EP0910651A1 - Ozone-induced gene expression in plants - Google Patents

Abstract

The present invention relates to new DNA sequences, a method for producing new plants which contain a new DNA sequence, the coding sequence thereof being expressed after ozone induction. The invention also relates to said new plants and the use of DNA sequences to produce ozone-responsive gene expression in plants and plant cells. Moreover, it relates to a new promoter, the specificity thereof being increased by removal of the ozone response capacity thereof.

Description

 Ozone-induced gene expression in plants

The present invention relates to new DNA sequences, a method for producing new plants which contain a new DNA sequence, the coding sequence of which is expressed after ozone induction, these new plants and the use of the DNA sequences for generating ozone. responsive gene expression in plants and plant cells. On the other hand, the present invention relates to a new promoter, the specificity of which is increased by eliminating its ozone responsiveness.

The ozone concentrations in the lower troposphere over the continents of the Northern Hemisphere have increased continuously in the course of the last hundred years as a result of increased industrial activities (Volz and Kley (1988) Nature 332, 240-242). In the meantime the ozone values reach temporary peak concentrations of 100 nl / 1 to 200 nl / 1 in Europe and North America (Krupa e_t al. (1995) Environ. Pollut. 87, 119-126).

The phytotoxicity of the air pollutant ozone has been well studied and documented; e.g. in Heagle (1989) Annu. Rev. Phytopathol. 2J7, 397-423; Heath (1994) In: Alscher, Wellburn (ed) "Plant responses to the gaseous environment", pp. 121-145, Chapman & Hall, London. A reduced net photosynthesis and increased early senescence are generally the result of such an ozone load, which consequently results in lower plant growth and lower crop yields.

Although ozone penetrates the plant cell by diffusion through open stomata, the ozone concentration in the intercellular spaces of the leaf is almost zero, regardless of the ambient ozone concentration (Laisk e_t al. (1989) Plant Physiol. JK>, 1163-1167). It is currently believed that ozone reacts rapidly with components of the cell walls and the plasma lemma and into reactive oxygen species such as superoxide anions, hydroxyl radicals and hydrogen peroxide, which are used in ozone-treated plant material using electron is magnetic resonance spectroscopy were detected, converted (Mehlhorn et AJL. (1990) Physiology Plantarum _79th, 377-383). The so-called "oxidative burst", ie the rapid formation of a relatively high amount of reactive oxygen species, can lead to a dramatic disruption of normal cell function by changing the permeability of the plasma membrane, inactivating redox-sensitive proteins and increasing lipid peroxidation.

Recent studies have shown that ozone-treated plants undergo an increased biosynthesis of non-specific defense enzymes, the task of which is to protect living cells from damage by oxidative stress (Kangasjärvi et al. (1994) Plant, Cell and Environment 17, 783- 794). However, the signal transduction chain responsible for ozone-induced gene activation, which carries the corresponding information about the formation of apoplastic reactive oxygen species in the cell nucleus, is still not understood. Various factors are currently being investigated, such as an increase in the calcium concentration in the cytosol (Price et aJU _. (1994) The Plant Cell 6, 1301-1310), formation of salicylic acid (Kleßsig and Malamy (1994) Plant Mol. Biol. 26, 1439- 1458) and the Phytohoπnone Jaβmonic acid (Farmer

(1994) Plant Mol. Biol. 2_6, 1423-1437) and ethylene (Ecker

(1995) Science 268, 667-674) as possible signal compounds caused by oxidative stress, which are generally involved in plant-based defense reactions.

In studies with tobacco plants fumigated with ozone, it was possible to show that ozone causes an increased expression of various disease resistance genes, namely some PR (pathogenesis-related) proteins (Ernst et al. (1992) Plant Mol. Biol. 2JD, 673 -682; Ernst et al ^ (1996) J. Plant Physiol. 148, 215-221; Eckey-Kaltenbach et al ^. (1994) Plant Physiol. IM _* 67-74). These results indicate that an oxidative stress caused by ozone influences the expression and regulation of plant defense genes in a manner similar to that described for pathogen infestation. There is currently very limited information about αis_ regulatory elements and transcription factors that may be involved in controlling gene expression of non-specific defense genes in response to Different environmental influences are available (Lee et al. (1994) Eur. J. Biochem. 226, 109-114). However, previous results suggest that there are separate or at least partially overlapping signal transduction pathways in the case of the genes coding for the PR proteins (Somssich

(1994) In: Nover (ed) "Plant promoters and transcription factors", pp. 163-179, Springer-Verlag, Berlin; Dolferuss et al.

(1994) Plant Physiol. 105, 1075-1087).

It is also known for the activity of the stilbene synthesis (STS) involved in phytoalexin synthesis that they are caused in adults by environmental stress factors such as pathogen attack (Langcake (1981) Physiol. Plant Pathol. 18_, 213-226), UV light (Fritzemeier and Kindl (1981) Planta 151, 48-52) and ozone (Rose et al. (1991) Plant Physiol. _97th, induced 1280-1286). In contrast, a constitutive expression pattern was observed in seedlings (Sparvoli et al. (1994) Plant Mol. Biol. 21 »743-755).

Stilbene synthesis enzymes catalyze the synthesis of stilbenes such as resveratrol and pininovin from one molecule of p-coumaroyl-CoA or cinnamoyl-CoA and three units of malonyl-CoA. Both resveratrol and pininovin have phytoalexin properties and antifungal activity and, as phytoalexins, together with other stilbenes derived from phenylpropane metabolism, have an important function in the defense against pathogens (Hart (1981) Annu. Rev. Phytopathol. 19, 437-458).

STS genes occur in some unrelated plant species, such as Peanut (Schröder et al. (1988) Eur. J. Biochem. 112, 161-169), Weinrebe (Hain et ah (1993) Nature 361, 153-156) and Kiefer (Fliegmann et al ^. (1992) Plant Mol Biol. 1J3, 489-503), and are organized in larger gene families consisting of six or more genes (Lanz et al. (1990) Planta 181, 169-175; Wiese et al _ (1994) Plant Mol. Biol. 2_6, 667-677).

Experiments with transgenic tobacco cells indicated that the expression of stilbene synthase was mainly based on transcript level is regulated and the stress-induced signal transduction chain in various plant species has been preserved in the course of evolution (Hain et al. (1990) Plant Mol. Biol. 15, 325-335).

STS genes from peanut (Arachis hypoσaea) and grapevine (Vitis vinifera) have already been isolated (Schröder et al. (1988) supra and Hain et al. (1993) supra) and expressed in transgenic plants (Hain et al. (1990) supra and Hain e_t al. (1993) supra).

DNA sequences encoding stilbene synthase are known, for example, from European patent EP 0 309 862, German patent application DE-A-41 07 396, European patent application 0 464 461 and US patent 5,500,367. These documents describe the isolation of stilbene synthase genes and their use in the generation of transgenic plants. The resulting transgenic plants have an increased resistance to various plant pests, such as fungi, bacteria, insects, viruses and nematodes. Plamides containing STS genes were deposited with the German Collection of Microorganisms (DSM), Maßcheroder Weg 1B, D-38124 Braunschweig, e.g. also the Vβtl gene from grapevine in the plasmid pVstl under the accession number DSM 6002 (DE-A-41 07 396, EP-A-0 464 461, US patent 5,500,367).

While the use of STS-coding sequences for producing male-sterile plants and changed flower color has also been described in the meantime (German patent application DE-A-44 40 200), there is a possible connection between STS gene expression and ozone induction completely unexplored to date.

There are now various indications that it is advantageous for the most efficient disease resistance based on the expression of STS genes in transgenic plants if the expression of the heterologous STS gene (or the heterogeneous STS genes) in the plant is only stimulated by the attacking pathogen, ie only by the interaction of plant and pathogen (Fischer and Hain (1994) Current Opinion in Biotechnology 5, 125-130; Fischer (1994) "Optimizing the heterologous expression of stilbene synthesis genes for crop protection", University of Hohenheim). This is particularly supported by the observation that pathogen-induced STS gene expression is locally restricted to the site of infection and occurs transiently, ie STS expression rises to a maximum relatively quickly and subsides within less than 48 h (Hain et al (1993) supra). Studies with transgenic tobacco plants in which STS genes were expressed under the constitutive 35S RNA promoter of Cauliflower Mosaic Virus also showed that the disease resistance achieved in these plants is lower than in plants which have the same genes under the control of the pathogen inducible homologous STS promoters expressed after fungal attack (Fischer and Hain (1994) supra; Fischer (1994) supra). In any case, it is desirable for the STS expression to be planted in transgenic (culture) plants which, owing to the STS genes introduced, have an increased resistance to disease, solely (and only) through the infestation of pathogens and not additionally (or previously) can be activated and controlled by undesirable environmental stress factors, such as ozone.

It is therefore an important task of biotechnological crop protection research to realize a more specific expression of plant defense genes in plants in order to be able to do so

To be able to implement molecular biological strategies for the production of more resistant plants in a controllable and efficient manner. An important aspect here is the switching off of undesired non-specific environmental stimuli, e.g. the induction of certain defense genes by ozone, UV light, heavy metals, extreme temperatures and other abiotic stimuli.

It is therefore an important object of the present invention to provide new DNA sequences which are directly involved in the ozone-induced expression of resistance genes.

Another object of the invention is to provide options for eliminating ozone induction, ie for switching off desired stimulation of gene expression by ozone.

Furthermore, it is an important object of the invention to provide a DNA sequence by means of which stilbene synthase genes can only be expressed in transgenic plants after the plant has come into contact with a pathogen and not by ozone stimulation.

As already mentioned at the beginning, there is a constant increase in the ozone load, which also has drastic influences on the vegetation. The observation and determination of the ozone concentrations in the air are already a focal point of chemical, physical and biological environmental research. In this context, so-called bio-monitors, with the help of ozone pollution and its consequences, especially the phytotoxic effects , easy to determine qualitatively and quantitatively, is an important instrument.

A further object of the invention is therefore to provide DNA sequences which can be used to generate promoters which can be induced in a targeted manner. With the help of such promoters, so-called reporter genes, the expression of which can be detected by simple enzymatic tests and which are well known in biotechnological research, can be used as bio-monitors in a very simple and reliable manner.

A further object of the invention is to provide a system with the aid of which certain genes, the gene products of which are able to detoxify reactive oxygen species in cells, are “switched on” when necessary, that is to say when there is a high ozone load can. To be more precise, the provision of DNA sequences which are responsible for ozone-responsive gene regulation is intended to enable ozone-inducible expression of such

Genes, such as catalase and / or superoxide dismutase genes, become possible. It is therefore an object of the invention to provide DNA sequences which are used to generate an ozone-inducible cellular "ozone protection system" can. Further objects of the invention will become apparent from the following description.

These objects are achieved by the subject matter of the independent claims, in particular based on the provision of the DNA sequences according to the invention which are directly involved in ozone-induced gene expression in plants.

We have surprisingly found that a certain plant nucleic acid sequence is directly involved in the ozone-responsive STS expression. During experiments with transgenic tobacco seedlings and plants using the common reporter gene uidA from E _± coli. which codes for a / 3-Glucuronidaβe, under the control of 5 'deletions of the Vstl promoter from grapevine which are of different lengths, indicate that at least some cis elements responsible for fungal induction lie in the region of the promoter which is the base pairs -140 to -280 (calculated from the transcription start) (Fischer (1994) supra), the region of the VstI sequence which comprises the base pairs -280 to -430 is essential for a strong activation of gene expression by ozone. Based on our experiments, it could be shown that a Vstl promoter that only has the base pairs up to and including -280 (and which therefore lacks the upstream Vstl promoter sequences) is no longer ozone-inducible. As mentioned above, this truncated promoter is still able to mediate pathogen-induced gene expression of the coding sequence controlled by it (see Fischer (1994) supra).

Our analyzes also suggest a connection between the treatment of plants with ozone and an increased biosynthesis or release of ethylene in the plant cells. Accordingly, the involvement of ethylene-responsive elements in ozone-induced gene expression cannot be ruled out. Accordingly, taking into account known cis elements that are currently being discussed in connection with ethylene responsiveness (Sesβa et al. (1995) Plant Mol. Biol. 28. 145-153; Shinshi et aJU (1995) Plant Mol. Biol 27, 923- 932), involvement of the sequence region of the Vst1 promoterβ, which comprises the base pairs -283 to -273, in an ozone-induced STS gene expression cannot be excluded.

The ozone-responsive DNA sequence region described here for the first time thus comprises the base pairs -270 to -430 of the Vstl promoter from grapevine.

The present invention thus relates to the DNA sequence defined in claim 1 (SEQ ID NO: 1):

ACTTTTCGAG CCCCTTGAAC TGGAAATTAA TACATTTTCC ACTTGACTTT TGAAAAGGAG GCAATCCCAC GGGAGGGAAG CTGCTACCAA CCTTCGTAAT GTTAATGAAA TCAAAGTCAC TCAATGTCCG AATTTCAAAC CTCANCAACC CAATAGCCAA T genes that are responsible for the gene expression ozone expression that In a preferred embodiment, the DNA sequence according to the invention is a DNA sequence that comes from grapevine, and particularly preferably from the stilbene synthase gene Vstl from grapevine (base pairs -270 to -430).

The invention further relates to a promoter region of the Vβtl gene which lacks at least the DNA sequence which comprises the base pairs -270 to -430 of the Vstl gene. In a preferred embodiment, it is a promoter region of the Vstl gene which only comprises the sequence region from the translation start to base pair -270 of the Vstl gene. The promoter region, which lacks the sequence range from -270 to -430 of the Vstl gene, is particularly preferably able to mediate pathogen-inducible gene expression in plants.

The invention further relates to chimeric nucleic acid molecules into which the DNA sequence of the base pairs -270 to -430 of the Vstl gene or at least one fragment of this sequence region has been introduced. The chimeric nucleic acid molecules of the invention particularly preferably enable the ozone-inducible expression of the coding regions contained in them in plants due to the presence of the DNA sequence of the base pairs -270 to -430 of the Vstl gene or at least a partial region thereof . The nucleic acid molecules according to the invention can be any nucleic acid molecules, in particular DNA or RNA molecules, for example cDNA, genomic DNA, mRNA etc. They can be naturally occurring molecules or those produced by genetic engineering or chemical synthesis methods.

By providing the DNA sequences, promoter regions, nucleic acid molecules or vectors according to the invention, it is now possible to use genetic engineering methods to modify plant cells to have an ozone-inducible characteristic. Furthermore, there is now the possibility of changing plant cells by means of genetic engineering methods in such a way that they can induce one or more genes which can be naturally derived due to the presence of the DNA sequence according to claim 1 or one of them or one which is homologous with it , no longer inducible by ozone, preferably essentially inducible by pathogens.

A particular advantage of the invention is that the

Ozone induction of naturally ozone-inducible genes in plants and plant cells by deletion of the DNA sequence according to claim 1 or at least one fragment thereof in the genes which naturally contain this DNA sequence or a derivative thereof or a DNA sequence homologous to it , can be switched off.

A further advantage of the invention consists in the fact that genes which are not or not substantially inducible by ozone can be expressed in plants and plant cells using the nucleic acid sequences according to the invention in an ozone-inducible manner. In a preferred embodiment, the nucleic acid sequence which is responsible for the ozone-inducible expression, or at least a fragment thereof, controls the expression of genes whose gene products are capable of reactive oxygen species which arise, inter alia, as a result of ozone in plant cells can detoxify. In a particularly preferred embodiment, this controls Nucleic acid sequence the expression of catalase and / or superoxide dismutase genes.

In an alternative embodiment, the DNA sequence responsible for the ozone-inducible gene expression controls the expression of reporter genes, which is measured for the quantitative and / or qualitative determination of ozone concentrations and for the evaluation of ozone effects. Such reporter genes can e.g. the uidA gene from E ^. coli which codes for the enzyme β-glucuronidase (GUS), luciferase genes or other genes customary in plant biotechnology. Suitable reporter genes are known to any person skilled in the field of biotechnology, biochemistry or molecular biology.

The present invention further relates to vectors which contain the abovementioned DNA sequences or promoter regions or parts thereof. The present invention thus also relates to vectors, in particular plasmids, cosmids, viruses, bacteriophages and other vectors which are common in genetic engineering and which contain the nucleic acid molecules according to the invention described above and which can optionally be used for the transfer of the nucleic acid molecules according to the invention to plants or plant cells.

The invention also relates to transformed microorganisms, such as bacteria, viruses, felts, which contain the nucleic acid sequences according to the invention.

It is also an object of the invention to provide new plants and plant cells which are characterized by the lack of ozone-inducible expression of genes which are naturally induced in plants by ozone.

This task is accomplished by the provision of the DNA sequence responsible for ozone induction and the provision of promoters which lack this sequence and which for this reason are no longer capable of gene expression which can be induced by ozone through controlled genes in plants and plant cells.

The task of enabling ozone-responsive gene expression of genes which are naturally not inducible by ozone is also achieved by providing the DNA sequence according to the invention. As a result, plants and plant cells are made available which specifically express certain characteristics in the presence of ozone.

In a preferred embodiment, these are transformed plants and plant cells in which genes are inducibly expressed, whose gene products are able to detoxify reactive oxygen species in plant cells. These are particularly preferably catalase and / or superoxide dimethyl genes. Alternatively, plants and plant cells (including protoplasts) can be generated, which express so-called reporter genes after induction by ozone and which can optionally be used as bio-monitors.

The invention thus relates to transgenic plants which contain the recombinant nucleic acid molecules described above, integrated in the plant genome. In principle, these plants can be any plant. It is preferably a monocot or dicot crop. Examples of monocotyledonous plants are the plants belonging to the genera Avena (oat), Triticum (wheat), Seeale (rye), Hordeum (barley), Oryza (rice), Panicum, Pennisetum, Setaria, sorghum (millet), Zea ( Corn). The dicotyledonous crops include cotton, legumes such as legumes and in particular alfalfa, soybean, rapeseed, tomato, sugar beet, potatoes, ornamental plants, trees. Other useful plants can be fruit (in particular apples, pears, cherries, grapes, citrus, pineapple and bananas), oil palms, tea, cocoa and coffee bushes, tobacco, sisal and, for medicinal plants, rauwolfia and digitalis. The cereals wheat, rye, Oats, barley, rice, corn and millet, sugar beet, rapeseed, soybeans, tomatoes, potatoes and tobacco.

The invention also relates to propagation material from plants according to the invention, for example seeds, fruits, cuttings, tubers, rhizomes, etc., and parts of these plants, such as plant cells, protoplasts and calli.

The plant cells include differentiated and undifferentiated plant cells (including protoplasts), as well

Plant cells (including protoplasts) in which the nucleic acid molecules according to the invention are integrated into the plant genome or as autonomous molecules (including transient transformation).

In a further embodiment, the invention relates to host cells, in particular prokaryotic and eukaryotic cells, which have been transformed or infected with a recombinant nucleic acid molecule or a vector described above, and cells which are derived from such host cells and contain the described nucleic acid molecules or vectors . The host cells can be bacteria or fungal cells as well as plant or animal cells.

The present invention is also based on the object

To show methods for the production of plants and plant cells, which are characterized by the lack of an ozone-inducible expression of a gene whose expression in plants and plant cells is naturally stimulated by ozone.

This object is achieved by methods with the aid of which it is possible to produce new plants and plant cells which do not have this naturally occurring ozone-induced gene expression.

As already mentioned above, the present invention is also based on the object of processes for the production of plants and plant cells which contain such genes and their expression naturally not or not significantly activated by ozone, after ozone stimulation, to provide. This object is achieved by methods by means of which plants and plant cells can be produced which, after the introduction of the DNA sequences according to the invention or at least a partial region thereof into genes which are naturally not or only weakly ozone-inducible, express these genes after ozone stimulation.

Various methods are available for producing such new plants or plant cells. On the one hand, plants or plant cells can be modified using conventional genetic engineering transformation methods in such a way that the new nucleic acid molecules are integrated into the plant genome, i.e. that stable transformants are generated.

According to the invention, plants or plant cells which, owing to the lack of the nucleic acid sequence according to the invention or at least one fragment thereof, no longer exhibit ozone induction of the gene (s) naturally containing this sequence, are produced by a process which comprises the following steps: a) deletion of the im Defined DNA sequence or a sequence which can be derived from this sequence or which is homologous to this sequence, or at least one fragment of this sequence from a gene which regulatory elements after the deletion of the DNA sequence according to the invention for the, if necessary regulated, transcription and translation in plant cells are indispensable, comprises at least one coding sequence, and optionally a termination signal for the termination of the transcription and the addition of a poly-A tail to the corresponding transcript; b) transformation of plant cells with the gene or nucleic acid molecule produced in step a), and c) optionally the regeneration of transgenic plants and, if appropriate, the multiplication of the plants. Alternatively, in step a), instead of deleting the sequence responsible for the ozone induction, this sequence or at least a part thereof, for example by mutagenesis, can be inactivated or blocked and remain in the gene in inactivated form. Regardless of how the ozone-responsive gene region is switched off, all manipulation measures can be carried out with the aid of generally customary methods and aids of recombinant genetic engineering (see, for example, Sambrook et al. (1989) Molecular Cloning: A Laboratory Manual, 2nd edition , Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York).

In a particularly preferred embodiment, the nucleic acid molecule which is transferred to plants or plant cells in step b) contains regulation elements which e.g. Enable pathogen-induced gene expression of the coding sequence.

According to the invention, plants or plant cells which, owing to the presence of the nucleic acid sequence according to the invention, which is essential or jointly responsible for ozone-induced expression of the genes containing them, or at least one fragment of this sequence, are produced by a process which comprises the following steps a) insertion of at least one DNA sequence according to the invention which can bring about an ozone-induced gene expression in plants, or a sequence which can be derived from this sequence or which is homologous to this sequence, or at least one fragment of this sequence in a gene , which is naturally not or not significantly expressed in an ozone-inducible manner b) transformation of plant cells with the gene or nucleic acid molecule produced in step a) which has all the elements which are naturally required for expression in plant cells, and c) if necessary the regeneration of transgenic cells Plants and gg f. the propagation of plants. In a preferred embodiment, the gene is a catalase, superoxide dismutase or a common reporter gene.

Another object of the invention is to show advantageous uses of the nucleic acid sequences according to the invention.

The invention therefore encompasses uses of the new DNA molecules for the production of the plants and plant cells according to the invention described above, which are characterized either by the lack of an expression of a certain phenotypic characteristic which is normally influenced by ozone, or by the presence of the DNA sequence according to the invention Distinguish ozone-induced traits from non-transgenic plants and plant cells.

Furthermore, the invention encompasses the use of the nucleic acid molecules according to the invention for the production of plants which are characterized by an increased pathogen-induced but non-ozone-induced disease resistance.

Furthermore, the invention relates to the use of the nucleic acid sequences according to the invention or fragments thereof for the detection and identification of ozone-responsive nucleic acid elements.

The person skilled in the art can identify such ozone-responsive nucleic acid elements with the aid of common molecular biological methods, for example hybridization experiments or DNA-protein binding studies. In a first step, for example, the poly (A) * RNA is isolated from a tissue that has been treated with ozone and a cDNA library is created. In a second step, with the help of cDNA clones which are based on poly (A) * RNA molecules from an untreated tissue, those clones are identified from the acquired bank by means of hybridization whose corresponding poly (A) * RNA -Molecules are only induced during ozone treatment. Then with the help of these identified cDNAβ promoters are isolated, which via Ozone-reflective elements. Nucleic acid sequences and molecules can be useful tools in the study and characterization of these isolated promoters.

The invention also relates to nucleic acid molecules or fragments thereof which hybridize with one of the nucleic acid molecules described above or with one of the DNA sequences of the invention described above. In the context of this invention, the term “hybridization” means hybridization under conventional hybridization conditions, preferably under stringent conditions, such as, for example, in Sambrook et al (1989) Molecular Cloning: A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York.

Nucleic acid molecules which hybridize with the molecules according to the invention can e.g. from genomic or from cDNA libraries.

Such nucleic acid molecules can be identified and isolated using the nucleic acid molecules according to the invention or parts of these molecules or the reverse complement of these molecules, e.g. by means of hybridization according to standard methods (see e.g. Sambrook et al, supra).

The invention thus also relates to the use of a DNA sequence according to the invention or of parts thereof for the identification and isolation of homologous sequences from plants or other organisms.

For example, nucleic acid molecules which have the nucleotide sequences according to the invention or parts of these sequences exactly or essentially can be used as the hybridization probe. The fragments used as the hybridization probe can also be synthetic fragments which were produced with the aid of the conventional synthetic techniques and whose sequence essentially corresponds to that of an inventive method Nucleic acid molecules. If genes which hybridize with the nucleic acid sequences according to the invention have been identified and isolated, a determination of the sequence and an analysis of the properties are necessary. For this purpose, a number of standard molecular, biochemical and biotechnological methods are available to the person skilled in the art.

The molecules hybridizing with the nucleic acid molecules according to the invention also include fragments, derivatives and allelic variants of the DNA molecules described above, which contain an ozone-responsive sequence, in active or inactivated form, or which are distinguished by the fact that they do not have this sequence have more. In this context, the term "derivative" means that the sequences of these molecules differ from the sequences of the nucleic acid molecules described above at one or more positions and have a high degree of homology to these sequences. Homology means a sequence identity of at least 40%, in particular an identity of at least 60%, preferably over 80% and particularly preferably over 90%. The deviations from the nucleic acid molecules described above can be caused by deletion, addition, substitution, insertion or recombination.

The nucleic acid molecules which are homologous to the molecules described above and which are derivatives of these molecules are generally variations of these molecules which represent modifications which have the same biological function. These can be both naturally occurring variations, for example sequences from other organisms, or mutations, whereby these modifications can have occurred naturally or have been introduced by targeted mutagenesis. Furthermore, the variations can be synthetically produced sequences. The allelich variants can be both naturally occurring and synthetically produced variants or those produced by recombinant DNA techniques. To prepare the introduction of foreign genes into higher plants or their cells, a large number of cloning vectors are available which generate a replication signal for JL. coli and a marker gene for the selection of transformed Baktβrien cells contain. Examples of such vectors are pBR322, pUC series, M13mp series, pACYC184 and others. The desired sequence can be inserted into the vector at a suitable restriction interface. The plasmid obtained is used for the transformation of Ej_ coli. Cells. Transformed E_ _j . coli cells are grown in a suitable medium and then harvested and lysed. The plasmid is recovered. Restriction analysis, gel electrophoresis and other biochemical-molecular biological methods are generally used as the analysis method for characterizing the plasmid DNA obtained. After each manipulation, the plasmid DNA can be cleaved and DNA fragments obtained can be linked to other DNA sequences. Each plasmid DNA sequence can be cloned into the same or different plasmids.

A large number of known techniques are available for introducing DNA into a plant host cell, the person skilled in the art being able to determine the appropriate method in each case without difficulty. These techniques include the transformation of plant cells with T-DNA using Aqrobacterium tumefaciens or Aαrobacterium rhizoqeneβ as a transformation agent, the fusion of protoplasts, the direct gene transfer of isolated DNA into protoplasts, the electroporation of DNA, the introduction of DNA using the biolistic method as well as other options. Both stable and transient transformants can be generated.

In the injection and electroporation of DNA into plant cells, no special requirements are made of the plasmids used per βe. The same applies to direct gene transfer. Simple plasmids such as pUC derivatives can be used. However, if whole plants are to be regenerated from such transformed cells, the presence of a animal marker gene necessary. The usual selection markers are known to the person skilled in the art and it is not a problem for him to select a suitable marker. Customary selection markers are those which impart to the transformed plant cells resistance to a biocide or an antibiotic such as kanamycin, G418, bleomycin, hygromycin, methotrexate, glyphosate, streptomycin, sulfonyl-urineoff, gentamycin or phosphinotricin, among others.

Depending on the method of introducing desired genes into the plant cell, further DNA sequences may be required. E.g. If the Ti or Ri plaßmid is used for the transplantation of the plant cell, at least the right boundary, but often the right and left boundary of the T-DNA contained in the Ti and Ri plaßmid, must be linked as a flank region with the genes to be introduced .

If agrobacteria are used for the transformation, the DNA to be introduced must be cloned into special plasmids, either in an intermediate or in a binary one

Vector. On the basis of sequences which are homologous to sequences in the T-DNA, the intermediate vectors can be integrated into the Ti or Ri plasmid of the agrobacteria by homologous recombination. This also contains the vir region necessary for the transfer of the T-DNA. Intermediate vectors cannot replicate in agrobacteria. Using a helper plasmid, the intermediate vector can be transferred to Aqrobacterium tumefacienβ (conjugation). Binary vectors can replicate in E_ ^ coli as well as in Agrobacteria. They contain a selection marker gene and a linker or

Polylinkers, which are framed by the right and left T-DNA border region. They can be transformed directly into the agrobacteria (Holsters et al (1978) Molecular and General Genetics 163, 181-187). The agrobacterium serving as the host cell is said to contain a plasmid which carries a vir reqion. The pre-region is necessary for the transfer of the T-DNA into the plant cell. Additional T-DNA may be present. The Agrobacterium transformed in this way is used for the transformation of plant cells. The use of T-DNA for the transformation of plant cells has been intensively investigated and is sufficiently described in EP 120 515; Hoekema in: The Binary Plant Vector System, Offsetdrokkerij Kanterβ BV, Alblaßβerdam (1985) Chapter V; Fraley et al (1993) Crit. Rev. Plant. Sci., 4, 1-46 and An et al (1985) EMBO J. 4, 277-287.

For the transfer of the DNA into the plant cell, plant explants can expediently be cultivated with Aqrobacterium turnefacienβ or Aqrobacterium rhizoqeneβ. Whole plants can then be regenerated again from the infected plant material (for example leaf pieces, stem segments, roots, but also protoplasts or suspension cells cultivated plant cells) in a suitable medium which can contain antibiotics or biocides for the selection of transformed cells . The

The plants are regenerated using conventional regeneration methods using known nutrient media. The plants or plant cells obtained can then be examined for the presence of the introduced DNA. Other ways of introducing foreign DNA using the biological one

Process or by protoplast transformation are known (see e.g. Willmitzer L. (1993) Transgenic Plante, in: Biotechnology, A Multi-Volume Comprehensive Treatiβe (HJ Rehm, G. Reed, A. Pühler, P. Stadler, edβ.) Vol. 2, 627-659, VCH Weinheim - New York - Baßel - Cambridge).

While the transformation of dicotyledonous plants or their cells via Ti-plaßmid vector systems with the help of Aqrobacterium tumefaclens has been well established, recent work indicates that monocotyledonous plants or their cells are also

Transformation using Aqrobacterium-based vectors is very accessible (Chan et al (1993) Plant Mol. Biol. 22, 491-506; Hiei et al (1994) Plant J. 6, 271-282; Deng et al (1990) Science in China 3_3, 28-34; Wilmink et al (1992) Plant Cell Reports 11, 76-80; May et al (1995) Bio / Technology 12,

486-492; Conner and Domiss (1992) Int. J. Plans Be. 153, 550-555; Ritchie et al (1993) Transgenic Res. 2, 252-265). Alternative systems for the transformation of monocotyledonous plants or their cells are the transformations using the biolistic approach (Wan and Lemaux (1994) Plant Physiol. 104, 37-48; Vaβil et al (1993) Bio / Technology 11, 1553-1558; Ritala et al (1994) Plant Mol. Biol. 2_4, 317-325; Spencer et al (1990) Theor. Appl. Genet. 79_, 625-631), the protoplast transformation, the electroporation of partially peπneabilized cells, the introduction of DNA in glass tubes.

The transformed cells grow within the plant in the usual way (see also McCormick et al (1986) Plant Cell Reports 5, 81-84). The resulting plants can be grown normally and crossed with plants that have the same transformed genetic makeup or other genetic makeup. The resulting hybrid individuals have the corresponding phenotypic properties.

Two or more generations should be attracted to ensure that the phenotypic characteristic is stably retained and inherited. Seeds should also be harvested to ensure that the appropriate phenotype or other characteristics have been preserved.

Likewise, transgenic lines can be determined using conventional methods, which are homozygous for the new nucleic acid molecules and which investigate their phenotypic behavior with regard to an existing or non-existing ozone-responsiveness and compare it with that of hemizygotic lines.

Of course, plant cells which contain the nucleic acid molecules according to the invention can also be further cultivated as plant cells (including protoplasts, calli, suspension cultures, etc.).

Another object of the present invention is the use of the nucleic acid molecules according to the invention or parts of these molecules or the reverse complements of these molecules for the identification and isolation of homologous molecules, the ozone-responsive elements comprise from plants or other organisms. For the definition of the term "homology" see above.

The following examples serve to explain the invention.

EXAMPLES

Example 1:

Construction of the 5 'deletions of the Vstl promoter as GUS fusion β constructs in the binary vector pPCV002

The 5 'non-coding sequence region of the Vstl gene from grapevine referred to below as the promoter consists of 1570 base pairs. This promoter, whose sequence i.a. Known from German DE 41 07 396 and Fischer (1994) supra, using a conventional polymer chain reaction using the following oligonucleotides as primer and the plasmid pVβtl containing the complete Vstl gene (DE-A-41 07 396; Fischer (1994) supra) amplified as template:

5'- CCCCAAGCTT CCCCGGATCA CATTTCTATG AGT -3 '(Primer 1, SEQ ID NO: 2)

5'- CGCGGATCCT CAATTGAAGC CATTGATCCT AGCT -3 '(Primer 2, SEQ ID NO: 3).

The PCR reaction was performed according to the Perkin Elmer protocol (Norwalk, USA) using the Perkin Elmer native Taq DNA polymerase. The DNA fragment amplified under customary PCR conditions was then subjected to the restriction enzymes HindII (the restriction portion is contained at the 5 'end of primer 1) and BamHI (the restriction site is contained at the 5' end of primer 2). resected and together with the BamHI / EcoRI fragment from the vector pBI101.2 (Jefferβon (1987) Plant Mol. Biol. Reporter 5_, 387-405), which contains the _/ 8-glucuronidase reporter gene (GUS, uidA) from E_j. coli together with the termination signal deβ nos gene from A. turnefacJens contains, via which HindIII and EcoRI restriction portions of the pUClβ polylinker in the pUClβ plasmid (Yaniβch-Perron et aJU (1985) Gene 33., 103-119; available B. subcloned by Boehringer Mannheim). All cloning steps were carried out using common molecular biological techniques and aids (for example Sambrook et al. (1989) supra); Restriction enzymes and other enzymes used for the cloning were obtained from Boehringer Mannheim. The resulting pUC clone (pUC-Vβtl / GUS) thus contains a translation fusion of the β Vβtl promoterβ with the GUS gene, in which the first five STS codons in frame are linked to the GUS gene via a BamHI cut. The sequence region of the fusion transition and the sequence of the Vβtl promoter were determined using the enzymatic chain termination method (Sanger et al. (1977) Proc. Natl. Acad. Sci. USA 74, 5463-5467) using the T7 sequencing -Kit from Pharmacia (Freiburg) checked for correctness. The cloning of the 5 'deletion mutants in the binary vector pPCV002 (Koncz and Schell (1986) Mol. Gen. Genet. 204, 383-396) is explained below. In most cases, pUC18 subclones were used as intermediate vectors, since the smaller pUC plasmid is easier to handle than the relatively large binary vectors.

The plasmid designations result from the approximate length of the respective promoter fragment, calculated from the transcription type, which is 73 base pairs away from the start codon (Hain et al. (1993) supra; Fischer (1994) supra). The restriction interfaces used for the gradual shortening of the Vβtl promoter are also shown schematically in FIG. 1.

pl500GUS: The Hindlll / EcoRI fragment, which contains the complete STS promoter together with the GUS gene, was isolated from the plasmid pUC-Vstl / GUS described above and inserted between the restriction sites Hindlll and EcoRI in the polylinker of pPCV002. - pl060GUS: An 1130 bp promoter fragment was olated via the restriction sites BamHI and Sspl from pUC-Vβtl / GUS i ^β and cloned in BamHI / HincII-linearized pUClβ (-> pUC1130). The GUS gene was then isolated as BamHI / EcoRI fragment from pUC-Vβtl / GUS and the BamHI and EcoRI cleavage site of pUC1130 was cloned in between. Finally, the fusion was isolated via a HindIII / EcoRI double digest and inserted into the polylinker of pPCV002 via the same interfaces. - p930GTJS: The 1.0 kb promoter fragment was over the

Restriction enzymes BamHI and HincII isolated from pUC-Vstl / GUS and inserted into the polylinker of pUClβ via the same restriction sites (-> pUClOOO). The cloning was then carried out analogously to pl060GUS. p740GUS: The 1.6 kb H ^ dlll / BamHI promoter fragment was isolated from the plasmid pUC-Vβtl / GUS and digested with the restriction enzyme Dral. The resulting 810 bp. BamHI / Dral fragment was then cloned into pUClθ via the restriction sites BamHI and HincII (-> pUC810). The GUS gene was then isolated as BamHI / EcoRI fragment from pUC-Vβtl / GUS and the BamHI and EcoRI cleavage sites of pUC810 were cloned in between. Finally, the fusion was isolated via a HindIII / EcoRI double digest and inserted into the polylinker of pPCV002 via the same interfaces.

- p550QUS: pUC-Vβtl / GUS was digested with the restriction enzyme AfIII and the overhanging 5 'ends were filled with Klenow enzyme (from Boehringer Mannheim; dNTPs also from Boehringer Mannheim) according to the manufacturer's information. Subsequently, the restriction enzyme BamHI was cut and the resulting 620 bp promoter fragment was ligated in BamHI / HincII-linearized pUClβ (-> pUC620). After that, the cloning was carried out as continued for pl060GUS.

p500GUS: A 570 bp. long β promoter fragment was isolated from pUC-Vβtl / GUS via a BamHI / HaelII double digest and in

BamHI / HincII linearized pUC19 vector ligated (-> pUC570). This was followed by further cloning, such as for the production of, inter alia, pl060GUS. p430GUS: The plasmid pUClOOO described above was linearized using the restriction enzyme SnaBI and digested with HincII. The linearized vector was then religated, as a result of which the 500 base pairs of the promoter β were deleted between -930 and -430 (-> pUC500). The further cloning proceeded as for pUC1060GUS.

p280GTJS: pUC-Vstl / GUS was digested with the restriction enzyme Banll, the overhanging ends were filled in with Klenow enzyme and the linearized vector was digested again with the restriction enzyme BamHI. After the isolation of the 350 bp long blunt end / BamHI promoter fragments, the cloning was continued in analogy to pl060GUS.

pI40GUS: The pUC subclone pUC620 described above was digested with the restriction enzymes Neil and Pβtl and the linearized vector was then purified and religated. This resulted in the deletion of the promoter sequences from -550 to -140 (-> pUC210). The GUS gene was then isolated as a BamHI / EcoRI fragment from pUC-Vβtl / GUS and the BamHI and EcoRI sections of pUC1130 were cloned in between. Finally, the foot was over a Hindlll / EeoRI

Double digestion isolated and inserted into the polylinker of pPCV002 via the same interfaces.

p40GUS: The 110 bp promoter fragment was isolated together with the GUS gene by means of a Nhel / EcoRI double digest from pUC-Vstl / GUS and the fragment was then cloned into Xbal / EcoRI-linearized pPCV002.

pΔGUS: The construct pl500GUS was digested with the restriction enzyme BamHI and the purified vector was then religated. The BamHI cut parts, which the vector pPCV002 naturally contains in its multiple cloning site next to the Hindlll cut parts (Koncz and Schell (1986) βupra), have thus eliminated the entire promoter fragment.

- p35SGUS: The Fuβion deβ 35S RNA promoter from Cauliflower Mosaic Virus with the GUS gene, which served as a positive control, was used as a HindIII fragment from the expression vector pRT99GUS (Töpfer jet al (1988) Nucleic Acids Research 16, _8725th). isolated and inserted into the multiple cloning site of pPCV002. Example 2:

Plant material, plant transformation and regeneration of 5 transgenic plants

NicotJana tabacum cv. Petit Havana SRI (Maliga et al. (1973) Nature New Biol. 244, 29-30) was grown as a sterile shoot culture on hormone-free 1/2 LS medium (Linβmaier and Skoog (1965) Physiol.

10 Plant i8_, 100-127) with 1% sucrose at 26 ° C, 3000 lux and a 16-hour photoperiod. In intervals of 6-8 weeks, shoot sections were converted to fresh LS medium. For the formation of leaf disks with Aqrobacterium tumefaciens (Horβch et al. (1985) Science 227, 1229-

15 1231), 2-3 cm long leaves of βterile shoot cultures were punched into 1 cm diameter disks and with a suspension of agrobacteria (approx. 10 ⁹ cells / ml YEB medium) which contained one of the above-mentioned plasmid constructs for 5 min . incubated. The infected leaf pieces were checked for hormone-free LS

20 medium kept at 26 ° C for 2-3 days. During this time, the bacteria grew over the leaf segments, which were then washed in liquid LS medium without hormones and on LS medium with kanamycin (75 μg / ml; Sigma, Munich), cefotaxime (500 μl / ml; Hoechst, Frankfurt) and benzylaminopurine (BAP, 0.5 mg / 1;

25 Duchefa, Haarlem, the Netherlands). After 2-3 weeks, transformed shoots were visible, which were rooted on hormone-free LS medium with 75 μg / ml kanamycin and 100 μg / ml cefotaxime.

30 The agrobacterial cultures used for the transformation of the tobacco leaf pieces were prepared as follows. First, the pPCVO02 derivatives described above were used in the E ^. coli mobilization strain S17-1 (Simon et al. (1983) Bio / Technology 1, 784-790). The manufacturing took place

35 competent S17-1 E ^. coli cells and the transformation of the competent cells with the corresponding plasmids according to Taketo (1988) Biochem. Biophys. Acta 941, 318-324 and Hanahan (1983) J. Mol. Biol. 166, 557-580. The E_j_coli strain S17-1, containing the respective binary vector, and the Aqrobacterium turnefacJens strain GV3101 C58C1 Rif ^r pMP90RK ⁽ Koncz and Schell (1986) supra) _grown in appropriate media up to OD _5β0 = 1.0. Conventional YT medium (Miller (1972) Experiments in Molecular Genetics, Cold Spring Harbor, was used to grow the E _± coli bacteria

Laboratory Press, Cold Spring Harbor, New York; Bacto-tryptone 0.8% (w / v), yeast extract 0.5% (w / v), NaCl 0.5% (w / v), pH 7.0) at 37 ° C and for cultivation the A ^. tumefaciens bacteria became YEB medium (beef extract 0.5% (w / v), yeast extract 0.1% (w / v), bactopeptones 0.5% (w / v), sucrose 0, 5% (w / v), MgS0 ₄ 2 mM, pH 7.2) used at 28 ° C. For the subsequent conjugation, the bacteria were at 1500 xg for 5 min. centrifuged off and washed twice in freshly prepared 10 mM MgS0 ₄ solution. The donor (E ^. Coli) and acceptor (Aj. Tumefaciens) were then mixed in a ratio of 1: 1 and dropped onto a YEB agar plate. After 16 hours of incubation at 28 ° C., the bacterial drop was rinsed with 10 mM MgSO ₄ solution and 10 ^'2 , 10 ³ and 10 * dilutions were plated onto YEB selection plates. From a single culture at 28 ° C one for the transformation of N ^ _. Agrobacteria culture used to grow tabacum.

The transgenic tobacco shoots, each containing one of the Vstl promoter / GUS fusions described above, were propagated βterilly via shoot culture, partially transferred to soil and in the greenhouse under normal conditions (22 ° C, 60% relative humidity, approx. 15,000 lux) cultivated until flowering. The flowers were protected from cross-pollination by parchment bags and ripe seed capsules with seeds of the Fl generation were harvested after 4-6 weeks. For biological tests in the greenhouse, the Fl generation seed was designed on LS medium with 75 μg / ml kanamycin. This was done under sterile conditions directly from the capsule or after surface sterilization (1. brief washing with sterile water; 2. 2 min. Incubation in 70% ethanol; 3. 10 min. Incubation in 3% NaOCl (13% active chlorine) ; 4. three washings with water; 5. drying in the laminar flow of the safety workbench). After 2 weeks of cultivation on LS medium with 75 μg / ml kanamycin at 25-26 ° C, 2000-3000 lux and 60% humidity, kanamycin to clearly distinguish resistant tobacco seedlings and kanamycin-sensitive tobacco seedlings. In contrast to beta seedlings, resistent seedlings showed pronounced primary root growth. In addition to the cotyledons, the primary leaves were only visible after 2 weeks. In this

In the "four-leaf stage", the resistant Fl seedlings were transferred to earth, hardened and further cultivated under suitable conditions.

Example 3:

Plant growing, ozone treatment and leaf harvesting

For the subsequent ozone treatment, transgenic, canine-resistant tobacco seedlings were first transferred from agar plates into flower pots with a 2: 1 mixture of standard substrate (type T / Frühstorfer / Lauterbach) with perlite and for 3 weeks in a climatic chamber with a 12-hour day / Night cycle, 15,000 lux, 25 ° C day temperature, 20 ° C night temperature, 65-70% humidity and filtered air incubated.

The tobacco plants were then exposed to a single ozone pulse for 10 h and then incubated in pollutant-free, filtered air for 2-14 h. All fumigation experiments were carried out in closed plexiglass boxes that were placed in the climatic chamber under the specified climatic conditions. Ozone treatments always started at 9:00 a.m. throughout the day. The ozone was obtained by electrical discharge in dry oxygen. The dosage and analyzes were carried out under computer control (Langebartels et al. (1991) Plant Physiol. 95, 882-889). The tobacco leaves of a plant were counted downwards from the top of the plant and classified into leaf numbers 1-10, the first leaf being at least 8 cm in size. The tobacco leaves (classified from 1-10) were individually frozen in liquid nitrogen at various times after the start of the ozone treatment and stored at -80 ° C. Example 4:

jS-Glucuronidaβe activity tests

The fluorometric analysis of the GUS enzyme activity was carried out strictly according to Jefferson (1987) supra or Jefferson et al. (1987) EMBO J. 6, 3901-3907 using 4-methyl-umbelliferyl-glucuronide (MUG, Sigma, Munich). The concentration of the product 4-methylumbelliferone (MU) was measured with a fluorescence photometer (Perkin Elmer LS-2 B filter fluorimeter) in a quartz flow cell. The GUS activity in plant extracts was calculated in pmol MU x mg " ¹ x min" ¹ . The protein concentration in the tobacco leaf extracts was analyzed according to Bradford (1976). Biochem. 12_, 248-254.

In experiments carried out in parallel with ozone-treated vine plants and subsequent Northern blot analyzes, it was shown that gassing with 0.2 μl / 1 and 0.4 μl / 1 ozone resulted in a considerable induction of STS gene expression at the mRNA level. For this reason, STS genes from grapevine should be particularly well suited for the identification of ozone-responsive DNA elements. It should be mentioned at this point that genes which have shown significant, reliably measurable ozone induction in ozone-treated plants compared to untreated plants have not hitherto been available.

In order to be able to analyze the influence of ozone at the promoter level, Fl tobacco plants (11 weeks old) from the stably transformed tobacco line, which contains the Vstl promoter / GUS fusion construct with the complete promoter region (plSOOGUS), were used in ozone gassing experiments. GUS enzyme activities were measured fluorometrically in crude extracts from leaves, which were at different times during a 10-hour ozone exposure with different ozone concentrations (0.1 μl / 1 ozone, 0.2 μl / l ozone and 0.4 μl / 1 ozone) and one 14-hour post-incubation phase in pollutant-free air were determined. The results shown in Figure 2 show a rapid increase induced by ozone the GUS activity compared to control plants which were only kept in air free of harmful substances. Thereafter, treatment with 0.1 μl / 1 ozone caused 11-fold induction and treatment with 0.2 or 0.4 μl / 1 ozone even caused up to 25-fold induction of the expression controlled by the STS promoter GUS genes 12 h after the start of the ozone treatment.

The transgenic tobacco lines which contain the 5 'deletions of the Vβtl promoter described above in fusion with the bacterial GUS reporter gene were identified for the identification of ice-regulatory sequences which are responsible for the observed strong ozone induction of the STS promoter. analyzed as independent FO plants in ozone fumigation experiments. The primary rain rate was cultivated in sterile culture for several months and propagated via shoot culture. Fl tobacco plants (11 weeks old) of these stable transformants were also examined for ozone-induced GUS expression.

The transparent tobacco plants were treated with 0.1 μl / 1 ozone for 10 h and then incubated for a further 2 h in air free of harmful substances. The GUS activity was determined in crude extracts from middle-aged leaves and compared with the enzyme activity in untreated control plants. The results of the fluorometric analysis of the GUS enzyme activities are shown in Table 1. While the GUS activity with increasing shortening of the promoter region from -1500 to -430 results both in ozone-treated test plants and in untreated control plants in a slight decrease in the ozone induction (induction β factor drops from approx. 12 (-1500) about 10 (-430)), the additional deletion of the promoter region between -430 and -280 results in a drastic reduction in GUS expression in ozone-treated test plants. While plants in which the GUS gene is under the control of the -430-5 'deletion promoter show a 10-fold ozone induction compared to the control plants, in plants the expression of the GUS gene by the shorter -280- 5 'deletion promoter is controlled, only a maximum 2-fold induction of the GUS expression by ozone is observed. As a result, the promoter region contains the Vstl gene Grapevine comprising the base pairs -430 to -280 cis-active elements which are essential for a pronounced ozone-induced expression of the STS gene.

These results were in plant cells that match the above

Contained constructs and were grown in plant cell cultures, confirmed.

FIGURES and TABLES

Figure 1: Restriction map of the Vstl promoter / GUS translation foot in the plasmid pUC-Vstl / GUS. The plasmid contains a translation fusion of the Vstl promoter from the grapevine with the GUS gene from E ^ coli. The restriction sites used for the cloning of the 5'-deletion beta mutants are shown, nos ter = termination signal of the nopalin beta synthetic gene from Aqrobacterium tumefaciens.

Figure 2:

Kinetics of controlled through the VSTL promoter induction of GUS expression in tranβgenen Fl tobacco plants which contain a ^β Tran lationsfuβion deβ GUS gene auβ with the full Vstl- Promσtor grapevine (pl500GUS), by various Ozonkσnzentrationen.

The GUS activities were measured fluorometrically in crude extracts from tobacco leaves (sheet No. 4) according to Jefferson (1987), supra. certainly. The different harvest times are shown in the figure. After the 10-hour ozone treatment, the tobacco plants were incubated for 14 hours in beta-free air. Control plants were kept only in air free of harmful substances (without gassing with ozone), n = 3 or 4; Mean values ± standard errors; all tests were carried out as double tests.

Table 1: GUS enzyme activities were determined fluorometrically in protein extracts from middle-aged leaves of ozone-treated (+) and untreated (-) independent tobacco teardrop formants. The transgenic tobacco lines contain various 5 'deletions of the Vstl promoter in fusion with the bacterial GUS reporter gene. FO transformants and FL plants (11 weeks old) were gassed with 100 nl / 1 ozone for 10 h and then incubated for 2 h in air free of harmful substances. Mean values ± standard error; all analyzes were carried out as double experiments.

ERSAΓZBLAΓΓ (RULE 26)

Table 1

FJSAΓZBLÄΓT (RULE 26) Table 1 :

GUS enzyme activities were determined fluorometrically in protein extracts from middle-aged leaves of ozone-treated (+) and untreated (-) independent tobacco transformants.

The transgenic tobacco lines contain various 5 'deletions of the Vβtl promoter in fusion with the bacterial GUS reporter gene. F0 transformants and FL plants (11 weeks old) were gassed with 100 nl / 1 ozone for 10 h and then post-incubated in pollutant-free air for 2 h. Mean values ± standard error; all analyzes were carried out as double tests.

SEQUENCE LOG

(1. GENERAL INFORMATION:

(i) APPLICANT:

(A) NAME: GSF - Research Center for Environment and

Health GmbH

(B) STREET: Ingolstaedter Landstr. 1

(C) LOCATION: Oberschleissheim

(E) COUNTRY: Germany

(F) POSTAL NUMBER: 85764

(A) NAME: Bayer AG

(B) ROAD: Bayerwerk

(C) LOCATION: Leverkusen

(E) COUNTRY: Germany

(F) POSTAL NUMBER: 51368

(ii) DESCRIPTION OF THE INVENTION: Ozone-induced gene expression in plants

(iii) NUMBER OF SEQUENCES: 3

(iv) COMPUTER READABLE VERSION:

(A) DATA CARRIER: floppy disk

(B) COMPUTER: IBM PC compatible

(C) OPERATING SYSTEM: PC-DOS / MS-DOS

(D) SOFTWARE: Patentin Release # 1.0, Version # 1.30 (EPA)

(2) INFORMATION ON SEQ ID NO: 1:

(i) SEQUENCE LABEL:

(A) LENGTH: 161 base pairs

(B) TYPE: nucleotide

(C) STRAND FORM: double strand

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: Genomic DNA

<xi) SEQUENCE DESCRIPTION: SEQ ID NO: 1:

ACTTTTCGAG CCCCTTGAAC TGGAAATTAA TACATTTTCC ACTTGACTTT TGAAAAGGAG 60

GCAATCCCAC GGGAGGGAAG CTGCTACCAA CCTTCGTAAT GTTÄATGAAA TCAAAGTCAC 120

TCAATGTCCG AATTTCAAAC CTCANCAACC CAATAGCCAA T 161 (2) INFORMATION ON SEQ ID NO: 2:

(i) SEQUENCE LABEL:

(A) LAENGΞ: 33 base pairs

(B) TYPE: nucleotide

(C) STRAND FORM: Single strand

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: Other nucleic acid

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 2: CCCCAAGCTT CCCCGGATCA CATTTCTATG AGT 33

(2) INFORMATION ON SEQ ID NO: 3:

(i) SEQUENCE LABEL:

(A) LENGTH: 34 base pairs

(B) TYPE: nucleotide

(C) STRAND FORM: Single strand

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: Other nucleic acid

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 3: CGCGGATCCT CAATTGAAGC CATTGATCCT AGCT 34

Claims

EXPECTATIONS

1. The plant DNA sequence:

ACTTTTCGAG CCCCTTGAAC TGGAAATTAA TACATTTTCC ACTTGACTTT TGAAAAGGAG GCAATCCCAC GGGAGGGAAG CTGCTACCAA CCTTCGTAAT GTTÄATGAAA TCAAAGTCAC TCAATGTCCG AATTTCAAAC CTCANCAACC CAATAGCCAA T.

2. DNA sequence according to claim 1, which comes from grapevine (Vitis vinifera).

3. DNA sequence according to claim 1 or 2, which in the

Stilbene synthase gene Vstl naturally contained and corresponds to the base pairs -270 to -430.

4. promoter region of the stilbene synthase gene Vstl from grapevine, at least the DNA sequence according to claim 1 is missing.

5. A promoter region according to claim 4, which comprises only the sequence region from the translation beta start to the base pair -270.

6. Promoter region according to claim 4 or 5, which still mediates pathogen-induced gene expression in plant cells.

7. Chimeric nucleic acid molecules into which the DNA sequence according to claim 1 or at least a fragment thereof has been introduced.

8. Chimeric nucleic acid molecules according to claim 7, which enable an ozone-inducible expression of the coding regions contained in them in plants.

9. Vectors containing the DNA sequence, a promoter region or a chimeric β nucleic acid molecule according to one of the preceding claims, or parts thereof.

10. Transgenic plants which contain the DNA sequence, a promoter region or a chimeric nucleic acid molecule according to one of the preceding claims or a DNA sequence derived therefrom, and parts of these plants and their nutritional material, such as protoplasts, plant cells, calli, seeds, tubers or Cuttings, etc., as well as the descendants of these plants.

11. Transgenic plants due to the lack of the (naturally present) DNA sequence

ACTTTTCGAG CCCCTTGAAC TGGAAATTAA TACATTTTCC ACTTGACTTT TGAAAAGGAG GCAATCCCAC GGGAGGGAAG CTGCTACCAA CCTTCGTAAT GTTÄATGAAA TCAAAGTCAC TCAATGTCCG AATTTCAAAC CTCANCAACC CAATAGCCAA T do not induce any o

12. Plants according to claim 11, in which the ozone-inducible expression of disease resistance genes is greatly reduced.

13. Plants according to claim 11 or 12, in which the ozone-inducible expression of stilbene synthase genes, in particular the Vstl gene from grapevine, is greatly reduced.

14. Plants according to claim 10, in which, due to the introduction of the DNA sequence according to claim 1 or at least one β fragment thereof, ozone-inducible gene expression of a gene which naturally does not have the β DNA sequence can take place.

15. Plants according to claim 14, in which ozone-inducible expression of genes can take place whose gene products in plant cells are able to detoxify reactive oxygen species.

16. Plants according to claim 14 or 15, in which ozone-inducible expression of catalase or superoxide dismutase genes can take place.

17. Plants according to claim 14, in which ozone-inducible expression of reporter genes can take place.

18. Dicotyledonous plants according to one of claims 10 to 17, in particular useful plants such as soybean, rapeseed, tomato, sugar beet, potato, cotton, tobacco, and ornamental plants or trees.

19. Monocot plants according to one of claims 10 to 17, in particular cereals such as oats, wheat, rye, barley, rice, millet or corn.

20. Transgenic plant cells, including prototypes, which contain the DNA sequence, a promoter region or a chimeric nucleic acid molecule according to one of claims 1 to 9 or a DNA sequence derived therefrom.

21. Plant cells, including protoplasts, which, owing to the lack of the (in their natural state) DNA sequence ACTTTTCGAG CCCCTTGAAC TσGAAATTAA TACATTTTCC ACTTGACTTT TGAAAAGGAG GCAATCCCAC GGGAGGGAAG CTGCTACCAA CCTTCGTAAT CTTTCACACCAAAAA TCTTCACCCAAAAATTTCCCATAAAAAA Expression of natural white ozone-inducible genes.

22. Plant cells according to claim 20, in which, due to the introduction of the DNA sequence according to claim 1 or at least one fragment thereof, ozone-inducible gene expression of a gene which naturally does not have this DNA sequence can take place.

23. A method for producing transgenic plants or plant cells in which the ozone-inducible expression of naturally ozone-inducible defense genes by deletion of the DNA sequence according to claim 1 or at least one fragment thereof in the defense gene, that the DNA sequence or one thereof derived DNA sequence contains naturally, βtark reduced or switched off.

24. The method according to claim 23, in which the ozone-inducible expression of stilbene synthesis genes is greatly reduced or eliminated.

25. The method according to claim 23 or 24, in which the ozone-inducible expression of the Vstl gene from grapevine is greatly reduced or eliminated.

26. A method for producing transgenic plants or plant cells in which one or more genes, the expression of which is not naturally or not significantly induced by ozone, can be induced by ozone due to the introduction of the DNA sequence according to claim 1 or at least one fragment thereof.

27. The method according to claim 26, in which one or more catalase and / or superoxide dimethyl genes are β-inducible.

28. The method according to claim 26, in which one or more reporter genes can be induced by ozone.

29. A method for eliminating the ozone inducibility of naturally ozone-inducible defense genes which naturally contain the DNA sequence according to claim 1 or a DNA sequence derived therefrom, by deleting or inactivating the DNA sequence according to claim 1 or at least one or more fragments thereof .

30. The method according to claim 29, in which the gene eats a stilbene synthase gene.

31. The method according to claim 29 or 30, in which the gene is the Vβtl gene from grapevine.

32. Process for producing ozone-inducible

5 Expression of characteristics in transgenic plants or plant cells by inserting the DNA sequence according to claim 1 or at least one fragment thereof into such genes which are naturally not or not significantly inducible by ozone.

33. Use of the DNA sequence according to claim 1 or a fragment thereof to find ozone-responsive sequence regions in plant genes.

34. Use of the DNA sequence according to claim 1 or 15 of a fragment thereof for generating ozone-inducible

Character expression in transgenic plants or plant cells.

35. Use of the DNA sequence according to claim 1 or a fragment thereof for the production of plants according to claim

20 17, which can be used as biomonitors for the quantitative and / or qualitative determination of ozone concentrations.

36. Use of the promoter region according to one of the

25 Claims 4 to 6 for the generation of increased pathogen but not ozone-inducible disease resistance in transgenic plants.

30