154 A2 EP 0937154A2 EP 97932879 A EP97932879 A EP 97932879A EP 97932879 A EP97932879 A EP 97932879A EP 0937154 A2 EP0937154 A2 EP 0937154A2
Authority
EP
European Patent Office
Prior art keywords
ala
herbicide
plants
leu
val
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP97932879A
Other languages
German (de)
French (fr)
Inventor
Ken Pallett
Richard Derose
Bernard Pelissier
Alain Sailland
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Bayer CropScience SA
Original Assignee
Rhone Poulenc Agrochimie SA
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Family has litigation
First worldwide family litigation filed litigation Critical https://patents.darts-ip.com/?family=9494283&utm_source=google_patent&utm_medium=platform_link&utm_campaign=public_patent_search&patent=EP0937154(A2) "Global patent litigation dataset” by Darts-ip is licensed under a Creative Commons Attribution 4.0 International License.
Application filed by Rhone Poulenc Agrochimie SA filed Critical Rhone Poulenc Agrochimie SA
Publication of EP0937154A2 publication Critical patent/EP0937154A2/en
Withdrawn legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
    • C12N15/8202—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation by biological means, e.g. cell mediated or natural vector
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
    • A01N43/00—Biocides, pest repellants or attractants, or plant growth regulators containing heterocyclic compounds
    • A01N43/72—Biocides, pest repellants or attractants, or plant growth regulators containing heterocyclic compounds having rings with nitrogen atoms and oxygen or sulfur atoms as ring hetero atoms
    • A01N43/80—Biocides, pest repellants or attractants, or plant growth regulators containing heterocyclic compounds having rings with nitrogen atoms and oxygen or sulfur atoms as ring hetero atoms five-membered rings with one nitrogen atom and either one oxygen atom or one sulfur atom in positions 1,2
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
    • A01N57/00—Biocides, pest repellants or attractants, or plant growth regulators containing organic phosphorus compounds
    • A01N57/02—Biocides, pest repellants or attractants, or plant growth regulators containing organic phosphorus compounds having alternatively specified atoms bound to the phosphorus atom and not covered by a single one of groups A01N57/10, A01N57/18, A01N57/26, A01N57/34
    • A01N57/04—Biocides, pest repellants or attractants, or plant growth regulators containing organic phosphorus compounds having alternatively specified atoms bound to the phosphorus atom and not covered by a single one of groups A01N57/10, A01N57/18, A01N57/26, A01N57/34 containing acyclic or cycloaliphatic radicals
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
    • C12N15/8274—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for herbicide resistance
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
    • C12N15/8274—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for herbicide resistance
    • C12N15/8275—Glyphosate
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
    • C12N15/8274—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for herbicide resistance
    • C12N15/8277—Phosphinotricin
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/0069—Oxidoreductases (1.) acting on single donors with incorporation of molecular oxygen, i.e. oxygenases (1.13)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/1085—Transferases (2.) transferring alkyl or aryl groups other than methyl groups (2.5)
    • C12N9/1092—3-Phosphoshikimate 1-carboxyvinyltransferase (2.5.1.19), i.e. 5-enolpyruvylshikimate-3-phosphate synthase
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/78—Hydrolases (3) acting on carbon to nitrogen bonds other than peptide bonds (3.5)

Definitions

  • the present invention relates to a chimeric gene with several herbicide tolerance genes, a plant cell and a plant tolerant to several herbicides.
  • the herbicides will be designated by the common name in particular referenced in "The Pesticide Manual” 10 th edition by British Crop Protection Council.
  • Plants are known which have been transformed to be tolerant to certain herbicides such as in particular the dihalogenohydroxybenzonitriles, in particular bromoxynil and ioxyml, thanks to the gene coding for the nitrilase degrading these herbicides or those tolerant to herbicides inhibiting EPSPS in particular.
  • herbicides such as in particular the dihalogenohydroxybenzonitriles, in particular bromoxynil and ioxyml
  • ALS acetolactatesynthase inhibitors
  • Certain herbicides are known, such as the isoxazoles described in particular in French patent applications 95 06800 and 95 13570 and in particular isoxaflutole, a selective corn herbicide, diketonitriles such as those described in European applications 0 496 630, 0 496 631, in particular 2-cyano-3-cyclopro ⁇ yl-l- (2-S ⁇ 2 CH3-4-CF3 phenyl) propane-1, 3-dione and 2-cyano-3-cyclopropyl-l- (2-S ⁇ 2 CH3-4 -2.3 CI2 phenyl) propane-1, 3-dione, the triketones described in European applications 0 625 505 and 0 625 508, in particular sulcotrione or those described in USP 5 506 195, or also pyrazolinates .
  • the gene coding for HPPD conferring tolerance to the latter herbicides has been isolated and transgenic plants containing it obtained showing significant tolerance and are the subject of unpublished French applications N ° 95/06800
  • the present invention firstly relates to a chimeric gene comprising at least two elementary chimeric genes 1 each containing, in the direction of transcription, regulatory elements necessary for its transcription in plants, that is to say at least a promoter regulatory sequence, at least one heterologous coding part comprising a coding sequence coding for an enzyme conferring on plants tolerance to a herbicide and at least one terminating or polyadenylation regulatory sequence.
  • glyphosate oxidoreductase cf. WO 92/000 377) a detoxification enzyme for glyphosate.
  • This HPPD can be of any kind. More particularly, this sequence can be of bacterial origin, such as in particular the genus Pseudomonas or also of vegetable origin, such as in particular of monocotyledonous or dicotyledonous plant, in particular ⁇ 'Arabidopsis or umbelliferae such as for example carrot (Daucus carota) . It can be native or wild or possibly mutated while fundamentally retaining a herbicidal tolerance property against HPPD inhibitors, such as herbicides of the isoxazole family or that of the triketones or pyrazolinates.
  • HPPD inhibitors such as herbicides of the isoxazole family or that of the triketones or pyrazolinates.
  • one of the chimeric genes contains a coding sequence for HPPD
  • the other or the other sequences may be any and in particular chosen from the group mentioned above
  • the other sequences are chosen from the group comprising the dihalogenohydroxybenzonitriles tolerance nitrilase gene and an EPSPS gene
  • the chimeric genes according to the invention can also contain genes coding for properties other than herbicide tolerance such as for example insect resistance genes, such as those of the Bacillus thurigensis type conferring resistance to various representatives of the family of beetles, lepidoptera, or genes for resistance to nematodes, genes for resistance to fungal or microbial diseases, or genes conferring agronomic properties such as the genes of the various desaturases involved in the production of fatty acids. particularly that of delta -6 desaturase described in international application WO 93/06712
  • promoter regulatory sequence it is possible to use any promoter sequence of a gene which is naturally expressed in plants, in particular a promoter of bacterial, viral or plant origin such as, for example, that of a gene for the small sub- ⁇ bulose-biscarboxylase unit (RuBisCO) or that of a tubuhne gene (European Application EP n ° 0 652 286), or of a plant virus gene such as, for example, that of the cauliflower mosaic (CaMV 19S or 35S), but any known suitable promoter can be used.
  • a promoter regulatory sequence is used which promotes the overexpression of the coding sequence, such as for example, that comprising at least one histone promoter as described in European application EP 0507698.
  • promoter regulatory sequence other regulatory sequences, which are located between the promoter and the coding sequence, such as enhancer enhancers, such as p.
  • enhancer enhancers such as p.
  • transit peptides either single or double, and in this case possibly separated by an intermediate sequence, it is to say comprising, in the direction of transcription, a sequence coding for a transit peptide of a plant gene coding for an enzyme with plastid localization, a p ⁇ irue of sequence of the mature N terminal appeared of a plant gene coding for an enzyme with plastid location, then a sequence coding for a second transit peptide of a plant gene coding for an enzyme with plastid location, consisting of a p.arue of sequence of part m ature N terminal of a plant gene coding for an enzyme with plastid localization, as described
  • any corresponding sequence of bacterial origin such as for example the terminator nos â'Agrobacterium lumefaciens, or of plant origin, such as for example a histone terminator as described in European application EP n ° 0633 317
  • the subject of the invention is also a plant cell, of monocotyledonous or dicotyledonous plants, especially cultures, tolerant of at least two herbicides, at least one of which is an HPPD inhibitor.
  • This cell can contain at least two chimeric genes each comprising a sequence coding for tolerance to a herbicide and one of which comprises a sequence coding for HPPD.
  • the two chimeric genes can either be carried by the same vector, or each on a different vector, or else brought as such by introduction into the cell by physical or physicochemical means, for example by microinjection, electroporation or bombardment, according to methods known per se.
  • the subject of the invention is also a transformed plant tolerant to at least two herbicides, one of which is an HPPD inhibitor.
  • This plant can be obtained either by crossing at least two plants each containing a gene coding for tolerance to a herbicide, or by regeneration of a cell according to the invention, as described above
  • the plants can be monocots or dicots, especially crops, field crops such as for example but not limited to dicots tobacco, cotton, rapeseed, soybeans, beets, and for monocots, corn and straw cereals, or still vegetable or floral crops
  • the subject of the invention is also a process for obtaining plants with multiple herbicide tolerance by plant trangenesis, characterized in that
  • Another subject of the invention is another process for obtaining plants with multiple herbicide tolerance by plant truuigenesis, a first step comprising the integration into plant cells of at least two genes for tolerance to a herbicide, including at least one is an HPPD inhibitor, the second step comprising the regeneration of the plant from the cells transformed according to the invention.
  • the transformation can be obtained by any suitable known means, fully described in the specialized literature and in particular the applications and patents cited in the present application.
  • the series of methods consists in bombarding cells or protoplasts with particles to which the DNA sequences are attached. According to the invention, these DNAs can be carried by the same particles or by different bombardments.
  • Another series of methods consists in using as a means of transfer into the plant a chimeric gene inserted into a Ti plasmid of Agrobactenum tumefaciens or Ri of Agrobactenum rhizogenes
  • plants transformed according to the invention exhibit significant tolerance to inhibitors of hydroxyphenyl pyruvate dioxygenase such as certain recent herbicides such as isoxazoles described in particular in French patent applications 9506800 and 95 13570 and in particular 4- [4-CF3-2- (methylsulfony 1) benzoyl] -5- cyclopropyl isoxazole.ou "îsoxaflutole", selective corn herbicide, diketomt ⁇ les such as those described in European applications 0496 630, 0496 631, in particular 2- cyano- 3-cyciopropyl- l- (2-S ⁇ 2 CH3-4-CF3 phenyl) propane- 1, 3 -dione and 2-cyano-3-cyclopropyl-l- (2-S ⁇ 2 CH3-4-2 CI2 phenyl) propane-1, 3-d ⁇ one, the triketones determined in European applications 0 625 505 and 0 625 508, in particular sulcot ⁇ one
  • a subject of the present invention is also plants regenerated from transformed cells. Regeneration is obtained by any suitable process which depends on the nature of the species, as for example described in the applications above.
  • the plants according to the invention can also be obtained by crossing parents, each of them carrying one of the herbicide tolerance genes dec ⁇ tes.
  • the invention finally relates to a process for weeding plants, especially crops, using a herbicide of this type, caracté ⁇ sé in that this herbicide is applied to plants transformed according to the invention, both in pre-plant, pre-emergence and post-emergence of the crop.
  • herbicide within the meaning of the present invention is meant a herbicidal active material alone or associated with an additive which modifies its effectiveness such as for example an agent increasing activity (synergist) or limiting activity (in English safener).
  • an agent increasing activity soynergist
  • limiting activity in English safener
  • the above herbicides are associated in known manner with the adjuvants of formulations usually used in agrochemistry.
  • one of the herbicide tolerance genes present in plants can be used as a marker for selection, either in vitro or in vivo
  • the various aspects of the invention will be better understood with the aid of the experimental examples below.
  • Example I Isolation of the HPPD gene from P. fluorescens A32. From the amino acid sequence of the HPPD of Pseudomonas sp. PJ 874 (published by R ⁇ etschi U. et al. 1992. Eur. J. Biochem. 205: 459-466), the sequence of different oligonucleotides is deduced to amplify by PCR a part of the coding sequence of the HPPD of P. fluorescens A32 (isolated by McKellar, RC 1982. J. Appl Bacteriol. 53: 305-316). An amplification fragment of the gene for this HPPD was used to screen a partial genomic library of P. fluorescens A32 and thus to isolate the gene coding for this enzyme.
  • the bacterium was cultivated in 40 ml of minimum medium M63 (KH2PO4 13.6 g / l, (NH4) 2S04 2g / l, MgS04 0.2g / l, FeS04 0.005 g / 1 pH7 plus L-tyrosine lOmM as the only source of carbon) at 28 ° C for 48 hours.
  • M63 KH2PO4 13.6 g / l, (NH4) 2S04 2g / l, MgS04 0.2g / l, FeS04 0.005 g / 1 pH7 plus L-tyrosine lOmM as the only source of carbon
  • the cells are taken up in 1 ml of lysis buffer (tris HCl 100 tnM pH 8.3, 1.4 M NaCl and 10 mM EDTA) and incubated for 10 minutes at 65 ° C.
  • lysis buffer tris HCl 100 tnM pH 8.3, 1.4 M NaCl and 10 mM EDTA
  • the nucleic acids are precipitated by adding a volume of isopropanol then taken up in 300 ⁇ l of sterile water and treated with RNAse 10 ⁇ g / ml final.
  • the DNA is again treated with phenol / chloroform, chloroform and reprecipitated by addition of 1/10 of volume of 3M sodium acetate pH5 and 2 volumes of ethanol.
  • the DNA is then taken up in sterile water and assayed.
  • a 3 ′ end of the stable oligonucleotide that is to say at least two bases without ambiguity. - the lowest possible degeneration.
  • oligonucleotides chosen have the following sequences: PI: 5TA (C / T) GA (G / A) AA (C / T) CCIATGGG3 'P2: 5'GA (G / A) ACIGGICCIATGGA3' P3: 5'AA (C / T) TGCATIA (G / A) (G / A) AA (C r) TC (C / T) TC3 'P4: 5 ⁇ AIGCIAC (G / A) TG (C ⁇ TG (T / G / A) ATICC3'
  • primers PI and P3> approximately 690 bp with the primers PI and P4> approximately 720 bp with primers PI and P5> approximately 1000 bp with primers P2 and P3> approximately 390 bp with primers P2 and P4> approximately 420 bp with primers P2 and P5> approximately 700 bp
  • Taq polymerase PERKIN ELMER with its buffer under standard conditions, ie for 50 ⁇ l of reaction there are dNTPs at 200 ⁇ M, p ⁇ mers at 20 ⁇ M, Taq polymerase 2.5 units and DNA from P. fluorescens A32 2.5 ⁇ g.
  • the amplification program used is, 5 min at 95 ° C then 35 cycles ⁇ 45 sec 95 ° C, 45 sec 49 ° C, 1 min 72 ° C> followed by 5 min at 72 ° C
  • the amplification fragments obtained with the primer sets P1 / P4, P1 / P5 and P2 / P4 are ligated into pBSII SK (-) after digestion of this plas ⁇ ude by Eco RV and treatment at the terminal transferase in the presence of ddTTP as dec ⁇ t in HOLTON TA and GRAHAM MW 1991 N AR vol 19, n ° 5 pi 156
  • fragments are ligated into pBSII SK (-), itself digested with Bam HI and dephosphorylated by treatment with alkaline phosphatase. After tr, ansformat ⁇ on in E. coh DHlOb, the partial genomic library is screened with the HPPD P1 / P4 probe.
  • pRP A A positive clone was isolated and called pRP A. Its simplified map is given in Figure 2. On this map is indicated the position of the codimit part of the HPPD gene. It is composed of 1077 nucleotides which code for 358 amino acids (see SEQ ID N ° 1). P's HPPD fluorescens A32 has good amino acid homology with that of Pseudomonas sp strain PJ 874, there is indeed 92% identity between these two proteins (see Figure 3)
  • Example 2 Construction of two chimeric genes with an HPPD sequence. To confer plant tolerance to herbicides that inhibit HPPD, two chimeric genes are constructed
  • the first consists in putting the coding part of the HPPD gene of P fluorescens A32 under the control of the double histone promoter (European Patent Application No. 0 507 698) followed by Tobacco etch virus translational enhancer (TEV) (pRTL-GUS (Car ⁇ ngton and Freed, 1990; J. Virol. 64: 1590-1597)) with the terminator of the nopaline syntliase gene.
  • TSV Tobacco etch virus translational enhancer
  • HPPD HPPD will then be localized in the cytoplasm.
  • the second will be identical to the first, except that between the activator of TEV tr ⁇ slation and the coding part of the HPPD, the optimized transit peptide (OTP) is inserted (European Application EP n ° 0 508 909).
  • OTP optimized transit peptide
  • the Kpnl site is transformed into a N " otI site by treatment with T4 DNA polymerase I in the presence of 150 ⁇ of deoxynucleotide t ⁇ phoshates then ligation with a Notl linker (Stratagene catalog # 1029). This gives a polyOS NOS cloning cassette.
  • pRPA-BL-488 was digested with Xbal and HindIII to isolate a 1.9 kbp fragment containing the SSU promoter and the oxy gene, which was ligated into the plasmid pRPA-RD-11 digested with compatible enzymes .
  • pRPA-RD-132 It is a derivative of pRPA-BL-488 (European Application EP No. 0 507 698) cloned in pRPA-RD-127 with creation of an expression cassette for the oxy gene with the promoter double histone:
  • pRPA-BL-466 is digested with HindIII, treated with Klenow then redigested with Ncol.
  • the purified 1.35 kbp fragment containing the double histone promoter H3A748 is ligated with the plasmid pRPA-RD-127 which had been digested with Xbal, treated Klenow and redigested by Ncol.
  • pRPA-RD- 153 It is a derivative of pRPA-RD- 132 containing the translational activator of the tobacco etch virus (TEV) pRTL-GUS (Camngton and Freed. 1990: J. Virol. 64 * 1590- 1597) is digested with Ncol and EcoRI and the 150 bp fragment is ligated into pRPA-RD-132 digested with the same enzymes. So we created an expression cassette containing the promoter:
  • Linker 1 AATTGGGCCA GTCAGGCCGT TTAAACCCTA GGGGGCCCG
  • the selected clone contains an EcoRI site followed by the polylinker which contains the following sites: EcoRI. Apal, Avril, Pmel, Sfil, Sacl, Kpnl, Smai, BamHI, Xbal, Sali, Pstl. SphI and HindIII.
  • pRPA-RD-185 it is a derivative of pUC19 / GECA containing a modified polylinker.
  • pUC19 / GECA is digested with HindIII and ligated with the oligonucleotide linker 2:
  • Linker 2 AGCTTTTAAT TAAGGCGCGC CCTCGAGCCT GGTTCAGGG
  • the selected clone contains a HindIII site in the middle of the polylinker which now contains the following sites: EcoRI, Apal, Avril, Pmel, Sfil, Sacl, Kpnl, Smai, BamHI, Xbal, Sali. Pstl, SphI, HindIII, Pacl, Ascl Xhol and EcoNI.
  • pRP T - pRP O: a derivative of pRPA-RD-153 containing an HPPD expression cassette, double histone promoter - TEV - HPPD gene - Nos terminator.
  • pRPA-RD153 is digested with Hind III, treated with Klenow then redigested with Ncol to remove the oxy gene and replace it with the HPPD gene taken out of the plasmid pRP A by BstEII digestion, Klenow treatment and redigestion by Ncol.
  • the pRP T vector chimera gene therefore has the following structure:
  • the plasmid pRPA-RD-153 is digested with Sal I, treated with Klenow then redigested with Ncol to remove the oxy gene and replace it with the HPPD gene released from the plasmid pRP F 'by BstEII digestion. Klenow treatment and redigestion by Ncol - pRP S: to obtain it, the plasmid pRP Q was digested with PvuII and Sacl to extract the chimeric gene which was ligated in pRPA-RD-185 itself digested by PvuII and Sacl.
  • the chimeric gene of the vector pRP Q therefore has the following structure.
  • Example 3 Processing of PBD6 industrial tobacco.
  • the vector is introduced into the non-oncogenic strain of Agrobactenum EHA 101 (Hood et al, 1987) carrying the cosmid pTVK 291 ( Koma ⁇ et al, 1986).
  • the transformation technique is based on the procedure of Horsh R. et al. (1985) Science, 227, 1229-1231.
  • Regeneration The regeneration of PBD6 tobacco (from SEITA France) from leaf explants is carried out on a Murashige and Skoog (MS) base medium comprising 30 g / l of sucrose as well as 100 ⁇ g / ml of kanamycin.
  • the leaf explants are taken from plants in the greenhouse or in vitro and transformed according to the technique of leaf discs (Science 1985Nol 227. p.1229-1231) in three successive stages: the first comprises the induction of shoots on an added MS medium 30g / l of sucrose containing 0.05mg / l of naphthiaciacetic acid (AN A) and 2 mg / 1 of benzylaminopurine (BAP) for 15 days.
  • MS medium 30g / l of sucrose containing 0.05mg / l of naphthiaciacetic acid (AN A) and 2 mg / 1 of benzylaminopurine (BAP) for 15 days.
  • AN A naphthiaciace
  • the shoots formed during this stage are then developed by culture on an MS medium supplemented with 30 g / l of sucrose but containing no hormone, for 10 days. Then developed shoots are taken and cultivated on an MS rooting medium with half content of salts, vitamins and sugars and containing no hormone. After about 15 days, the rooted shoots are put in the ground. The plants obtained are called Co 17.
  • the transformed tobacco seedlings were acclimated in the greenhouse (60% relative humidity; temperature: 20 ° C at night and 23 ° C during the day) for five weeks then treated with 4- [4-CF3-2- (methylsulfonyl) benzoyl] -5-cyclopropyl isoxazole.
  • the overexpressed enzyme is in the chloroplast, that is to say if the transformation was made with the gene carried by the vector pRP V, then the plant is perfectly protected, has no symptoms.
  • columbia was obtained from Clontech (catalog reference: 6970-1) c) 50 nanograms (ng) of DNA are mixed with 300ng of each of the oligonucleotides and subjected to 35 amplification cycles with a Perkin-Elmer 9600 device, under standard medium conditions for the amplification recommended by the supplier.
  • the resulting 204 bp fragment constitutes the EPSPS fragment from Arabidopsis thaliana.
  • RNA-polyA + fraction of the RNA fraction is obtained by chromatography on an oligo-dT cellulose column as described in "Current Protocols in Molecular Biology".
  • the cDNAs presenting at their ends the EcoRI cohesive artificial sites are ligated with the cDNA of the bacteriophage ⁇ gt10 cut by EcoRI and dephosphorylated according to the protocol of the supplier New England Biolabs
  • An ahquote of the ligation reaction was packaged in vitro with packaging extracts - Gigapack Gold according to the supplier's instructions, this library was titrated using the E.coli C600hf bacteria.
  • the library thus obtained is amplified and stored according to the instructions of the same supplier and constitutes the library of cDNA of cell suspension of corn BMS 3 Screening of the library of cDNA of cell suspension of corn BMS with the EPSPS probe of Arabidopsis thaliana
  • the specific activity obtained is of the order of 10 & cpm per ⁇ g of fragment. After denaturation for 5 min at 100 ° C., the probe is added to the prehyb ⁇ dation medium and the hybridization is continued for 14 hours at 55 ° C. Filters are fluorographs 48h to -
  • Two ⁇ l of the above ligation mixture are used for the transformation of an aliquot of electro-competent E. coli DH10B; the transformation is done by electroporation using the following conditions: the mixture of competent bacteria and ligation medium is introduced into an electroporation cuvette of 0.2 cm thickness (Biorad) previously cooled to 0 ° C.
  • the physical conditions of electroporation using a Biorad brand electroporator are 2500 Volts, 25 ⁇ Farad and 200 ⁇ . Under these conditions, the average capacitor discharge time is of the order of 4.2 milliseconds.
  • the bacteria are then taken up in 1 ml of SOC medium (ref.
  • Clones with an insert of 1.7kbp are kept One last verification consists in ensuring that the purified DNA does indeed present a hybridization signal with the EPSPS probe from Arabidopsis thaliana After the electrophoresis, the DNA fragments are transferred onto Amersham Hybond N membrane according to the protocol of Southern described in "Current Protocols m Molecular Biology" The filter is hybridized with the EPSPS probe from Arabidopsis thaliana according to the conditions set out in paragraph 3 above.
  • the plasmid clone having an insert of 1.7 kbp and hybridizing with the probe EPSPS d Arabidopsis thaliana was prepared on a larger scale and the DNA resulting from the lysis of bacteria purified on a CsCl gradient as described in "Current Protocols in Molecular Biology".
  • the purified DNA was partially sequenced with a Pharmacia kit following the supplier's instructions and using as primers, the direct and reverse M13 universal primers ordered from the same supplier.
  • the partial sequence performed covers approximately 0.5 kbp.
  • the amino acid derivative sequence in the region of the mature protein (approximately 50 amino acid residues) has 100% identity with the corresponding amino sequence of the mature EPSPS of but described in US Patent USP 4,971,908).
  • This clone corresponding to an EcoRI fragment of 1.7 kbp of the EPSP DNA from the corn cell suspension BMS was named pRPA-ML-711.
  • the complete sequence of this clone was carried out on the two bnns using the protocol of the Pharmacia kit and by synthesizing complementary oligonucleotides and of opposite direction every 250 bp approximately.
  • the complete sequence of this 1713 bp clone obtained is presented by SEQ ID No. 2. 6.
  • Obtaining of the clone pRPA-ML-715 Analysis of the sequence of the clone pRPA-ML-711 and in particular the comparison of the amino acid sequence derived from that of corn shows a 92 bp sequence extension upstream of the GCG codon coding for NH2-terminal Alanine of the mature part of the corn EPSPS (US Patent USP 4,971,908). Similarly, a 288 bp extension downstream of the AAT codon coding for COOH-terminal asparagine of the mature part of the corn EPSPS (US Patent USP 4,971,908) is observed. These two parts could correspond, for the NH2-terminal extension to a portion of the sequence of a transit peptide for plastid localization and for the COOH-terminal extension to the 3 'untranslated region of the cDNA.
  • the clone pRPA-ML-711 was cut by the restriction enzyme Asel and the ends resulting from this cleavage made blunt by treatment with the Klenow fragment of DNA polymerase I according to the protocol described in CPMB. A cut by the enzyme of Sacll restriction was then performed. The DNA resulting from these operations was separated by electrophoresis on agarose gel LGTA / TBE (ref. CPMB) 1%.
  • the gel fragment containing the 0.4 kob "Asel-blunt ends / SacII" insert was excised from the gel and purified according to the protocol described in paragraph 5 above.
  • the DNA of the pRPA-ML-71 1 cione was cut with the restriction enzyme HindIII located in the polylinker of the cloning vector pUC 19 and the ends resulting from this cleavage were made blunt by treatment with the Klenow fragment of DNA polymerase I.
  • a cut by the restriction enzyme Sac11 was then carried out.
  • the DNA resulting from these manipulations was separated by electrophoresis on an agarose gel LGTA / TBE (ref. CPMB) 0.7%.
  • the gel fragment containing the HindIII blunt end / SacII insert of approximately 3.7 kbp was excised from the gel and purified according to the protocol described in paragraph 5 above.
  • the two inserts were ligated, and 2 ⁇ l of the ligation mixture were used to transform E. coli DH1OB as described above in paragraph 5.
  • the plasmid DNA content of different clones is analyzed according to the procedure described for pRPA-ML- 71 1.
  • One of the plasmid clones selected contains an EcoRI-HindlJJ insert of about 1.45 kbp.
  • the sequence of terminal ends of this clone reveals that the 5 'end of the insert corresponds exactly to the corresponding end of pRPA-ML-71 1 and that the 3' terminal end has the following sequence: "5J .. A ⁇ ITAAGCTCTAGAGTCGACCTGCAGGCATGCAAGCTT-3 '".
  • the underlined sequence corresponds to the COOH-terminal amino acid codon asparagine, the next codon corresponding to the translation stop codon.
  • the nucleotides downstream correspond to elements of the pUCI9 polylinker sequence.
  • This clone comprising the sequence of pRPAML-71 1 up to the translation termination site of mature corn EPSPS and followed by polylinker sequences from pUC 19 to the HindIII site was named pRPA-ML-712.
  • b) Modification of the 5 'End of pRPA-ML-712 Construction of pRPA-ML-715 The clone pRPA-ML-712 was cut by the restriction enzymes Pstl and Hinii ⁇ l.
  • Oligol 5-GAGCCGAGCTCCATGGCCGGCGCCGAGGAGATCGTGCTGCA-3 'Oligo 2: 5'-GCACGATCTCCTCGGCGCCGGCCATGGAGCTCGGCTC-3' as well as in the presence of DNA of the plasmid pUC19 digested by the restriction enzymes BamHI and HindIII. Two ⁇ l of the ligation mixture were used to transform E. coli DH1OB as described above in paragraph 5 After analysis of the plasmid DNA content of different clones according to the procedure described above in paragraph 5. one of the clones having an insert d approximately 1.3 kbp was kept for further analysis.
  • sequence of the 5 ′ end of the clone retained reveals that the DNA sequence in this region is as follows: sequence of the polylinker of pUC19 from the EcoRI sites to BamHI, followed by the sequence of the oligonucleotides used during the cloning, followed by the rest of the sequence present in pRPAML-712.
  • This clone was named pRPA-ML-713.
  • This clone has an ATG methionine codon included in an NcoFen site upstream of the N-terminal Alanine codon of mature EPSPSynthase.
  • the alanine and glycine codons of the N-terminal end were conserved, but modified on the third variable base: initial GCGGGT gives modified GC ⁇ GG ⁇ .
  • the clone pRPA-ML-713 was cut with the restriction enzyme HindIII and the ends of this cut made blunt by treatment with the Klenow fragment of DNA polymerase I. A cut with the restriction enzyme Sacl was then performed. The DNA resulting from these manipulations was separated by electrophoresis on an agarose gel LGTA TBE (ref CPMB) 0.8%. The gel fragment containing the 1.3 kbp "HindIII-blunt ends / Sad" insert was excised from the gel and purified according to the protocol described in paragraph 5 above.
  • This insert was ligated in the presence of DNA of the plasmid pUC19 digested with the restriction enzyme Xbal and the ends of this cleavage made blunt by treatment with the Klenow fragment of DNA polymerase I. A cleavage with the Sacl restriction enzyme was then performed. Two ⁇ l of the ligation mixture were used to transform E. coli DH1OB as described above in paragraph 5. After analysis of the plasmid DNA content of different clones according to the procedure described above in paragraph 5, one of the clones having an insert approximately 1.3 kbp was kept for later analysis.
  • sequence of terminal ends of the clone retained reveals that the DNA sequence is as follows: sequence of the polylinker of pUC19 from the EcoRI sites to Sac1, followed by the sequence of the oligonucleotides used during the deleted cloning of the 4 bp GATCC of the oligonucleotide 1 decnt ci above, followed by the rest of the sequence present in pRPA-ML-712 to the HindIII site and the polylinker sequence of pUC19 from Xbal to HindIII.
  • This clone was named pRPA-ML-715.
  • mutagenesis steps were carried out with the USE mutagenesis kit from Pharmacia following the supplier's instructions.
  • the principle of this mutagenesis system is as follows: the plasmid DNA is denatured by heat and reassociated in the presence of a molar excess on the one hand of the mutagenesis oligonucleotide, and on the other hand of an oligonucleotide allowing to eliminate a unique restriction enzyme site present in the polylinker. After the reassociation step, the synthesis of the complementary strand is carried out by the action of T4 DNA polymerase in the presence of T4 DNA ligase and gene 32 protein in an appropriate buffer provided.
  • the synthetic product is incubated in the presence of the restriction enzyme, the site of which is supposed to have disappeared by mutagenesis.
  • the strain of E coli exhibiting, in particular, the mutS mutation is used as a host for the transformation of this DNA.
  • the plasmid DNA tota] is prepared, incubated in the presence of the rest ⁇ ction enzyme used previously. After these treatments, the strain of E. coli DH1OB is used as the host for transformation.
  • the plasmid DNA of the clones isolated is prepared and the presence of the mutation 'introduced verified by sequencing.
  • the sequence of pRPA-ML-715 is arbitrarily numbered by placing the first base of the Alanine N-terminal GCC codon in position I This sequence has an Ncol site at position 1217.
  • the site-modification oligonucleotide presents the sequence. 5'-CCACAGGATGGCGATGGCCTTCTCC-3 'After sequencing according to the references given above, the sequence read after mutagenesis corresponds to that of the oligonucleotide used.
  • the Ncol site has been eliminated and the translation into amino acids in this region retains the initial sequence present on pRPA-ML-715.
  • This clone was named pRPA-ML-716.
  • the sequence read after mutagenesis on the three mutated fragments is identical to the parental DNA sequence ⁇ RPA-ML-716 with the exception of the mutagenized region which corresponds to that of the mutagenesis oligonucleotides used.
  • These clones have been named pRPA-ML-717 for the mutation Thr 102 " • * Ile, pRPA-ML-718 for the mutation Pro 106 ⁇ Ser, pRPA-ML-719 for the mutations Gly 101 " ⁇ Ala and Thr 102 " ⁇ Ile and pRPA-ML-720 for Thr 102 "• * Ile and Pro 106" mutations • »Ser
  • the 1340 bp sequence of pRPA-ML-720 is presented SEQ ID No. 5 and SEQ ID No. 6.
  • the 1395 bp NcoI-HindIII insert is the basis of all the constructs used for plant transformation for the introduction of resistance to competitive EPSPS inhibitor herbicides and in particular resistance to glyphosate.
  • This insert will be named in the following descriptions "the double mutant of EPSPSJie corn”. B Tolerance to glyphosate of the various mutants in vitro.
  • EPSP synthase Extraction of EPSP synthase.
  • the different EPSP synthases genes are introduced in the form of an Ncol-Hind ⁇ l cassette into the plasmid vector pTrc99a (Pharmacia, ref: 27-5007-01) cut with Ncol and HindlTI.
  • the recombinant E. coli DH10B overexpressing the various ⁇ PSP synthases are sonicated in 40 ml of buffer per 10 g of pellet cells and washed with this same buffer (tris HC1 200 mM pH 7.8, mercaptoethanol 50 mM, ⁇ DTA 5 mM and PMSF 1 mM), to which 1 g of polyvinylpy ⁇ olidone is added.
  • the suspension is stirred for 15 minutes at 4 ° C., then centrifuged for 20 minutes at 27000 g and 4 ° C.
  • Ammonium sulfate is added to the supernatant to bring the solution to 40% of the ammonium sulfate saturation.
  • the mixture is centrifuged for 20 minutes at 27000 g and 4 ° C.
  • the new supernatant is added with ammonium sulfate to bring the solution to 70% of the saturation with ammonium sulfate.
  • the mixture is centrifuged for 30 minutes at 27000 g and 4 ° C.
  • ⁇ PSP synthase present in this protein pellet, is taken up in 1 ml of buffer (tris HC1 20 mM pH 7.8 and mercaptoethanol 50 mM). This solution is dialyzed overnight against two liters of this same buffer at 4 ° C. 2.b: Enzymatic activity. The activity of each enzyme as well as its resistance to glyphosate is measured in vitro over 10 minutes at 37 ° C. in the following reaction mixture: 100 mM maleic acid pH 5.6, 1 mM phosphoenol pyruvate, 3 mM shikimate-3-phosphate (prepared according to Knowles PF and Sprinson DB 1970.
  • the wild-type enzyme WT is inhibited by 85% from the concentration of 0.12 mM of glyphosate. At this concentration, the known mutant enzyme SerlO ⁇ is not inhibited than 50% and the other three Ile 102 mutants. Ilel02 / Serl06, Alal01 Ilel02 are not or only slightly inhibited.
  • the concentration of glyphosate must be multiplied by ten, or 1.2 mM. to inhibit the mutant Ile 102 enzyme by 50%, the Ilel02 / Ser106 mutants. Ala / Ile and Ala are still not inhibited. It should be noted that the activity of the Ala / Ile and Ala mutants is not inhibited up to concentrations of 10 mM of glyphosate, and that that of the mutant Il102 / Ser106 is not reduced even if the concentration of glyphosate is multiplied by 2, i.e. 20 mM. VS
  • pRPA-RD-124 Addition of a polyadenylation signal "nos" to pRPA-ML-720, obtained previously, with creation of a cloning cassette containing the double mutant EPSPS gene of corn (Thr 102 ⁇ Ile and Pro 106 ⁇ Ser).
  • pRPA-ML-720 is digested with Hind m, treated with the Klenow fragment of DNA polymerase I of E. coli to produce a blunt end. A second digestion is carried out with Nco I and the ⁇ PSPS fragment is purified.
  • pRPA-RD-12 a cloning cassette containing the polyadenylation signal of nopaline synthase
  • pRPA-RD-124 a cloning cassette containing the polyadenylation signal of nopaline synthase
  • OTP transit peptide
  • pRPA-RD-7 (European patent application EP 652,286) is digested with Sph I, treated with T4 DNA polymerase, then digested with Spe 1 and the OTP fragment is purified.
  • This OTP fragment is cloned in pRPA-RD-124 which has been previously digested with Ncol, treated with Klenow DNA polymerase to remove the protruding part 3 ', then digested with Spe I.
  • This clone is then sequenced to ensure fusion translational connects between the OTP and the EPSPS gene. We then obtain pRPA-RD-125.
  • pRPA-RD-159 Addition of the double histone promoter from arabidopsis H4A748 (patent application EP 507 698) to pRPA-RD-125 with creation of a cassette for expression in plants for gene expression "OTP- double mutant EPSPS gene" in dicotyledonous tissues.
  • pRPA-RD-132 (a cassette containing the double promoter H4A748 (patent application EP 507 698)) is digested with Nco I and Sac I. The purified fragment of the promoter is then cloned into which has been digested with Eco I and Bag I.
  • pRPA-RD-173 Addition of the "H4A748-OTP promoter-double mutant EPSPS gene" gene from pRPA-RD-159 into plasmid pRPA-BL-150A (European patent application 508 909) with creation of a transformation vector Agrobactenum tumefaciens.
  • pRPA- RD-159 is digested with Not I and treated with Klenow polymerase. This fragment is then cloned into pRPA-BL-150A with Sma I.
  • the vector pRPA-RD-173 is introduced into the Agrobactenum tumefaciens strain
  • the regeneration of the tobacco PBD6 (origin SEITA France) 'from foliar explants is carried out on a Murashige and Skoog medium (MS) comprising 30 g / 1 sucrose and 200 ug / ml kanamycin.
  • MS Murashige and Skoog medium
  • the leaf explants are taken from plants cultivated in sene or in vitro and transformed according to the technique of leaf discs.
  • the first includes induction of the shoots on a medium supplemented with 30g / 1 of sucrose containing 0.05 mg / 1 of naphthylacetic acid (ANA ) and 2 mg / l of benzylaminopurine (BAP) for 15 days.
  • the shoots formed during this stage are then developed for 10 days by culture on an MS medium supplemented with 30 g / l of sucrose but containing no hormone.
  • Then take developed shoots and cultivate them on an MS rooting medium with half content of salts, vitamins and sugar and containing no hormone. After about 15 days, the rooted shoots are put in the ground.
  • the three lines are homozygous with respect to the gene concerned: consequently the progeny are hemizygous for each of the two genes introduced by crossing. Cross plants are obtained after six weeks.
  • Example 7 Measurement of the tolerance of tobacco in post-emergence treatment with isoxaflutole and post-emergence treatment with bromoxynil or glyphosate.
  • each test is carried out on a sample of 10 plants, 10 plants being kept untreated.
  • All the treatments are carried out by spraying at the rate of 5001 of spray mixture per hectare.
  • HPPD gene from Pseudomonas fluorescens can be used as a marker gene during the "transformation - regeneration" cycle of a plant species
  • tobacco has been transformed with the chimeric gene composed of the HPPD and the doubly mutated EPSPS gene for resistance to glyphosate and transformed plants resistant to both isoxaflutole and glyphosate were obtained after selection on isoxaflutole.
  • the chimeric pRP 2012 gene described below is transferred into industrial tobacco PBD6 according to the transformation and regeneration procedures already described in European application EP No. 0 508 909.
  • the chimeric gene of the vector pRP 2012 has the following structure A-B, in which:
  • A is:
  • Double promoter TEV OTP Coding region of HPPD Terminator nos histone and B is:
  • Dual TEV OTP promoter EPSPS coding region Nos histone terminator like that used in the vector pRPA-RD-173
  • the pRP 2012 chimeric gene is introduced into tobacco. 1 / Transformation:
  • the vector is introduced into the non-oncogenic strain of Agrobactenum EHA 101 (Hood et al, 1987) carrying the cosmid pTVK 291 (Komari et al, 1986).
  • the transformation technique is based on the procedure of Horsh et al (1985).
  • the regeneration of PBD6 tobacco (from SEITA France) from leaf explants is carried out on a Murashige and Skoog (MS) base medium comprising 30 g / l of sucrose as well as 350 mg / 1 of cefotaxime and 1 mg / 1 of isoxaflutole.
  • MS Murashige and Skoog
  • the leaf explants are taken from plants in the greenhouse or in vitro and transformed according to the technique of leaf discs (Science 1985Nol 227, p.1229-1231) in three successive stages: the first comprises the induction of shoots on an added MS medium 30g / l of sucrose containing 0.05mg l of naphthylacetic acid (A ⁇ A) and 2 mg 1 of benzylaminopurine (BAP) for 15 days and 1 mg / 1 of isoxaflutole. The green shoots formed during this stage are then developed by culture on an MS medium supplemented with 30 g 1 of sucrose and 1 mg / 1 of isoxaflutole but containing no hormone, for 10 days.
  • MS medium 30g / l of sucrose containing 0.05mg l of naphthylacetic acid (A ⁇ A) and 2 mg 1 of benzylaminopurine (BAP) for 15 days and 1 mg / 1 of isoxaflutole.
  • Example 9 Plant with an HPPD gene and a bar gene, resistant to both soxaflutole and phosphinothrvcin 1 Construction of a chimeric gene with an HPPD sequence.
  • the plasmid pRPA-RD-1004 represented in FIG. 4 is obtained by insertion of the chimeric gene for resistance to isoxazoles in the plasmid pUC 19 of 2686 bp, marketed by New Englamd Biolabs (Yannish-Perron, C. Viera, J. and Massmg , J. (1985) Gene 33, 103-119 and containing resistance to ampicillin
  • the various elements of the chimeric gene are, in the sense of translation.
  • OTP tansit peptide
  • this OTP consists of 171 bp of the transit peptide of the small subunit of Ribulose 1.5 bisphosphate carboxylase / oxygenase from Helianthus annuus (Waksman G. et al 1987. Nucleics acids Res. 15: 7181) followed by 66 bp of the mature part of the small subunit of the Ribulose 1.5 bisphosphate carboxylase / oxygenase from Zea mays (Lebrun et al 1987. Nucleics acids Res.
  • nopaline synthase (nos) gene polyadenylation zone of the nos gene isolated from pTi 37, 250 bp (Bevan M. et al. Nucleics Acids Res. 11: 369-385);
  • the phosphinothricin acetyl tranferase (PAT) encoded by the bar gene is an enzyme that inactivates a herbicide, phosphinothricin (PPT). PPT inhibits the synthesis of glutamine and causes a rapid accumulation of ammonia in the cells leading to their death (Tachibana et al. 1986).
  • the piasmide used to introduce tolerance to phosphinothricin as a selection agent is obtained by insertion of the chimeric gene pDM 302 into the vector pSP72 of 2462 bp. marketed by Promega Corp. (Genbank DDBJ database accession number
  • Plasmid pDM 302 of 4700bp has been described by Cao, J., et al. Plant Cell Report 1 1: 586-591 (1992).
  • nopaline synthase (nos) gene polyadenylation zone of the nos gene isolated from pTi 37, 250 bp (Bevan M. et al. Nucleics Acids Res. 1 1: 369-385).
  • the bombardment technique is used to introduce genetic construction.
  • the palsmides are purified on a Qiagen column and coprecipitated on tungsten particles M10 according to the Klein method (Nature 327: 70-73, 1987).
  • a mixture (?) Of metal particles and of the two plasmids described above is then bombarded on embryogenic corn cells according to the protocol by (???)
  • the transformed plants obtained above emitted pollen supposedly partly transgenic, which fertilized eggs from a wild non-transgenic corn.
  • the seeds obtained are selected on sand after treatment with isoxaflutole.
  • the selection protocol is as follows: 800ml of Fontainebleau sand are placed in a 15 x 20 cm tray.
  • Isoxaflutole genotypes number of number of number of number of (g / ha) seeds plants plants plants seeded germinated dead surviving non 0 20 20 0 20 transgenic
  • SEQ ID No. 5 and SEQ ID No. 6 sequences of the mutated maize EPSPS gene and protein, part
  • Figure 1 shows the protein sequence of the HPPD of Pseudomonas sp. strain P.J. 874 and the theoretical nucleotide sequence of the corresponding coding part; the five oligonucleotides chosen to amplify part of this coding region are symbolized by the five arrows.
  • Figure 2 shows the mapping of the plasmid with the 7 kb genomic DNA fragment containing the HPPD gene from P. fluorescens A32.
  • Figure 3 gives the comparison of the amino acid sequences of the HPPD from P. fluorescens A32 and the HPPD of Pseudomonas sp strain PJ 874 (only the divergent amino acids between the two sequences are indicated) as well as the consensus sequence. isce sequences
  • CTGTTCGAGT CCATCGAACG TGACCAGGTG CGTCGTGGTG TATTGACCGC CGATTAA 1077
  • AAAAAAAAAA AAAAAAAAAAAA AACCCGGGAA TTC 1713 SEQ ID NO: 3:
  • AGC GCA AGC TAT TTC TTG GCT GGT GCT GCA ATT ACT GGA GGG ACT GTG 815 Ser Ala Ser Tyr Phe Leu Ala Gly Ala Ala Ile Thr Gly Gly Thr Val 255 260 265 270
  • AGC GCA AGC TAT TTC TTG GCT GGT GCT GCA ATT ACT GGA GGG ACT GTG 815 Ser Ala Ser Tyr Phe Leu Ala Gly Ala Ala Ile Thr Gly Gly Thr Val 255 260 265 270

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Organic Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Cell Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Environmental Sciences (AREA)
  • Pest Control & Pesticides (AREA)
  • Dentistry (AREA)
  • Agronomy & Crop Science (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Agricultural Chemicals And Associated Chemicals (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Botany (AREA)
  • Developmental Biology & Embryology (AREA)
  • Catching Or Destruction (AREA)

Abstract

The invention concerns: 1.Chimera gene with several herbicide resistant genes, plant cell and plant resistant to several herbicides. 2.The plant is resistant both to several herbicides, particularly to HPPD inhibitors and EPSPS inhibitors and/or to dihalogenohydroxybenzonitriles. 3. Its use for weeding plants with several herbicides.

Description

GENE CHIMERE A PLUSIEURS GENES DE TOLERANCE HERBICIDE, CELLULE VEGETALE ET PLANTE TOLER¬ ANTES A PLUSIEURS HERBICIDES r AJ m IULUKCHIMERIC GENE WITH MULTIPLE HERBICIDE TOLERANCE GENES, PLANT CELL AND PLANT TOLER ¬ ANTES WITH MULTIPLE HERBICIDES r AJ m IULUK
La présente invention a pour objet un gène chimère à plusieurs gènes de tolérance herbicide, une cellule végétale et une plante tolérantes à plusieurs herbicides. Dans la suite de la description, les herbicides seront désignés selon le nom commun en particulier référencé dans "The Pesticide Manual" 10 th édition par British Crop Protection Council.The present invention relates to a chimeric gene with several herbicide tolerance genes, a plant cell and a plant tolerant to several herbicides. In the following description, the herbicides will be designated by the common name in particular referenced in "The Pesticide Manual" 10 th edition by British Crop Protection Council.
On connaît des plantes qui ont été transformées pour être tolérantes à certains herbicides comme notamment les dihalogenohydroxybenzonitriles, en particulier le bromoxynil et l' ioxyml, grâce au gène codant pour la nitrilase dégradant ces herbicides ou encore celles tolérantes aux herbicides inhibiteurs de l'EPSPS notamment le glyphosate, le sulfosate ou la fosametine ou encore aux inhibiteurs de l'acétolactatesynthase (ALS) du type des sulfonylurées ou encore aux inhibiteurs de la dihydro-pteroate synthase tel que l'asulam ou encore aux inhibiteurs de la glutamine synthase tels que le glufosinate. On connaît certains herbicides tels que les isoxazoles décrites notamment dans les demandes de brevets français 95 06800 and 95 13570 et notamment l'isoxaflutole, herbicide sélectif du maïs, les dicétonitriles tels que ceux décrits dans les demandes européennes 0 496 630, 0 496 631 , en particulier la 2-cyano-3-cycloproρyl-l-(2-Sθ2 CH3-4-CF3 phényl) propane-l ,3-dione et la 2-cyano-3-cyclopropyl-l-(2-Sθ2 CH3-4-2,3 CI2 phényl) propane-1, 3-dione, les tricétones décrites dans les demandes européennes 0 625 505 et 0 625 508, en particulier la sulcotrione ou encore celles décrites dans l'USP 5 506 195, ou encore les pyrazolinates. De plus le gène codant pour l'HPPD conférant une tolérance à ces derniers herbicides a été isolé et des plantes transgéniques le contenant obtenues montrant une tolérance significative et font l'objet des demandes françaises non publiées N°95/06800, 95/13570 et 96/05944.Plants are known which have been transformed to be tolerant to certain herbicides such as in particular the dihalogenohydroxybenzonitriles, in particular bromoxynil and ioxyml, thanks to the gene coding for the nitrilase degrading these herbicides or those tolerant to herbicides inhibiting EPSPS in particular. glyphosate, sulfosate or fosametine or also to acetolactatesynthase inhibitors (ALS) of the sulfonylurea type or to dihydro-pteroate synthase inhibitors such as asulam or to glutamine synthase inhibitors such as glufosinate . Certain herbicides are known, such as the isoxazoles described in particular in French patent applications 95 06800 and 95 13570 and in particular isoxaflutole, a selective corn herbicide, diketonitriles such as those described in European applications 0 496 630, 0 496 631, in particular 2-cyano-3-cycloproρyl-l- (2-Sθ2 CH3-4-CF3 phenyl) propane-1, 3-dione and 2-cyano-3-cyclopropyl-l- (2-Sθ2 CH3-4 -2.3 CI2 phenyl) propane-1, 3-dione, the triketones described in European applications 0 625 505 and 0 625 508, in particular sulcotrione or those described in USP 5 506 195, or also pyrazolinates . In addition, the gene coding for HPPD conferring tolerance to the latter herbicides has been isolated and transgenic plants containing it obtained showing significant tolerance and are the subject of unpublished French applications N ° 95/06800, 95/13570 and 96/05944.
Cependant la pratique agricole montre que les agriculteurs aiment disposer pour le traitement des plantes, et notamment des cultures, d'associations d'herbicides en particulier pour répondre à différents problèmes de désherbage dûs aux limites du spectre des herbicides pris isolément. Il peut être en outre intéressant de disposer d'un gène de marquage de sélection associé à un gène de tolérance herbicide. Il y a donc un besoin de plantes et notamment de cultures présentant une tolérance à plusieurs herbicides, de préférence au moins deux ou trois . Il a maintenant été découvert qu'on pouvait conférer à une cellule végétale et à uns plante un tolérance herbicide multipleHowever, agricultural practice shows that farmers like to use herbicides for the treatment of plants, and in particular crops, in particular to respond to different problems of weed control due to the limits of the spectrum of herbicides taken in isolation. It may also be advantageous to have a selection marking gene associated with a herbicide tolerance gene. There is therefore a need for plants and in particular for crops having a tolerance to several herbicides, preferably at least two or three. It has now been discovered that a plant cell and a plant can be given multiple herbicide tolerance
La présente invention a d'abord pour objet un gène chimère comprenant au moins deux g nes chimère1, élémentaires contenant chacun, dans le sens de la transcription, des éléments de régulation nécessaires à sa transcription dans les plantes c'est à dire au moins une séquence de régulation promotrice, au moins une partie codante hétérologue comprenant une séquence codante codant pour une enzyme conférant aux plantes la tolérance à un herbicide et au moins une séquence de régulation terminatπce ou de polyadénylation.The present invention firstly relates to a chimeric gene comprising at least two elementary chimeric genes 1 each containing, in the direction of transcription, regulatory elements necessary for its transcription in plants, that is to say at least a promoter regulatory sequence, at least one heterologous coding part comprising a coding sequence coding for an enzyme conferring on plants tolerance to a herbicide and at least one terminating or polyadenylation regulatory sequence.
Comme séquence codante, on peut notamment utiliser toutes celles connues pour conférer la tolérance de plantes à certains inhibiteurs telles que:As coding sequence, it is possible in particular to use all those known to confer plant tolerance to certain inhibitors such as:
- celle de l'EPSPS pour la tolérance au glyphosate, au sulfosate ou à la fosamétine, notamment celles de la protéine mutée ou non, on peut citer notamment les brevets;- that of EPSPS for tolerance to glyphosate, sulfosate or fosametin, in particular those of the protein, mutated or not, mention may in particular be made of patents;
- USP 4 535 060, EP 1 15 673, USP 4 769 061, USP 5 094 945; USP 4 971 908, USP 5 145 783. EP 293 358; EP 378 985 , WO 91/04323; WO 92 044 449; WO 92 06201. Dans, la suite ce type de gène sera désigné par séquence ou gène "EPSPS".- USP 4,535,060, EP 1,15,673, USP 4,769,061, USP 5,094,945; USP 4,971,908, USP 5,145,783. EP 293,358; EP 378,985, WO 91/04323; WO 92,044,449; WO 92 06201. In the following, this type of gene will be designated by sequence or "EPSPS" gene.
On peut également citer la glyphosate oxydoréductase (cf WO 92/ 000 377) enzyme de détoxification du glyphosate.Mention may also be made of glyphosate oxidoreductase (cf. WO 92/000 377) a detoxification enzyme for glyphosate.
- celle du gène de la nitrilase de Klebsielia sp. pour la tolérance aux dihalogénobenzonitriles décrite dans l'USP 4 810 648 et en particulier celui issu de Klebsielia ozaenae, qui sera désigné dans la suite par gène ou séquence "OXY".- that of the gene for nitrilase from Klebsielia sp. for the tolerance to dihalobenzonitriles described in USP 4,810,648 and in particular that derived from Klebsielia ozaenae, which will be designated in the following by gene or sequence "OXY".
- celle de l'HPPD telle décrite dans les demandes françaises non publiées N°95/06800, 95/13570 et 96/05944 citées ci-dessus. Cette HPPD peut être de toute nature. Plus particulièrement cette séquence peut être d'origine bactérienne, telle que notamment le genre Pseudomonas ou encore d'origine végétale, telle que notamment de plante monocotylédone ou dicotylédone, notamment ά'Arabidopsis ou d'ombellifères comme par exemple la carotte (Daucus carota). Elle peut être native ou sauvage ou éventuellement mutée tout en gardant fondamentalement une propriété de tolérance herbicide contre les inhibiteurs de l'HPPD, tels que les herbicides de la famille des isoxazoles ou de celle des tricétones ou des pyrazolinates.- that of the HPPD as described in the unpublished French applications N ° 95/06800, 95/13570 and 96/05944 cited above. This HPPD can be of any kind. More particularly, this sequence can be of bacterial origin, such as in particular the genus Pseudomonas or also of vegetable origin, such as in particular of monocotyledonous or dicotyledonous plant, in particular ά'Arabidopsis or umbelliferae such as for example carrot (Daucus carota) . It can be native or wild or possibly mutated while fundamentally retaining a herbicidal tolerance property against HPPD inhibitors, such as herbicides of the isoxazole family or that of the triketones or pyrazolinates.
D'autres séquences peuvent être utilisées:Other sequences can be used:
- celle de la phosphinotrycine acétyl transférase ou celle de la glutamine synthase pour la tolérance au glufosinate (cf EP 0242 236) - celle de la dihydroptéroate synthase pour la tolérance à l'asulam (cf EP 0 369- that of phosphinotrycine acetyl transferase or that of glutamine synthase for tolerance to glufosinate (cf EP 0242 236) - that of dihydropteroate synthase for tolerance to asulam (cf EP 0 369
367)367)
- celle de l'ALS pour la tolérance aux sulfonylurées - celle de la Piotoporphyrogen oxydase ( 'protox ' ) pour la tolérance aux herbicides de la tarmlle des diphenyléthers tels que l'acifluorten ou 1 oxyfluorfen ou celle des oxaduzoles tels que l'oxadiazon ou 1 oxadiargyl ou celle des îmides cvchques tels que le chlorophtha m ou celle des phénylpyrrazoles tel que le TNP ou celles des pyπdines et les phénopylates et analogues carbamates (cf WO 95/34659)- that of ALS for tolerance to sulfonylureas - that of Piotoporphyrogen oxidase ('protox') for the tolerance to herbicides of the tarmlle of diphenyl ethers such as acifluorten or 1 oxyfluorfen or that of oxaduzoles such as oxadiazon or 1 oxadiargyl or that of cambic ides such as chlorophtha m or that of phenylpyrrazoles such as TNP or those of pyπdines and phenopylates and carbamate analogs (cf. WO 95/34659)
De préférence l'un des gènes chimères contient une séquence codante de l'HPPD Dans ce cas l'autre ou les autres séquences peuvent être quelconques et notamment choisies dans le groupe mentionne ci-dessus De préférence les autres séquences sont choisies dans le groupe comprenant le gène de la nitrilase de tolérance aux dihalogenohydroxybenzonitriles et un gène EPSPSPreferably one of the chimeric genes contains a coding sequence for HPPD In this case the other or the other sequences may be any and in particular chosen from the group mentioned above Preferably the other sequences are chosen from the group comprising the dihalogenohydroxybenzonitriles tolerance nitrilase gene and an EPSPS gene
Les gènes chimères selon l'invention peuvent en outre contenir des gènes codant pour des propriétés autres que de tolérance herbicides tels que par exemple des gènes de résistance aux insectes, tels que ceux de type Bacillus thurigensis conférant une résistance à divers représentants de la famille des coléoptères, des lépidoptères, ou encore des gènes de résistance aux nematodes, des gènes de résistance aux maladies fongiques ou microbiennes, ou encore des gènes conférant des propriétés agronomiques telles que les gènes des diverses desaturases intervenant dans la production des acides gras On peut citer en particulier celui de la delta -6 desaturase décrit dans la demande internationale WO 93/06712The chimeric genes according to the invention can also contain genes coding for properties other than herbicide tolerance such as for example insect resistance genes, such as those of the Bacillus thurigensis type conferring resistance to various representatives of the family of beetles, lepidoptera, or genes for resistance to nematodes, genes for resistance to fungal or microbial diseases, or genes conferring agronomic properties such as the genes of the various desaturases involved in the production of fatty acids. particularly that of delta -6 desaturase described in international application WO 93/06712
Comme séquence de régulation promotrice on peut utiliser toute séquence promotrice d'un gène s'expπmant naturellement dans les plantes en particulier un promoteur d'origine bactérienne, virale ou végétale tel que, par exemple, celui d'un gène de la petite sous-unité de πbulose-biscarboxylase (RuBisCO) ou de celui d'un gène de l'a tubuhne (Demande européennne EP n° 0 652 286), ou encore d'un gène de virus de plante tel que, par exemple, celui de la mosaïque du choux fleur (CaMV 19S ou 35S), mais tout promoteur convenable connu peut être utilisé. De préférence on a recours à une séquence de régulation promotrice qui favorise la surexpression de la séquence codante, tel que par exemple, celle comprenant au moins un promoteur d'histone tel que décrit dans la demande européenne EP 0507698As promoter regulatory sequence, it is possible to use any promoter sequence of a gene which is naturally expressed in plants, in particular a promoter of bacterial, viral or plant origin such as, for example, that of a gene for the small sub- πbulose-biscarboxylase unit (RuBisCO) or that of a tubuhne gene (European Application EP n ° 0 652 286), or of a plant virus gene such as, for example, that of the cauliflower mosaic (CaMV 19S or 35S), but any known suitable promoter can be used. Preferably, a promoter regulatory sequence is used which promotes the overexpression of the coding sequence, such as for example, that comprising at least one histone promoter as described in European application EP 0507698.
Selon l'invention, on peut également utiliser, en association avec la séquence de régulation promotrice, d'autres séquences de régulation, qui sont situées entre le promoteur et la séquence codante, telles que des activateurs de trancπption "enhancer", comme p.ar exemple l'activateur de translation du virus etch du tabac (TEV) décπt dans la demande WO87/07644, ou des peptides de transit, soit simples, soit doubles, et dans ce cas éventuellement séparés par une séquence intermédiaire, c'est à dire comprenant, dans le sens de la transcription, une séquence codant pour un peptide de transit d'un gène végétal codant pour une enzyme à localisation plastidiale, une p∑irue de séquence de la parue mature N terminale d'un gène végétal codant pour une enzyme à localisation plastidiale, puis une séquence codant pour un second peptide de transit d'un gène végétal codant pour une enzyme à localisation plastidiale, constituée d'une p.arue de séquence de la partie mature N terminale d'un gène végétal codant pour une enzyme à localisation plastidiale, tels que décrit dans la demande européenne n° 0 508 909.According to the invention, it is also possible to use, in association with the promoter regulatory sequence, other regulatory sequences, which are located between the promoter and the coding sequence, such as enhancer enhancers, such as p. ar example the translational activator of the etch tobacco virus (TEV) decπt in application WO87 / 07644, or transit peptides, either single or double, and in this case possibly separated by an intermediate sequence, it is to say comprising, in the direction of transcription, a sequence coding for a transit peptide of a plant gene coding for an enzyme with plastid localization, a p∑irue of sequence of the mature N terminal appeared of a plant gene coding for an enzyme with plastid location, then a sequence coding for a second transit peptide of a plant gene coding for an enzyme with plastid location, consisting of a p.arue of sequence of part m ature N terminal of a plant gene coding for an enzyme with plastid localization, as described in European application No. 0 508 909.
Comme séquence de régulation terminatπce ou de polyadénylation, on peut utiliser toute séquence correspondante d'origine bactérienne, comme par exemple le terminateur nos â'Agrobacterium lumefaciens, ou encore d'origine végétale, comme par exemple un terminateur d'histone tel que décrit dans la demande européenne EP n° 0633 317As a terminating or polyadenylation regulatory sequence, any corresponding sequence of bacterial origin, such as for example the terminator nos â'Agrobacterium lumefaciens, or of plant origin, such as for example a histone terminator as described in European application EP n ° 0633 317
L'invention a encore pour objet une cellule végétale, de plantes monocotylédones ou dicotylédones, notamment des cultures, tolérante à aux moins deux herbicides dont au moins un est un inhibiteur de l'HPPD. Cette cellule peut contenir au moins deux gènes chimères comprenant chacun une séquence codant pour la tolérance à un herbicide et dont l'un comprend une séquence codant pour l'HPPD. Les deux gènes chimères peuvent être soit portés par un même vecteur, soit chacun sur un vecteur différent, soit encore apportés tels quels par introduction dans la cellule par des moyens physiques ou physico-chimiques, par exemple par microinjection, électroporation ou bombardement, selon des méthodes en soi connues.The subject of the invention is also a plant cell, of monocotyledonous or dicotyledonous plants, especially cultures, tolerant of at least two herbicides, at least one of which is an HPPD inhibitor. This cell can contain at least two chimeric genes each comprising a sequence coding for tolerance to a herbicide and one of which comprises a sequence coding for HPPD. The two chimeric genes can either be carried by the same vector, or each on a different vector, or else brought as such by introduction into the cell by physical or physicochemical means, for example by microinjection, electroporation or bombardment, according to methods known per se.
L'invention a encore pour objet une plante transformée tolérante à au moins deux herbicides dont un est inhibiteur de l'HPPD. Cette plante peut être obtenue soit par croisement d'au moins deux plantes contenant chacune un gène codant pour la tolérance à un herbicide, soit par régénération d'une cellule selon l'invention, telle que décrite ci-dessus Les plantes peuvent être des monocotylédones ou dicotylédones, notamment des cultures., grandes cultures telles que par exemple mais de manière non limitative pour les dicotylédones le tabac, le coton, le colza, le soja, la betterave, et pour les monocotylédones le mais et les céréales à paille, ou en core des cultures maraîchères ou floralesThe subject of the invention is also a transformed plant tolerant to at least two herbicides, one of which is an HPPD inhibitor. This plant can be obtained either by crossing at least two plants each containing a gene coding for tolerance to a herbicide, or by regeneration of a cell according to the invention, as described above The plants can be monocots or dicots, especially crops, field crops such as for example but not limited to dicots tobacco, cotton, rapeseed, soybeans, beets, and for monocots, corn and straw cereals, or still vegetable or floral crops
L'invention a encore pour objet un procédé d'obtention de plantes à tolérance herbicide multiple par trangénese végtale, caractérisé en ce queThe subject of the invention is also a process for obtaining plants with multiple herbicide tolerance by plant trangenesis, characterized in that
- dans une première étape, on insère dans plusieurs cellules respectivement un des gènes élémentaires contenant chacun des éléments de régulation nécessaires à sa transcription dans les plantes et une séquence codante codant pour une enzyme conférant aux plantes la tolérance à un herbicide, et que - ensuite les plantes sont croisées pour obtenir des plantes à tolérance multiple.- in a first step, one inserts into several cells respectively one of the elementary genes each containing regulatory elements necessary for its transcription in plants and a coding sequence coding for an enzyme conferring on plants tolerance to a herbicide, and that - then the plants are crossed to obtain plants with multiple tolerance.
L'invention a encore pour objet un autre procédé d'obtention de plantes à tolérωce herbicide multiple par tr∑uigénèse végét e, une première étape comportant l' intégration dans des cellules végétales d'au moins deux gènes de tolérances à un herbicide dont au moins un est un inhibiteur de l'HPPD, la seconde étape compremant la régénération de la plante à partir des cellules transformées selon l'invention.Another subject of the invention is another process for obtaining plants with multiple herbicide tolerance by plant truuigenesis, a first step comprising the integration into plant cells of at least two genes for tolerance to a herbicide, including at least one is an HPPD inhibitor, the second step comprising the regeneration of the plant from the cells transformed according to the invention.
La transformation peut être obtenue par tout moyen connu approprié, amplement décrit dans la littérature spécialisée et notamment les demandes et brevets cités dans la présente demande. L ne série de méthodes consiste à bombarder des cellules ou des protoplastes avec des particules auxquelles sont accrochées les séquences d'ADN Selon l'invention ces ADN peuvent être portés par les mêmes particules ou par des bombardements différents. Une autre série de méthodes consiste à utiliser comme moyen de transfert dans la plante un gène chimère inséré dans un plasmide Ti d'Agrobactenum tumefaciens ou Ri d'Agrobactenum rhizogenesThe transformation can be obtained by any suitable known means, fully described in the specialized literature and in particular the applications and patents cited in the present application. The series of methods consists in bombarding cells or protoplasts with particles to which the DNA sequences are attached. According to the invention, these DNAs can be carried by the same particles or by different bombardments. Another series of methods consists in using as a means of transfer into the plant a chimeric gene inserted into a Ti plasmid of Agrobactenum tumefaciens or Ri of Agrobactenum rhizogenes
D'autres méthodes peuvent être utilisées telles que la micro-injection ou l'électroporationOther methods can be used such as micro-injection or electroporation
L'homme de métier fera le choix de la méthode appropriée en fonction de la nature de la plante, notamment de son caractère monocotylédone ou dicotylédoneA person skilled in the art will choose the appropriate method depending on the nature of the plant, in particular its monocotyledonous or dicotyledonous nature.
On a observé que des plantes transformées selon l'invention présentent une tolérance significative aux inhibiteurs de l'hydroxy phényl pyruvate dioxygénase tels que certains herbicides récents tels que les isoxazoles décrites notamment dans les demandes de brevets français 9506800 and 95 13570 et notamment du 4-[4-CF3-2-(méthylsulfony 1) benzoyl]-5- cyclopropyl isoxazole.ou "îsoxaflutole", herbicide sélectif du mais, les dicétomtπles tels que ceux décrus dans les demandes européennes 0496 630, 0496 631 , en particulier la 2-cyano- 3-cyciopropyl- l-(2-Sθ2 CH3-4-CF3 phényl) propane- 1, 3 -dione et la 2-cyano-3- cyclopropyl-l-(2-Sθ2 CH3-4-2 CI2 phényl) propane- 1 , 3-dιone, les tricétones décπtes dans les demandes européennes 0 625 505 et 0 625 508, en particulier la sulcotπone et les pyrazinolates. Ces mêmes plantes selon l'invention présentent une tolérance significative à d'autres herbicides tels que par exemple les dihalogéno benzonitπles, notamment le bromoxynil et l'ioxynil, le glyphosate et ses analogues, le glufosinateIt has been observed that plants transformed according to the invention exhibit significant tolerance to inhibitors of hydroxyphenyl pyruvate dioxygenase such as certain recent herbicides such as isoxazoles described in particular in French patent applications 9506800 and 95 13570 and in particular 4- [4-CF3-2- (methylsulfony 1) benzoyl] -5- cyclopropyl isoxazole.ou "îsoxaflutole", selective corn herbicide, diketomtπles such as those described in European applications 0496 630, 0496 631, in particular 2- cyano- 3-cyciopropyl- l- (2-Sθ2 CH3-4-CF3 phenyl) propane- 1, 3 -dione and 2-cyano-3-cyclopropyl-l- (2-Sθ2 CH3-4-2 CI2 phenyl) propane-1, 3-dιone, the triketones determined in European applications 0 625 505 and 0 625 508, in particular sulcotπone and pyrazinolates. These same plants according to the invention exhibit significant tolerance to other herbicides such as, for example, the dihalogeno benzonites, in particular bromoxynil and ioxynil, glyphosate and its analogues, glufosinate.
La présente invention a encore pour objet les plantes régénérées à partir des cellules transformées La régénération est obtenue par tout procédé approprié qui dépende de la nature de l'espèce, comme par exemple décrit dans les demandes ci-dessus. Les plantes selon l'invention peuvent encore être obtenues par croisement de parents, chacun d'eux portant l'un des gènes de tolérance herbicide décπtes.A subject of the present invention is also plants regenerated from transformed cells. Regeneration is obtained by any suitable process which depends on the nature of the species, as for example described in the applications above. The plants according to the invention can also be obtained by crossing parents, each of them carrying one of the herbicide tolerance genes decπtes.
L'invention a enfin pour objet un procédé de désherbage de plantes, notamment de cultures, à l'aide d'un herbicide de ce type, caractéπsé en ce qu'on applique cet herbicide sur des plantes transformées selon l'invention, tant en présemis, en prélevée qu'en postlevée de la culture. Par herbicide au sens de la présente invention on entend une matière active herbicide seule ou associée à un additif qui modifie son efficacité comme par exemple un agent augmentant l'activité (synergiste) ou limitant l'activité (en anglais safener). Bien entendu, pour leur application pratique, les herbicides ci-dessus sont associée de manière en soi connue aux adjuvants de formulations utilisés habituellement en agrochimie Selon l'invention l'un des gènes de tolérance herbicides présents dans les plantes peut être utilisé comme marqueur de sélection, soit in vitro, soit in vivo Les différents aspects de l'invention seront mieux compris à l'aide des exemples expérimentaux ci-dessous.The invention finally relates to a process for weeding plants, especially crops, using a herbicide of this type, caractéπsé in that this herbicide is applied to plants transformed according to the invention, both in pre-plant, pre-emergence and post-emergence of the crop. By herbicide within the meaning of the present invention is meant a herbicidal active material alone or associated with an additive which modifies its effectiveness such as for example an agent increasing activity (synergist) or limiting activity (in English safener). Of course, for their practical application, the above herbicides are associated in known manner with the adjuvants of formulations usually used in agrochemistry. According to the invention, one of the herbicide tolerance genes present in plants can be used as a marker for selection, either in vitro or in vivo The various aspects of the invention will be better understood with the aid of the experimental examples below.
Exemple I : Isolement du gène de l'HPPD de P. fluorescens A32 . A partir de la séquence en acides aminés de l'HPPD de Pseudomonas sp. P.J. 874 ( publié par Rϋetschi U. et al. 1992. Eur. J. Biochem. 205: 459-466), on déduit la séquence de différents oligonucléotides pour amplifier par PCR une partie de la séquence codante de l'HPPD de P. fluorescens A32 (isolée par McKellar, R.C. 1982. J. Appl Bacteriol. 53:305- 316). Un fragment d'amplification du gène de cette HPPD a été utilisé pour cribler une banque genomique partielle de P. fluorescens A32 et ainsi isoler le gène codant pour cette enzyme.Example I: Isolation of the HPPD gene from P. fluorescens A32. From the amino acid sequence of the HPPD of Pseudomonas sp. PJ 874 (published by Rϋetschi U. et al. 1992. Eur. J. Biochem. 205: 459-466), the sequence of different oligonucleotides is deduced to amplify by PCR a part of the coding sequence of the HPPD of P. fluorescens A32 (isolated by McKellar, RC 1982. J. Appl Bacteriol. 53: 305-316). An amplification fragment of the gene for this HPPD was used to screen a partial genomic library of P. fluorescens A32 and thus to isolate the gene coding for this enzyme.
A) Préparation de l'ADN genomique de P. fluorescens A32.A) Preparation of the genomic DNA of P. fluorescens A32.
La bactérie a été cultivée dans 40 ml de milieu minimum M63 (KH2PO4 13,6g/l, (NH4)2S04 2g/l, MgS04 0,2g/l, FeS04 0,005 g/1 pH7 plus L-tyrosine lOmM comme seule source de carbone) à 28°C pendant 48 heures.The bacterium was cultivated in 40 ml of minimum medium M63 (KH2PO4 13.6 g / l, (NH4) 2S04 2g / l, MgS04 0.2g / l, FeS04 0.005 g / 1 pH7 plus L-tyrosine lOmM as the only source of carbon) at 28 ° C for 48 hours.
Après lavage, les cellules sont reprises dans 1 ml de tampon de lyse (tris HC1 100 tnM pH 8,3, NaCl 1,4 M et EDTA 10 mM) et incubées 10 minutes à 65°C. Après un traitement au phénol/chloroforme (24/1) et un traitement au chloroforme, les acides nucléiques sont précipités par addition d'un volume d'isopropanol puis repris dans 300 μl d'eau stérile et traités à la RNAse 10 μg/ml final. L'ADN est de nouveau traité au phénol/chlorofoime, chloroforme et reprécipité par addition de 1/10 de volume d'acétate de sodium 3M pH5 et 2 volumes d'éthanol. L'ADN est ensuite repris dans de l'eau stérile et dosé.After washing, the cells are taken up in 1 ml of lysis buffer (tris HCl 100 tnM pH 8.3, 1.4 M NaCl and 10 mM EDTA) and incubated for 10 minutes at 65 ° C. After a phenol / chloroform treatment (24/1) and a chloroform treatment, the nucleic acids are precipitated by adding a volume of isopropanol then taken up in 300 μl of sterile water and treated with RNAse 10 μg / ml final. The DNA is again treated with phenol / chloroform, chloroform and reprecipitated by addition of 1/10 of volume of 3M sodium acetate pH5 and 2 volumes of ethanol. The DNA is then taken up in sterile water and assayed.
B) Choix des oligonucléotides et synthèses.B) Choice of oligonucleotides and syntheses.
A partir de la séquence en acides aminés de l'HPPD de Pseudomonas sp. P.J. 874 on choisit cinq oligonucléotides, deux dirigés dans le sens NH2 terminal de la protéine vers le COOH terminal de la protéine et trois dirigés dans le sens inverse (voir figure 1). Le choix a été dicté par les deux règles suivantes:From the amino acid sequence of the HPPD of Pseudomonas sp. P.J. 874, five oligonucleotides are chosen, two directed in the NH2 terminal direction of the protein towards the COOH terminal of the protein and three directed in the opposite direction (see FIG. 1). The choice was dictated by the following two rules:
-une extrémité 3' de l'oligonucléotide stable, c'est à dire au moins deux bases s;ans ambiguité. -une dégénérescence la plus faible possible.a 3 ′ end of the stable oligonucleotide, that is to say at least two bases without ambiguity. - the lowest possible degeneration.
Les oligonucléotides choisis ont les séquences suivantes: PI : 5TA(C/T)GA(G/A)AA(C/T)CCIATGGG3' P2: 5'GA(G/A)ACIGGICCIATGGA3' P3: 5'AA(C/T)TGCATIA(G/A)(G/A)AA(C r)TC(C/T)TC3' P4: 5ΑAIGCIAC(G/A)TG(CπΥTG(T/G/A)ATICC3'The oligonucleotides chosen have the following sequences: PI: 5TA (C / T) GA (G / A) AA (C / T) CCIATGGG3 'P2: 5'GA (G / A) ACIGGICCIATGGA3' P3: 5'AA (C / T) TGCATIA (G / A) (G / A) AA (C r) TC (C / T) TC3 'P4: 5ΑAIGCIAC (G / A) TG (CπΥTG (T / G / A) ATICC3'
P5: 5'GC(C/T)TT(A/G)AA(A/G)TTICC(C/T)TCICC3' Ils ont été synthétisés sur le synthétiseur "Cyclone plus DNA Synthesizer" de m-arque MELLPORE. Avec ces cinq oligonucléotides par PCR les fragments d'amplification que l'on doit obtenir théoriquement d'après la séquence SEQ ID ° 1 ont les tailles suivantes avec les amorces PI et P3 > environ 690 bp avec les amorces PI et P4 > environ 720 bp avec les amorces PI et P5 > environ 1000 bp avec les amorces P2 et P3 > environ 390 bp avec les amorces P2 et P4 > environ 420 bp avec les amorces P2 et P5 > environ 700 bpP5: 5'GC (C / T) TT (A / G) AA (A / G) TTICC (C / T) TCICC3 'They were synthesized on the "Cyclone plus DNA Synthesizer" synthesizer from m-arque MELLPORE. With these five oligonucleotides by PCR, the amplification fragments which must theoretically be obtained according to the sequence SEQ ID No. 1 have the following sizes with the primers PI and P3> approximately 690 bp with the primers PI and P4> approximately 720 bp with primers PI and P5> approximately 1000 bp with primers P2 and P3> approximately 390 bp with primers P2 and P4> approximately 420 bp with primers P2 and P5> approximately 700 bp
C) Amplification d'une partie codante de l'HPPD de P. fluorescens A32 Les amplifications ont été faites sur un appareil PCR PERKIN ELMER 9600 et avec laC) Amplification of a coding part of the HPPD from P. fluorescens A32 The amplifications were carried out on a PERKIN ELMER 9600 PCR apparatus and with the
Taq polymérase PERKIN ELMER avec son tampon dans les conditions standards, c'est à dire pour 50μl de réaction il y a les dNTP à 200μM, les pπmers à 20μM, la Taq polymérase 2,5 unités et l' ADN de P. fluorescens A32 2,5 μg.Taq polymerase PERKIN ELMER with its buffer under standard conditions, ie for 50 μl of reaction there are dNTPs at 200 μM, pπmers at 20 μM, Taq polymerase 2.5 units and DNA from P. fluorescens A32 2.5 μg.
Le programme d'amplification utilisé est, 5 min à 95°C puis 35 cycles <45 sec 95°C, 45 sec 49°C, 1 min 72°C> suivis de 5 min à 72°CThe amplification program used is, 5 min at 95 ° C then 35 cycles <45 sec 95 ° C, 45 sec 49 ° C, 1 min 72 ° C> followed by 5 min at 72 ° C
Dans ces conditions, tous les fragments d'amplification obtenus ont une taille compatible avec les tailles théoriques données au-dessus, ce qui est une bonne indication de la spécificité des amplificationsUnder these conditions, all the amplification fragments obtained have a size compatible with the theoretical sizes given above, which is a good indication of the specificity of the amplifications.
Les fragments d'amplifications obtenus avec les jeux d'amorces P1/P4, P1/P5 et P2/P4 sont ligués dans pBSII SK(-) après digestion de ce plasπude par Eco RV et traitement à la terminal transférase en présence de ddTTP comme décπt dans HOLTON T A and GRAHAM M W 1991 N A.R vol 19, n°5 pi 156The amplification fragments obtained with the primer sets P1 / P4, P1 / P5 and P2 / P4 are ligated into pBSII SK (-) after digestion of this plasπude by Eco RV and treatment at the terminal transferase in the presence of ddTTP as decπt in HOLTON TA and GRAHAM MW 1991 N AR vol 19, n ° 5 pi 156
Un clone de chacun des trois types est séquence paπiellement; ceci permet de confirmer qu on a bien amplifié dans les trois cas une partie de la région codante de l'HPPD de P fluorescens A32 Le fragment P1/P4 est retenu comme sonde pour cribler une banque genomique partielle de P. fluorescens A32 et isoler le gène complet de l'HPPD.One clone of each of the three types is sequenced paπiellement; this makes it possible to confirm that a portion of the HPPD coding region of P fluorescens A32 has indeed been amplified in the three cases. The P1 / P4 fragment is retained as a probe to screen a partial genomic library of P. fluorescens A32 and to isolate the complete HPPD gene.
D) Isolement du gène.D) Isolation of the gene.
Par Southern on montre qu'un fragment de 7 Kbp après digestion de l'ADN de P. fluorescens A32 par l'enzyme de restriction BamHI s'hybride avec la sonde HPPD P1/P4. On a donc fait digérer 400μg d'ADN de P. fluorescens A32 par l'enzyme de restπction BamHI et purifier sur gel d'agarose les fragments d'ADN faisant environ 7KbpBy Southern, it is shown that a 7 Kbp fragment after digestion of the DNA of P. fluorescens A32 with the restriction enzyme BamHI hybridizes with the HPPD P1 / P4 probe. So 400 μg of P. fluorescens A32 DNA was digested with the BamHI restriction enzyme and the DNA fragments making about 7Kbp were purified on agarose gel.
Ces fragments sont ligués dans pBSII SK(-), lui-même digéré par Bam HI et déphosphorylé par traitement à la phosphatase alcaline. Après tr,ansformatιon dans E. coh DHlOb, la banque genomique partielle est criblée avec la sonde HPPD P1/P4.These fragments are ligated into pBSII SK (-), itself digested with Bam HI and dephosphorylated by treatment with alkaline phosphatase. After tr, ansformatιon in E. coh DHlOb, the partial genomic library is screened with the HPPD P1 / P4 probe.
Un clone posiuf a été isolé et appelé pRP A. Sa carte simplifiée est donnée figure 2. Sur cette carte est indiqué la position de la partie codîmte du gène HPPD. Elle est composée de 1077 nucléotides qui codent pour 358 acides aminés (voir SEQ ID N° 1 ). L'HPPD de P fluorescens A32 présente une bonne homologie en acides aminés avec celle de Pseudomonas sp strain P J 874, il y a en effet 92% d'identité entre ces deux protéines ( voir figure 3 )A positive clone was isolated and called pRP A. Its simplified map is given in Figure 2. On this map is indicated the position of the codimit part of the HPPD gene. It is composed of 1077 nucleotides which code for 358 amino acids (see SEQ ID N ° 1). P's HPPD fluorescens A32 has good amino acid homology with that of Pseudomonas sp strain PJ 874, there is indeed 92% identity between these two proteins (see Figure 3)
Exemple 2 : Construction de deux gènes chimères avec une séquence HPPD. Pour conférer ia tolérance de plantes aux herbicides inhibant l'HPPD, on construit deux gènes chimèresExample 2: Construction of two chimeric genes with an HPPD sequence. To confer plant tolerance to herbicides that inhibit HPPD, two chimeric genes are constructed
Le premier consiste à mettre la partie codante du gène de l'HPPD de P fluorescens A32 sous le contrôle du promoteur double histone (Demande de Brevet européen N° 0 507 698) suivi du Tobacco etch virus translational enhancer (TEV) (pRTL-GUS (Carπngton and Freed, 1990; J. Virol. 64: 1590-1597)) avec le terminateur du gène de la nopaline syntliase.The first consists in putting the coding part of the HPPD gene of P fluorescens A32 under the control of the double histone promoter (European Patent Application No. 0 507 698) followed by Tobacco etch virus translational enhancer (TEV) (pRTL-GUS (Carπngton and Freed, 1990; J. Virol. 64: 1590-1597)) with the terminator of the nopaline syntliase gene.
L'HPPD sera alors localisée dans le cytoplasme.The HPPD will then be localized in the cytoplasm.
Le deuxième sera identique au premier, à ceci près qu'entre l'activateur de trωslation TEV et la partie codante de l'HPPD, on intercale le peptide de transit optimisé (OTP) (Demande européenne EP n° 0 508 909). L'HPPD sera alors localisée dans le chloroplaste A) Construction du vecteur pRPA-RD-153:The second will be identical to the first, except that between the activator of TEV trωslation and the coding part of the HPPD, the optimized transit peptide (OTP) is inserted (European Application EP n ° 0 508 909). The HPPD will then be located in the chloroplast A) Construction of the vector pRPA-RD-153:
- pRPA-RD-1 1 Un dérivé de pBS-II SK(-) (Stratagene catalog #212206) contenant le sue de polyadenylation de la nopaline synthase (NOS polyA) (Demande européennne n° 0 652 286) est clone entre les sites Kpnl et Sali. Le site Kpnl est transformé en un site N"otI par traitement avec la T4 ADN polymérase I en présence de 150 μ de deoxynucleotide tπphoshates puis ligation avec un linker Notl (Stratagene catalog #1029) Ainsi on obtient une cassette de clonage NOS polyA .- pRPA-RD-1 1 A derivative of pBS-II SK (-) (Stratagene catalog # 212206) containing the polyadenylation sue of nopaline synthase (NOS polyA) (European application n ° 0 652 286) is cloned between the sites Kpnl and Sali. The Kpnl site is transformed into a N " otI site by treatment with T4 DNA polymerase I in the presence of 150 μ of deoxynucleotide tπphoshates then ligation with a Notl linker (Stratagene catalog # 1029). This gives a polyOS NOS cloning cassette.
- pRPA-RD-127. Un dérivé de pRPA-BL-466 (Demande européenne EP n° 0 337 899) clone dans pRPA-RD-1 1 créant une cassette d'expression du gène oxy et contenant le promoteur de la petite sous unité de la ribulose-biscarboxylase. " promoter (SSU) - oxy gène - NOS polyA"- pRPA-RD-127. A derivative of pRPA-BL-466 (European Application EP No. 0 337 899) cloned in pRPA-RD-11 creating an expression cassette for the oxy gene and containing the promoter of the small subunit of ribulose-biscarboxylase. "promoter (SSU) - oxy gene - NOS polyA"
Pour créer ce plasmide, pRPA-BL-488 a été digéré avec Xbal et HindIII pour isoler un fragment de 1.9 kpb contenant le promoteur SSU et le gène oxy, qui a été ligué dans le plasmide pRPA-RD-11 digéré avec des enzymes compatibles.To create this plasmid, pRPA-BL-488 was digested with Xbal and HindIII to isolate a 1.9 kbp fragment containing the SSU promoter and the oxy gene, which was ligated into the plasmid pRPA-RD-11 digested with compatible enzymes .
- pRPA-RD-132: C'est un dérivé de pRPA-BL-488 (Demande européenne EP n° 0 507 698) clone dans pRPA-RD-127 avec création d'une cassette d'expression du gène oxy avec le promoteur double histone:- pRPA-RD-132: It is a derivative of pRPA-BL-488 (European Application EP No. 0 507 698) cloned in pRPA-RD-127 with creation of an expression cassette for the oxy gene with the promoter double histone:
" promoteur double histone - oxy gène - NOS polyA ""double histone promoter - oxy gene - NOS polyA"
Pour fabriquer ce plasmide, pRPA-BL-466 est digéré par HindIII, traité par la Klenow puis redigéré avec Ncol. Le fragment de 1.35 kbp purifié contenant le promoteur double histone H3A748 est ligué avec le plasmide pRPA-RD-127 qui avait été digéré par Xbal, traité Klenow et redigéré par Ncol. - pRPA-RD- 153: C'est un dérivé de pRPA-RD- 132 contenant l'activateur de translation du virus etch du tabac (TEV) pRTL-GUS (Camngton and Freed. 1990: J. Virol. 64* 1590- 1597 ) est digéré avec Ncol et EcoRI et le fragment de 150 bp est ligué dans pRPA-RD- 132 digéré avec les mêmes enzymes. Donc on a créé une cassette d'expression contenant le promoteur:To make this plasmid, pRPA-BL-466 is digested with HindIII, treated with Klenow then redigested with Ncol. The purified 1.35 kbp fragment containing the double histone promoter H3A748 is ligated with the plasmid pRPA-RD-127 which had been digested with Xbal, treated Klenow and redigested by Ncol. - pRPA-RD- 153: It is a derivative of pRPA-RD- 132 containing the translational activator of the tobacco etch virus (TEV) pRTL-GUS (Camngton and Freed. 1990: J. Virol. 64 * 1590- 1597) is digested with Ncol and EcoRI and the 150 bp fragment is ligated into pRPA-RD-132 digested with the same enzymes. So we created an expression cassette containing the promoter:
"double histone promoteur - TEV -oxy u - NOS polyA""double histone promoter - TEV -oxy u - NOS polyA"
B) Construction du vecteur pRPA-RD- 185: pUC19/GECA: Un dérivé de pUC-19 (Gibco catalog #15364-011) contenant de nombreux sites de clonage. pUC- 19 est digéré avec EcoRI et ligué avec l'oligonucleotide linker 1 :B) Construction of the vector pRPA-RD-185: pUC19 / GECA: A derivative of pUC-19 (Gibco catalog # 15364-011) containing numerous cloning sites. pUC-19 is digested with EcoRI and ligated with oligonucleotide linker 1:
Linker 1: AATTGGGCCA GTCAGGCCGT TTAAACCCTA GGGGGCCCGLinker 1: AATTGGGCCA GTCAGGCCGT TTAAACCCTA GGGGGCCCG
CCCGGT CAGTCCGGCA AATTTGGGAT CCCCCGGGC TTAACCCGGT CAGTCCGGCA AATTTGGGAT CCCCCGGGC TTAA
Le clone sélectionné contient un site EcoRI suivi du polylinker qui contient les sites suivants: EcoRI. Apal, Avril, Pmel, Sfil, Sacl, Kpnl, Smai, BamHI, Xbal, Sali, Pstl. SphI et HindIII. pRPA-RD-185: c'est un dérivé de pUC19/GECA contenant un polylinker modifié. pUC19/GECA est digéré par HindIII et ligué avec l'oligonucleotide linker 2:The selected clone contains an EcoRI site followed by the polylinker which contains the following sites: EcoRI. Apal, Avril, Pmel, Sfil, Sacl, Kpnl, Smai, BamHI, Xbal, Sali, Pstl. SphI and HindIII. pRPA-RD-185: it is a derivative of pUC19 / GECA containing a modified polylinker. pUC19 / GECA is digested with HindIII and ligated with the oligonucleotide linker 2:
Linker 2: AGCTTTTAAT TAAGGCGCGC CCTCGAGCCT GGTTCAGGGLinker 2: AGCTTTTAAT TAAGGCGCGC CCTCGAGCCT GGTTCAGGG
AAATTA ATTCCGCGCG GGAGCTCGGA CCAAGTCCC TCGA Le clone sélectionné contient un site HindIII site au milieu du polylinker qui contient maintenant les sites suivants: EcoRI, Apal, Avril, Pmel, Sfil, Sacl, Kpnl, Smai, BamHI, Xbal, Sali. Pstl, SphI, HindIII, Pacl, Ascl Xhol et EcoNI.AAATTA ATTCCGCGCG GGAGCTCGGA CCAAGTCCC TCGA The selected clone contains a HindIII site in the middle of the polylinker which now contains the following sites: EcoRI, Apal, Avril, Pmel, Sfil, Sacl, Kpnl, Smai, BamHI, Xbal, Sali. Pstl, SphI, HindIII, Pacl, Ascl Xhol and EcoNI.
C) Construction du vecteur pRP T: - pRP O: un dérivé de pRPA-RD-153 conten.ant une cassette d'expression de l'HPPD, promoteur double histone - TEV - gène HPPD - terminateur Nos. Pour fabriquer pRP O, pRPA-RD153 est digéré par Hind III, traité par la Klenow puis redigéré par Ncol pour enlever le gène oxy et le remplacer par le gène HPPD sorti du plasmide pRP A par digestion BstEÏÏ, traitement par la Klenow et redigestion par Ncol. - pRP R: pour l'obtenir le plasmide pRP O a été digéré par PvuII et Sacl, le gène chimère a été purifié puis ligué dans pRPA-RD-185 lui-même digéré par PvuJJ et Sacl.C) Construction of the vector pRP T: - pRP O: a derivative of pRPA-RD-153 containing an HPPD expression cassette, double histone promoter - TEV - HPPD gene - Nos terminator. To make pRP O, pRPA-RD153 is digested with Hind III, treated with Klenow then redigested with Ncol to remove the oxy gene and replace it with the HPPD gene taken out of the plasmid pRP A by BstEII digestion, Klenow treatment and redigestion by Ncol. - pRP R: to obtain the plasmid pRP O was digested with PvuII and Sac1, the chimeric gene was purified and then ligated into pRPA-RD-185 itself digested with PvuJJ and Sacl.
- pRP T: il a été obtenu par ligation du gène chimère sorti de pRP R après digestion par Sacl et HindIII d∑tns le plasmide pRPA-BL 150 alpha2 digéré par les mêmes enzymes (Demande européenne EP n° 0 508 909). Le gène chimère du vecteur pRP T a donc la structure suivante'- pRP T: it was obtained by ligation of the chimeric gene exited from pRP R after digestion with SacI and HindIII in the plasmid pRPA-BL 150 alpha2 digested with the same enzymes (European Application EP No. 0 508 909). The pRP T vector chimera gene therefore has the following structure:
Promoteur double histone TEV Région codante de l'HPPD Terminateur nosPromoter double histone TEV Coding region of HPPD Terminator nos
D) Construction du vecteur pRP V - pRP P: c'est un dérivé de pRPA-RD-7 (Demande européennne EP n° 0 652 286) contenant le peptide de transit optimisé suivi du gène de l'HPPD. Il a été obtenu par ligation de la partie codante de l'HPPD sorti de pRP A par digestion BstEII et Ncol, traitement à la Klenow et du plasmide pRPA-RD-7 lui-même digéré SphI et AccI et traité à la DNAse polymérase T4. - pRP Q' un dérivé de pRPA-RD- 153 contenant une cassette d'expression de l'HPPD, promoteur double histone - TEV - OTP - gène HPPD - terminateur Nos. Pour le construire le plasmide pRPA-RD- 153 est digéré par Sal I, traité par la Klenow puis redigéré par Ncol pour enlever le gène oxy et le remplacer par le gène HPPD sorti du plasmide pRP F' par digestion BstEII. traitement par la Klenow et redigestion par Ncol - pRP S: pour l'obtenir, le plasmide pRP Q a été digéré par PvuII et Sacl pour sorrir le gène chimère qui a été ligué dans pRPA-RD-185 lui-même digéré par PvuII et Sacl.D) Construction of the vector pRP V - pRP P: it is a derivative of pRPA-RD-7 (European Application EP No. 0 652 286) containing the optimized transit peptide followed by the HPPD gene. It was obtained by ligation of the coding part of HPPD out of pRP A by BstEII and Ncol digestion, Klenow treatment and of the plasmid pRPA-RD-7 itself digested SphI and AccI and treated with T4 DNAse polymerase . - pRP Q 'a derivative of pRPA-RD-153 containing an HPPD expression cassette, double histone promoter - TEV - OTP - HPPD gene - Nos terminator. To construct it, the plasmid pRPA-RD-153 is digested with Sal I, treated with Klenow then redigested with Ncol to remove the oxy gene and replace it with the HPPD gene released from the plasmid pRP F 'by BstEII digestion. Klenow treatment and redigestion by Ncol - pRP S: to obtain it, the plasmid pRP Q was digested with PvuII and Sacl to extract the chimeric gene which was ligated in pRPA-RD-185 itself digested by PvuII and Sacl.
- pRP V. il a été obtenu par ligation du gène chimère sorti de pRP S après digestion par Sacl et HindIII dans le plasmide pRPA-BL 150 alpha2 (Demande européennne EP n° 0 508 909) Le gène chimère du vecteur pRP Q a donc la structure suivante.- pRP V. it was obtained by ligation of the chimeric gene exited from pRP S after digestion with SacI and HindIII in the plasmid pRPA-BL 150 alpha2 (European Application EP n ° 0 508 909) The chimeric gene of the vector pRP Q therefore has the following structure.
Promoteur double TEV OTP Région codante de l'HPPD Terminateur nos histoneDual TEV OTP promoter HPPD coding region Nos histone terminator
Exemple 3 : Transformation du tabac industriel PBD6.Example 3: Processing of PBD6 industrial tobacco.
Afin de déterminer l'efficacité de ces deux gènes chimériques, ceux-ci ont été transi'érés dans du tabac industriel PBD6 selon les procédures de transformation et de régénération déjà décrites dans la demande européenne EP n° 0 508 909.To determine the efficacy of these two chimeric genes, they were numb 'eras in the industrial tobacco PBD6 as processing procedures and regeneration already described in European Application EP No. 0,508,909.
1) Transformation:1) Transformation:
Le vecteur est introduit dans la souche non oncogène d'Agrobactenum EHA 101 (Hood et al, 1987) porteuse du cosmide pTVK 291(Komaπ et al, 1986). La technique de transformation est basée sur la procédure de Horsh R. et al. (1985) Science, 227, 1229-1231.The vector is introduced into the non-oncogenic strain of Agrobactenum EHA 101 (Hood et al, 1987) carrying the cosmid pTVK 291 (Komaπ et al, 1986). The transformation technique is based on the procedure of Horsh R. et al. (1985) Science, 227, 1229-1231.
2) Régénération: La régénération du tabac PBD6 (provenance SEITA France) à partir d'expiants foliaires est réalisée sur un milieu de base Murashige et Skoog (MS) comprenant 30g/l de saccharose ainsi que 100 μg/ml de kanamycine. Les explants foliaires sont prélevés sur des plants en serre ou in vitro et transformés selon la technique des disques foliaires( Science 1985Nol 227. p.1229-1231) en trois étapes successιves:la première comprend l'induction des pousses sur un milieu MS additionné de 30g/l de saccharose contenant 0.05mg/l d'acide naphtyiacétique (AN A) et 2 mg/1 de benzylaminopurine (BAP) pendant 15 jours. Les pousses formées au cours de cette étape sont ensuite développées par culture sur un milieu MS additionné de 30 g/1 de saccharose mais ne contenant pas d'hormone, pendant 10 jours. Puis on prélève des pousses développées et on les cultive sur un milieu d'enracinement MS à teneur moitié en sels, vitamines et sucres et ne contenant pas d'hormone. Au bout d'environ 15 jours, les pousses enracinées sont passées en terre. Les plantes obtenues sont appellées Co 17.2) Regeneration: The regeneration of PBD6 tobacco (from SEITA France) from leaf explants is carried out on a Murashige and Skoog (MS) base medium comprising 30 g / l of sucrose as well as 100 μg / ml of kanamycin. The leaf explants are taken from plants in the greenhouse or in vitro and transformed according to the technique of leaf discs (Science 1985Nol 227. p.1229-1231) in three successive stages: the first comprises the induction of shoots on an added MS medium 30g / l of sucrose containing 0.05mg / l of naphthiaciacetic acid (AN A) and 2 mg / 1 of benzylaminopurine (BAP) for 15 days. The shoots formed during this stage are then developed by culture on an MS medium supplemented with 30 g / l of sucrose but containing no hormone, for 10 days. Then developed shoots are taken and cultivated on an MS rooting medium with half content of salts, vitamins and sugars and containing no hormone. After about 15 days, the rooted shoots are put in the ground. The plants obtained are called Co 17.
Au sortir de l'in-vitro, les plantules de tabac transformées ont été acclimatées à la serre (60% d'humidité relative; température: 20°C la nuit et 23°C la jour) pendant cinq semaines puis traitées au 4-[4-CF3-2-(méthylsulfonyl) benzoyl]-5-cyclopropyl isoxazole.At the end of in-vitro, the transformed tobacco seedlings were acclimated in the greenhouse (60% relative humidity; temperature: 20 ° C at night and 23 ° C during the day) for five weeks then treated with 4- [4-CF3-2- (methylsulfonyl) benzoyl] -5-cyclopropyl isoxazole.
Le tabac témoin, non transformé et traité au 4-[4-CF3-2-(méthylsulfonyl)benzoyl]-5- cyclopropyl isoxazole à des doses allant de 50 à 400 g/ha, développe en environ 72 heures des chloroses, qui s'intensifient pour évoluer vers des nécroses très prononcées en une semaine (couvrant environ 80% des feuilles terminales).Control tobacco, unprocessed and treated with 4- [4-CF3-2- (methylsulfonyl) benzoyl] -5- cyclopropyl isoxazole at doses ranging from 50 to 400 g / ha, develops in about 72 hours chloroses, which s 'intensify to progress to very pronounced necrosis in a week (covering about 80% of the terminal leaves).
Après transformation ce même tabac, qui surexpπme l'HPPD de P. fluorescens, est très bien protégé contre un traitement au 4-[4-CF3-2-(méthylsulfonyl) benzoyl]-5-cyclopropyl isoxazole à la dose de 400 g/ha.After processing, this same tobacco, which overexpπme the HPPD of P. fluorescens, is very well protected against treatment with 4- [4-CF3-2- (methylsulfonyl) benzoyl] -5-cyclopropyl isoxazole at a dose of 400 g / Ha.
Si l'enzyme surexpπmée est dans le chloroplaste, c'est à dire si la transformation a été faite avec le gène porté par le vecteur pRP V, alors la plante est parfaitement protégée, ne présente aucun symptôme.If the overexpressed enzyme is in the chloroplast, that is to say if the transformation was made with the gene carried by the vector pRP V, then the plant is perfectly protected, has no symptoms.
Exemple 4: Transformation du tabac industriel PBD6. avec gène EPSPS pour =3 construction 173 Isolement d'un ADNc codant pour une EPSPS de maïs:Example 4: Processing of PBD6 industrial tobacco. with EPSPS gene for = 3 construction 173 Isolation of a cDNA coding for a corn EPSPS:
Les différentes étapes, qui ont conduit à l'obtention de l'ADNc d'EPSPS de maïs, qui a servi de substrat à l'introduction des deux mutations, sont décrites ci-dessous. Toutes les opérations décrites ci-dessous sont données à titre d'exemples et correspondent à un choix, effectué parmi les différentes méthodes disponibles pour parvenir au même résultat. Ce choix n'a aucune incidence sur la qualité du résultat et par conséquent, toute méthode adaptée peut être utilisée par l'homme de l'art pour parvenir au même résultat. La plupart des méthodes d'ingénierie des fragments d'ADN sont décrites dans "Current Protocols in Molecular Biology" Volumes 1 et 2, Ausubel F.M. et al , publiés par Greene Publishmg Associates et Wiley -Interscience ( 1989)(Par la suite, les références à des protocoles décrits dans cet ouvrage seront notées "réf. CPMB"). Les opérations concernant l'ADN, qui ont été effectuées selon les protocoles décrits dans cet ouvrage sont, en particulier les suivantes: ligation de fragments d'ADN, traitements par l'ADN polymérase de Klenow et la T4 ADN polymérase, préparation d'ADN de plasmides et de bactéπophages λ soit en rrunipréparation soit en maxi préparation, analyses d'ADN et d'ARN respectivement selon les techniques de Southern et Northern. D'autres méthodes décrites dans cet ouvrage ont été suivies, et seules les modifications ou ajouts significatifs à ces protocoles ont été décrits ci-dessous. Al. Obtention d'un fragment d'EPSPS d' Arabidopsis thaliana a) deux oligonucléotides 20-mers de séquences respectives:The various steps, which led to the production of the corn EPSPS cDNA, which served as a substrate for the introduction of the two mutations, are described below. All the operations described below are given as examples and correspond to a choice made from the different methods available to achieve the same result. This choice does not affect the quality of the result and therefore, any suitable method can be used by those skilled in the art to achieve the same result. Most of the methods for engineering DNA fragments are described in "Current Protocols in Molecular Biology "Volumes 1 and 2, Ausubel FM et al, published by Greene Publishmg Associates and Wiley -Interscience (1989) (Thereafter, references to protocols described in this work will be noted" ref. CPMB "). Operations concerning DNA, which have been carried out according to the protocols described in this work, are in particular the following: ligation of DNA fragments, treatments with Klenow DNA polymerase and T4 DNA polymerase, preparation of plasmid DNA and bacteriophages λ either in preparation or in maximum preparation, DNA and RNA analyzes respectively according to Southern and Northern techniques. Other methods described in this work have been followed, and only significant modifications or additions to these Protocols have been described below. A1. Obtaining an EPSPS fragment from Arabidopsis thaliana a) two 20-mer oligonucleotides of respective sequences:
5 - GCTCTGCTCATGTCTGCTCC -3' 5'- GCCCGCCCTTGACAAAGAAA- 3' ont été synthétisés à partir de la séquence d'un gène d'EPSPS d'Arabidopsis thaliana (Klee H.J. et al. (1987) Mol. Gen. Genêt.. 210, 437-442). Ces deux oligonucléotides sont respectivement en position 1523 à 1543 et 1737 à 1717 de la séquence publiée et en orientation convergente. b) L'ADN total d'Arabidopsis thaliana (var. columbia) a été obtenu chez Clontech (référence catalogue: 6970-1) c) On mélange 50 nanogrammes(ng) d'ADN avec 300ng de chacun des oligonucléotides et soumis à 35 cycles d'amplification avec un appareil Perkin-Elmer 9600, dans les conditions de milieu standard pour l'amplification préconisées par le fournisseur Le fragment de 204 pb résultant constitue le fragment d'EPSPS d' Arabidopsis thaliana.5 - GCTCTGCTCATGTCTGCTCC -3 '5'- GCCCGCCCTTGACAAAGAAA- 3' were synthesized from the EPSPS gene sequence of Arabidopsis thaliana (Klee HJ et al. (1987) Mol. Genet Genet .. 210, 437-442). These two oligonucleotides are respectively in positions 1523 to 1543 and 1737 to 1717 of the published sequence and in convergent orientation. b) The total DNA of Arabidopsis thaliana (var. columbia) was obtained from Clontech (catalog reference: 6970-1) c) 50 nanograms (ng) of DNA are mixed with 300ng of each of the oligonucleotides and subjected to 35 amplification cycles with a Perkin-Elmer 9600 device, under standard medium conditions for the amplification recommended by the supplier. The resulting 204 bp fragment constitutes the EPSPS fragment from Arabidopsis thaliana.
2. Construction d'une bibliothèque d'un ADNc à partir d'une ligne cellulaire de mais BMS . a) On broyé 5 g de cellules filtrées dans l'azote liquide et les acides nucléiques totaux extraits selon la méthode décrite par Shure et al. avec les modifications suivantes:2. Construction of a cDNA library from a BMS corn cell line. a) 5 g of filtered cells are ground in liquid nitrogen and the total nucleic acids extracted according to the method described by Shure et al. with the following modifications:
- le pH du tampon de lyse est ajusté à PH = 9,0;- the pH of the lysis buffer is adjusted to PH = 9.0;
-après la précipitation par l'isopropanol, le culot est repris dans l'eau et après dissolution, ajusté à 2,5 M LiCl. Après incubation pendant 12 h à °C, le culot de la centrifugation d 15 min. à 30000g à 4°C est resolubilisé. L'étape de précipitation par LiCl est alors répétée. Le culot resolubilisé constitue la fraction ARN des acide s nucléiques totaux. b) La fraction ARN-polyA+ de la fraction ARN est obtenue par chromatographie sur colonne oligo-dT cellulose telle que décrite dans "Current Protocols in Molecular Biology ' . c) Synthèse d'ADNc double brin à extrémité synthétique EcoRI: elle est réalisée en suivant le protocole du fournisseur des différents réactifs nécessaires à cette synthèse s.ou forme d'un kit: le "copy kit" de la société In Vitrogen. Deux oligonucléotides simples brins et partiellement complémentaires de séquences respectivesafter precipitation with isopropanol, the residue is taken up in water and after dissolution, adjusted to 2.5 M LiCl. After incubation for 12 h at ° C, the pellet of the centrifugation for 15 min. at 30000g at 4 ° C is resolubilized. The LiCl precipitation step is then repeated. The resolubilized pellet constitutes the RNA fraction of the total nucleic acids. b) The RNA-polyA + fraction of the RNA fraction is obtained by chromatography on an oligo-dT cellulose column as described in "Current Protocols in Molecular Biology". c) Synthesis of double-stranded cDNA with EcoRI synthetic end: it is carried out in according to the protocol of the supplier of the various reagents necessary for this synthesis, or in the form of a kit: the "copy kit" from the company In Vitrogen. Two single-stranded and partially complementary oligonucleotides of respective sequences
5 - AATTCCCGGG -35 - AATTCCCGGG -3
5'- CCCGGG- 3' (ce dernier étant phosphorylé) sont ligués avec ies ADNc double brin à extrémités franches5'- CCCGGG- 3 '(the latter being phosphorylated) are ligated with double-stranded cDNAs with blunt ends
Cette ligation des adaptateurs résulte en la création de sites Sma I accolés aux ADNc double brin et EcoRI sous forme cohésive à chaque extrémité des ADNc double bπn d) Création de la bibliothèqueThis ligation of the adapters results in the creation of Sma I sites attached to the double strand cDNAs and EcoRI in cohesive form at each end of the double bπn cDNAs d) Creation of the library
Les ADNc présentant à leurs extrémités les sites artificiels cohésifs EcoRI sont ligués avec le ADNc du bactéπophage λgtlO coupe par EcoRI et déphosphorylé selon le protocole du fournisseur New England Biolabs Une ahquote de la réaction de ligation a été encapsidée in vitro avec des extraits d'encapsidation- Gigapack Gold selon les instructions du fournisseur, cette librairie a été titrée en utilisant la bactérie E.coli C600hf. l la librairie ainsi obtenue est amplifiée et stockée selon les instructions du même fournisseur et constitue la librairie de ADNc de suspension cellulaire de mais BMS 3 Criblage de la bibliothèque de ADNc de suspension cellulaire de mais BMS avec la sonde EPSPS d'Arabidopsis thalianaThe cDNAs presenting at their ends the EcoRI cohesive artificial sites are ligated with the cDNA of the bacteriophage λgt10 cut by EcoRI and dephosphorylated according to the protocol of the supplier New England Biolabs An ahquote of the ligation reaction was packaged in vitro with packaging extracts - Gigapack Gold according to the supplier's instructions, this library was titrated using the E.coli C600hf bacteria. l the library thus obtained is amplified and stored according to the instructions of the same supplier and constitutes the library of cDNA of cell suspension of corn BMS 3 Screening of the library of cDNA of cell suspension of corn BMS with the EPSPS probe of Arabidopsis thaliana
Le protocole suivi est celui de "Current Protocols in Molecular Biology" Volumes 1 et 2, Ausubel F.M et al , publiés par Greene Pubhshing Associates et S (1989)(CPMB). En bref, environ 10^ phages recombinants sont étalés sur boîte LB à une densité moyenne deThe protocol followed is that of "Current Protocols in Molecular Biology" Volumes 1 and 2, Ausubel F.M et al, published by Greene Pubhshing Associates and S (1989) (CPMB). In short, approximately 10 ^ recombinant phages are spread on an LB dish at an average density of
100 phages /cm^ Les plages de lyses sont répliqués en doubles sur membrane Hybond N d'Amersham h) L'ADN a été fixé sur les filtres par traitement UV 1600kJ (Stratahnker de Stratagene) Les filtres îont été préhydndés dans 6xSSC/0,l%SDS/0,25 lait écrémé pendant100 phages / cm ^ The lyses are replicated in duplicates on Hybond N membrane from Amersham h) The DNA was fixed on the filters by UV treatment 1600kJ (Stratahnker of Stratagene) The filters were pre-hydrated in 6xSSC / 0, l% SDS / 0.25 skim milk for
2h à 65°C La sonde EPSPS d'Arabidopsis thaliana a été marquée au 32p-dCTP par2 h at 65 ° C. The EPSPS probe of Arabidopsis thaliana was labeled with 32p-dCTP by
"random-pπming" selon les instructions du fournisseur (Kit Ready to Go de Pharmacia)"random-pπming" according to the supplier's instructions (Pharmacia Ready to Go Kit)
L'activité spécifique obtenue est de l'ordre de 10& cpm par μg de fragment. Après dénaturation pendant 5 min à 100°C, la sonde est ajoutée dans le milieu de préhybπdation et l'hybridation est poursuivie pendant 14 heures à 55°C. Les filtres sont fluorographies 48h à -The specific activity obtained is of the order of 10 & cpm per μg of fragment. After denaturation for 5 min at 100 ° C., the probe is added to the prehybπdation medium and the hybridization is continued for 14 hours at 55 ° C. Filters are fluorographs 48h to -
80°C avec un film Kodak XAR5 et des écrans renforçateurs Hyperscreen RPN d'Amersham.80 ° C with Kodak XAR5 film and Amersham Hyperscreen RPN reinforcing screens.
L'alignement des spots positifs sur le filtre avec les boîtes d'où ils sont issus permet de prélever, sur la boîte, des zones correspondant aux phages présentant une réponse d'hybridation positive avec la sonde EPSPS d'Arabidopsis thaliana. Cette étape d'étalement, transfert, hybπdation, récupération est répétée jusqu'à ce que tous les spots de la boîte des phages successivement puπfiés se révèlent positifs à 100% en hybridation. Une plage de lyse par phage indépendant est alors prélevée dans du milieu λ diluant (Tris-Ci pH= 7,5; MgSO4 lOmM. NaCl 0.1 M. gélatine 0.1 %). ces phages en solution constituant les clones positifs de I' EPSP de la suspension cellulaire de mais BMSThe alignment of the positive spots on the filter with the boxes from which they originate makes it possible to take, from the box, zones corresponding to the phages having a positive hybridization response with the EPSPS probe of Arabidopsis thaliana. This step of spreading, transfer, hybridization, recovery is repeated until all the spots in the phage box successively puπfiés prove to be 100% positive in hybridization. An independent phage lysis range is then taken in diluent λ medium (Tris-Ci pH = 7.5; MgSO4 lOmM. 0.1 M NaCl 0.1% gelatin). these phages in solution constituting the positive clones of the EPSP of the BMS corn cell suspension
4 Préparation et analyse de l'ADN des clones d'EPSPS de la suspension cellulaire de4 Preparation and analysis of the DNA of the EPSPS clones of the cell suspension of
On ajoute environ 5 10^ phages à 20 ml de bactéries C600hfl à 2 OD 600nm/ml et incubés 15 minutes à 37°C Cette suspension est alors diluée dans 200ml de milieu de croissance des bactéries dans un Erlen de 1 1 et agitée dans un agitateur rotatif à 250 rpm La lyse est constatée par clarification du milieu, correspondant à 1 lyse des bactéries turbides et se produit après environ 4 h d'agitation. Ce surnageant est alors traité comme décrit dans "Current Protocols in Molecular Biology" L'ADN obtenu correspond aux clones d'EPSP de la suspension cellulaire de mais BMSAbout 5 × 10 6 phages are added to 20 ml of bacteria C600hfl at 2 OD 600nm / ml and incubated for 15 minutes at 37 ° C. This suspension is then diluted in 200 ml of bacteria growth medium in a 1-liter Erlenmeyer flask and stirred in a rotary agitator at 250 rpm Lysis is observed by clarification of the medium, corresponding to 1 lysis of the turbid bacteria and occurs after approximately 4 h of agitation. This supernatant is then treated as described in "Current Protocols in Molecular Biology" The DNA obtained corresponds to the EPSP clones of the corn cell suspension BMS
Un à deux μg de cet ADN sont coupés par EcoRI et séparés sur gel d'agarose LGTA TBE (réf. CPMB) à 0,8% Une dernière vérification consiste à s'assurer que l' ADN purifié présente bien un signal d'hybridation avec la sonde EPSPS d'Arabidopsis thaliana. Après l'électrophorese, les fragments d'ADN sont transférés sur membrane Hybond N d'Amersham selon le protocole de Southern décrit dans "Current Protocols in Molecular Biology". Le filtre est hybride avec la sonde EPSPS d'Arabidopsis thaliana selon les conditions décrites au paragraphe 3 ci-dessus Le clone présentant un signal d'hybridation avec la sonde EPSPS d'Arabidopsis thaliana et contenant le plus long fragment EcoRI a une taille estimée sur gel à environ l ,7kpbOne to two μg of this DNA are cut with EcoRI and separated on 0.8% LGTA TBE agarose gel (ref. CPMB). A final check consists in making sure that the purified DNA does indeed present a hybridization signal. with the EPSPS probe from Arabidopsis thaliana. After electrophoresis, the DNA fragments are transferred onto an Amersham Hybond N membrane according to the Southern protocol described in "Current Protocols in Molecular Biology". The filter is hybridized with the Arabidopsis thaliana EPSPS probe according to the conditions described in paragraph 3 above. The clone exhibiting a hybridization signal with the Arabidopsis thaliana EPSPS probe and containing the longest EcoRI fragment has an estimated size of frost at around l, 7kpb
5. Obtention du clone pRPA-ML-71 1:5. Obtaining the clone pRPA-ML-71 1:
Dix μg de l'ADN du clone phagique contenant linsert de l,7kpb sont digérés par EcoRI et séparés sur gel d'agarose LGTA/TBE (réf. CPMB) à 0,8% Le fragment de gel contenant linsert de l,7kpb est excisé du gel par coloration BET et le fragment est traité à la β-agarase selon le protocole du fournisseur New a Biolabs. L'ADN purifié du fragment de l,7kpb est ligué à 12°C pendant 14h avec l'ADN du plasmide pUC 19 (New England Biolabs) coupé par EcoRI selon le protocole de ligation décrit dans "Current Protocols in Molécule Biology". Deux μl du mélange de ligation ci-dessus sont utilisés pour la transformation d'une aliquote d'E.coli DH10B électro compétentes; la transformation se fait par électroporation en utilisant les conditions suivantes: le mélange de bactéπes compétentes et de milieu de ligation est introduit dans une cuvette d'électroporation d'épaisseur 0,2 cm (Biorad) prélablement refroidie à 0°C. Les conditions physiques de l'électroporation utilisant un électroporateur de marque Biorad sont 2500 Volts, 25 μFarad et 200 Ω. Dans ces conditions, le temps de décharge moyen de condensateur est de l'ordre de 4,2 millisecondes. I-es bactéπes sont alors reprises dans 1 ml de milieu SOC (réf. CPMB) et agitées pendani 1 heure à 200 rpm sur un agitateur rotatif dans des tubes Corning de 15 ml. Après étalement sur milieu LB/agar supplémenté à 100 μg/ml de carbénici ne, les mιni-prép.aratιons des clones bactériens ayant poussé après une nuit à 37 °C est réalisée selon le protocole décrit dans ' Current Protocols in Moleculai Biology". Après digestion par EcoRI de l'ADN et séparation en electrophorèse sur gel d'agarose LGTA/TBE (réf. CPMB) à 0.8%. les clones présentant un insert de 1.7kpb sont conservés Une dernière vérification consiste à s'assurer que l' ADN purifié présente bien un signal d'hybridation avec la sonde EPSPS d'Arabidopsis thaliana. Après l'électrophorese, les fragments d'ADN sont transférés sur membrane Hybond N d'Amersham selon le protocole de Southern décrit dans "Current Protocols m Molecular Biology" Le filtre est hybride avec la sonde EPSPS d'Arabidopsis thaliana selon les conditions décπtes au paragraphe 3 ci-dessus. Le clone plasmidique présentant un insert de 1 ,7kpb et hybπdant avec la sondé EPSPS d'Arabidopsis thaliana a été préparé à plus grande échelle et l'ADN résultant de la lyse des bactéries purifié sur gradient de CsCl ainsi que décrit dans "Current Protocols in Molecular Biology". L'ADN purifié a été partiellement séquence avec un kit Pharmacia en suivant les instructions du fournisseur et en utilisant comme amorces, les amorces universelles de M13 directes et inverses commandées chez le même fournisseur. La séquence partielle réalisée couvre environ 0,5 kpb. La séquence dérivée en acides aminés dans la région de la protéine mature (environ 50 résidus acides aminés) présente une identité de 100% avec la séquence aminée correspondante de l'EPSPS mature de mais décrite dans le brevet américain USP 4 971 908). Ce clone correspondant à un fragment EcoRI de l,7kpb de l'ADN de l' EPSP de la suspension cellulaire de mais BMS a été nommé pRPA-ML-711. La séquence complète de ce clone a été réalisée sur les deux bnns en utilisant le protocole du kit Pharmacia et en synthétisant des oligonucléotides complémentaires et de direction opposée tous les 250 pb environ. La séquence complète de ce clone de 1713 pb obtenue est présentée par SEQ ID N° 2. 6. Obtention du clone pRPA-ML-715: L'analyse de la séquence du clone pRPA-ML-711 et en particulier la comparaison de la séquence d' acides aminés dérivés avec celle de maïs montre une extension de séquence de 92 pb en amont du codon GCG codant pour l'Alanine NH2-termιnale de la partie mature de l'EPSPS de maïs (brevet américain USP 4 971 908). De même une extension de 288 pb en aval du codon AAT codant pour l'asparagine COOH-terminale de la partie mature de l'EPSPS de mais (brevet américain USP 4 971 908) est observée. Ces deux parties pourraient correspondre, pour l'extension NH2-termιnale à une portion de la séquence d'un peptide de transit pour la localisation plastidiale et pour l'extension COOH-terminale à la région 3' non traduite de l'ADNcTen μg of the DNA of the phage clone containing the insert of 1.7 kbp are digested with EcoRI and separated on an agarose LGTA / TBE gel (ref. CPMB) at 0.8% The gel fragment containing the insert of the 1.7 kbp is excised from the gel by BET staining and the fragment is treated with β-agarase according to the protocol of the supplier New a Biolabs. The purified DNA of the 1.7 kbp fragment is ligated at 12 ° C. for 14 h with the DNA of the plasmid pUC 19 (New England Biolabs) cut by EcoRI according to the ligation protocol described in "Current Protocols in Molecule Biology". Two μl of the above ligation mixture are used for the transformation of an aliquot of electro-competent E. coli DH10B; the transformation is done by electroporation using the following conditions: the mixture of competent bacteria and ligation medium is introduced into an electroporation cuvette of 0.2 cm thickness (Biorad) previously cooled to 0 ° C. The physical conditions of electroporation using a Biorad brand electroporator are 2500 Volts, 25 μFarad and 200 Ω. Under these conditions, the average capacitor discharge time is of the order of 4.2 milliseconds. The bacteria are then taken up in 1 ml of SOC medium (ref. CPMB) and stirred for 1 hour at 200 rpm on a rotary shaker in 15 ml Corning tubes. After spreading on LB / agar medium supplemented with 100 μg / ml of carbenici ne, the mid-prep.aratιons of the bacterial clones having grown after a night at 37 ° C. is carried out according to the protocol described in "Current Protocols in Moleculai Biology". After EcoRI digestion of DNA and separation by electrophoresis on 0.8% LGTA / TBE agarose gel (ref. CPMB). Clones with an insert of 1.7kbp are kept One last verification consists in ensuring that the purified DNA does indeed present a hybridization signal with the EPSPS probe from Arabidopsis thaliana After the electrophoresis, the DNA fragments are transferred onto Amersham Hybond N membrane according to the protocol of Southern described in "Current Protocols m Molecular Biology" The filter is hybridized with the EPSPS probe from Arabidopsis thaliana according to the conditions set out in paragraph 3 above. The plasmid clone having an insert of 1.7 kbp and hybridizing with the probe EPSPS d Arabidopsis thaliana was prepared on a larger scale and the DNA resulting from the lysis of bacteria purified on a CsCl gradient as described in "Current Protocols in Molecular Biology". The purified DNA was partially sequenced with a Pharmacia kit following the supplier's instructions and using as primers, the direct and reverse M13 universal primers ordered from the same supplier. The partial sequence performed covers approximately 0.5 kbp. The amino acid derivative sequence in the region of the mature protein (approximately 50 amino acid residues) has 100% identity with the corresponding amino sequence of the mature EPSPS of but described in US Patent USP 4,971,908). This clone corresponding to an EcoRI fragment of 1.7 kbp of the EPSP DNA from the corn cell suspension BMS was named pRPA-ML-711. The complete sequence of this clone was carried out on the two bnns using the protocol of the Pharmacia kit and by synthesizing complementary oligonucleotides and of opposite direction every 250 bp approximately. The complete sequence of this 1713 bp clone obtained is presented by SEQ ID No. 2. 6. Obtaining of the clone pRPA-ML-715: Analysis of the sequence of the clone pRPA-ML-711 and in particular the comparison of the amino acid sequence derived from that of corn shows a 92 bp sequence extension upstream of the GCG codon coding for NH2-terminal Alanine of the mature part of the corn EPSPS (US Patent USP 4,971,908). Similarly, a 288 bp extension downstream of the AAT codon coding for COOH-terminal asparagine of the mature part of the corn EPSPS (US Patent USP 4,971,908) is observed. These two parts could correspond, for the NH2-terminal extension to a portion of the sequence of a transit peptide for plastid localization and for the COOH-terminal extension to the 3 'untranslated region of the cDNA.
Afin d'obtenir un ADNc codant pour la partie mature de l'ADNc de l'EPSPS de maïs, telle que décrite dans l' USP 4 971 908, les opérations suivantes ont été réalisées: a) Elimination de la région 3' non traduite: construction de pRPA-ML-712:In order to obtain a cDNA coding for the mature part of the cDNA of the corn EPSPS, as described in USP 4,971,908, the following operations were carried out: a) Elimination of the 3 'untranslated region : construction of pRPA-ML-712:
Le clone pRPA-ML-711 a été coupé par l'enzyme de restriction Asel et les extrémités résultant de cette coupure rendues franches par traitement avec le fragment de Klenow de l'ADN polymérase I selon le protocole décrit dans CPMB. Une coupure par l'enzyme de restriction Sacll a ensuite été effectuée. L'ADN résultant de ces opérations a été séparé par électrophorèse sur gel d'agarose LGTA/TBE (réf. CPMB) 1%.The clone pRPA-ML-711 was cut by the restriction enzyme Asel and the ends resulting from this cleavage made blunt by treatment with the Klenow fragment of DNA polymerase I according to the protocol described in CPMB. A cut by the enzyme of Sacll restriction was then performed. The DNA resulting from these operations was separated by electrophoresis on agarose gel LGTA / TBE (ref. CPMB) 1%.
Le fragment de gel contenant l'insert "Asel-extrémités franches/SacII" de 0.4 kob a été excisé du gel et purifié selon le protocole décrit au paragraphe 5 ci-dessus. L'ADN du cione pRPA-ML-71 1 a été coupé par l'enzyme de restriction HindIII située dans le polylinker du vecteur de clonage pUC 19 et les extrémités résultant de cette coupure ont été rendues franches par traitement avec le fragment de Klenow de l'ADN polymérase I. Une coupure par l'enzyme de restriction Sacll a ensuite été effectuée. L'ADN résultant de ces manipulations a été séparé par électrophorèse sur gel d'agarose LGTA/TBE (réf. CPMB) 0,7%.The gel fragment containing the 0.4 kob "Asel-blunt ends / SacII" insert was excised from the gel and purified according to the protocol described in paragraph 5 above. The DNA of the pRPA-ML-71 1 cione was cut with the restriction enzyme HindIII located in the polylinker of the cloning vector pUC 19 and the ends resulting from this cleavage were made blunt by treatment with the Klenow fragment of DNA polymerase I. A cut by the restriction enzyme Sac11 was then carried out. The DNA resulting from these manipulations was separated by electrophoresis on an agarose gel LGTA / TBE (ref. CPMB) 0.7%.
Le fragment de gel contenant l'insert HindIII-extrémités franches/SacII de environ 3,7kpb a été excisé du gel et purifié selon le protocole décrit au paragraphe 5 ci-dessus.The gel fragment containing the HindIII blunt end / SacII insert of approximately 3.7 kbp was excised from the gel and purified according to the protocol described in paragraph 5 above.
Les deux inserts ont été ligués, et 2 μl du mélange de ligation ont servi à transformer E. coli DH1OB ainsi que décrit plus haut au paragraphe 5. On analyse le contenu en ADN plasmidique de différents clones selon la procédure décrite pour pRPA-ML-71 1. Un des clones plasmidique retenu contient un insert EcoRI- HindlJJ de 1,45 kpb environ. La séquence des extrémités terminales de ce clone révèle que l'extrémité 5' de l'insert correspond exactement à l'extrémité correspondante de pRPA-ML- 71 1 et que l'extrémité 3' terminale présente la séquence suivante: " 5J..AΔITAAGCTCTAGAGTCGACCTGCAGGCATGCAAGCTT-3' ".The two inserts were ligated, and 2 μl of the ligation mixture were used to transform E. coli DH1OB as described above in paragraph 5. The plasmid DNA content of different clones is analyzed according to the procedure described for pRPA-ML- 71 1. One of the plasmid clones selected contains an EcoRI-HindlJJ insert of about 1.45 kbp. The sequence of terminal ends of this clone reveals that the 5 'end of the insert corresponds exactly to the corresponding end of pRPA-ML-71 1 and that the 3' terminal end has the following sequence: "5J .. AΔITAAGCTCTAGAGTCGACCTGCAGGCATGCAAGCTT-3 '".
La séquence soulignée conespond au codon de l'acide aminé COOH-terminal asparagine, le codon suivant correspondant au codon stop de la traduction. Les nucléotides en aval correspondent à des éléments de séquence du polylinker de pUCI9. Ce clone comprenant la séquence de pRPAML-71 1 jusqu'au site de terminaison de la traduction de l'EPSPS mature de maïs et suivie de séquences du polylinker de pUC 19 jusqu'au site HindIII a été nommé pRPA-ML-712. b) Modification de l'extrémité 5' de pRPA-ML-712: construction de pRPA-ML-715 Le clone pRPA-ML-712 a été coupé par les enzymes de restrictions Pstl et Hiniiïïl. L'ADN résultant de ces manipulations a été séparé par électrophorèse sur gel d'agarose LGTA/TBE (réf. CPMB) 0,8%. Le fragment de gel contenant l'insert Pstl/EcoRI de 1,3 kpb a été excisé du gel et purifié selon le protocole décrit au paragraphe 5 ci-dessus. Cet insert a été mis en ligation en présence de quantité équimoléculaire de chacun des deux oligonucléotides partiellement complémentaires, de séquence:The underlined sequence corresponds to the COOH-terminal amino acid codon asparagine, the next codon corresponding to the translation stop codon. The nucleotides downstream correspond to elements of the pUCI9 polylinker sequence. This clone comprising the sequence of pRPAML-71 1 up to the translation termination site of mature corn EPSPS and followed by polylinker sequences from pUC 19 to the HindIII site was named pRPA-ML-712. b) Modification of the 5 'End of pRPA-ML-712: Construction of pRPA-ML-715 The clone pRPA-ML-712 was cut by the restriction enzymes Pstl and Hiniiïl. The DNA resulting from these manipulations was separated by electrophoresis on an agarose gel LGTA / TBE (ref. CPMB) 0.8%. The gel fragment containing the 1.3 kbp Pstl / EcoRI insert was excised from the gel and purified according to the protocol described in paragraph 5 above. This insert was ligated in the presence of an equimolecular amount of each of the two partially complementary oligonucleotides, of sequence:
Oligol: 5-GAGCCGAGCTCCATGGCCGGCGCCGAGGAGATCGTGCTGCA-3' Oligo 2: 5'-GCACGATCTCCTCGGCGCCGGCCATGGAGCTCGGCTC-3' ainsi qu'en présence d'ADN du plasmide pUC19 digéré par les enzymes de restrictions BamHI et HindIII. Deux μl du mélange de ligation ont servi à transformer E. coli DH1OB ainsi que décrit plus haut au paragraphe 5 Après analyse du contenu en ADN plasmidique de différents clones selon la procédure décrite ci-dessus au paragraphe 5. un des clones présentant un insert d'environ 1 ,3 kpb a été conservé pour analyses ultérieures. La séquence de l'extrémité 5' terminale du clone retenu révèle que la séquence ADN dans cette région est la suivante: séquence du polylinker de pUC19 des sites EcoRI à BamHI, suivi de la séquence des oligonucléotides utilisés lors du clonage, suivi du reste de la séquence présente dans pRPAML-712. Ce clone a été nommé pRPA-ML-713. Ce clone présente un codon methionine ATG inclus dans un site NcoFen amont du codon Alanine N-terminal de l'EPSPSynthase mature. De plus, les codons alanine et glycine de l'extrémité N-terminale ont été conservées, mais modifiées sur la troisième base variable : GCGGGT initial donne GCÇGGÇ modifié.Oligol: 5-GAGCCGAGCTCCATGGCCGGCGCCGAGGAGATCGTGCTGCA-3 'Oligo 2: 5'-GCACGATCTCCTCGGCGCCGGCCATGGAGCTCGGCTC-3' as well as in the presence of DNA of the plasmid pUC19 digested by the restriction enzymes BamHI and HindIII. Two μl of the ligation mixture were used to transform E. coli DH1OB as described above in paragraph 5 After analysis of the plasmid DNA content of different clones according to the procedure described above in paragraph 5. one of the clones having an insert d approximately 1.3 kbp was kept for further analysis. The sequence of the 5 ′ end of the clone retained reveals that the DNA sequence in this region is as follows: sequence of the polylinker of pUC19 from the EcoRI sites to BamHI, followed by the sequence of the oligonucleotides used during the cloning, followed by the rest of the sequence present in pRPAML-712. This clone was named pRPA-ML-713. This clone has an ATG methionine codon included in an NcoFen site upstream of the N-terminal Alanine codon of mature EPSPSynthase. In addition, the alanine and glycine codons of the N-terminal end were conserved, but modified on the third variable base: initial GCGGGT gives modified GCÇGGÇ.
Le clone pRPA-ML-713 a été coupé par l'enzyme de restriction HindIII et les extrémités de cette coupure rendues franches par traitement avec le fragment de Klenow de la ADN polymérase I. Une coupure par l'enzyme de restriction Sacl a ensuite été effectuée. L'ADN résultant de ces manipulations a été séparé par électrophorèse sur gel d'agarose LGTA TBE (réf CPMB) 0,8%. Le fragment de gel contenant l'insert "HindIII-extrémités franches/Sad" de 1,3 kpb a été excisé du gel et purifié selon le protocole décrit au paragraphe 5 ci-dessus. Cet insert a été mis en ligation en présence d'ADN du plasmide pUC19 digéré par l'enzyme de restriction Xbal et les extrémités de cette coupure rendues franches par traitement avec le fragment de Klenow de l'ADN polymérase I. Une coupure par l'enzyme de restriction Sacl a ensuite été effectuée. Deux μl du mélange de ligation ont servi à transformer E. coli DH1OB ainsi que décrit plus haut au paragraphe 5. Après analyse du contenu en ADN plasmidique de différents clones selon la procédure décrite ci-dessus au paragraphe 5, un des clones présentant un insert d'environ 1 ,3 kpb a été conservé pour analyses ultérieures. La séquence des extrémités terminales du clone retenu révèle que la séquence ADN est la suivante: séquence du polylinker de pUC19 des sites EcoRI à Sacl, suivie de la séquence des oligonucléotides utilisés lors du clonage délétée des 4 pb GATCC de l'oligonucleotide 1 décnt ci-dessus, suivi du reste de la séquence présente dans pRPA- ML-712 jusqu'au site HindIII et séquence du polylinker de pUC19 de Xbal à HindIII. Ce clone a été nommé pRPA-ML-715.The clone pRPA-ML-713 was cut with the restriction enzyme HindIII and the ends of this cut made blunt by treatment with the Klenow fragment of DNA polymerase I. A cut with the restriction enzyme Sacl was then performed. The DNA resulting from these manipulations was separated by electrophoresis on an agarose gel LGTA TBE (ref CPMB) 0.8%. The gel fragment containing the 1.3 kbp "HindIII-blunt ends / Sad" insert was excised from the gel and purified according to the protocol described in paragraph 5 above. This insert was ligated in the presence of DNA of the plasmid pUC19 digested with the restriction enzyme Xbal and the ends of this cleavage made blunt by treatment with the Klenow fragment of DNA polymerase I. A cleavage with the Sacl restriction enzyme was then performed. Two μl of the ligation mixture were used to transform E. coli DH1OB as described above in paragraph 5. After analysis of the plasmid DNA content of different clones according to the procedure described above in paragraph 5, one of the clones having an insert approximately 1.3 kbp was kept for later analysis. The sequence of terminal ends of the clone retained reveals that the DNA sequence is as follows: sequence of the polylinker of pUC19 from the EcoRI sites to Sac1, followed by the sequence of the oligonucleotides used during the deleted cloning of the 4 bp GATCC of the oligonucleotide 1 decnt ci above, followed by the rest of the sequence present in pRPA-ML-712 to the HindIII site and the polylinker sequence of pUC19 from Xbal to HindIII. This clone was named pRPA-ML-715.
7) Obtention d'un ADNc codant pour une EPSPS de mais mutée7) Obtaining a cDNA coding for an EPSPS of mutated maize
Toutes les étapes de mutagénèse ont été réalisées avec le U.S.E. mutagenesis kit de Pharmacia en suivant les instructions du fournisseur. Le principe de ce système de mutagénèse est le suivant: l'ADN plasmidique est dénaturé par la chaleur et réassocié en présence d'un excès molaire d'une part de l'oligonucleotide de mutagénèse, et d'autre part d'un oligonucléotide permettant d'éliminer un site d'enzyme de restriction unique présent dans le polylinker. Après l'étape de reassociation, la synthèse du brin complémentaire est réalisée par l'action de la T4 ADN polymérase en présence de T4 ADN ligase et de protéine du gène 32 dans un tampon approprié fourni. Le produit de synthèse est incubé en présence de l'enzyme de restriction, dont le site est suppose avoir disparu par mutagénèse. La souche d'E coli présentant, en particulier, la mutation mutS est utilisée comme hôte pour la transformation de cet ADN. Après croissance en milieu liquide, l'ADN plasmidique tota] est préparé, incubé en présence de l'enzyme de restπction utilisée précédemment. Après ces traitements, la souche d'E. coli DH1OB est utilisée comme hôte pour la transformation. L'ADN plasmidique des clones isolés est préparé et la présence de la mutation' introduite vérifiée par séquençage.All mutagenesis steps were carried out with the USE mutagenesis kit from Pharmacia following the supplier's instructions. The principle of this mutagenesis system is as follows: the plasmid DNA is denatured by heat and reassociated in the presence of a molar excess on the one hand of the mutagenesis oligonucleotide, and on the other hand of an oligonucleotide allowing to eliminate a unique restriction enzyme site present in the polylinker. After the reassociation step, the synthesis of the complementary strand is carried out by the action of T4 DNA polymerase in the presence of T4 DNA ligase and gene 32 protein in an appropriate buffer provided. The synthetic product is incubated in the presence of the restriction enzyme, the site of which is supposed to have disappeared by mutagenesis. The strain of E coli exhibiting, in particular, the mutS mutation is used as a host for the transformation of this DNA. After growth in liquid medium, the plasmid DNA tota] is prepared, incubated in the presence of the restπction enzyme used previously. After these treatments, the strain of E. coli DH1OB is used as the host for transformation. The plasmid DNA of the clones isolated is prepared and the presence of the mutation 'introduced verified by sequencing.
A)- modifications de sites ou de séquence sans incidence a pπoπ sur le caractère de résistance de l'EPSPS de mais aux produits inhibiteurs compétitifs de l'activité EPSP synthase. élimination d'un site Ncol interne de pRPA-ML-715A) - modifications of sites or of sequence without impact a pπoπ on the resistance character of EPSPS but to competitive inhibitor products of EPSP synthase activity. elimination of an internal Ncol site from pRPA-ML-715
La séquence de pRPA-ML-715 est numérotée arbitrairement en plaçant la première base du codon Alanine N-terminal GCC en position I Cette séquence présente un site Ncol en position 1217. L'oligonucleotide de modification du site présente la séquence . 5'-CCACAGGATGGCGATGGCCTTCTCC-3' Après séquençage selon les références données ci-dessus, la séquence lue après mutagénèse correspond à celle de l'oligonucleotide utilisé. Le site Ncol a bien été éliminé et la traduction en acides aminés dans cette région conserve la séquence initiale présente sur pRPA-ML-715.The sequence of pRPA-ML-715 is arbitrarily numbered by placing the first base of the Alanine N-terminal GCC codon in position I This sequence has an Ncol site at position 1217. The site-modification oligonucleotide presents the sequence. 5'-CCACAGGATGGCGATGGCCTTCTCC-3 'After sequencing according to the references given above, the sequence read after mutagenesis corresponds to that of the oligonucleotide used. The Ncol site has been eliminated and the translation into amino acids in this region retains the initial sequence present on pRPA-ML-715.
Ce clone a été nommé pRPA-ML-716.This clone was named pRPA-ML-716.
La séquence de 1340 bp de ce clone est présentée SEQ ID N° 3 et SEQ ID N° 4 B) modifications de séquence permettant l'augmentation du caractère de résistance de l'EPSPS de mais aux produits inhibiteurs compétitifs de l'activité EPSP synthase Les oligonucléotides suivants ont été utilisés • a) mutation Thr 102 «→ Ile. 5'-GAATGCTGGAATCGCAATGCGGCCATTGACAGC-3' b) mutation Pro 106 «+ Ser. 5'-GAATGCTGGAACTGCAATGCGGTCCTTGACAGC-3' c) mutations Gly 101 -^ Ala et Thr 102 «* Ile. 5'-CTTGGGGAATGCTGCCATCGCAATGCGGCCATTG-3' d) mutations Thr 102 •* Ile et Pro 106 «→ Ser. 5'-GGGGAATGCTGGAATCGCAATGCGGTCCTTGACAGC-3'The 1340 bp sequence of this clone is presented SEQ ID No. 3 and SEQ ID No. 4 B) sequence modifications allowing the increase in the resistance character of the EPSPS of maize to competitive inhibitors of EPSP synthase activity The following oligonucleotides were used • a) mutation Thr 102 " → Ile. 5'-GAATGCTGGAATCGCAATGCGGCCATTGACAGC-3 'b) mutation Pro 106 " + Ser. 5'-GAATGCTGGAACTGCAATGCGGTCCTTGACAGC-3 'c) Gly 101 mutations - ^ Ala and Thr 102 "* Ile. 5'-CTTGGGGAATGCTGCCATCGCAATGCGGCCATTG-3 'd) Thr 102 • * Ile and Pro 106 mutations « → Ser. 5'-GGGGAATGCTGGAATCGCAATGCGGTCCTTGACAGC-3 '
Après séquençage, la séquence lue après mutagénèse sur les trois fragments mutés est identique à la séquence de l'ADN parental ρRPA-ML-716 à l'exceDtion de la région mutagénéisée qui correspond à celle des oligonucléotides de mutagénèse utilisés. Ces clones ont été nommés pRPA-ML-717 pour la mutation Thr 102 «•* Ile, pRPA-ML-718 pour la mutation Pro 106 → Ser, pRPA-ML-719 pour les mutations Gly 101 »→ Ala et Thr 102 "→ Ile et pRPA-ML-720 pour les mutations Thr 102 "•* Ile et Pro 106 "•» SerAfter sequencing, the sequence read after mutagenesis on the three mutated fragments is identical to the parental DNA sequence ρRPA-ML-716 with the exception of the mutagenized region which corresponds to that of the mutagenesis oligonucleotides used. These clones have been named pRPA-ML-717 for the mutation Thr 102 " • * Ile, pRPA-ML-718 for the mutation Pro 106 → Ser, pRPA-ML-719 for the mutations Gly 101 " → Ala and Thr 102 "→ Ile and pRPA-ML-720 for Thr 102 "• * Ile and Pro 106" mutations • »Ser
La séquence de 1340 bp de pRPA-ML-720 est présentée SEQ ID N° 5 et SEQ ID N° 6.The 1340 bp sequence of pRPA-ML-720 is presented SEQ ID No. 5 and SEQ ID No. 6.
L'insert NcoI-HindIII de 1395 pb est à la base de toutes les constructions utilisées pour la transformation des plantes pour l'introduction de la résistance aux herbicides inhibiteurs compétitifs de l'EPSPS et en particulier la résistance au glyphosate. Cet insert sera nommé dans la suite des descriptions "le double mutant de l'EPSPSJie maïs". B Tolérance au glyphosate des différents mutants in vitro.The 1395 bp NcoI-HindIII insert is the basis of all the constructs used for plant transformation for the introduction of resistance to competitive EPSPS inhibitor herbicides and in particular resistance to glyphosate. This insert will be named in the following descriptions "the double mutant of EPSPSJie corn". B Tolerance to glyphosate of the various mutants in vitro.
2.a: Extraction de l'EPSP synthase. Les différents gènes d'EPSP synthases sont introduits sous forme d'une cassette Ncol-Hindϋl dans le vecteur plasmidique pTrc99a (Pharmacia, ref : 27-5007-01) coupé par Ncol et HindlTI. Les E. coli DH10B recombinantes surexprimant les différents ΕPSP synthases sont soniquées dans 40 ml de tampon par 10 g de cellules culottées et lavées avec ce même tampon (tris HC1 200 mM pH 7,8, mercaptoethanol 50 mM, ΕDTA 5 mM et PMSF 1 mM), auxquels on ajoute 1 g de polyvinylpyπolidone. La suspension est agitée pendant 15 minutes à 4°C, puis centrifugée 20 minutes à 27000g et 4°C. Le surnageant est additionné de sulfate d'ammonium pour amener la solution à 40% de la saturation en sulfate d'ammonium. Le mélange est centrifugé 20 minutes à 27000g et 4°C. Le nouveau surnageant est additionné de sulfate d'ammonium pour amener la solution à 70% de la saturation en sulfate d'ammonium. Le mélange est centrifugé 30 minutes à 27000g et 4°C. L'ΕPSP synthase, présente dans ce culot protéique, est reprise dans 1 ml de tampon (tris HC1 20 mM pH 7.8 et mercaptoethanol 50 mM). Cette solution est dialysée une nuit contre deux litres de ce même tampon à 4°C. 2.b: Activité enzymatique. L'activité de chaque enzyme ainsi que sa résistance au glyphosate est mesurée in vitro sur 10 minutes à 37°C dans le mélange réactionnel suivant: acide maléique 100 mM pH 5,6, phosphoénol pyruvate 1 mM, shikimate-3-phosphate 3 mM (préparé selon Knowles P.F. et Sprinson D.B. 1970. Methods in Εnzymol 17A, 351-352 à partir de Aerobacter aerogenes stram ATCC 25597) et fluorure de potassium 10 mM. L'extrait enzymatique est ajouté au dernier moment après l'addition de glyphosate dont la concentration finale varie de 0 à 20 mM. L'activité est mesurée par dosage du phosphate libéré selon la technique de Tausky H. A. et Shorr Ε. 1953. J. Biol. Chem. 202, 675-685.2.a: Extraction of EPSP synthase. The different EPSP synthases genes are introduced in the form of an Ncol-Hindϋl cassette into the plasmid vector pTrc99a (Pharmacia, ref: 27-5007-01) cut with Ncol and HindlTI. The recombinant E. coli DH10B overexpressing the various ΕPSP synthases are sonicated in 40 ml of buffer per 10 g of pellet cells and washed with this same buffer (tris HC1 200 mM pH 7.8, mercaptoethanol 50 mM, ΕDTA 5 mM and PMSF 1 mM), to which 1 g of polyvinylpyπolidone is added. The suspension is stirred for 15 minutes at 4 ° C., then centrifuged for 20 minutes at 27000 g and 4 ° C. Ammonium sulfate is added to the supernatant to bring the solution to 40% of the ammonium sulfate saturation. The mixture is centrifuged for 20 minutes at 27000 g and 4 ° C. The new supernatant is added with ammonium sulfate to bring the solution to 70% of the saturation with ammonium sulfate. The mixture is centrifuged for 30 minutes at 27000 g and 4 ° C. ΕPSP synthase, present in this protein pellet, is taken up in 1 ml of buffer (tris HC1 20 mM pH 7.8 and mercaptoethanol 50 mM). This solution is dialyzed overnight against two liters of this same buffer at 4 ° C. 2.b: Enzymatic activity. The activity of each enzyme as well as its resistance to glyphosate is measured in vitro over 10 minutes at 37 ° C. in the following reaction mixture: 100 mM maleic acid pH 5.6, 1 mM phosphoenol pyruvate, 3 mM shikimate-3-phosphate (prepared according to Knowles PF and Sprinson DB 1970. Methods in Εnzymol 17A, 351-352 from Aerobacter aerogenes stram ATCC 25597) and 10 mM potassium fluoride. The enzymatic extract is added at the last moment after the addition of glyphosate whose final concentration varies from 0 to 20 mM. The activity is measured by assaying the phosphate released according to the technique of Tausky H. A. and Shorr Ε. 1953. J. Biol. Chem. 202, 675-685.
Dans ces conditions, l'enzyme sauvage (WT) est inhibée à 85% dès la concentration de 0,12 mM de glyphosate. A cette concentration, l'enzyme mutante connue SerlOό n'est inhibée qu'à 50% et les trois autres mutants Ile l02. Ilel02/Serl06, Alal01 Ilel02 ne sont pas ou peu inhibées.Under these conditions, the wild-type enzyme (WT) is inhibited by 85% from the concentration of 0.12 mM of glyphosate. At this concentration, the known mutant enzyme SerlOό is not inhibited than 50% and the other three Ile 102 mutants. Ilel02 / Serl06, Alal01 Ilel02 are not or only slightly inhibited.
11 faut multiplier la concentration de glyphosate par dix, soit 1,2 mM. pour inhiber l'enzyme mutante Ile 102 à 50%, les mutants Ilel02/Serl06. Ala/Ile et Ala n'étant toujours pas inhibés. II faut noter que l'activité des mutants Ala/Ile et Ala n'est pas inhibée jusqu'à des concentrations de 10 mM de glyphosate, et que celle du mutant Ilel02/Serl06 n'est pas réduite même si la concentration en glyphosate est multipliée par 2, soit 20 mM. CThe concentration of glyphosate must be multiplied by ten, or 1.2 mM. to inhibit the mutant Ile 102 enzyme by 50%, the Ilel02 / Ser106 mutants. Ala / Ile and Ala are still not inhibited. It should be noted that the activity of the Ala / Ile and Ala mutants is not inhibited up to concentrations of 10 mM of glyphosate, and that that of the mutant Il102 / Ser106 is not reduced even if the concentration of glyphosate is multiplied by 2, i.e. 20 mM. VS
Résistance des plantes de tabac transformés. 0-1 Constructions des plasmides: pRPA-RD-124: Addition d'un signal de polyadénylation "nos" à pRPA-ML-720, obtenu précédemment, avec création d'une cassette de clonage contenant le gène d'EPSPS double mutant de maïs (Thr 102 → Ile et Pro 106 → Ser). pRPA-ML-720 est digéré avec Hind m, traité avec le fragment de Klenow de l'ADN polymérase I d'E. coli pour produire une extrémité franche. On effectue une seconde digestion avec Nco I et le fragment ΕPSPS est purifié. Le gène ΕPSPS est ensuite ligué avec pRPA-RD- 12 purifié (une cassette de clonage contenant le signal de polyadénylation de la nopaline synthase) pour donner pRPA- RD-124. Pour obtenir le vecteur pRPA-RD-12 purifié utile, il a fallu que celui-ci soit préalablement digéré par Sali, traité avec l'ADN polymérase de Klenow, puis digéré une seconde fois avec Ncol. pRPA-RD-125: Addition d'un peptide de transit optimisé (OTP) à pRPA-RD-124 avec création d'une cassette de clonage contenant le gène d'EPSPS ciblé sur les plasmides. pRPA-RD-7 (demande de brevet européen EP 652 286) est digéré avec Sph I, traité avec la T4 ADN polymérase, puis digéré avec Spe 1 et le fragment OTP est purifié. Ce fragment OTP est clone dans pRPA-RD- 124 qui a été préalablement digérée par Ncol, traité avec l'ADN polymérase de Klenow pour enlever la partie protubérante 3', puis digérée par Spe I. Ce clone est alors séquence pour assurer la fusion traductionnelle conecte entre le OTP et le gène d'EPSPS. On obtient alors pRPA-RD-125. pRPA-RD-159: Addition du promoteur double d'histone d' arabidopsis H4A748 (dem.ande de brevet EP 507 698 ) à pRPA-RD-125 avec création d'une cassette pour expression dans les plantes pour l'expression du gène "OTP- gène d'EPSPS double mutant" dans les tissus de dicotylédones. pRPA-RD-132 (une cassette conten.ant le promoteur double H4A748 (demande de brevet EP 507 698)) est digérée avec Nco I et Sac I. Le fragment purifié du promoteur est ensuite clone dans qui a été digéré avec Eco I et Sac I. pRPA-RD-173: Addition du gène "promoteur H4A748-OTP-gène d'EPSPS double mutant" de pRPA-RD-159 dans plasmide pRPA-BL-150A (demande de brevet européen 508 909) avec création d'un vecteur de transformation Agrobactenum tumefaciens. pRPA- RD- 159 est digéré avec Not I et traité avec la polymérase de Klenow. Ce fragment est ensuite clone dans pRPA-BL- 150A avec Sma I.Resistance of processed tobacco plants. 0-1 Constructs of the plasmids: pRPA-RD-124: Addition of a polyadenylation signal "nos" to pRPA-ML-720, obtained previously, with creation of a cloning cassette containing the double mutant EPSPS gene of corn (Thr 102 → Ile and Pro 106 → Ser). pRPA-ML-720 is digested with Hind m, treated with the Klenow fragment of DNA polymerase I of E. coli to produce a blunt end. A second digestion is carried out with Nco I and the ΕPSPS fragment is purified. The ΕPSPS gene is then ligated with purified pRPA-RD-12 (a cloning cassette containing the polyadenylation signal of nopaline synthase) to give pRPA-RD-124. To obtain the useful purified pRPA-RD-12 vector, it had to be digested beforehand with SalI, treated with Klenow DNA polymerase, then digested a second time with Ncol. pRPA-RD-125: Addition of an optimized transit peptide (OTP) to pRPA-RD-124 with creation of a cloning cassette containing the EPSPS gene targeted on the plasmids. pRPA-RD-7 (European patent application EP 652,286) is digested with Sph I, treated with T4 DNA polymerase, then digested with Spe 1 and the OTP fragment is purified. This OTP fragment is cloned in pRPA-RD-124 which has been previously digested with Ncol, treated with Klenow DNA polymerase to remove the protruding part 3 ', then digested with Spe I. This clone is then sequenced to ensure fusion translational connects between the OTP and the EPSPS gene. We then obtain pRPA-RD-125. pRPA-RD-159: Addition of the double histone promoter from arabidopsis H4A748 (patent application EP 507 698) to pRPA-RD-125 with creation of a cassette for expression in plants for gene expression "OTP- double mutant EPSPS gene" in dicotyledonous tissues. pRPA-RD-132 (a cassette containing the double promoter H4A748 (patent application EP 507 698)) is digested with Nco I and Sac I. The purified fragment of the promoter is then cloned into which has been digested with Eco I and Bag I. pRPA-RD-173: Addition of the "H4A748-OTP promoter-double mutant EPSPS gene" gene from pRPA-RD-159 into plasmid pRPA-BL-150A (European patent application 508 909) with creation of a transformation vector Agrobactenum tumefaciens. pRPA- RD-159 is digested with Not I and treated with Klenow polymerase. This fragment is then cloned into pRPA-BL-150A with Sma I.
1 - 1 - Transformation. Le vecteur pRPA-RD- 173 est introduit dans la souche d'Agrobactenum tumefaciens1 - 1 - Transformation. The vector pRPA-RD-173 is introduced into the Agrobactenum tumefaciens strain
EHA101 (Hood et al.,1987) porteuse du cosmide pTVK291 (Komari et al.,1986). La technique de transformation est basée sur la procédure de Horsh et al. ( 1985). 1-2- Régénération.EHA101 (Hood et al., 1987) carrying the cosmid pTVK291 (Komari et al., 1986). The transformation technique is based on the procedure of Horsh et al. (1985). 1-2- Regeneration.
La régénération du tabac PBD6 (provenance SEITA France) 'à partir d'expiants foliaires est réalisée sur un milieu de base Murashige et Skoog (MS) comprenant 30g/ 1 de saccharose ainsi que 200 μg/ml de kanamycine. Les explants foliaires sont prélevés sur des plantes cultivées en sene ou in vitro et transformées selon la technique des disques foliairesThe regeneration of the tobacco PBD6 (origin SEITA France) 'from foliar explants is carried out on a Murashige and Skoog medium (MS) comprising 30 g / 1 sucrose and 200 ug / ml kanamycin. The leaf explants are taken from plants cultivated in sene or in vitro and transformed according to the technique of leaf discs.
(Science, 1985,Vol 227,p.1229- 1231) en trois étapes successives: la première comprend l'induction des pousses sur un milieu additionné de 30g/ 1 de saccharose contenant 0,05 mg/1 d'acide naphtylacétique (ANA) et 2mg/l de benzylaminopurine (BAP) pendant 15 jours. Les pousses formées au cours de cette étape sont ensuite développées pendant 10 jours par culture sur un milieu MS additionné de 30g/ 1 de saccharose mais ne contenant pas d'hormone. Puis on prélève des pousses développées et on les cultive sur un milieu d'enracinement MS à teneur moitié en sels, vitamines et sucre et ne contenant pas d'hormone. Au bout d'environ 15 jours, les pousses enracinées sont passées en terre.(Science, 1985, Vol 227, p.1229-1231) in three successive stages: the first includes induction of the shoots on a medium supplemented with 30g / 1 of sucrose containing 0.05 mg / 1 of naphthylacetic acid (ANA ) and 2 mg / l of benzylaminopurine (BAP) for 15 days. The shoots formed during this stage are then developed for 10 days by culture on an MS medium supplemented with 30 g / l of sucrose but containing no hormone. Then take developed shoots and cultivate them on an MS rooting medium with half content of salts, vitamins and sugar and containing no hormone. After about 15 days, the rooted shoots are put in the ground.
1-3- Résistance au glyphosate.1-3- Resistance to glyphosate.
Vingt plantes transformées ont été régénérées et passées en sene pour la construction pRPA-RD-173. Ces plantes ont été traitées en serre au stade 5 feuilles avec une suspension acqueuse de RoundUp conespondant à 0,8kg de matière active glyphosate par hectare. Les résultats coπespondent à l'observation d'indices de phytotoxicité relevés 3 semaine après traitement. Dans ces conditions, on constate que les plantes transformées par la construction pRPA-RD-173 présentent une très bonne tolér∑uice alors que les plantes témoins non transformées sont complètement détruites.Twenty transformed plants were regenerated and passed into seine for construction pRPA-RD-173. These plants were treated in the greenhouse at the 5-leaf stage with an aqueous suspension of RoundUp corresponding to 0.8 kg of active ingredient glyphosate per hectare. The results correspond to the observation of phytotoxicity indices noted 3 weeks after treatment. Under these conditions, it is found that the plants transformed by the construction pRPA-RD-173 have a very good tolerance while the untransformed control plants are completely destroyed.
Ces résultats montrent clairement l'amélioration apportée par l'utilisation d'un gène chimère selon l'invention pour un même gène codant pour la tolérance au glyphosate.These results clearly show the improvement brought by the use of a chimeric gene according to the invention for the same gene coding for tolerance to glyphosate.
Exemple 5: Transformation du tabac industriel PBD6. avec gène de la nitrilase (pour =» construction 238:Example 5: Processing of PBD6 industrial tobacco. with nitrilase gene (for = »construction 238:
Ce tabac est obtenu selon l'enseignement de la demande européenne n° 0 337 899 page 6 ligne 50 et suivantes à partir de la construction 238, qui est celle décrite sous le nom de pRPA-BL 238. Exemple 6: Croisement par pollinisationThis tobacco is obtained according to the teaching of European application No. 0 337 899 page 6 line 50 and following from construction 238, which is that described under the name of pRPA-BL 238. Example 6: Crossing by pollination
On procède par pollinisation en seσe au croisement respectivement des lignées Co 17, 173 et 238 :We proceed by seσe pollination at the crossing of lines Co 17, 173 and 238 respectively:
- Co 17 avec 238 pour obtenir des plantes de tabac PBD6 à tester sur la double tolérance à l'isoxaflutole et au bromoxynil (" plantes HPPD + OXY") et- Co 17 with 238 to obtain PBD6 tobacco plants to be tested for double tolerance to isoxaflutole and bromoxynil ("HPPD + OXY plants") and
- Co 17 avec 173 pour obtenir des plantes de tabac PBD6 à tester sur la double tolérance à l'isoxaflutole et au glyphosate ( "plantes HPPD + EPSPS").- Co 17 with 173 to obtain PBD6 tobacco plants to be tested on the double tolerance to isoxaflutole and to glyphosate ("plants HPPD + EPSPS").
Les trois lignées sont homozygotes vis à vis du gène concerné: en conséquence la descendance est hemizygote pour chacun des deux gènes introduits par croisement. Les plantes croisées sont obtenues au bout de six semaines.The three lines are homozygous with respect to the gene concerned: consequently the progeny are hemizygous for each of the two genes introduced by crossing. Cross plants are obtained after six weeks.
Exemple 7: Mesure de la tolérance du tabac en traitement de postlevée avec l'isoxaflutole et de postlevée avec le bromoxynil ou le glyphosate.Example 7: Measurement of the tolerance of tobacco in post-emergence treatment with isoxaflutole and post-emergence treatment with bromoxynil or glyphosate.
Dans cet essai, chaque test est effectué sur un échantillon de 10 plantes, 10 plantes étant gardées non traitées.In this test, each test is carried out on a sample of 10 plants, 10 plants being kept untreated.
Tous les traitements sont effectués par pulvérisation à raison de 5001 de bouillie par hectare.All the treatments are carried out by spraying at the rate of 5001 of spray mixture per hectare.
Pour le traitement en postlevée, on fait un semis puis on repique les plantes en godets de 9cm x 9cm. Les traitements de post levée sont faits à un stade bien développé (3-4 feuilles)Des lots de plantes respectivement sauvage et génétiquement transformées obtenues ci-dessus sont répartis en plusieurs parts, avec: a) un lot non traité, b) d'autres lots qui sont traités respectivement avec un herbicide seul, - de l'isoxaflutole en post levée, à deux doses (respectivement 200 et 400 g/ha) ,For the post-emergence treatment, we sow and then transplant the plants in 9cm x 9cm pots. Post emergence treatments are carried out at a well developed stage (3-4 leaves). Lots of wild and genetically transformed plants respectively obtained above are divided into several parts, with: a) an untreated batch, b) other batches which are treated with a herbicide alone, - post-emergence isoxaflutole, in two doses (200 and 400 g / ha respectively),
- du bromoxynil en post levée à deux doses (respectivement 400 et 800 g/ha)„- bromoxynil post-emergence at two doses (400 and 800 g / ha respectively) „
- du glyphosate en post levée à deux doses (respectivement 800 et 1200 g/ha), c) d'autres lots qui sont traités respectivement avec deux herbicides, en post levée, en mélange extemporané: - de l'isoxaflutole et du bromoxynil à deux doses (respectivement 200/400 et 400/800 g ha)- glyphosate post-emergence at two doses (800 and 1200 g / ha respectively), c) other batches which are treated respectively with two herbicides, post-emergence, in extemporaneous mixture: - isoxaflutole and bromoxynil at two doses (200/400 and 400/800 g ha respectively)
- de l'isoxaflutole et du glyphosate à deux doses (respectivement 200/800 et 400/1200 g/ha). Les traitements sont effectués avec les formulations suivantes: isoxaflutole à 75%, le bromoxynil ( produit commercial PARDNER) sous forme octanoate en concentré émulsionnable à 225g /l et le glyphosate (Round-UP)- isoxaflutole and glyphosate in two doses (200/800 and 400/1200 g / ha respectively). The treatments are carried out with the following formulations: isoxaflutole at 75%, bromoxynil (commercial product PARDNER) in octanoate form in emulsifiable concentrate at 225g / l and glyphosate (Round-UP)
Dans ces conditions, on observe 17 jours après le traitement les phytotoxicités suivantes, exprimées en pourcentage de destruction indiquées dans le tableau suivant, ainsi que le nombre de plantes par lot et les doses d'herbicide(s) exprimées en gramme de matière active par hectare:Under these conditions, the following phytotoxicities are observed 17 days after the treatment, expressed as percentage of destruction indicated in the following table, as well as the number of plants per batch and the doses of herbicide (s) expressed in grams of active ingredient per hectare:
Traitement de postlevée avec l'isoxaflutole et de postlevée avec le bromoxynil ou le glyphosatePost-emergence treatment with isoxaflutole and post-emergence treatment with bromoxynil or glyphosate
* nombre de plants* number of plants
Exemple 8Example 8
Dans le but d'étudier si le gène de l'HPPD de Pseudomonas fluorescens peut être utilisé comme gène marqueur au cours du cycle "transformation - régénération" d'une espèce végétale, le tabac a été transformé avec le gène chimère composé du gène de l'HPPD et du gène EPSPS doublement muté de résistance au glyphosate et des plantes transformées résistantes à la fois à l'isoxaflutole et au glyphosate ont été obtenues après sélection sur isoxaflutole.In order to study whether the HPPD gene from Pseudomonas fluorescens can be used as a marker gene during the "transformation - regeneration" cycle of a plant species, tobacco has been transformed with the chimeric gene composed of the HPPD and the doubly mutated EPSPS gene for resistance to glyphosate and transformed plants resistant to both isoxaflutole and glyphosate were obtained after selection on isoxaflutole.
Matériel et méthodes et résultatsMaterials and methods and results
Le gène chimérique pRP 2012 décrit ci-dessous est transféré dans du tabac industriel PBD6 selon les procédures de transformation et de régénération déjà décrites dans la demande européenne EP n° 0 508 909.The chimeric pRP 2012 gene described below is transferred into industrial tobacco PBD6 according to the transformation and regeneration procedures already described in European application EP No. 0 508 909.
Le gène chimère du vecteur pRP 2012 a la structure A-B suivante, dans laquelle:The chimeric gene of the vector pRP 2012 has the following structure A-B, in which:
A est:A is:
Promoteur double TEV OTP Région codante de l'HPPD Terminateur nos histone et B est :Double promoter TEV OTP Coding region of HPPD Terminator nos histone and B is:
Promoteur double TEV OTP Région codante de l'EPSPS Terminateur nos histone comme celui utilisé dans le vecteur pRPA-RD-173Dual TEV OTP promoter EPSPS coding region Nos histone terminator like that used in the vector pRPA-RD-173
Le gène chimère pRP 2012 est introduit dans le tabac. 1 /Transformation:The pRP 2012 chimeric gene is introduced into tobacco. 1 / Transformation:
Le vecteur est introduit dans la souche non oncogène d'Agrobactenum EHA 101(Hood et al,1987) porteuse du cosmide pTVK 291(Komari et al,1986). La technique de transformation est basée sur la procédure de Horsh et al(1985).The vector is introduced into the non-oncogenic strain of Agrobactenum EHA 101 (Hood et al, 1987) carrying the cosmid pTVK 291 (Komari et al, 1986). The transformation technique is based on the procedure of Horsh et al (1985).
2) Régénération:2) Regeneration:
La régénération du tabac PBD6 (provenance SEITA France) à partir d'expiants foliaires est réalisée sur un milieu de base Murashige et Skoog (MS) comprenant 30g/l de saccharose ainsi que 350 mg/1 de cefotaxime et 1 mg/1 d'isoxaflutole. Les explants foliaires sont prélevés sur des plants en serre ou in vitro et transformés selon la technique des disques foliaires (Science 1985Nol 227,p.1229- 1231) en trois étapes successives: la première comprend l'induction des pousses sur un milieu MS additionné de 30g/l de saccharose contenant 0.05mg l d'acide naphtylacétique (AΝA) et 2 mg 1 de benzylaminopurine (BAP) pendant 15 jours et 1 mg/1 d'isoxaflutole. Les pousses vertes formées au cours de cette étape sont ensuite développées par culture sur un milieu MS additionné de 30 g 1 de saccharose et 1 mg/1 d'isoxaflutole mais ne contenant pas d'hormone, pendant 10 jours. Puis on prélève des pousses développées et on les cultive sur un milieu d'enracinement MS à teneur moitié en sels, vitamines et sucres et 1 mg/1 d'isoxaflutole et ne contenant pas d'hormone. Au bout d'environ 15 jours, les pousses enracinées sont passées en tene.The regeneration of PBD6 tobacco (from SEITA France) from leaf explants is carried out on a Murashige and Skoog (MS) base medium comprising 30 g / l of sucrose as well as 350 mg / 1 of cefotaxime and 1 mg / 1 of isoxaflutole. The leaf explants are taken from plants in the greenhouse or in vitro and transformed according to the technique of leaf discs (Science 1985Nol 227, p.1229-1231) in three successive stages: the first comprises the induction of shoots on an added MS medium 30g / l of sucrose containing 0.05mg l of naphthylacetic acid (AΝA) and 2 mg 1 of benzylaminopurine (BAP) for 15 days and 1 mg / 1 of isoxaflutole. The green shoots formed during this stage are then developed by culture on an MS medium supplemented with 30 g 1 of sucrose and 1 mg / 1 of isoxaflutole but containing no hormone, for 10 days. Then we take grown shoots and cultivated on an MS rooting medium with half content of salts, vitamins and sugars and 1 mg / 1 of isoxaflutole and containing no hormone. After approximately 15 days, the rooted shoots are transferred into tene.
Toutes les plantules obtenues selon ce protocole sont analysées par PCR avec des amorces spécifiques de l'HPPD de P.fluorescens. Cette analyse PCR a permis de confirmer que toutes les plantules ainsi obtenues ont bien intégré le gène de l'HPPD et qu'elles sont tolérantes à la fois à l'isoxaflutole et au glyphosate, dans les conditions décπtes à l'exemple7.All the seedlings obtained according to this protocol are analyzed by PCR with primers specific for the HPPD of P.fluorescens. This PCR analysis made it possible to confirm that all the seedlings thus obtained have well integrated the HPPD gene and that they are tolerant to both isoxaflutole and to glyphosate, under the conditions determined in Example 7.
En conclusion, cet essai confirme que le gène de l'HPPD peut être utilisé comme gène marqueur et que, associé à ce gène, l'isoxaflutole peut être un bon agent de sélection.In conclusion, this test confirms that the HPPD gene can be used as a marker gene and that, associated with this gene, isoxaflutole can be a good selection agent.
Exemple 9' Plante avec un gène HPPD et un gène bar, résistant à la fois à r soxaflutole et à la phosphinothrvcine 1 Construction d'un gène chimère avec une séquence HPPD.Example 9 Plant with an HPPD gene and a bar gene, resistant to both soxaflutole and phosphinothrvcin 1 Construction of a chimeric gene with an HPPD sequence.
Le plasmide pRPA-RD-1004 représenté à la figure 4 est obtenu par insertion du gène chimère de résistance aux isoxazoles dans le plasmide pUC 19 de 2686 pb, commercialisé par New Englamd Biolabs (Yannish-Perron, C.Viera, J. and Massmg, J. (1985) Gène 33, 103-119 et contenant la résistance à l'ampicilline. Les différents éléments du gène chimère sont, dans le sens de la traduction.The plasmid pRPA-RD-1004 represented in FIG. 4 is obtained by insertion of the chimeric gene for resistance to isoxazoles in the plasmid pUC 19 of 2686 bp, marketed by New Englamd Biolabs (Yannish-Perron, C. Viera, J. and Massmg , J. (1985) Gene 33, 103-119 and containing resistance to ampicillin The various elements of the chimeric gene are, in the sense of translation.
- le promoteur histone H3C4 de mais de 1020pb décrit dans la demande EP 0 507 698;- The histone H3C4 promoter of 1020 bp corn described in application EP 0 507 698;
- lintron du gène de l'alcool déshydrogénase 1 de mais décrit par Sachs M et al. Genetics 113: 449-467 (1986) et constitué de 536pb- lintron of the alcohol dehydrogenase 1 gene from corn described by Sachs M et al. Genetics 113: 449-467 (1986) and consisting of 536bp
- le peptide de tansit optimisé (OTP) décrit dans la demande de brevet EP 0 508 909; cet OTP est constitué des 171 pb du peptide de transit de la petite sous unité de la Ribulose 1,5 bisphosphate carboxylase /oxygénase d'Helianthus annuus (Waksman G. et al 1987. Nucleics acids Res. 15: 7181) suivies des 66 pb de la partie mature de la petite sous unité de la Ribulose 1,5 bisphosphate carboxylase /oxygénase de Zea mays (Lebrun et al 1987. Nucleics acids Res. 15: 4360) elles mêmes suivies des 150 pb du peptide de transit de la petite sous unité de la Ribulose 1,5 bisphosphate carboxylase/ oxygénase de Zea mays (Lebrun et al 1987. Nucleics acids Res. 15: 4360); L'ensemble fait donc 387 pb;- the optimized tansit peptide (OTP) described in patent application EP 0 508 909; this OTP consists of 171 bp of the transit peptide of the small subunit of Ribulose 1.5 bisphosphate carboxylase / oxygenase from Helianthus annuus (Waksman G. et al 1987. Nucleics acids Res. 15: 7181) followed by 66 bp of the mature part of the small subunit of the Ribulose 1.5 bisphosphate carboxylase / oxygenase from Zea mays (Lebrun et al 1987. Nucleics acids Res. 15: 4360) themselves followed by the 150 bp of the transit peptide of the small sub Zea mays Ribulose 1.5 bisphosphate carboxylase / oxygenase unit (Lebrun et al 1987. Nucleics acids Res. 15: 4360); The whole therefore makes 387 bp;
- la région codante de l'HPPD de Pseudomonas fluorescens décrite ci-dessus;- the coding region of the HPPD of Pseudomonas fluorescens described above;
- le terminateur du gène de la nopaline synthase (nos) (zone de polyadénylation du gène nos isolé de pTi 37, 250 pb (Bevan M. et al. Nucleics Acids Res. 11 : 369-385);- the terminator of the nopaline synthase (nos) gene (polyadenylation zone of the nos gene isolated from pTi 37, 250 bp (Bevan M. et al. Nucleics Acids Res. 11: 369-385);
2. construction d'un gène chimère de tolérance à la phosphmothricine (gène bar):2. construction of a chimeric tolerance gene for phosphmothricin (bar gene):
La phosphinothricine acetyl tranferase (PAT) codée par le gène bar est une enzyme qui inactive un herbicide, la phosphinothricine (PPT). La PPT inhibe la synthèse de glutamine et provoqie une accumulation rapide d'ammoniaque dans les cellus conduisant à leur mort (Tachibana et al. 1986) .The phosphinothricin acetyl tranferase (PAT) encoded by the bar gene is an enzyme that inactivates a herbicide, phosphinothricin (PPT). PPT inhibits the synthesis of glutamine and causes a rapid accumulation of ammonia in the cells leading to their death (Tachibana et al. 1986).
Le piasmide utilisé pour introduire la tolérance à la phosphinothricine comme agent de sélection est obtenu par insertion du gène chimère pDM 302 dans le vecteur pSP72 de 2462 pb. commercialisé par Promega Corp. (Genbank DDBJ database accession numberThe piasmide used to introduce tolerance to phosphinothricin as a selection agent is obtained by insertion of the chimeric gene pDM 302 into the vector pSP72 of 2462 bp. marketed by Promega Corp. (Genbank DDBJ database accession number
X65332) et contenant le gène de résistance à l'amplicilline.X65332) and containing the amplicillin resistance gene.
Le plasmide pDM 302 de 4700pb a été décrit par Cao, J., et al. Plant Cell Report 1 1: 586-591 ( 1992).Plasmid pDM 302 of 4700bp has been described by Cao, J., et al. Plant Cell Report 1 1: 586-591 (1992).
Les différents éléments de ce plasmide sont:The different elements of this plasmid are:
- le promoteur du gène actine de riz décrit par Me Elroy D. et al. Plant Molecular Biology- the promoter of the rice actin gene described by Me Elroy D. et al. Plant Molecular Biology
15: 257-268 ( 1990) constitué de 840 pb;15: 257-268 (1990) consisting of 840 bp;
- le premier exon du gène actine de riz constitué de 80 pb;- the first exon of the actin rice gene consisting of 80 bp;
- le premier intron du gène actine de riz constitué de 450 pb;- la région codante du gène bar de 600 pb excisée du plasmide pIJ41404 décrit par White J. et al. Nue. Acids res. 18:- the first intron of the rice actin gene consisting of 450 bp; - the coding region of the 600 bp bar gene excised from the plasmid pIJ41404 described by White J. et al. Naked. Acids res. 18:
1862 ( 1990);1862 (1990);
- le terminateur du gène de la nopaline synthase (nos) (zone de polyadénylation du gène nos isolé de pTi 37, 250 pb (Bevan M. et al. Nucleics Acids Res. 1 1: 369-385).- the terminator of the nopaline synthase (nos) gene (polyadenylation zone of the nos gene isolated from pTi 37, 250 bp (Bevan M. et al. Nucleics Acids Res. 1 1: 369-385).
3. transformation:3. transformation:
La technique du bombardement est utilisée pour introduire la construction génétique. Les palsmides sont purifiés sur colonne Qiagen et coprécipités sur particules de tungstène M10 selonle procédé Klein (Nature 327: 70-73, 1987). Une mixture (?) de particules métalliques et des deux plasmides décrits ci-dessus est ensuite n bombardées sur des cellules embryogènes de maïs selon le protocole par (???)The bombardment technique is used to introduce genetic construction. The palsmides are purified on a Qiagen column and coprecipitated on tungsten particles M10 according to the Klein method (Nature 327: 70-73, 1987). A mixture (?) Of metal particles and of the two plasmids described above is then bombarded on embryogenic corn cells according to the protocol by (???)
4. Régénération et utilisation du gène bar comme agent de sélection: Les cals bombardés sont sélectionnés sur glufosinate jusqu'à l'apparition de seteeurs verts. Les cals positifs (?) sont alors convertis en embryons somatiques (conditions ou référence de la technique?) puis mis dans les conditions favorisant la germination (conditions ou référence de la technique?). Les jeunes plantes son transférées en serre pour la production de graines (conditions ou référence de la technique?). Les analyse moléculaires (conditions ou référence de la technique? PCR?) réalisées sur ces plantes montrent que :4. Regeneration and use of the bar gene as a selection agent: The bombarded calluses are selected on glufosinate until the appearance of green seters. The positive calluses (?) Are then converted into somatic embryos (conditions or reference of the technique?) And then put under the conditions favoring germination (conditions or reference of the technique?). The young plants are transferred to the greenhouse for seed production (conditions or technical reference?). Molecular analyzes (conditions or reference of the technique? PCR?) Carried out on these plants show that:
- au moins 4 cals sélectionnés sur phosphinothricine ont engendré des plantes révélant la présence du gène de l'HPPD par PCR; - au moins 5 cals sélectionnés sur phosphinothricine ont engendré des plantes révélant la présence du gène de l'HPPD par Southern blot;- at least 4 calluses selected on phosphinothricin generated plants revealing the presence of the HPPD gene by PCR; - at least 5 calls selected on phosphinothricin have generated plants revealing the presence of the HPPD gene by Southern blot;
- au moins 5 cals sélectionnés sur phosphinothricine ont engendré des plantes révélant la présence de la protéine recombinante par Western blot; - le gène chimère de l'HPPD et la protéine hétérologue sont absents des cals non transformés. Ces résultats montrent l'efficacité du gène chimère bar pour la sélection des cals transformés contenant un autre gène d'intérêt agronomique.- at least 5 calls selected on phosphinothricin generated plants revealing the presence of the recombinant protein by Western blot; - the chimeric gene for HPPD and the heterologous protein are absent from the unprocessed calluses. These results show the efficiency of the chimeric bar gene for the selection of transformed calluses containing another gene of agronomic interest.
5. Analyse de la descendance des plantes tr.ansformées:5. Analysis of the progeny of highly transformed plants:
Les plantes transformées obtenues ci-dessus ont émis du pollen supposé en partie transgénique, qui a fécondé des ovules d'un maïs sauvage non transgénique. Les graines obtenues sont sélectionnées sur sable après traitement à l'isoxaflutole. Le protocole de sélection est le suivant: 800ml de sable de Fontainebleau sont placés dans une barquette de 15 x 20 cm de côtés.The transformed plants obtained above emitted pollen supposedly partly transgenic, which fertilized eggs from a wild non-transgenic corn. The seeds obtained are selected on sand after treatment with isoxaflutole. The selection protocol is as follows: 800ml of Fontainebleau sand are placed in a 15 x 20 cm tray.
Ces barquettes sont alors arrosées oar de l'eau et maintenant hydratées par apport d'une solution nutritive constituée de 5ml de Quinoligo (La Quinoléine) par litre d'eau. Vingt graines de maïs sont placées sur les barquettes, qui sont alors traitées à l'isoxaflutole par pulvérisation à raison de 100 à 200g de matière active par hectare (300 ou 600 μg de matière active par barquette). Les barquettes sont ensuite placées en culture en sene.These trays are then sprinkled with water and now hydrated by adding a nutritive solution consisting of 5ml of Quinoligo (La Quinoline) per liter of water. Twenty corn seeds are placed on the trays, which are then treated with isoxaflutole by spraying at the rate of 100 to 200 g of active ingredient per hectare (300 or 600 μg of active ingredient per tray). The trays are then placed in sene culture.
Les résultats obtenus sont rassemblés dans le tableau suivant:The results obtained are collated in the following table:
Génotypes Isoxaflutole nombre de nombre de nombre de nombre de (g/ha) graines plantes plantes plantes semées germées mortes survivantes non 0 20 20 0 20 transgéniqueIsoxaflutole genotypes number of number of number of number of (g / ha) seeds plants plants plants seeded germinated dead surviving non 0 20 20 0 20 transgenic
100 20 20 20 0100 20 20 20 0
261 2B 459 100 10 10 5 5261 2B 459 100 10 10 5 5
200 10 9 4 5200 10 9 4 5
261 2D2 100 10 9 6 3261 2D2 100 10 9 6 3
200 10 10 7 3200 10 10 7 3
261 2A2 100 10 5 3 2261 2A2 100 10 5 3 2
200 10 7 7 0 Ces résultats montrent l'efficacité du gène de l'HPPD pour la sélection des plantes résistantes de mais Ils montrent aussi que la surexpression de l'HPPD de Pseudomonas dans les tissus de mais leur confère la tolérance à l'isoxaflutole.200 10 7 7 0 These results show the efficacy of the HPPD gene for the selection of resistant maize plants. They also show that the overexpression of Pseudomonas HPPD in the tissues of, but confers on them tolerance to isoxaflutole.
Les séquences illustrées sont les suivantes: SEQ ID N° 1The illustrated sequences are as follows: SEQ ID N ° 1
Séquence du gène de l'HPPD de Pseudomonas fluorescens A32.Pseudomonas fluorescens A32 HPPD gene sequence.
SEQ ID N° 2 Séquence d' ADNc d'EPSPS d'Arabidopsis thalianaSEQ ID No. 2 EPSPS cDNA sequence of Arabidopsis thaliana
SEQ ID N° 3 et 4 séquences respectivement du gène et de la protéine de l'EPSPS de mais mutée, partie 1340 pb du clone pRPA-ML-716SEQ ID N ° 3 and 4 sequences of the mutated corn EPSPS gene and protein respectively, part 1340 bp of the clone pRPA-ML-716
SEQ ID n° 5 et SEQ ID n° 6 séquences respectivement du gène et de la protéine de l'EPSPS de mais mutée, partieSEQ ID No. 5 and SEQ ID No. 6 sequences of the mutated maize EPSPS gene and protein, part
1340 pb du clone pRPA-ML-7201340 bp from the clone pRPA-ML-720
Les figures ci-après sont données à titre indicatif pour illustrer l'invention.The figures below are given as an indication to illustrate the invention.
La Figure 1 représente la séquence protéique de l'HPPD de Pseudomonas sp. strain P.J. 874 et la séquence nucléotidique théorique de la partie codante correspondante; les cinq oligonucléotides choisis pour faire l'amplification d'une partie de cette région codante sont symbolisés par les cinq flèches.Figure 1 shows the protein sequence of the HPPD of Pseudomonas sp. strain P.J. 874 and the theoretical nucleotide sequence of the corresponding coding part; the five oligonucleotides chosen to amplify part of this coding region are symbolized by the five arrows.
La Figure 2 représente la cartographie du plasmide avec le fragment d'ADN genomique de 7 kb contenant le gène de l'HPPD de P. fluorescens A32.Figure 2 shows the mapping of the plasmid with the 7 kb genomic DNA fragment containing the HPPD gene from P. fluorescens A32.
La Figure 3 donne la comparaison des séquences en acides aminés de l' HPPD de P. fluorescens A32 et de l'HPPD de Pseudomonas sp strain P.J. 874 (seuls les acides aminés divergents entre les deux séquences sont indiqués) ainsi que la séquence consensus. isce des séquencesFigure 3 gives the comparison of the amino acid sequences of the HPPD from P. fluorescens A32 and the HPPD of Pseudomonas sp strain PJ 874 (only the divergent amino acids between the two sequences are indicated) as well as the consensus sequence. isce sequences
SEQ ID NO: 1:SEQ ID NO: 1:
ATGGCAGATC TATACGAAAA CCCAATGGGC CTGATGGGCT TTGAATTCAT CGAATTCGCG 60ATGGCAGATC TATACGAAAA CCCAATGGGC CTGATGGGCT TTGAATTCAT CGAATTCGCG 60
TCGCCGACGC CGGGTACCCT GGAGCCGATC TTCGAGATCA TGGGCTTCAC CAAAGTCGCG 120TCGCCGACGC CGGGTACCCT GGAGCCGATC TTCGAGATCA TGGGCTTCAC CAAAGTCGCG 120
ACCCACCGTT CCAAGAACGT GCACCTGTAC CGCCAGGGCG AGATCAACCT GATCCTCAAC 180ACCCACCGTT CCAAGAACGT GCACCTGTAC CGCCAGGGCG AGATCAACCT GATCCTCAAC 180
AACGAGCCCA ACAGCATCGC CTCCTACTTT GCGGCCGAAC ACGGCCCGTC GGTGTGCGGC 240AACGAGCCCA ACAGCATCGC CTCCTACTTT GCGGCCGAAC ACGGCCCGTC GGTGTGCGGC 240
ATGGCGTTCC GCGTGAAGGA CTCGCAAAAG GCCTACAACC GCGCCCTGGA ACTCGGCGCC 300ATGGCGTTCC GCGTGAAGGA CTCGCAAAAG GCCTACAACC GCGCCCTGGA ACTCGGCGCC 300
CAGCCGATCC ATATTGACAC CGGGCCGATG GAATTGAACC TGCCGGCGAT CAAGGGCATC 360CAGCCGATCC ATATTGACAC CGGGCCGATG GAATTGAACC TGCCGGCGAT CAAGGGCATC 360
GGCGGCGCGC CGTTGTACCT GATCGACCGT TTCGGCGAAG GCAGCTCGAT CTACGACATC 420GGCGGCGCGC CGTTGTACCT GATCGACCGT TTCGGCGAAG GCAGCTCGAT CTACGACATC 420
GACTTCGTGT ACCTCGAAGG TGTGGAGCGC AATCCGGTCG GTGCAGGTCT CAAAGTCATC 480GACTTCGTGT ACCTCGAAGG TGTGGAGCGC AATCCGGTCG GTGCAGGTCT CAAAGTCATC 480
GACCACCTGA CCCACAACGT CTATCGCGGC CGCATGGTCT ACTGGGCCAA CTTCTACGAG 540GACCACCTGA CCCACAACGT CTATCGCGGC CGCATGGTCT ACTGGGCCAA CTTCTACGAG 540
AAATTGTTCA ACTTCCGTGA AGCGCGTTAC TTCGATATCA AGGGCGAGTA CACCGGCCTG 600AAATTGTTCA ACTTCCGTGA AGCGCGTTAC TTCGATATCA AGGGCGAGTA CACCGGCCTG 600
ACTTCCAAGG CCATGAGTGC GCCGGACGGC ATGATCCGCA TCCCGCTGAA CGAAGAGTCG 660ACTTCCAAGG CCATGAGTGC GCCGGACGGC ATGATCCGCA TCCCGCTGAA CGAAGAGTCG 660
TCCAAGGGCG CGGGGCAGAT CGAAGAGTTC CTGATGCAGT TCAACGGCGA AGGCATCCAG 720TCCAAGGGCG CGGGGCAGAT CGAAGAGTTC CTGATGCAGT TCAACGGCGA AGGCATCCAG 720
CACGTGGCGT TCCTCACCGA CGACCTGGTC AAGACCTGGG ACGCGTTGAA GAAAATCGGC 780CACGTGGCGT TCCTCACCGA CGACCTGGTC AAGACCTGGG ACGCGTTGAA GAAAATCGGC 780
ATGCGCTTCA TGACCGCGCC GCCAGACACT TATTACGAAA TGCTCGAAGG CCGCCTGCCT 840ATGCGCTTCA TGACCGCGCC GCCAGACACT TATTACGAAA TGCTCGAAGG CCGCCTGCCT 840
GACCACGGCG AGCCGGTGGA TCAACTGCAG GCACGCGGTA TCCTGCTGGA CGGATCTTCC 900GACCACGGCG AGCCGGTGGA TCAACTGCAG GCACGCGGTA TCCTGCTGGA CGGATCTTCC 900
GTGGAAGGCG ACAAACGCCT GCTGCTGCAG ATCTTCTCGG AAACCCTGAT GGGCCCGGTG 960GTGGAAGGCG ACAAACGCCT GCTGCTGCAG ATCTTCTCGG AAACCCTGAT GGGCCCGGTG 960
TTCTTCGAAT TCATCCAGCG CAAGGGCGAC GATGGGTTTG GCGAGGGCAA CTTCAAGGCG 1020TTCTTCGAAT TCATCCAGCG CAAGGGCGAC GATGGGTTTG GCGAGGGCAA CTTCAAGGCG 1020
CTGTTCGAGT CCATCGAACG TGACCAGGTG CGTCGTGGTG TATTGACCGC CGATTAA 1077 CTGTTCGAGT CCATCGAACG TGACCAGGTG CGTCGTGGTG TATTGACCGC CGATTAA 1077
SEQ ID NO : 2 :SEQ ID NO: 2:
AATCAATTTC ACACAGGAAA CAGCTATGAC CATGATTACG AATTCGGGCC CGGGCGCGTG 60AATCAATTTC ACACAGGAAA CAGCTATGAC CATGATTACG AATTCGGGCC CGGGCGCGTG 60
ATCCGGCGGC GGCAGCGGCG GCGGCGGTGC AGGCGGGTGC CGAGGAGATC GTGCTGCAGC 120ATCCGGCGGC GGCAGCGGCG GCGGCGGTGC AGGCGGGTGC CGAGGAGATC GTGCTGCAGC 120
CCATCAAGGA GATCTCCGGC ACCGTCAAGC TGCCGGGGTC CAAGTCGCTT TCCAACCGGA 180CCATCAAGGA GATCTCCGGC ACCGTCAAGC TGCCGGGGTC CAAGTCGCTT TCCAACCGGA 180
TCCTCCTACT CGCCGCCCTG TCCGAGGGGA CAACAGTGGT TGATAACCTG CTGAACAGTG 240TCCTCCTACT CGCCGCCCTG TCCGAGGGGA CAACAGTGGT TGATAACCTG CTGAACAGTG 240
AGGATGTCCA CTACATGCTC GGGGCCTTGA GGACTCTTGG TCTCTCTGTC GAAGCGGACA 300AGGATGTCCA CTACATGCTC GGGGCCTTGA GGACTCTTGG TCTCTCTGTC GAAGCGGACA 300
AAGCTGCCAA AAGAGCTGTA GTTGTTGGCT GTGGTGGAAA GTTCCCAGTT GAGGATGCTA 360AAGCTGCCAA AAGAGCTGTA GTTGTTGGCT GTGGTGGAAA GTTCCCAGTT GAGGATGCTA 360
AAGAGGAAGT GCAGCTCTTC TTGGGGAATG CTGGAACTGC AATGCGGCCA TTGACAGCAG 420AAGAGGAAGT GCAGCTCTTC TTGGGGAATG CTGGAACTGC AATGCGGCCA TTGACAGCAG 420
CTGTTACTGC TGCTGGTGGA AATGCAACTT ACGTGCTTGA TGGAGTACCA AGAATGAGGG 480CTGTTACTGC TGCTGGTGGA AATGCAACTT ACGTGCTTGA TGGAGTACCA AGAATGAGGG 480
AGAGACCCAT TGGCGACTTG GTTGTCGGAT TGAAGCAGCT TGGTGCAGAT GTTGATTGTT 540AGAGACCCAT TGGCGACTTG GTTGTCGGAT TGAAGCAGCT TGGTGCAGAT GTTGATTGTT 540
TCCTTGGCAC TGACTGCCCA CCTGTTCGTG TCAATGGAAT CGGAGGGCTA CCTGGTGGCA 600TCCTTGGCAC TGACTGCCCA CCTGTTCGTG TCAATGGAAT CGGAGGGCTA CCTGGTGGCA 600
AGGTCAAGCT GTCTGGCTCC ATCAGCAGTC AGTACTTGAG TGCCTTGCTG ATGGCTGCTC 660AGGTCAAGCT GTCTGGCTCC ATCAGCAGTC AGTACTTGAG TGCCTTGCTG ATGGCTGCTC 660
CTTTGGCTCT TGGGGATGTG GAGATTGAAA TCATTGATAA ATTAATCTCC ATTCCGTACG 720CTTTGGCTCT TGGGGATGTG GAGATTGAAA TCATTGATAA ATTAATCTCC ATTCCGTACG 720
TCGAAATGAC ATTGAGATTG ATGGAGCGTT TTGGTGTGAA AGCAGAGCAT TCTGATAGCT 780TCGAAATGAC ATTGAGATTG ATGGAGCGTT TTGGTGTGAA AGCAGAGCAT TCTGATAGCT 780
GC-GACAGATT CTACATTAAG GGAGGTCAAA AATACAAGTC CCCTAAAAAT GCCTATGTTG 840GC-GACAGATT CTACATTAAG GGAGGTCAAA AATACAAGTC CCCTAAAAAT GCCTATGTTG 840
AAGGTGATGC CTCAAGCGCA AGCTATTTCT TGGCTGGTGC TGCAATTACT GGAGGGACTG 900AAGGTGATGC CTCAAGCGCA AGCTATTTCT TGGCTGGTGC TGCAATTACT GGAGGGACTG 900
TGACTGTGGA AGGTTGTGGC ACCACCAGTT TGCAGGGTGA TGTGAAGTTT GCTGAGGTAC 960TGACTGTGGA AGGTTGTGGC ACCACCAGTT TGCAGGGTGA TGTGAAGTTT GCTGAGGTAC 960
TGGAGATGAT GGGAGCGAAG GTTACATGGA CCGAGACTAG CGTAACTGTT ACTGGCCCAC 1020TGGAGATGAT GGGAGCGAAG GTTACATGGA CCGAGACTAG CGTAACTGTT ACTGGCCCAC 1020
CGCGGGAGCC ATTTGGGAGG AAACACCTCA AGGCGATTGA TGTCAACATG AACAAGATGC 1080CGCGGGAGCC ATTTGGGAGG AAACACCTCA AGGCGATTGA TGTCAACATG AACAAGATGC 1080
CTGATGTCGC CATGACTCTT GCTGTGGTTG CCCTCTTTGC CGATGGCCCG ACAGCCATCA 1140CTGATGTCGC CATGACTCTT GCTGTGGTTG CCCTCTTTGC CGATGGCCCG ACAGCCATCA 1140
GAGACGTGGC TTCCTGGAGA GTAAAGGAGA CCGAGAGGAT GGTTGCGATC CGGACGGAGC 1200GAGACGTGGC TTCCTGGAGA GTAAAGGAGA CCGAGAGGAT GGTTGCGATC CGGACGGAGC 1200
TAACCAAGCT GGGAGCATCT GTTGAGGAAG GGCCGGACTA CTGCATCATC ACGCCGCCGG 1260TAACCAAGCT GGGAGCATCT GTTGAGGAAG GGCCGGACTA CTGCATCATC ACGCCGCCGG 1260
AGAAGCTGAA CGTGACGGCG ATCGACACGT ACGACGACCA CAGGATGGCC ATGGCCTTCT 1320AGAAGCTGAA CGTGACGGCG ATCGACACGT ACGACGACCA CAGGATGGCC ATGGCCTTCT 1320
CCCTTGCCGC CTGTGCCGAG GTCCCCGTCÂ CCATCCGGGA CCCTGGGTGC ACCCGGAAGA 1380CCCTTGCCGC CTGTGCCGAG GTCCCCGTCÂ CCATCCGGGA CCCTGGGTGC ACCCGGAAGA 1380
CCTTCCCCGA CTACTTCGAT GTGCTGAGCA CTTTCGTCAA GAATTAATAA AGCGTGCGAT 1440CCTTCCCCGA CTACTTCGAT GTGCTGAGCA CTTTCGTCAA GAATTAATAA AGCGTGCGAT 1440
ACTACCACGC AGCTTGATTG AAGTGATAGG CTTGTGCTGA GGAAATACAT TTCTTTTGTT 1500ACTACCACGC AGCTTGATTG AAGTGATAGG CTTGTGCTGA GGAAATACAT TTCTTTTGTT 1500
CTGTTTTTCT CTTTCACGGG ATTAAGTTTT GAGTCTGTAA CGTTAGTTGT TTGTAGCAAG 1560CTGTTTTTCT CTTTCACGGG ATTAAGTTTT GAGTCTGTAA CGTTAGTTGT TTGTAGCAAG 1560
TTTCTATTTC GGATCTTAAG TTTGTGCACT GTAAGCCAAA TTTCATTTCA AGAGTGGTTC 1620TTTCTATTTC GGATCTTAAG TTTGTGCACT GTAAGCCAAA TTTCATTTCA AGAGTGGTTC 1620
GTTGGAATAA TAAGAATAAT AAATTACGTT TCAGTGAAAA AAAAAAAAAA AAAAAAAAAA 1680GTTGGAATAA TAAGAATAAT AAATTACGTT TCAGTGAAAA AAAAAAAAAA AAAAAAAAAA 1680
AAAAAAAAAA AAAAAAAAAA AACCCGGGAA TTC 1713 SEQ ID NO : 3 :AAAAAAAAAA AAAAAAAAAA AACCCGGGAA TTC 1713 SEQ ID NO: 3:
CCATG GCC GGC GCC GAG GAG ATC GTG CTG CAG CCC ATC AAG GAG ATC 47CCATG GCC GGC GCC GAG GAG ATC GTG CTG CAG CCC ATC AAG GAG ATC 47
Ala Gly Ala Glu Glu Ile Val Leu Gin Pro Ile Lys Glu Ile 1 5 10Ala Gly Ala Glu Glu Ile Val Leu Gin Pro Ile Lys Glu Ile 1 5 10
TCC GGC ACC GTC AAG CTG CCG GGG TCC AAG TCG CTT TCC AAC CGG ATC 95 Ser Gly Thr Val Lys Leu Pro Gly Ser Lys Ser Leu Ser Asn Arg Ile 15 20 25 30TCC GGC ACC GTC AAG CTG CCG GGG TCC AAG TCG CTT TCC AAC CGG ATC 95 Ser Gly Thr Val Lys Leu Pro Gly Ser Lys Ser Leu Ser Asn Arg Ile 15 20 25 30
CTC CTA CTC GCC GCC CTG TCC GAG GGG ACA ACA GTG GTT GAT AAC CTG 143 Leu Leu Leu Ala Ala Leu Ser Glu Gly Thr Thr Val Val Asp Asn Leu 35 40 45CTC CTA CTC GCC GCC CTG TCC GAG GGG ACA ACA GTG GTT GAT AAC CTG 143 Leu Leu Leu Ala Ala Leu Ser Glu Gly Thr Thr Val Val Asp Asn Leu 35 40 45
CTG AAC AGT GAG GAT GTC CAC TAC ATG CTC GGG GCC TTG AGG ACT CTT 191 Leu Asn Ser Glu Asp Val His Tyr Met Leu Gly Ala Leu Arg Thr Leu 50 55 60CTG AAC AGT GAG GAT GTC CAC TAC ATG CTC GGG GCC TTG AGG ACT CTT 191 Leu Asn Ser Glu Asp Val His Tyr Met Leu Gly Ala Leu Arg Thr Leu 50 55 60
GGT CTC TCT GTC GAA GCG GAC AAA GCT GCC AAA AGA GCT GTA GTT GTT 239 Gly Leu Ser Val Glu Ala Asp Lys Ala Ala Lys Arg Ala Val Val Val 65 70 75GGT CTC TCT GTC GAA GCG GAC AAA GCT GCC AAA AGA GCT GTA GTT GTT 239 Gly Leu Ser Val Glu Ala Asp Lys Ala Ala Lys Arg Ala Val Val Val 65 70 75
GGC TGT GGT GGA AAG TTC CCA GTT GAG GAT GCT AAA GAG GAA GTG CAG 287 Glv Cvs Gly Gly Lys Phe Pro Val Glu Asp Ala Lys Glu Glu Val Gin 80 85 90GGC TGT GGT GGA AAG TTC CCA GTT GAG GAT GCT AAA GAG GAA GTG CAG 287 Glv Cvs Gly Gly Lys Phe Pro Val Glu Asp Ala Lys Glu Glu Val Gin 80 85 90
CTC TTC TTG GGG AAT GCT GGA ACT GCA ATG CGG CCA TTG ACA GCA GCT 335 Leu Phe Leu Gly Asn Ala Gly Thr Ala Met Arg Pro Leu Thr Ala Ala 95 100 105 110CTC TTC TTG GGG AAT GCT GGA ACT GCA ATG CGG CCA TTG ACA GCA GCT 335 Leu Phe Leu Gly Asn Ala Gly Thr Ala Met Arg Pro Leu Thr Ala Ala 95 100 105 110
GTT ACT GCT GCT GGT GGA AAT GCA ACT TAC GTG CTT GAT GGA GTA CCA 383 Val Thr Ala Ala Gly Gly Asn Ala Thr Tyr Val Leu Asp Gly Val Pro 115 120 125GTT ACT GCT GCT GGT GGA AAT GCA ACT TAC GTG CTT GAT GGA GTA CCA 383 Val Thr Ala Ala Gly Gly Asn Ala Thr Tyr Val Leu Asp Gly Val Pro 115 120 125
AGA ATG AGG GAG AGA CCC ATT GGC GAC TTG GTT GTC GGA TTG AAG CAG 431 Arg Met Arg Glu Arg Pro Ile Gly Asp Leu Val Val Gly Leu Lys Gin 130 135 140AGA ATG AGG GAG AGA CCC ATT GGC GAC TTG GTT GTC GGA TTG AAG CAG 431 Arg Met Arg Glu Arg Pro Ile Gly Asp Leu Val Val Gly Leu Lys Gin 130 135 140
CTT GGT GCA GAT GTT GAT TGT TTC CTT GGC ACT GAC TGC CCA CCT GTT 479 Leu Gly Ala Asp Val Asp Cys Phe Leu Gly Thr Asp Cys Pro Pro Val 145 150 155CTT GGT GCA GAT GTT GAT TGT TTC CTT GGC ACT GAC TGC CCA CCT GTT 479 Leu Gly Ala Asp Val Asp Cys Phe Leu Gly Thr Asp Cys Pro Pro Val 145 150 155
CGT GTC AAT GGA ATC GGA GGG CTA CCT GGT GGC AAG GTC AAG CTG TCT 527 Arg Val Asn Gly Ile Gly Gly Leu Pro Gly Gly Lys Val Lys Leu Ser 160 165 170CGT GTC AAT GGA ATC GGA GGG CTA CCT GGT GGC AAG GTC AAG CTG TCT 527 Arg Val Asn Gly Ile Gly Gly Leu Pro Gly Gly Lys Val Lys Leu Ser 160 165 170
GGC TCC ATC AGC AGT CAG TAC TTG AGT GCC TTG CTG ATG GCT GCT CCT 575 Gly Ser Ile Ser Ser Gin Tyr Leu Ser Ala Leu Leu Met Ala Ala Pro 175 180 185 190GGC TCC ATC AGC AGT CAG TAC TTG AGT GCC TTG CTG ATG GCT GCT CCT 575 Gly Ser Ile Ser Ser Gin Tyr Leu Ser Ala Leu Leu Met Ala Ala Pro 175 180 185 190
TTG GCT CTT GGG GAT GTG GAG ATT GAA ATC ATT GAT AAA TTA ATC TCC 623 Leu Ala Leu Gly Asp Val Glu Ile Glu Ile Ile Asp Lys Leu Ile Ser 195 200 205TTG GCT CTT GGG GAT GTG GAG ATT GAA ATC ATT GAT AAA TTA ATC TCC 623 Leu Ala Leu Gly Asp Val Glu Ile Glu Ile Asp Lys Leu Ile Ser 195 200 205
ATT CCG TAC GTC GAA ATG ACA TTG AGA TTG ATG GAG CGT TTT GGT GTG 671 Ile Pro Tyr Val Glu Met Thr Leu Arg Leu Met Glu Arg Phe Gly Val 210 215 220ATT CCG TAC GTC GAA ATG ACA TTG AGA TTG ATG GAG CGT TTT GGT GTG 671 Ile Pro Tyr Val Glu Met Thr Leu Arg Leu Met Glu Arg Phe Gly Val 210 215 220
AAA GCA GAG CAT TCT GAT AGC TGG GAC AGA TTC TAC ATT AAG GGA GGT 719 Lys Ala Glu His Ser Asp Ser Trp Asp Arg Phe Tyr Ile Lys Gly Gly 225 230 235AAA GCA GAG CAT TCT GAT AGC TGG GAC AGA TTC TAC ATT AAG GGA GGT 719 Lys Ala Glu His Ser Asp Ser Trp Asp Arg Phe Tyr Ile Lys Gly Gly 225 230 235
CAA AAA TAC AAG TCC CCT AAA AAT GCC TAT GTT GAA GGT GAT GCC TCA 767 Gin Lys Tyr Lys Ser Pro Lys Asn Ala Tyr Val Glu Gly Asp Ala Ser 240 245 250 SEQ ID NO: 3 (suite)CAA AAA TAC AAG TCC CCT AAA AAT GCC TAT GTT GAA GGT GAT GCC TCA 767 Gin Lys Tyr Lys Ser Pro Lys Asn Ala Tyr Val Glu Gly Asp Ala Ser 240 245 250 SEQ ID NO: 3 (continued)
AGC GCA AGC TAT TTC TTG GCT GGT GCT GCA ATT ACT GGA GGG ACT GTG 815 Ser Ala Ser Tyr Phe Leu Ala Gly Ala Ala Ile Thr Gly Gly Thr Val 255 260 265 270AGC GCA AGC TAT TTC TTG GCT GGT GCT GCA ATT ACT GGA GGG ACT GTG 815 Ser Ala Ser Tyr Phe Leu Ala Gly Ala Ala Ile Thr Gly Gly Thr Val 255 260 265 270
ACT GTG GAA GGT TGT GGC ACC ACC AGT TTG CAG GGT GAT GTG AAG TTT 863 Thr Val Glu Gly Cys Gly Thr Thr Ser Leu Gin Gly Asp Val Lys Phe 275 280 285ACT GTG GAA GGT TGT GGC ACC ACC AGT TTG CAG GGT GAT GTG AAG TTT 863 Thr Val Glu Gly Cys Gly Thr Thr Ser Leu Gin Gly Asp Val Lys Phe 275 280 285
GCT GAG GTA CTG GAG ATG ATG GGA GCG AAG GTT ACA TGG ACC GAG ACT 911 Ala Glu Val Leu Glu Met Met Gly Ala Lys Val Thr Trp Thr Glu Thr 290 295 300GCT GAG GTA CTG GAG ATG ATG GGA GCG AAG GTT ACA TGG ACC GAG ACT 911 Ala Glu Val Leu Glu Met Met Gly Ala Lys Val Thr Trp Thr Glu Thr 290 295 300
AGC GTA ACT GTT ACT GGC CCA CCG CGG GAG CCA TTT GGG AGG AAA CAC 959 Ser Val Thr Val Thr Gly Pro Pro Arg Glu Pro Phe Gly Arg Lys His 305 310 315AGC GTA ACT GTT ACT GGC CCA CCG CGG GAG CCA TTT GGG AGG AAA CAC 959 Ser Val Thr Val Thr Gly Pro Pro Arg Glu Pro Phe Gly Arg Lys His 305 310 315
CTC AAG GCG ATT GAT GTC AAC ATG AAC AAG ATG CCT GAT GTC GCC ATG 1007 Leu Lys Ala Ile Asp Val Asn Met Asn Lys Met Pro Asp Val Ala Met 320 325 330CTC AAG GCG ATT GAT GTC AAC ATG AAC AAG ATG CCT GAT GTC GCC ATG 1007 Leu Lys Ala Ile Asp Val Asn Met Asn Lys Met Pro Asp Val Ala Met 320 325 330
ACT CTT GCT GTG GTT GCC CTC TTT GCC GAT GGC CCG ACA GCC ATC AGA 1055 Thr Leu Ala Val Val Ala Leu Phe Ala Asp Gly Pro Thr Ala Ile Arg 335 340 345 350ACT CTT GCT GTG GTT GCC CTC TTT GCC GAT GGC CCG ACA GCC ATC AGA 1055 Thr Leu Ala Val Val Ala Leu Phe Ala Asp Gly Pro Thr Ala Ile Arg 335 340 345 350
GAC GTG GCT TCC TGG AGA GTA AAG GAG ACC GAG AGG ATG GTT GCG ATC 1103 ASΌ Val Ala Ser TrD Arg Val Lys Glu Thr Glu Arg Met Val Ala Ile 355 360 365GAC GTG GCT TCC TGG AGA GTA AAG GAG ACC GAG AGG ATG GTT GCG ATC 1103 ASΌ Val Ala Ser TrD Arg Val Lys Glu Thr Glu Arg Met Val Ala Ile 355 360 365
CGG ACG GAG CTA ACC AAG CTG GGA GCA TCT GTT GAG GAA GGG CCG GAC 1151 Arg Thr Glu Leu Thr Lys Leu Gly Ala Ser Val Glu Glu Gly Pro Asp 370 375 380CGG ACG GAG CTA ACC AAG CTG GGA GCA TCT GTT GAG GAA GGG CCG GAC 1151 Arg Thr Glu Leu Thr Lys Leu Gly Ala Ser Val Glu Glu Gly Pro Asp 370 375 380
TAC TGC ATC ATC ACG CCG CCG GAG AAG CTG AAC GTG ACG GCG ATC GAC 1199 Tyr Cys Ile Ile Thr Pro Pro Glu Lys Leu Asn Val Thr Ala Ile Asp 385 390 395TAC TGC ATC ATC ACG CCG CCG GAG AAG CTG AAC GTG ACG GCG ATC GAC 1199 Tyr Cys Ile Ile Thr Pro Pro Glu Lys Leu Asn Val Thr Ala Ile Asp 385 390 395
ACG TAC GAC GAC CAC AGG ATG GCC ATG GCC TTC TCC CTT GCC GCC TGT 1247 Thr Tyr Asp Asp His Arg Met Ala Met Ala Phe Ser Leu Ala Ala Cys 400 405 410ACG TAC GAC GAC CAC AGG ATG GCC ATG GCC TTC TCC CTT GCC GCC TGT 1247 Thr Tyr Asp Asp His Arg Met Ala Met Ala Phe Ser Leu Ala Ala Cys 400 405 410
GCC GAG GTC CCC GTC ACC ATC CGG GAC CCT GGG TGC ACC CGG AAG ACC 1295 Ala Glu Val Pro Val Thr Ile Arg Asp Pro Gly Cys Thr Arg Lys Thr 415 420 425 430GCC GAG GTC CCC GTC ACC ATC CGG GAC CCT GGG TGC ACC CGG AAG ACC 1295 Ala Glu Val Pro Val Thr Ile Arg Asp Pro Gly Cys Thr Arg Lys Thr 415 420 425 430
TTC CCC GAC TAC TTC GAT GTG CTG AGC ACT TTC GTC AAG AAT 1337TTC CCC GAC TAC TTC GAT GTG CTG AGC ACT TTC GTC AAG AAT 1337
Phe Pro Asp Tyr Phe Asp Val Leu Ser Thr Phe Val Lys Asn 435 440Phe Pro Asp Tyr Phe Asp Val Leu Ser Thr Phe Val Lys Asn 435 440
TAA 1340 TAA 1340
SEQ ID NO: 4:SEQ ID NO: 4:
Ala Gly Ala Glu Glu Ile Val Leu Gin Pro Ile Lys Glu Ile Ser GlyAla Gly Ala Glu Glu Ile Val Leu Gin Pro Ile Lys Glu Ile Ser Gly
1 5 10 151 5 10 15
Thr Val Lys Leu Pro Gly Ser Lys Ser Leu Ser Asn Arg Ile Leu Leu 20 25 30Thr Val Lys Leu Pro Gly Ser Lys Ser Leu Ser Asn Arg Ile Leu Leu 20 25 30
Leu Ala Ala Leu Ser Glu Gly Thr Thr Val Val Asp Asn Leu Leu Asn 35 40 45Leu Ala Ala Leu Ser Glu Gly Thr Thr Val Val Asp Asn Leu Leu Asn 35 40 45
Ser Glu Asp Val His Tyr Met Leu Gly Ala Leu Arg Thr Leu Gly Leu 50 55 60Ser Glu Asp Val His Tyr Met Leu Gly Ala Leu Arg Thr Leu Gly Leu 50 55 60
Ser Val Glu Ala Asp Lys Ala Ala Lys Arg Ala Val Val Val Gly Cys 65 70 75 80Ser Val Glu Ala Asp Lys Ala Ala Lys Arg Ala Val Val Val Gly Cys 65 70 75 80
Gly Gly Lys Phe Pro Val Glu Asp Ala Lys Glu Glu Val Gin Leu Phe 85 90 95Gly Gly Lys Phe Pro Val Glu Asp Ala Lys Glu Glu Val Gin Leu Phe 85 90 95
Leu Gly Asn Ala Gly Thr Ala Met Arg Pro Leu Thr Ala Ala Val Thr 100 105 110Leu Gly Asn Ala Gly Thr Ala Met Arg Pro Leu Thr Ala Ala Val Thr 100 105 110
Ala Ala Gly Gly Asn Ala Thr Tyr Val Leu ASD Gly Val Pro Arg Met 115 120 125Ala Ala Gly Gly Asn Ala Thr Tyr Val Leu ASD Gly Val Pro Arg Met 115 120 125
Arg Glu Arg Pro Ile Gly Asp Leu Val Val Gly Leu Lys Gin Leu GlyArg Glu Arg Pro Ile Gly Asp Leu Val Val Gly Leu Lys Gin Leu Gly
130 135 140130 135 140
Ala Asp Val Asp Cys Phe Leu Gly Thr Asp Cys Pro Pro Val Arg Val 145 150 " 155 160Ala Asp Val Asp Cys Phe Leu Gly Thr Asp Cys Pro Pro Val Arg Val 145 150 " 155 160
Asn Gly Ile Gly Gly Leu Pro Gly Gly Lys Val Lys Leu Ser Gly Ser 165 170 175Asn Gly Ile Gly Gly Leu Pro Gly Gly Lys Val Lys Leu Ser Gly Ser 165 170 175
Ile Ser Ser Gin Tyr Leu Ser Ala Leu Leu Met Ala Ala Pro Leu Ala 180 185 190Ile Ser Ser Gin Tyr Leu Ser Ala Leu Leu Met Ala Ala Pro Leu Ala 180 185 190
Leu Gly ASD Val Glu Ile Glu Ile Ile ASD Lys Leu Ile Ser Ile Pro 195 200 205Leu Gly ASD Val Glu Ile Glu Ile Ile ASD Lys Leu Ile Ser Ile Pro 195 200 205
Tyr Val Glu Met Thr Leu Arg Leu Met Glu Arg Phe Gly Val Lys Ala 210 215 220Tyr Val Glu Met Thr Leu Arg Leu Met Glu Arg Phe Gly Val Lys Ala 210 215 220
Glu His Ser Asp Ser Trp Asp Arg Phe Tyr Ile Lys Gly Gly Gin Lys 225 230 235 240Glu His Ser Asp Ser Trp Asp Arg Phe Tyr Ile Lys Gly Gly Gin Lys 225 230 235 240
Tyr Lys Ser Pro Lys Asn Ala Tyr Val Glu Gly Asp Ala Ser Ser Ala 245 250 255Tyr Lys Ser Pro Lys Asn Ala Tyr Val Glu Gly Asp Ala Ser Ser Ala 245 250 255
Ser Tyr Phe Leu Ala Gly Ala Ala Ile Thr Gly Gly Thr Val Thr Val 260 265 270Ser Tyr Phe Leu Ala Gly Ala Ala Ile Thr Gly Gly Thr Val Thr Val 260 265 270
Glu Gly Cys Gly Thr Thr Ser Leu Gin Gly Asp Val Lys Phe Ala Glu 275 280 285Glu Gly Cys Gly Thr Thr Ser Leu Gin Gly Asp Val Lys Phe Ala Glu 275 280 285
Val Leu Glu Met Met Gly Ala Lys Val Thr Trp Thr Glu Thr Ser Val 290 295 300Val Leu Glu Met Met Gly Ala Lys Val Thr Trp Thr Glu Thr Ser Val 290 295 300
Thr Val Thr Gly Pro Pro Arg Glu Pro Phe Gly Arg Lys His Leu Lys 305 310 315 320Thr Val Thr Gly Pro Pro Arg Glu Pro Phe Gly Arg Lys His Leu Lys 305 310 315 320
Ala Ile Asp Val Asn Met Asn Lys Met Pro Asp Val Ala Met Thr Leu 325 330 335Ala Ile Asp Val Asn Met Asn Lys Met Pro Asp Val Ala Met Thr Leu 325 330 335
Ala Val Val Ala Leu Phe Ala Asp Gly Pro Thr Ala Ile Arg Asp Val 340 345 350 SEQ ID NO : 4 ( suite )Ala Val Val Ala Leu Phe Ala Asp Gly Pro Thr Ala Ile Arg Asp Val 340 345 350 SEQ ID NO: 4 (continued)
Ala Ser Trp Arg Val Lys Glu Thr Glu Arg Met Val Ala lie Arg Thr 355 360 365Ala Ser Trp Arg Val Lys Glu Thr Glu Arg Met Val Ala lie Arg Thr 355 360 365
Glu Leu Thr Lys Leu Gly Ala Ser Val Glu Glu Gly Pro Asp Tvr Cys 370 375 380Glu Leu Thr Lys Leu Gly Ala Ser Val Glu Glu Gly Pro Asp Tvr Cys 370 375 380
Ile Ile Thr Pro Pro Glu Lys Leu Asn Val Thr Ala Ile Asp Thr Tyr 385 390 395 400Ile Ile Thr Pro Pro Glu Lys Leu Asn Val Thr Ala Ile Asp Thr Tyr 385 390 395 400
Asp Asp His Arg Met Ala Met Ala Phe Ser Leu Ala Ala Cys Ala GluAsp Asp His Arg Met Ala Met Ala Phe Ser Leu Ala Ala Cys Ala Glu
405 -_ - 410 415405 -_ - 410 415
Val Pro Val Thr Ile Arg Asp Pro Gly Cys Thr Arg Lys Thr Phe Pro 420 425 430Val Pro Val Thr Ile Arg Asp Pro Gly Cys Thr Arg Lys Thr Phe Pro 420 425 430
Asp Tyr Phe Asp Val Leu Ser Thr Phe Val Lys Asn 435 440 Asp Tyr Phe Asp Val Leu Ser Thr Phe Val Lys Asn 435 440
SEQ ID NO : 5 :SEQ ID NO: 5:
CCATG GCC GGC GCC GAG GAG ATC GTG CTG CAG CCC ATC AAG GAG ATC 47CCATG GCC GGC GCC GAG GAG ATC GTG CTG CAG CCC ATC AAG GAG ATC 47
Ala Gly Ala Glu Glu Ile Val Leu Gin Pro Ile Lys Glu Ile 1 5 10Ala Gly Ala Glu Glu Ile Val Leu Gin Pro Ile Lys Glu Ile 1 5 10
TCC GGC ACC GTC AAG CTG CCG GGG TCC AAG TCG CTT TCC AAC CGG ATC 95 Ser Gly Thr Val Lys Leu Pro Gly Ser Lys Ser Leu Ser Asn Arg Ile 15 20 25 30TCC GGC ACC GTC AAG CTG CCG GGG TCC AAG TCG CTT TCC AAC CGG ATC 95 Ser Gly Thr Val Lys Leu Pro Gly Ser Lys Ser Leu Ser Asn Arg Ile 15 20 25 30
CTC CTA CTC GCC GCC CTG TCC GAG GGG ACA ACA GTG GTT GAT AAC CTG 143 Leu Leu Leu Ala Ala Leu Ser Glu Gly Thr Thr Val Val Asp Asn Leu 35 40 45CTC CTA CTC GCC GCC CTG TCC GAG GGG ACA ACA GTG GTT GAT AAC CTG 143 Leu Leu Leu Ala Ala Leu Ser Glu Gly Thr Thr Val Val Asp Asn Leu 35 40 45
CTG AAC AGT GAG GAT GTC CAC TAC ATG CTC GGG GCC TTG AGG ACT CTT 191 Leu Asn Ser Glu Asp Val His Tyr Met Leu Gly Ala Leu Arg Thr Leu 50 55 60CTG AAC AGT GAG GAT GTC CAC TAC ATG CTC GGG GCC TTG AGG ACT CTT 191 Leu Asn Ser Glu Asp Val His Tyr Met Leu Gly Ala Leu Arg Thr Leu 50 55 60
GGT CTC TCT GTC GAA GCG GAC AAA GCT GCC AAA AGA GCT GTA GTT GTT 239 Gly Leu Ser Val Glu Ala Asp Lys Ala Ala Lys Arg Ala Val Val Val 65 70 75GGT CTC TCT GTC GAA GCG GAC AAA GCT GCC AAA AGA GCT GTA GTT GTT 239 Gly Leu Ser Val Glu Ala Asp Lys Ala Ala Lys Arg Ala Val Val Val 65 70 75
GGC TGT GGT GGA AAG TTC CCA GTT GAG GAT GCT AAA GAG GAA GTG CAG 287 Gly Cys Gly Gly Lys Phe Pro Val Glu Asp Ala Lys Glu Glu Val Gin 80 85 90GGC TGT GGT GGA AAG TTC CCA GTT GAG GAT GCT AAA GAG GAA GTG CAG 287 Gly Cys Gly Gly Lys Phe Pro Val Glu Asp Ala Lys Glu Glu Val Gin 80 85 90
CTC TTC TTG GGG AAT GCT GGA ATC GCA ATG CGG TCC TTG ACA GCA GCT 335 Leu Phe Leu Gly Asn Ala Gly Ile Ala Met Arg Ser Leu Thr Ala Ala 95 100 105 110CTC TTC TTG GGG AAT GCT GGA ATC GCA ATG CGG TCC TTG ACA GCA GCT 335 Leu Phe Leu Gly Asn Ala Gly Ile Ala Met Arg Ser Leu Thr Ala Ala 95 100 105 110
GTT ACT GCT GCT GGT GGA AAT GCA ACT TAC GTG CTT GAT GGA GTA CCA 383 Val Thr Ala Ala Gly Gly Asn Ala Thr Tyr Val Leu Asp Gly Val Pro 115 120 125GTT ACT GCT GCT GGT GGA AAT GCA ACT TAC GTG CTT GAT GGA GTA CCA 383 Val Thr Ala Ala Gly Gly Asn Ala Thr Tyr Val Leu Asp Gly Val Pro 115 120 125
AGA ATG AGG GAG AGA CCC ATT GGC GAC TTG GTT GTC GGA TTG AAG CAG 431 Arg Met Arg Glu Arg Pro Ile Gly Asp Leu Val Val Gly Leu Lys Gin 130 135 140AGA ATG AGG GAG AGA CCC ATT GGC GAC TTG GTT GTC GGA TTG AAG CAG 431 Arg Met Arg Glu Arg Pro Ile Gly Asp Leu Val Val Gly Leu Lys Gin 130 135 140
CTT GGT GCA GAT GTT GAT TGT TTC CTT GGC ACT GAC TGC CCA CCT GTT 479 Leu Gly Ala Asp Val Asp Cys Phe Leu Gly Thr Asp Cys Pro Pro Val 145 150 155CTT GGT GCA GAT GTT GAT TGT TTC CTT GGC ACT GAC TGC CCA CCT GTT 479 Leu Gly Ala Asp Val Asp Cys Phe Leu Gly Thr Asp Cys Pro Pro Val 145 150 155
CGT GTC AAT GGA ATC GGA GGG CTA CCT GGT GGC AAG GTC AAG CTG TCT 527 Arg Val Asn Gly Ile Gly Gly Leu Pro Gly Gly Lys Val Lys Leu Ser 160 165 170CGT GTC AAT GGA ATC GGA GGG CTA CCT GGT GGC AAG GTC AAG CTG TCT 527 Arg Val Asn Gly Ile Gly Gly Leu Pro Gly Gly Lys Val Lys Leu Ser 160 165 170
GGC TCC ATC AGC AGT CAG TAC TTG AGT GCC TTG CTG ATG GCT GCT CCT 575 Gly Ser Ile Ser Ser Gin Tyr Leu Ser Ala Leu Leu Met Ala Ala Pro 175 180 185 190GGC TCC ATC AGC AGT CAG TAC TTG AGT GCC TTG CTG ATG GCT GCT CCT 575 Gly Ser Ile Ser Ser Gin Tyr Leu Ser Ala Leu Leu Met Ala Ala Pro 175 180 185 190
TTG GCT CTT GGG GAT GTG GAG ATT GAA ATC ATT GAT AAA TTA ATC TCC 623 Leu Ala Leu Gly Asp Val Glu Ile Glu Ile Ile Asp Lys Leu Ile Ser 195 200 205TTG GCT CTT GGG GAT GTG GAG ATT GAA ATC ATT GAT AAA TTA ATC TCC 623 Leu Ala Leu Gly Asp Val Glu Ile Glu Ile Asp Lys Leu Ile Ser 195 200 205
ATT CCG TAC GTC GAA ATG ACA TTG AGA TTG ATG GAG CGT TTT GGT GTG 671 Ile Pro Tyr Val Glu Met Thr Leu Arg Leu Met Glu Arg Phe Gly Val 210 215 220ATT CCG TAC GTC GAA ATG ACA TTG AGA TTG ATG GAG CGT TTT GGT GTG 671 Ile Pro Tyr Val Glu Met Thr Leu Arg Leu Met Glu Arg Phe Gly Val 210 215 220
AAA GCA GAG CAT TCT GAT AGC TGG GAC AGA TTC TAC ATT AAG GGA GGT 719 Lys Ala Glu His Ser Asp Ser Trp Asp Arg Phe Tyr Ile Lys Gly Gly 225 230 235AAA GCA GAG CAT TCT GAT AGC TGG GAC AGA TTC TAC ATT AAG GGA GGT 719 Lys Ala Glu His Ser Asp Ser Trp Asp Arg Phe Tyr Ile Lys Gly Gly 225 230 235
CAA AAA TAC AAG TCC CCT AAA AAT GCC TAT GTT GAA GGT GAT GCC TCA 767 Gin Lys Tyr Lys Ser Pro Lys Asn Ala Tyr Val Glu Gly Asp Ala Ser 240 245 250 SEQ ID NO : 5 ( suite )CAA AAA TAC AAG TCC CCT AAA AAT GCC TAT GTT GAA GGT GAT GCC TCA 767 Gin Lys Tyr Lys Ser Pro Lys Asn Ala Tyr Val Glu Gly Asp Ala Ser 240 245 250 SEQ ID NO: 5 (continued)
AGC GCA AGC TAT TTC TTG GCT GGT GCT GCA ATT ACT GGA GGG ACT GTG 815 Ser Ala Ser Tyr Phe Leu Ala Gly Ala Ala Ile Thr Gly Gly Thr Val 255 260 265 270AGC GCA AGC TAT TTC TTG GCT GGT GCT GCA ATT ACT GGA GGG ACT GTG 815 Ser Ala Ser Tyr Phe Leu Ala Gly Ala Ala Ile Thr Gly Gly Thr Val 255 260 265 270
ACT GTG GAA GGT TGT GGC ACC ACC AGT TTG CAG GGT GAT GTG AAG TTT 863 Thr Val Glu Gly Cys Gly Thr Thr Ser Leu Gin Gly Asp Val Lys Phe 270 275 280 285ACT GTG GAA GGT TGT GGC ACC ACC AGT TTG CAG GGT GAT GTG AAG TTT 863 Thr Val Glu Gly Cys Gly Thr Thr Ser Leu Gin Gly Asp Val Lys Phe 270 275 280 285
GCT GAG GTA CTG GAG ATG ATG GGA GCG AAG GTT ACA TGG ACC GAG ACT 911 Ala Glu Val Leu Glu Met Met Gly Ala Lys Val Thr Trp Thr Glu Thr 290 295 300GCT GAG GTA CTG GAG ATG ATG GGA GCG AAG GTT ACA TGG ACC GAG ACT 911 Ala Glu Val Leu Glu Met Met Gly Ala Lys Val Thr Trp Thr Glu Thr 290 295 300
AGC GTA ACT GTT ACT GGC CCA CCG CGG GAG CCA TTT GGG AGG AAA CAC 959 Ser Val Thr Val Thr Gly Pro Pro Arg Glu Pro Phe Gly Arg Lys His 305 310 315AGC GTA ACT GTT ACT GGC CCA CCG CGG GAG CCA TTT GGG AGG AAA CAC 959 Ser Val Thr Val Thr Gly Pro Pro Arg Glu Pro Phe Gly Arg Lys His 305 310 315
CTC AAG GCG ATT GAT GTC AAC ATG AAC AAG ATG CCT GAT GTC GCC ATG 1007 Leu Lys Ala Ile Asp Val Asn Met Asn Lys Met Pro Asp Val Ala Met 320 325 330CTC AAG GCG ATT GAT GTC AAC ATG AAC AAG ATG CCT GAT GTC GCC ATG 1007 Leu Lys Ala Ile Asp Val Asn Met Asn Lys Met Pro Asp Val Ala Met 320 325 330
ACT CTT GCT GTG GTT GCC CTC TTT GCC GAT GGC CCG ACA GCC ATC AGA 1055 Thr Leu Ala Val Val Ala Leu Phe Ala ASD Gly Pro Thr Ala Ile Arg 335 340 345 350ACT CTT GCT GTG GTT GCC CTC TTT GCC GAT GGC CCG ACA GCC ATC AGA 1055 Thr Leu Ala Val Val Ala Leu Phe Ala ASD Gly Pro Thr Ala Ile Arg 335 340 345 350
GAC GTG GCT TCC TGG AGA GTA AAG GAG ACC GAG AGG ATG GTT GCG ATC 1103 Asp Val Ala Ser Trp Arg Val Lys Glu Thr Glu Arg Met Val Ala Ile 355 360 365GAC GTG GCT TCC TGG AGA GTA AAG GAG ACC GAG AGG ATG GTT GCG ATC 1103 Asp Val Ala Ser Trp Arg Val Lys Glu Thr Glu Arg Met Val Ala Ile 355 360 365
CGG ACG GAG CTA ACC AAG CTG GGA GCA TCT GTT GAG GAA GGG CCG GAC 1151 Arg Thr Glu Leu Thr Lys Leu Gly Ala Ser Val Glu Glu Gly Pro Asp 370 375 380CGG ACG GAG CTA ACC AAG CTG GGA GCA TCT GTT GAG GAA GGG CCG GAC 1151 Arg Thr Glu Leu Thr Lys Leu Gly Ala Ser Val Glu Glu Gly Pro Asp 370 375 380
TAC TGC ATC ATC ACG CCG CCG GAG AAG CTG AAC GTG ACG GCG ATC GAC 1199 Tyr Cys Ile Ile Thr Pro Pro Glu Lys Leu Asn Val Thr Ala Ile Asp 385 390 395TAC TGC ATC ATC ACG CCG CCG GAG AAG CTG AAC GTG ACG GCG ATC GAC 1199 Tyr Cys Ile Ile Thr Pro Pro Glu Lys Leu Asn Val Thr Ala Ile Asp 385 390 395
ACG TAC GAC GAC CAC AGG ATG GCG ATG GCC TTC TCC CTT GCC GCC TGT 1247 Thr Tyr Asp Asp His Arg Met Ala Met Ala Phe Ser Leu Ala Ala Cys 400 405 410ACG TAC GAC GAC CAC AGG ATG GCG ATG GCC TTC TCC CTT GCC GCC TGT 1247 Thr Tyr Asp Asp His Arg Met Ala Met Ala Phe Ser Leu Ala Ala Cys 400 405 410
GCC GAG GTC CCC GTC ACC ATC CGG GAC CCT GGG TGC ACC CGG AAG ACC 1295 Ala Glu Val Pro Val Thr Ile Arg Asp Pro Gly Cys Thr Arg Lys Thr 415 420 425 430GCC GAG GTC CCC GTC ACC ATC CGG GAC CCT GGG TGC ACC CGG AAG ACC 1295 Ala Glu Val Pro Val Thr Ile Arg Asp Pro Gly Cys Thr Arg Lys Thr 415 420 425 430
TTC CCC GAC TAC TTC GAT GTG CTG AGC ACT TTC GTC AAG AAT 1337TTC CCC GAC TAC TTC GAT GTG CTG AGC ACT TTC GTC AAG AAT 1337
Phe Pro Asp Tyr Phe Asp Val Leu Ser Thr Phe Val Lys Asn 435 440Phe Pro Asp Tyr Phe Asp Val Leu Ser Thr Phe Val Lys Asn 435 440
TAA 1340 SEQ ID NO : 6 :TAA 1340 SEQ ID NO: 6:
Ala Gly Ala Glu Glu Ile Val Leu Gin Pro Ile Lys Glu Ile Ser Gly 1 5 10 15Ala Gly Ala Glu Glu Ile Val Leu Gin Pro Ile Lys Glu Ile Ser Gly 1 5 10 15
Thr Val Lys Leu Pro Gly Ser Lys Ser Leu Ser Asn Arg Ile Leu Leu 20 25 30Thr Val Lys Leu Pro Gly Ser Lys Ser Leu Ser Asn Arg Ile Leu Leu 20 25 30
Leu Ala Ala Leu Ser Glu Gly Thr Thr Val Val Asp Asn Leu Leu Asn 35 40 45Leu Ala Ala Leu Ser Glu Gly Thr Thr Val Val Asp Asn Leu Leu Asn 35 40 45
Ser Glu Asp Val His Tyr Met Leu Gly Ala Leu Arg Thr Leu Gly Leu 50 55 60Ser Glu Asp Val His Tyr Met Leu Gly Ala Leu Arg Thr Leu Gly Leu 50 55 60
Ser Val Glu Ala Âsp Lys Ala Ala Lys Arg Ala Val Val Val Gly Cys 65 70 75 80Ser Val Glu Ala Âsp Lys Ala Ala Lys Arg Ala Val Val Val Gly Cys 65 70 75 80
Gly Gly Lys Phe Pro Val Glu Asp Ala Lys Glu Glu Val Gin Leu Phe 85 90 95Gly Gly Lys Phe Pro Val Glu Asp Ala Lys Glu Glu Val Gin Leu Phe 85 90 95
Leu Gly Asn Ala Gly Ile Ala Met Arg Ser Leu Thr Ala Ala Val Thr 100 105 110Leu Gly Asn Ala Gly Ile Ala Met Arg Ser Leu Thr Ala Ala Val Thr 100 105 110
Ala Ala Gly Gly Asn Ala Thr Tyr Val Leu Asp Gly Val Pro Arg Met 115 120 125Ala Ala Gly Gly Asn Ala Thr Tyr Val Leu Asp Gly Val Pro Arg Met 115 120 125
Arg Glu Arg Pro Ile Gly Asp Leu Val Val Gly Leu Lys Gin Leu Gly 130 135 140Arg Glu Arg Pro Ile Gly Asp Leu Val Val Gly Leu Lys Gin Leu Gly 130 135 140
Ala Asp Val Asp Cys Phe Leu Gly Thr Asp Cys Pro Pro Val Arg Val 145 150 155 160Ala Asp Val Asp Cys Phe Leu Gly Thr Asp Cys Pro Pro Val Arg Val 145 150 155 160
Asn Gly Ile Gly Gly Leu Pro Gly Gly Lys Val Lys Leu Ser Gly Ser 165 170 175Asn Gly Ile Gly Gly Leu Pro Gly Gly Lys Val Lys Leu Ser Gly Ser 165 170 175
Ile Ser Ser Gin Tyr Leu Ser Ala Leu Leu Met Ala Ala Pro Leu Ala 180 185 190Ile Ser Ser Gin Tyr Leu Ser Ala Leu Leu Met Ala Ala Pro Leu Ala 180 185 190
Leu Gly ASD Val Glu Ile Glu Ile Ile Asp Lys Leu Ile Ser Ile Pro 195 200 205Leu Gly ASD Val Glu Ile Glu Ile Asp Island Lys Leu Ile Ser Ile Pro 195 200 205
Tyr Val Glu Met Thr Leu Arg Leu Met Glu Arg Phe Gly Val Lys Ala 210 215 220Tyr Val Glu Met Thr Leu Arg Leu Met Glu Arg Phe Gly Val Lys Ala 210 215 220
Glu His Ser Asp Ser Trp Asp Arg Phe Tyr Ile Lys Gly Gly Gin Lys 225 230 235 240Glu His Ser Asp Ser Trp Asp Arg Phe Tyr Ile Lys Gly Gly Gin Lys 225 230 235 240
Tyr Lys Ser Pro Lys Asn Ala Tyr Val Glu Gly Asp Ala Ser Ser Ala 245 250 255Tyr Lys Ser Pro Lys Asn Ala Tyr Val Glu Gly Asp Ala Ser Ser Ala 245 250 255
Ser Tyr Phe Leu Ala Gly Ala Ala Ile Thr Gly Gly Thr Val Thr Val 260 265 270Ser Tyr Phe Leu Ala Gly Ala Ala Ile Thr Gly Gly Thr Val Thr Val 260 265 270
Glu Gly Cys Gly Thr Thr Ser Leu Gin Gly Asp Val Lys Phe Ala Glu 275 280 285Glu Gly Cys Gly Thr Thr Ser Leu Gin Gly Asp Val Lys Phe Ala Glu 275 280 285
Val Leu Glu Met Met Gly Ala Lys Val Thr Trp Thr Glu Thr Ser Val 290 295 300Val Leu Glu Met Met Gly Ala Lys Val Thr Trp Thr Glu Thr Ser Val 290 295 300
Thr Val Thr Gly Pro Pro Arg Glu Pro Phe Gly Arg Lys His Leu Lys 305 310 315 320Thr Val Thr Gly Pro Pro Arg Glu Pro Phe Gly Arg Lys His Leu Lys 305 310 315 320
Ala Ile Asp Val Asn Met Asn Lys Met Pro Asp Val Ala Met Thr Leu 325 330 335Ala Ile Asp Val Asn Met Asn Lys Met Pro Asp Val Ala Met Thr Leu 325 330 335
Ala Val Val Ala Leu Phe Ala Asp Gly Pro Thr Ala Ile Arg Asp Val 340 345 350 SEQ ID NO : 6 ( sui te )Ala Val Val Ala Leu Phe Ala Asp Gly Pro Thr Ala Ile Arg Asp Val 340 345 350 SEQ ID NO: 6 (next)
Ala Ser Tro Arg Val Lys Glu Thr Glu Arg Met Val Ala Ile Arg Thr 355 360 365Ala Ser Tro Arg Val Lys Glu Thr Glu Arg Met Val Ala Ile Arg Thr 355 360 365
Glu Leu Thr Lys Leu Gly Ala Ser Val Glu Glu Gly Pro Asp Tyr Cys 370 375 380Glu Leu Thr Lys Leu Gly Ala Ser Val Glu Glu Gly Pro Asp Tyr Cys 370 375 380
Ile Ile Thr Pro Pro Glu Lys Leu Asn Val Thr Ala Ile Asp Thr Tyr 385 390 395 400Ile Ile Thr Pro Pro Glu Lys Leu Asn Val Thr Ala Ile Asp Thr Tyr 385 390 395 400
Asp Asp His Arg Met Ala Met Ala Phe Ser Leu Ala Ala Cys Ala Glu 405 410 415Asp Asp His Arg Met Ala Met Ala Phe Ser Leu Ala Ala Cys Ala Glu 405 410 415
Val Pro Val Thr Ile Arg ASD Pro Gly Cys Thr Arg Lys Thr Phe Pro 420 425 430Val Pro Val Thr Ile Arg ASD Pro Gly Cys Thr Arg Lys Thr Phe Pro 420 425 430
Asp Tyr Phe Asp Val Leu Ser Thr Phe Val Lys Asn 435 440 Asp Tyr Phe Asp Val Leu Ser Thr Phe Val Lys Asn 435 440

Claims

Revendications claims
1. Gène chimère comprenant au moins deux gènes chimères élémentaires comprenant chacun des éléments de régulation nécessaires à sa transcription dans les plantes et une séquence codante codant pour une enzyme conférant aux plantes la tolérance à un herbicide, caractérisé en ce que l'une des séquences codantes code pour l'hydroxy-phényl pyruvate dioxygénase (HPPD).1. Chimeric gene comprising at least two elementary chimeric genes each comprising regulatory elements necessary for its transcription in plants and a coding sequence coding for an enzyme conferring on plants tolerance to a herbicide, characterized in that one of the sequences coding codes for hydroxyphenyl pyruvate dioxygenase (HPPD).
2. Gène chimère selon la revendication 1 , caractérisé en ce qu'il comprend en outre un troisième gène chimère conten.ant une séquence codante pour une enzyme conférant aux plantes une tolérance herbicide.2. chimeric gene according to claim 1, characterized in that it further comprises a third chimeric gene containing a coding sequence for an enzyme conferring on plants a herbicidal tolerance.
3. Gène chimère selon l'une des revendications 1 et 2, caractérisé en ce que la seconde séquence codante est issu d'un gène de nitrilase Klebsielia sp. conférant une tolérance à un herbicide de la famille des dihalogenohydroxybenzonitriles.3. Chimera gene according to one of claims 1 and 2, characterized in that the second coding sequence is derived from a gene for nitrilase Klebsielia sp. conferring tolerance to a herbicide from the dihalogenohydroxybenzonitriles family.
4. Gène chimère selon la revendication 3, caractérisé en ce que l'herbicide est le bromoxynil.4. Chimera gene according to claim 3, characterized in that the herbicide is bromoxynil.
5. Gène chimère selon la revendication 3, caractérisé en ce que l'herbicide est l'ioxynil.5. Chimera gene according to claim 3, characterized in that the herbicide is ioxynil.
6 . Gène chimère selon l'une des revendications 2 à 5, caractérisé en ce que la seconde séquence codante code pour une tolérance au glyphosate.6. Chimeric gene according to one of claims 2 to 5, characterized in that the second coding sequence codes for tolerance to glyphosate.
7. Gène chimère selon l'une des revendications 2 à 6, caractérisé en ce que la seconde séquence codante code pour une EPSPS conférant une tolérance à un herbicide inhibiteur de l'EPSPS.7. chimeric gene according to one of claims 2 to 6, characterized in that the second coding sequence codes for an EPSPS conferring tolerance to a herbicide inhibitor of EPSPS.
8. Gène chimère selon la revendication 7, caractérisé en ce que la seconde séquence codante code pour une EPSPS conférant une tolérance au glyphosate.8. Chimeric gene according to claim 7, characterized in that the second coding sequence codes for an EPSPS conferring tolerance to glyphosate.
9. Gène chimère selon la revendication 6, caractérisé en ce que la seconde séquence codante code pour la glyphosate oxydoréductase, enzyme de détoxification du glyphosate. 9. chimeric gene according to claim 6, characterized in that the second coding sequence codes for glyphosate oxidoreductase, glyphosate detoxifying enzyme.
10. Gène chimère selon l'une des revendications 1 à 9, caractérisé en ce que la séquence codante pour l'HPPD est issue de Pseudomonas sp.10. Chimeric gene according to one of claims 1 to 9, characterized in that the coding sequence for HPPD comes from Pseudomonas sp.
11. Gène chimère selon la revendication 10, caractérisé en ce que la séquence codante pour l'HPPD est issue de Pseudomonas fluorescens.11. chimeric gene according to claim 10, characterized in that the coding sequence for HPPD is derived from Pseudomonas fluorescens.
12. Gène chimère selon l'une des revendications 1 à 9, caractérisé en ce que la séquence codante pour l'HPPD est d'origine végétale.12. Chimeric gene according to one of claims 1 to 9, characterized in that the coding sequence for HPPD is of plant origin.
13. Gène chimère selon la revendication 12, caractérisé en ce que la séquence codante pour l'HPPD est issue d'Arabidopsis thaliana.13. Chimeric gene according to claim 12, characterized in that the coding sequence for the HPPD comes from Arabidopsis thaliana.
14. Gène chimère selon la revendication 11, caractérisé en ce que la séquence codante pour l'HPPD est issue de Daucus carota.14. Chimeric gene according to claim 11, characterized in that the coding sequence for the HPPD comes from Daucus carota.
15. Vecteur caractérisé en ce qu'il comprend un gène chimère selon l'une des revendications 1 à 14.15. Vector characterized in that it comprises a chimeric gene according to one of claims 1 to 14.
16. Vecteur selon la revendication 15, caractérisé en ce qu'il est constitué par un plasmide.16. Vector according to claim 15, characterized in that it consists of a plasmid.
17. Cellule végétale, caractérisée en ce qu'elle contient au moins deux gènes contenant chacun une séquence codante codant pour une enzyme conférant aux plantes la tolérance à un herbicide, dont l'un est un inhibiteur de l'hydroxy-phényl pyruvate dioxygénase (HPPD).17. Plant cell, characterized in that it contains at least two genes each containing a coding sequence coding for an enzyme conferring on plants tolerance to a herbicide, one of which is an inhibitor of hydroxy-phenyl pyruvate dioxygenase ( HPPD).
18. Cellule végétale selon la revendication 17, caractérisée en ce qu'elle contient trois gènes chimères élémentaires contenant chacun des éléments de régulation et une séquence codante codant pour une enzyme conférant aux plantes la tolérance à un herbicide.18. Plant cell according to claim 17, characterized in that it contains three elementary chimeric genes each containing regulatory elements and a coding sequence coding for an enzyme conferring on plants tolerance to a herbicide.
19. Cellule végétale selon l'une des revendications 17 et 18, caractérisée en ce qu'elle contient au moins un gène chimère, selon l'une des revendications 1 à 14.19. Plant cell according to one of claims 17 and 18, characterized in that it contains at least one chimeric gene, according to one of claims 1 to 14.
20. Plante, caractérisée en ce qu'elle contient une cellule végétale selon l'une des revendications 17 à 19. 20. Plant, characterized in that it contains a plant cell according to one of claims 17 to 19.
21. Procédé de transformation des plantes pour les rendre tolérantes à au moins d eux herbicides, caractérisé en ce qu'on insère dans une cellule végétale un gène selon les revendications 1 à 14 et que les cellules transformées sont soumises à une régénération.21. Process for transforming plants to make them tolerant to at least one herbicide, characterized in that a gene according to claims 1 to 14 is inserted into a plant cell and that the transformed cells are subjected to regeneration.
22. Procédé d'obtention de plantes à tolérance herbicide multiple par trangénese des plantes, caractérisé en ce que:22. Method for obtaining plants with multiple herbicide tolerance by plant transgenesis, characterized in that:
- dans une première étape, on insère dans plusieurs cellules respectivement un des gènes élémentaires contenant chacun des éléments de régulation nécessaires à sa transcription dans les plantes et une séquence codante codant pour une enzyme conférant aux plantes la tolérance à un herbicide, et que- in a first step, one inserts into several cells respectively one of the elementary genes each containing regulatory elements necessary for its transcription in plants and a coding sequence coding for an enzyme conferring on plants tolerance to a herbicide, and that
- ensuite les plantes sont croisées pour obtenir des plantes à tolérance multiple.- then the plants are crossed to obtain plants with multiple tolerance.
23. Procédé de traitement herbicide de plantes selon la revendication 20, caractérisé en ce qu'on applique au moins deux herbicides.23. A method of herbicide treatment of plants according to claim 20, characterized in that at least two herbicides are applied.
24. Procédé selon la revendication 23, caractérisé en ce qu'on applique trois herbicides.24. The method of claim 23, characterized in that three herbicides are applied.
25. Procédé selon l'une des revendications 21 à 24, caractérisé en ce que l'un des herbicides est un inhibiteur de l'HPPD.25. Method according to one of claims 21 to 24, characterized in that one of the herbicides is an HPPD inhibitor.
26. Procédé selon l'une des revendications 21 à 25, caractérisé en ce que les deux herbicides sont appliqués simultanément.26. Method according to one of claims 21 to 25, characterized in that the two herbicides are applied simultaneously.
27. Procédé selon la revendication 26, caractérisé en ce que les deux herbicides sont appliqués sous la forme d'une seule composition prête à l'emploi.27. The method of claim 26, characterized in that the two herbicides are applied in the form of a single composition ready for use.
28. Procédé selon la revendication 25, caractérisé en ce que les deux herbicides sont appliqués sous la forme d'un mélange extemporané.28. The method of claim 25, characterized in that the two herbicides are applied in the form of an extemporaneous mixture.
29. Procédé l'une des revendications 22 à 24, caractérisé en ce que les deux herbicides sont appliqués successivement.29. Method one of claims 22 to 24, characterized in that the two herbicides are applied successively.
30. Procédé selon l'une des revendications 22 à 29, caractérisé en ce que l'herbicide inhibiteur de l'HPPD est l'isoxaflutole.30. Method according to one of claims 22 to 29, characterized in that the herbicide inhibitor of HPPD is isoxaflutole.
31. Procédé selon l'une des revendications 22 à 29, caractérisé en ce que l'herbicide inhibiteur de l'HPPD est la sulcotrione.31. Method according to one of claims 22 to 29, characterized in that the herbicide inhibitor of HPPD is sulcotrione.
FEUIU.E DE REMPLACEMENT (REGLE 26) REPLACEMENT FEUIU.E (RULE 26)
32. Procédé selon l'une des revendications 22 à 31, caractérisé en ce que l'herbicide appartient à la famille des dihydrogènohydroxybenzonitriles.32. Method according to one of claims 22 to 31, characterized in that the herbicide belongs to the family of dihydrogènohydroxybenzonitriles.
33. Procédé selon la revendication 32, caractérisé en ce que l'herbicide est choisi dans le groupe comprenant le bromoxynil et l'ioxynil33. Process according to claim 32, characterized in that the herbicide is chosen from the group comprising bromoxynil and ioxynil
34. Procédé selon l'une des revendications 22 à 33, caractérisé en ce que l'herbicide inhibiteur de l'EPSPS est le glyphosate ou le sulfosate. 34. Method according to one of claims 22 to 33, characterized in that the EPSPS inhibitor herbicide is glyphosate or sulfosate.
EP97932879A 1996-07-16 1997-07-10 Chimera gene with several herbicide resistant genes, plant cell and plant resistant to several herbicides Withdrawn EP0937154A2 (en)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
FR9609137 1996-07-16
FR9609137A FR2751347B1 (en) 1996-07-16 1996-07-16 CHIMERIC GENE WITH MULTIPLE HERBICIDE TOLERANCE GENES, PLANT CELL AND PLANT TOLERANT WITH MULTIPLE HERBICIDES
PCT/FR1997/001256 WO1998002562A2 (en) 1996-07-16 1997-07-10 Chimera gene with several herbicide resistant genes, plant cell and plant resistant to several herbicides

Publications (1)

Publication Number Publication Date
EP0937154A2 true EP0937154A2 (en) 1999-08-25

Family

ID=9494283

Family Applications (1)

Application Number Title Priority Date Filing Date
EP97932879A Withdrawn EP0937154A2 (en) 1996-07-16 1997-07-10 Chimera gene with several herbicide resistant genes, plant cell and plant resistant to several herbicides

Country Status (20)

Country Link
US (5) US7250561B1 (en)
EP (1) EP0937154A2 (en)
JP (1) JP2000517166A (en)
KR (1) KR20000023830A (en)
CN (1) CN1154741C (en)
AR (1) AR007884A1 (en)
AU (1) AU734878B2 (en)
BR (2) BR9710340B1 (en)
CA (1) CA2261094C (en)
CO (1) CO4770898A1 (en)
CU (1) CU22809A3 (en)
CZ (1) CZ11399A3 (en)
EA (2) EA002980B1 (en)
FR (1) FR2751347B1 (en)
HU (1) HU223788B1 (en)
NZ (1) NZ334188A (en)
PL (1) PL190393B1 (en)
TR (1) TR199900117T2 (en)
WO (1) WO1998002562A2 (en)
ZA (1) ZA976296B (en)

Families Citing this family (113)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
FR2736926B1 (en) * 1995-07-19 1997-08-22 Rhone Poulenc Agrochimie 5-ENOL PYRUVYLSHIKIMATE-3-PHOSPHATE SYNTHASE MUTEE, CODING GENE FOR THIS PROTEIN AND PROCESSED PLANTS CONTAINING THIS GENE
CA2269666A1 (en) * 1996-11-07 1998-05-14 Zeneca Limited Herbicide resistant plants
US7235716B2 (en) 1997-06-03 2007-06-26 Chromatin, Inc. Plant centromere compositions
US7119250B2 (en) 1997-06-03 2006-10-10 The University Of Chicago Plant centromere compositions
US7193128B2 (en) 1997-06-03 2007-03-20 Chromatin, Inc. Methods for generating or increasing revenues from crops
US6900012B1 (en) 1997-06-03 2005-05-31 The University Of Chicago Plant artificial chromosome compositions and methods
US7227057B2 (en) 1997-06-03 2007-06-05 Chromatin, Inc. Plant centromere compositions
WO1999005265A2 (en) * 1997-07-23 1999-02-04 Sanford Scientific, Inc. Improved plastid transformation of higher plants and production of transgenic plants with herbicide resistance
US7161064B2 (en) 1997-08-12 2007-01-09 North Carolina State University Method for producing stably transformed duckweed using microprojectile bombardment
US6069115A (en) * 1997-11-12 2000-05-30 Rhone-Poulenc Agrochimie Method of controlling weeds in transgenic crops
FR2771104B1 (en) * 1997-11-17 2000-12-08 Rhone Poulenc Agrochimie CHIMERIC GENE HAVING A DEPENDENT LIGHT PROMOTER GIVING TOLERANCE TO HPPD INHIBITORS
JP4788011B2 (en) * 1998-04-30 2011-10-05 住友化学株式会社 Method for imparting resistance to weed control agents
BR9912745A (en) 1998-08-04 2001-11-06 Cargill Inc Promoters of plant fatty acid denaturase
DE19836673A1 (en) 1998-08-13 2000-02-17 Hoechst Schering Agrevo Gmbh Use of a synergistic herbicidal combination including a glufosinate- or glyphosate-type or imidazolinone herbicide to control weeds in sugar beet
FR2785148B1 (en) * 1998-11-02 2000-12-15 Rhone Poulenc Agrochimie NEW HERBICIDE COMPOSITIONS BASED ON GLYPHOSATE AND ISOXAZOLES
JP4570706B2 (en) * 1999-03-09 2010-10-27 バイエルクロップサイエンス株式会社 How to control paddy weeds
US7989202B1 (en) 1999-03-18 2011-08-02 The University Of Chicago Plant centromere compositions
JP4821038B2 (en) * 1999-10-29 2011-11-24 住友化学株式会社 Herbicide-tolerant plants
EP1315801A1 (en) * 2000-09-08 2003-06-04 Bayer CropScience S.A. Hydroxy-phenyl pyruvate dioxygenase fused with a signal peptide, dna sequence and use for obtaining plants containing herbicide-tolerant plants
EP1362113B1 (en) 2001-02-22 2011-01-12 Biogemma Constitutive promoter from arabidopsis
TR201816453T4 (en) 2001-08-09 2018-11-21 Northwest Plant Breeding Company Wheat plants with increased resistance to imidazolinone herbicides.
US8729341B2 (en) 2004-02-23 2014-05-20 University Of Chicago Plants modified with mini-chromosomes
MXPA06011412A (en) 2004-03-30 2007-01-23 Monsanto Technology Llc Methods for controlling plant pathogens using n-phosphonomethylglycine.
EP2308977B2 (en) 2004-04-30 2017-04-26 Dow AgroSciences LLC Novel herbicide resistance gene
EP1929019A2 (en) 2005-09-08 2008-06-11 Chromatin, Inc. Plants modified with mini-chromosomes
BRPI0618025B1 (en) * 2005-10-28 2016-12-27 Dow Agrosciences Llc method for controlling weeds in an area, isolated polynucleotide, plant cell and herbicide resistant plant
ES2531882T3 (en) * 2006-01-12 2015-03-20 Cibus Europe B.V. EPSPS mutants
PE20080886A1 (en) * 2006-10-03 2008-08-21 Monsanto Technology Llc METHOD FOR THE PRODUCTION OF HYBRID CORN SEED AND COMPOSITIONS PRODUCED FROM THE SAME
EP2094831B1 (en) * 2006-12-07 2015-09-16 Dow AgroSciences LLC Novel selectable marker genes
WO2008112972A2 (en) 2007-03-15 2008-09-18 Chromatin, Inc. Centromere sequences and minichromosomes
CN101998988A (en) * 2007-05-30 2011-03-30 先正达参股股份有限公司 Cytochrome P450 genes conferring herbicide resistance
US8097712B2 (en) 2007-11-07 2012-01-17 Beelogics Inc. Compositions for conferring tolerance to viral disease in social insects, and the use thereof
AR071237A1 (en) * 2008-05-02 2010-06-02 Pioneer Hi Bred Int CHEMICAL SELECTION OF GLIFOSATO RESISTANT GAMETS OF FIELD PLANTS
EP2299804A4 (en) * 2008-06-11 2011-05-18 Dow Agrosciences Llc Constructs for expressing herbicide tolerance genes, related plants, and related trait combinations
GB0816880D0 (en) * 2008-09-15 2008-10-22 Syngenta Ltd Improvements in or relating to organic compounds
WO2010135324A1 (en) * 2009-05-18 2010-11-25 Monsanto Technology Llc Use of glyphosate for disease suppression and yield enhancement in soybean
CA2767724A1 (en) 2009-07-23 2011-01-27 Chromatin, Inc. Sorghum centromere sequences and minichromosomes
US8962584B2 (en) 2009-10-14 2015-02-24 Yissum Research Development Company Of The Hebrew University Of Jerusalem, Ltd. Compositions for controlling Varroa mites in bees
CA2781598C (en) 2009-11-23 2020-06-02 Bayer Cropscience N.V. Herbicide tolerant soybean plants and methods for identifying same
KR101951958B1 (en) 2009-11-23 2019-02-25 바이엘 크롭사이언스 엔.브이. Elite event ee-gm3 and methods and kits for identifying such event in biological samples
US9057072B2 (en) 2009-11-24 2015-06-16 Katholieke Universiteit Leuven, K.U. Leuven R&D Banana promoters
BR112012015690A2 (en) * 2009-12-23 2015-08-25 Bayer Intelectual Property Gmbh Herbicide tolerant plants of hppd inhibitors.
BR112012015692A2 (en) * 2009-12-23 2015-08-25 Bayer Intelectual Property Gmbh Hppds inhibitor herbicide tolerant plants.
AU2010334808B2 (en) * 2009-12-23 2015-07-09 Bayer Intellectual Property Gmbh Plants tolerant to HPPD inhibitor herbicides
CN102869769A (en) * 2009-12-23 2013-01-09 拜尔知识产权有限公司 Plants tolerant to HPPD inhibitor herbicides
ES2659086T3 (en) * 2009-12-23 2018-03-13 Bayer Intellectual Property Gmbh HPPD-inhibiting herbicide-tolerant plants
JP2010070578A (en) * 2010-01-05 2010-04-02 Rhone Poulenc Yuka Agro Kk Method for controlling paddy field weed
WO2011112570A1 (en) 2010-03-08 2011-09-15 Monsanto Technology Llc Polynucleotide molecules for gene regulation in plants
WO2012021785A1 (en) 2010-08-13 2012-02-16 Pioneer Hi-Bred International, Inc. Compositions and methods comprising sequences having hydroxyphenylpyruvate dioxygenase (hppd) activity
US20140056908A1 (en) * 2010-10-08 2014-02-27 Fraunhofer Usa Inc. Closterovirus-based nucleic acid molecules and uses thereof
US9018451B2 (en) * 2010-12-03 2015-04-28 M S Technologies, LLC Optimized expression of glyphosate resistance encoding nucleic acid molecules in plant cells
BR122019027736B1 (en) * 2010-12-28 2021-04-27 Incorporated Administrative Agency, National Agriculture And Food Research Organization VECTOR AND PROCESS FOR THE PRODUCTION OF A PLANT
EP3434780A1 (en) 2011-09-13 2019-01-30 Monsanto Technology LLC Methods and compositions for weed control
WO2013040005A1 (en) 2011-09-13 2013-03-21 Monsanto Technology Llc Methods and compositions for weed control
BR112014005795A2 (en) 2011-09-13 2020-12-08 Monsanto Technology Llc methods of controlling plants, reducing the expression of a plant's hppd gene, preparing a nucleotide, and identifying polynucleotides useful in modulating the expression of the hppd gene in the external treatment of a plant, compositions and cassette of microbial expression
US10829828B2 (en) 2011-09-13 2020-11-10 Monsanto Technology Llc Methods and compositions for weed control
CN104160028A (en) 2011-09-13 2014-11-19 孟山都技术公司 Methods and compositions for weed control
US10760086B2 (en) 2011-09-13 2020-09-01 Monsanto Technology Llc Methods and compositions for weed control
BR112014005954A2 (en) 2011-09-13 2020-12-01 Monsanto Technology Llc agricultural chemical methods and compositions for plant control, method of reducing the expression of a dhps gene in a plant, microbial expression cassette, method for making a polynucleotide, method of identifying polynucleotides useful in modulating expression of the dhps gene
UA116089C2 (en) 2011-09-13 2018-02-12 Монсанто Текнолоджи Ллс Methods and compositios for weed control
US9840715B1 (en) 2011-09-13 2017-12-12 Monsanto Technology Llc Methods and compositions for delaying senescence and improving disease tolerance and yield in plants
EP2755467B1 (en) 2011-09-13 2017-07-19 Monsanto Technology LLC Methods and compositions for weed control
BR112014005951A2 (en) 2011-09-13 2017-04-04 Monsanto Technology Llc Weed control methods and compositions
US10806146B2 (en) 2011-09-13 2020-10-20 Monsanto Technology Llc Methods and compositions for weed control
US9920326B1 (en) 2011-09-14 2018-03-20 Monsanto Technology Llc Methods and compositions for increasing invertase activity in plants
WO2013109754A1 (en) 2012-01-17 2013-07-25 Pioneer Hi-Bred International, Inc. Plant transcription factors, promoters and uses thereof
MX344968B (en) * 2012-02-01 2017-01-12 Dow Agrosciences Llc Chloroplast transit peptide.
CN104703998B (en) 2012-03-13 2020-08-21 先锋国际良种公司 Genetic reduction of male fertility in plants
WO2013138309A1 (en) 2012-03-13 2013-09-19 Pioneer Hi-Bred International, Inc. Genetic reduction of male fertility in plants
MX360866B (en) 2012-05-24 2018-11-09 A B Seeds Ltd Compositions and methods for silencing gene expression.
WO2013188291A2 (en) 2012-06-15 2013-12-19 E. I. Du Pont De Nemours And Company Methods and compositions involving als variants with native substrate preference
US10041087B2 (en) 2012-06-19 2018-08-07 BASF Agro B.V. Plants having increased tolerance to herbicides
AR091489A1 (en) 2012-06-19 2015-02-11 Basf Se PLANTS THAT HAVE A GREATER TOLERANCE TO HERBICIDES INHIBITORS OF PROTOPORFIRINOGENO OXIDASA (PPO)
AR092564A1 (en) * 2012-09-14 2015-04-22 Bayer Cropscience Lp VARIANTS OF THE ENZYME 4-HYDROXYPHENYL PIRUVATO DEOXIGENASA (HPPD) AND METHODS OF USE TO CONFER TOLERANCE TO HERBICIDES IN PLANTS
CN104870647A (en) 2012-10-18 2015-08-26 孟山都技术公司 Methods and compositions for plant pest control
US10683505B2 (en) 2013-01-01 2020-06-16 Monsanto Technology Llc Methods of introducing dsRNA to plant seeds for modulating gene expression
UY35251A (en) 2013-01-01 2014-07-31 Seeds Ltd Ab ISOLATED DsRNA MOLECULES AND METHODS TO USE THEM TO SILENCE DIANA OF INTEREST MOLECULES
US10000767B2 (en) 2013-01-28 2018-06-19 Monsanto Technology Llc Methods and compositions for plant pest control
US9789511B2 (en) * 2013-03-12 2017-10-17 Nordson Corporation Jetting devices
WO2014164797A2 (en) 2013-03-13 2014-10-09 Monsanto Technology Llc Methods and compositions for weed control
UY35379A (en) 2013-03-13 2014-09-30 Monsanto Technology Llc ? METHODS AND COMPOSITIONS FOR WEED CONTROL ?.
US20140283211A1 (en) 2013-03-14 2014-09-18 Monsanto Technology Llc Methods and Compositions for Plant Pest Control
CA2903693A1 (en) 2013-03-14 2014-10-02 Pioneer Hi-Bred International, Inc. Maize stress related transcription factor 18 and uses thereof
US10568328B2 (en) 2013-03-15 2020-02-25 Monsanto Technology Llc Methods and compositions for weed control
CN105143454A (en) 2013-03-15 2015-12-09 先锋国际良种公司 Compositions and methods of use of ACC oxidase polynucleotides and polypeptides
MX359191B (en) 2013-07-19 2018-09-18 Monsanto Technology Llc Compositions and methods for controlling leptinotarsa.
US9850496B2 (en) 2013-07-19 2017-12-26 Monsanto Technology Llc Compositions and methods for controlling Leptinotarsa
UA120426C2 (en) 2013-11-04 2019-12-10 Монсанто Текнолоджі Елелсі Compositions and methods for controlling arthropod parasite and pest infestations
UA119253C2 (en) 2013-12-10 2019-05-27 Біолоджикс, Інк. Compositions and methods for virus control in varroa mite and bees
EP3116303B1 (en) 2014-01-15 2020-07-22 Monsanto Technology LLC Methods and compositions for weed control using epsps polynucleotides
PT3099172T (en) 2014-01-31 2021-11-08 Agbiome Inc Modified biological control agents and their uses
WO2015153339A2 (en) 2014-04-01 2015-10-08 Monsanto Technology Llc Compositions and methods for controlling insect pests
CA2953347A1 (en) 2014-06-23 2015-12-30 Monsanto Technology Llc Compositions and methods for regulating gene expression via rna interference
EP3161138A4 (en) 2014-06-25 2017-12-06 Monsanto Technology LLC Methods and compositions for delivering nucleic acids to plant cells and regulating gene expression
CN114009454A (en) 2014-07-29 2022-02-08 孟山都技术公司 Compositions and methods for controlling insect pests
PL3256589T3 (en) 2015-01-22 2022-02-21 Monsanto Technology Llc Compositions and methods for controlling leptinotarsa
AU2016270870A1 (en) 2015-06-02 2018-01-04 Monsanto Technology Llc Compositions and methods for delivery of a polynucleotide into a plant
AU2016270913A1 (en) 2015-06-03 2018-01-04 Monsanto Technology Llc Methods and compositions for introducing nucleic acids into plants
WO2016203377A1 (en) * 2015-06-17 2016-12-22 BASF Agro B.V. Plants having increased tolerance to herbicides
WO2017223501A1 (en) 2016-06-24 2017-12-28 AgBiome, Inc. Methods and compositions for spray drying gram-negative bacteria
WO2019023226A1 (en) 2017-07-26 2019-01-31 AgBiome, Inc. Compositions and methods for improving plant health and controlling plant disease and pests
AR113436A1 (en) 2017-10-09 2020-05-06 Agbiome Inc COMPOSITIONS AND METHODS TO IMPROVE PLANT HEALTH AND CONTROL PLANT DISEASES AND PESTS
CA3026528A1 (en) * 2017-12-15 2019-06-15 Monsanto Technology Llc Methods and compositions for ppo herbicide tolerance
WO2019241370A1 (en) 2018-06-12 2019-12-19 AgBiome, Inc. Compositions and methods for improving plant health and controlling plant disease
WO2020006555A1 (en) 2018-06-29 2020-01-02 AgBiome, Inc. Compositions comprising bacteria and methods for controlling plant pests and improving plant health
JP2022512655A (en) 2018-10-10 2022-02-07 アグバイオーム， インコーポレイテッド Compositions and Methods for Controlling Plant Pests and Improving Plant Health
JP2022509508A (en) 2018-10-30 2022-01-20 アグバイオーム， インコーポレイテッド Bacterial compositions and methods for controlling plant pests and improving plant health
WO2020232103A1 (en) 2019-05-13 2020-11-19 AgBiome, Inc. Dried biological control agents and their uses
WO2020247848A1 (en) 2019-06-07 2020-12-10 AgBiome, Inc. Compositions and methods for improving plant health and controlling plant disease
WO2022225925A1 (en) 2021-04-19 2022-10-27 AgBiome, Inc. Compositions and methods for improving plant health and controlling plant disease
US20240251801A1 (en) 2021-05-18 2024-08-01 AgBiome, Inc. Compositions and methods for improving plant health and controlling plant disease
WO2023211979A2 (en) 2022-04-26 2023-11-02 AgBiome, Inc. Use of bacterial strains to solubilize phosphorus for agriculture
WO2024026305A1 (en) 2022-07-26 2024-02-01 AgBiome, Inc. Compositions and methods based on pseudomonas chlororaphis for improving plant health and controlling plant disease

Family Cites Families (21)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4535060A (en) 1983-01-05 1985-08-13 Calgene, Inc. Inhibition resistant 5-enolpyruvyl-3-phosphoshikimate synthetase, production and use
CA1313830C (en) 1985-08-07 1993-02-23 Dilip Maganlal Shah Glyphosate-resistant plants
FR2591069B1 (en) * 1985-12-09 1988-03-18 Produits Ind Cie Fse HERBICIDE PRODUCTS BASED ON BROMOXYNIL ESTERS AND / OR IXXYNIL
US7705215B1 (en) * 1990-04-17 2010-04-27 Dekalb Genetics Corporation Methods and compositions for the production of stably transformed, fertile monocot plants and cells thereof
DE69034268D1 (en) * 1989-08-10 2011-03-03 Bayer Bioscience Nv Plants with modified flowers
AU655197B2 (en) * 1990-06-25 1994-12-08 Monsanto Technology Llc Glyphosate tolerant plants
WO1992004449A1 (en) * 1990-08-31 1992-03-19 Monsanto Company Glyphosate tolerant 5-enolpyruvylshikimate-3-phosphate synthases
FR2673643B1 (en) 1991-03-05 1993-05-21 Rhone Poulenc Agrochimie TRANSIT PEPTIDE FOR THE INSERTION OF A FOREIGN GENE INTO A PLANT GENE AND PLANTS TRANSFORMED USING THIS PEPTIDE.
FR2673642B1 (en) 1991-03-05 1994-08-12 Rhone Poulenc Agrochimie CHIMERIC GENE COMPRISING A PROMOTER CAPABLE OF GIVING INCREASED TOLERANCE TO GLYPHOSATE.
CA2105990A1 (en) * 1991-03-12 1992-09-13 Gunter Donn Maize resistant to aryloxyphenoxyalkanecarboxylic acid herbicides
GB9218664D0 (en) * 1992-09-03 1992-10-21 Rhone Poulenc Agrochimie Herbicidal compositions
CA2146113A1 (en) * 1992-10-15 1994-10-15 Adrianus Johannes Van Tunen Genetic moderation of restoration or plant phenotypes
DE4305696A1 (en) 1993-02-25 1994-09-01 Hoechst Ag Detection method for the identification of inhibitors
US5530187A (en) 1993-07-16 1996-06-25 The Salk Institute For Biological Studies Transgenic plants containing multiple disease resistance genes
US5491076A (en) * 1993-11-01 1996-02-13 The Texas A&M University System Expression of foreign genes using a replicating polyprotein producing virus vector
FR2712302B1 (en) 1993-11-10 1996-01-05 Rhone Poulenc Agrochimie Promoter elements of alpha tubulin chimeric genes.
GB9515941D0 (en) * 1995-08-03 1995-10-04 Zeneca Ltd DNA constructs
FR2734842B1 (en) * 1995-06-02 1998-02-27 Rhone Poulenc Agrochimie DNA SEQUENCE OF A HYDROXY-PHENYL PYRUVATE DIOXYGENASE GENE AND OBTAINING PLANTS CONTAINING A HYDROXY-PHENYL PYRUVATE DIOXYGENASE GENE, TOLERANT TO CERTAIN HERBICIDES
EP0938546A4 (en) * 1996-07-25 2003-07-30 Basf Ag Hppd gene and inhibitors
US6245968B1 (en) 1997-11-07 2001-06-12 Aventis Cropscience S.A. Mutated hydroxyphenylpyruvate dioxygenase, DNA sequence and isolation of plants which contain such a gene and which are tolerant to herbicides
US6069115A (en) * 1997-11-12 2000-05-30 Rhone-Poulenc Agrochimie Method of controlling weeds in transgenic crops

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO9802562A2 *

Also Published As

Publication number Publication date
NZ334188A (en) 2000-09-29
US20080028481A1 (en) 2008-01-31
HUP9903774A2 (en) 2000-03-28
JP2000517166A (en) 2000-12-26
HU223788B1 (en) 2005-01-28
FR2751347A1 (en) 1998-01-23
KR20000023830A (en) 2000-04-25
US20120005769A1 (en) 2012-01-05
CN1230996A (en) 1999-10-06
CZ11399A3 (en) 1999-05-12
TR199900117T2 (en) 1999-03-22
PL190393B1 (en) 2005-12-30
US20130157854A1 (en) 2013-06-20
US7935869B2 (en) 2011-05-03
EA002980B1 (en) 2002-12-26
US20100029481A1 (en) 2010-02-04
CA2261094C (en) 2005-06-28
US7250561B1 (en) 2007-07-31
EA200001219A1 (en) 2001-06-25
AU3625997A (en) 1998-02-09
CN1154741C (en) 2004-06-23
WO1998002562A2 (en) 1998-01-22
ZA976296B (en) 1998-08-19
CA2261094A1 (en) 1998-01-22
AR007884A1 (en) 1999-11-24
HUP9903774A3 (en) 2000-04-28
BR9710340A (en) 1999-08-17
WO1998002562A3 (en) 1998-04-30
EA003140B1 (en) 2003-02-27
AU734878B2 (en) 2001-06-21
FR2751347B1 (en) 2001-12-07
EA199900116A1 (en) 1999-08-26
BRPI9710340B8 (en) 2018-02-27
BR9710340B1 (en) 2009-12-01
CO4770898A1 (en) 1999-04-30
PL331165A1 (en) 1999-06-21
CU22809A3 (en) 2002-12-19

Similar Documents

Publication Publication Date Title
CA2261094C (en) Chimera gene with several herbicide resistant genes, plant cell and plant resistant to several herbicides
US10450549B2 (en) Aryloxyphenoxypropionate tolerance in turfrgass species and use of AAD1 as a selectable marker
EP0828837B1 (en) Chimeric gene comprising a dna sequence of a gene of hydroxy-phenyl pyruvate dioxygenase and production of plants containing a gene of hydroxy-phenyl pyruvate dioxygenase and which are tolerant to certain herbicides
EP0837944B1 (en) Mutated 5-enol pyruvylshikimate-3-phosphate synthase, gene coding for said protein and transformed plants containing said gene
JP2001503625A (en) Herbicide resistant plants
SK88599A3 (en) Glyphosate resistant transgenic plants
EP1042491B1 (en) Maize h3c4 promoter associated with first rice actin intron, chimeric gene containing it and transformed plant
FR2848571A1 (en) Cassette for expressing p-hydroxyphenyl pyruvate dioxygenase in plants, useful for imparting resistance to herbicides e.g. isoxazoles or triketones, includes the promoter from cassava vein mosaic virus
JP6486505B2 (en) Herbicide resistant proteins, their coding genes and uses
WO1999025842A1 (en) Chimera gene having a light dependent promoter providing tolerance to hppd inhibitors
EP4396357A1 (en) Methods and compositions for ppo herbicide tolerance
CA2422649A1 (en) Hydroxy-phenyl pyruvate dioxygenase fused with a signal peptide, dna sequence and use for obtaining plants containing herbicide-tolerant plants
FR2796954A1 (en) Fusion protein of hydroxyphenylpyruvate dioxygenase, useful for imparting herbicide resistance to plants, includes signal for non-cytoplasmic or non-plast localization
MXPA99000639A (en) Chemical gene for various genes of herbicide tolerance, cell vegetable plants tolerantesa various herbici

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 19990111

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): AT BE CH DE DK ES FI FR GB GR IE IT LI LU NL PT SE

RIN1 Information on inventor provided before grant (corrected)

Inventor name: SAILLAND, ALAIN

Inventor name: PELISSIER, BERNARD

Inventor name: DEROSE, RICHARD

Inventor name: PALLETT, KEN

RAP1 Party data changed (applicant data changed or rights of an application transferred)

Owner name: AVENTIS CROPSCIENCE S.A.

RAP1 Party data changed (applicant data changed or rights of an application transferred)

Owner name: BAYER CROPSCIENCE S.A.

17Q First examination report despatched

Effective date: 20030620

RIC1 Information provided on ipc code assigned before grant

Ipc: 7A 01H 5/00 B

Ipc: 7C 12N 5/10 B

Ipc: 7C 12N 15/53 B

Ipc: 7C 12N 15/82 A

GRAP Despatch of communication of intention to grant a patent

Free format text: ORIGINAL CODE: EPIDOSNIGR1

RIC1 Information provided on ipc code assigned before grant

Ipc: 7A 01H 5/00 B

Ipc: 7C 12N 5/10 B

Ipc: 7C 12N 15/53 B

Ipc: 7C 12N 15/82 A

GRAS Grant fee paid

Free format text: ORIGINAL CODE: EPIDOSNIGR3

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20040817