EP0840739A1 - Ligands d'acide nucleique a haute affinite pour les lectines - Google Patents

Ligands d'acide nucleique a haute affinite pour les lectines

Info

Publication number
EP0840739A1
EP0840739A1 EP96923232A EP96923232A EP0840739A1 EP 0840739 A1 EP0840739 A1 EP 0840739A1 EP 96923232 A EP96923232 A EP 96923232A EP 96923232 A EP96923232 A EP 96923232A EP 0840739 A1 EP0840739 A1 EP 0840739A1
Authority
EP
European Patent Office
Prior art keywords
nucleic acid
ligand
selectin
rna
ligands
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP96923232A
Other languages
German (de)
English (en)
Other versions
EP0840739A4 (fr
Inventor
David H. Parma
Brian Hicke
Philippe Bridonneau
Larry Gold
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Gilead Sciences Inc
Original Assignee
Nexstar Pharmaceuticals Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from US08/472,256 external-priority patent/US6001988A/en
Priority claimed from US08/472,255 external-priority patent/US5766853A/en
Priority claimed from US08/479,724 external-priority patent/US5780228A/en
Application filed by Nexstar Pharmaceuticals Inc filed Critical Nexstar Pharmaceuticals Inc
Publication of EP0840739A1 publication Critical patent/EP0840739A1/fr
Publication of EP0840739A4 publication Critical patent/EP0840739A4/fr
Withdrawn legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6811—Selection methods for production or design of target specific oligonucleotides or binding molecules
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00—Drugs for disorders of the respiratory system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00—Drugs for dermatological disorders
    • A61P17/02—Drugs for dermatological disorders for treating wounds, ulcers, burns, scars, keloids, or the like
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00—Drugs for dermatological disorders
    • A61P17/06—Antipsoriatics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00—Drugs for skeletal disorders
    • A61P19/02—Drugs for skeletal disorders for joint disorders, e.g. arthritis, arthrosis
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/04—Antibacterial agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A61P35/04—Antineoplastic agents specific for metastasis
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A61P37/02—Immunomodulators
    • A61P37/06—Immunosuppressants, e.g. drugs for graft rejection
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P7/00—Drugs for disorders of the blood or the extracellular fluid
    • A61P7/02—Antithrombotic agents; Anticoagulants; Platelet aggregation inhibitors
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00—Drugs for disorders of the cardiovascular system
    • A61P9/10—Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
    • G01N2333/46—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans from vertebrates
    • G01N2333/47—Assays involving proteins of known structure or function as defined in the subgroups
    • G01N2333/4701—Details
    • G01N2333/4724—Lectins
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
    • G01N2333/705—Assays involving receptors, cell surface antigens or cell surface determinants
    • G01N2333/7056—Selectin superfamily, e.g. LAM-1, GlyCAM, ELAM-1, PADGEM
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/90—Enzymes; Proenzymes
    • G01N2333/914—Hydrolases (3)
    • G01N2333/948—Hydrolases (3) acting on peptide bonds (3.4)
    • G01N2333/95—Proteinases, i.e. endopeptidases (3.4.21-3.4.99)
    • G01N2333/964—Proteinases, i.e. endopeptidases (3.4.21-3.4.99) derived from animal tissue
    • G01N2333/96425—Proteinases, i.e. endopeptidases (3.4.21-3.4.99) derived from animal tissue from mammals
    • G01N2333/96427—Proteinases, i.e. endopeptidases (3.4.21-3.4.99) derived from animal tissue from mammals in general
    • G01N2333/9643—Proteinases, i.e. endopeptidases (3.4.21-3.4.99) derived from animal tissue from mammals in general with EC number
    • G01N2333/96433—Serine endopeptidases (3.4.21)

Definitions

  • Lectins are carbohydrate binding proteins.
  • the method utilized herein for identifying such nucleic acid ligands is called SELEX, an acronym for Systematic Evolution of Ligands by Exponential enrichment.
  • SELEX an acronym for Systematic Evolution of Ligands by Exponential enrichment.
  • proteins mediate a diverse array of biological processes which include: trafficking of lysosomal enzymes, clearance of serum proteins, endocytosis, phagocytosis, opsonization, microbial and viral infections, toxin binding, fertilization, immune and inflammatory responses, cell adhesion and migration in development and in pathological conditions such as metastasis.
  • trafficking of lysosomal enzymes clearance of serum proteins, endocytosis, phagocytosis, opsonization, microbial and viral infections, toxin binding, fertilization, immune and inflammatory responses, cell adhesion and migration in development and in pathological conditions such as metastasis.
  • Roles in symbiosis and host defense have been proposed for plant lectins but remain controversial. While the functional role of some lectins is well understood, that of many others is understood poorly or not at all.
  • the diversity and importance of processes mediated by lectins is illustrated by two well documented mammalian lectins, the asialoglycoprotein receptor and the serum mannose binding protein, and by the viral lectin, influenza virus hemagglutinin.
  • the hepatic asialoglycoprotein receptor specifically binds galactose and N-acetylgalactose and thereby mediates the clearance of serum glycoproteins that present terminal N-acetylgalactose or galactose residues, exposed by the prior removal of a terminal sialic acid.
  • the human mannose-binding protein is a serum protein that binds terminal mannose, fucose and N-acetylglucosamine residues.
  • MBP mammalian glyco-conjugates
  • the binding specificity of MBP constitutes a non-immune mechanism for distinguishing self from non-self and mediates host defense through opsonization and complement fixation.
  • Influenza virus hemagglutinin mediates the initial step of infection, attachment to nasal epithelial cells, by binding sialic acid residues of cell-surface receptors.
  • lectin mediated functions provides a vast array of potential therapeutic targets for lectin antagonists. Both lectins that bind endogenous carbohydrates and those that bind exogenous carbohydrates are target candidates. For example, antagonists to the mammalian selectins, a family of endogenous carbohydrate binding lectins, may have therapeutic applications in a variety of leukocyte-mediated disease states.
  • Inhibition of selectin binding to its receptor blocks cellular adhesion and consequently may be useful in treating inflammation, coagulation, transplant rejection, tumor metastasis, rheumatoid arthritis, reperfusion injury, stroke, myocardial infarction, burns, psoriasis, multiple sclerosis, bacterial sepsis, hypovolaemic and traumatic shock, acute lung injury, and ARDS.
  • the selectins, E-, P- and L-, are three homologous C-type lectins that recognize the tetrasaccharide, sialyl-Lewis x (C. Foxall et al, 1992, J. Cell Biol. 117,895-902). Selectins mediate the initial adhesion of neutrophils and monocytes to activated vascular endothelium at sites of inflammation (R. S. Cotran et al., 1986, J. Exp. Med. 164, 661-; M. A. Jutila et al., 1989, J. Immunol. 143,3318-; J. G. Geng et al., 1990, Nature, 757; U. H.
  • L-selectin is responsible for the homing of lymphocytes to peripheral and mesenteric lymph nodes (W. M. Gallatin et al., 1983, Nature 304,30; T. K. Kishimoto et al., 1990, Proc. Natl. Acad. Sci. 87,2244-) and P-selectin mediates the adherence of platelets to neutrophils and monocytes (S-C. Hsu-Lin et al., 1984, J. BioL Chem. 259,9121).
  • Pathol. 144, 592-598 insulitis/diabetes (X.D. Yang et al., 1993, Proc. Natl. Acad. Sci. 90,10494-10498), meningitis (C. Granet et al., 1994, J. Clin. Invest. 93, 929-936), hemorrhagic shock (R.K. Winn et al., 1994, Am J. Physiol. Heart Circ. Physiol. 267, H2391-H2397) and transplantation.
  • selectin expression has been documented in models of arthritis (F. Jamar et al., 1995, Radiology 194, 843-850), experimental allergic encephalomyelitis (J.M.
  • CD22 ⁇ , CD23, CD44 and sperm lectins (A. Varki, 1993, Glycobiol.3, 97-130; P.M. Wassarman, 1988, Ann. Rev. Biochem. 57, 415-442).
  • CD22 ⁇ is involved in early stages of B lymphocyte activation; antagonists may modulate the immune response.
  • CD23 is the low affinity IgE receptor; antagonists may modulate the IgE response in allergies and asthma.
  • CD44 binds hyaluronic acid and thereby mediates cell cell and cell/matrix adhesion; antagonists may modulate the inflammatory response.
  • Sperm lectins are thought to be involved in sperm/egg adhesion and in the acrosomal response; antagonists may be effective contraceptives, either by blocking adhesion or by inducing a premature, spermicidal acrosomal response. Antagonists to lectins that recognize exogenous carbohydrates may have wide application for the prevention of infectious diseases.
  • viruses influenza A, B and C; Sendhi, Newcastle disease, coronavirus, rotavirus, encephalomyelitis virus, enchephalomyocarditis virus, reovirus, paramyxovirus
  • lectins on the surface of the viral particle for attachment to cells, a prerequisite for infection; antagonists to these lectins are expected to prevent infection
  • Glycobiol.3, 97-130 Similarly colonization/infection strategies of many bacteria utilize cell surface lectins to adhere to mammalian cell surface glyco-conjugates. Antagonists to bacterial cell surface lectins are expected to have therapeutic potential for a wide spectrum of bacterial infections, including: gastric (Helicobacter pylori), urinary tract (E. coli), pulmonary (Klebsiella pneumoniae, Stretococcus pneumoniae, Mycoplasma pneumoniae) and oral (Actinomyces naeslundi and Actinomyces viscosus) colonization/infection (S.N.
  • gastric Helicobacter pylori
  • urinary tract E. coli
  • pulmonary Klebsiella pneumoniae, Stretococcus pneumoniae, Mycoplasma pneumoniae
  • oral Actinomyces naeslundi and Actinomyces viscosus colonization/infection
  • GalNAc ⁇ l-4Gal binding lectin mediates infection by adherence to asialogangliosides ( ⁇ GMl and ⁇ GM2) of pulmonary epithelium (L. Imundo et al., 1995, Proc. Natl. Acad. Sci 92, 3019-3023).
  • asialogangliosides ⁇ GMl and ⁇ GM2
  • pulmonary epithelium L. Imundo et al., 1995, Proc. Natl. Acad. Sci 92, 3019-3023.
  • the binding of P. aeruginosa is competed by the gangliosides' tetrasaccharide moiety, Gal ⁇ l-3GalNAc ⁇ l-4Gal ⁇ l-4Glc.
  • instillation of antibodies to Pseudomonas surface antigens can prevent lung and pleural damage (J.F.
  • Non-bacterial microbes that utilize lectins to initiate infection include Entamoeba histalytica (a Gal specific lectin that mediates adhesion to intestinal mucosa; W.A. Petri, Jr., 1991, AMS News 57:299-306) and Plasmodium faciparum (a lectin specific for the terminal Neu5 Ac(a2-3)Gal of glycophorin A of erthrocytes; PA. Orlandi et al., 1992, J. Cell Biol. 116:901-909). Antagonists to these lectins are potential therapeutics for dysentery and malaria.
  • Toxins are another class of proteins that recognize exogenous carbohydrates (K-A Karlsson, 1989, Ann. Rev. Biochem. 58:309-350). Toxins are complex, two domain molecules, composed of a functional and a cell recognition/adhesion domain.
  • the adhesion domain is often a lectin (i.e., bacterial toxins: pertussis toxin, cholera toxin, heat labile toxin, verotoxin and tetanus toxin; plant toxins: ricin and abrin).
  • Lectin antagonists are expected to prevent these toxins from binding their target cells and consequently to be useful as antitoxins.
  • lectins There are still other conditions for which the role of lectins is currently speculative. For example, genetic mutations result in reduced levels of the serum mannose-binding protein (MBP). Infants who have insufficient levels of this lectin suffer from severe infections, but adults do not. The high frequency of mutations in both oriental and Caucasian populations suggests a condition may exist in which low levels of serum mannose-binding protein are advantageous. Rheumatoid arthritis (RA) may be such a condition. The severity of RA is correlated with an increase in IgG antibodies lacking terminal galactose residues on Fc region carbohydrates (A. Young et al., 1991, Arth. Rheum. 34, 1425-1429; I.M. Roitt et al., 1988, J.
  • Lectin antagonists may also be useful as imaging agents or diagnostics.
  • E-selectin antagonists may be used to image inflamed endothelium.
  • antagonists to specific serum lectins i.e. mannose-binding protein, may also be useful in quantitating protein levels.
  • Lectins are often complex, multi-domain, multimeric proteins.
  • the carbohydrate-binding activity of mammalian lectins is normally the property of a carbohydrate recognition domain or CRD.
  • the CRDs of mammalian lectins fall into three phylogenetically conserved classes: C-type, S-type and P-type (K. Drickamer and M.E. Taylor, 1993, Annu. Rev. Cell Biol. 9, 237-264).
  • C-type lectins require Ca"-" "1" for ligand binding, are extracellular membrane and soluble proteins and, as a class, bind a variety of carbohydrates.
  • S-type lectins are most active under reducing conditions, occur both intra- and extracellularly, bind ⁇ -galactosides and do not require Ca 4-1 ".
  • P-type lectins bind mannose 6-phosphate as their primary ligand.
  • lectin specificity is usually expressed in terms of monosaccharides and/or oligosacchrides (i.e., MBP binds mannose, fucose and N- acetylglucosamine), the affinity for monosaccharides is weak.
  • the dissociation constants for monomeric saccharides are typically in the millimolar range (Y.C. Lee, 1992, FASEB J. 6:3193-3200; G.D. Glick et al., 1991, J Biol.Chem. 266:23660- 23669; Y. Nagata and M.M. Burger, 1974, J. Biol. Chem. 249:116-3122).
  • Co-crystals of MBP complexed with mannose oligomers offer insight into the molecular limitations on affinity and specificity of C-type lectins (W.I. Weis et al., 1992, Nature 360:127-134; K. Drickamer, 1993, Biochem. Soc. Trans. 21:456- 459).
  • the 3- and 4-hydroxyl groups of mannose form coordination bonds with bound Ca"*""- " ion #2 and hydrogen bonds with glutamic acid (185 and 193) and asparagine (187 and 206).
  • the limited contacts between the CRD and bound sugar are consistent with its spectrum of monosaccharide binding; N-acetylglucosamine has equatorial 3- and 4-hydroxyls while fucose has similarly configured hydroxyls at the 2 and 3 positions.
  • the affinity of the mannose-binding protein and other lectins for their natural ligands is greater than that for monosaccharides. Increased specificity and affinity can be accomplished by establishing additional contacts between a protein and its ligand (K.
  • Drickamer, 1993, supra either by 1) additional contacts with the terminal sugar (i.e., chicken hepatic lectin binds N-acetylglucose amine with greater affinity than mannose or fucose suggesting interaction with the 2-substituent); 2) clustering of CRDs for binding complex oligosaccharides (i.e., the mammalian asialylglycoprotein receptor); 3) interactions with additional saccharide residues (i.e., the lectin domain of selectins appears to interact with two residues of the tetrasaccharide sialyl-Lewis-* ⁇ : with the charged terminal residue, sialic acid, and with the fucose residue; wheat germ agglutinin appears to interact with all three residues of trimers of N-acetylglucosamine); or by 4) contacts with a non- carbohydrate portion of a glyco-protein.
  • the terminal sugar i.e., chicken hepatic lectin binds
  • the first approach has had limited success.
  • homologues of sialic acid have been analyzed for affinity to influenza virus hemagglutinin (SJ. Watowich et al. 1994, Structure 2:719-731).
  • the dissociation constants of the best analogues are 30 to 300 ⁇ M which is only 10 to 100-fold better than the standard monosaccharide.
  • sialyl-Lewis a and sialyl-Lewis x have IC50S of 220 ⁇ M and 750 ⁇ M, respectively, for the inhibition of the binding of an
  • Lectins are nearly ideal targets for isolation of antagonists by SELEX technology described below. The reason is that oligonucleotide ligands that are bound to the carbohydrate binding site can be specifically eluted with the relevant sugar(s). Oligonucleotide ligands with affinities that are several orders of magnitude greater than that of the competing sugar can be obtained by the appropriate manipulation of the nucleic acid ligand to competitor ratio. Since the carbohydrate binding site is the active site of a lectin, essentially all ligands isolated by this procedure will be antagonists. In addition, these SELEX ligands will exhibit much greater specificity than monomeric and oligomeric saccharides.
  • SELEX Systematic Evolution of Ligands by Exponential enrichment
  • the SELEX method involves selection from a mixture of candidate oligonucleotides and step-wise iterations of binding, partitioning and amplification, using the same general selection scheme, to achieve virtually any desired criterion of binding affinity and selectivity.
  • the SELEX method includes steps of contacting the mixture with the target under conditions favorable for binding, partitioning unbound nucleic acids from those nucleic acids which have bound specifically to target molecules, dissociating the nucleic acid-target complexes, amplifying the nucleic acids dissociated from the nucleic acid-target complexes to yield a ligand-enriched mixture of nucleic acids, then reiterating the steps of binding, partitioning, dissociating and amplifying through as many cycles as desired to yield highly specific, high affinity nucleic acid ligands to the target molecule.
  • the SELEX method encompasses the identification of high-affinity nucleic acid ligands containing modified nucleotides conferring improved characteristics on the ligand, such as improved in vivo stability or improved delivery characteristics. Examples of such modifications include chemical substitutions at the ribose and/or phosphate and/or base positions. SELEX-identified nucleic acid ligands containing modified nucleotides are described in United States Patent Application Serial No. 08/117,991, filed September 8, 1993, entitled "High Affinity Nucleic Acid Ligands Containing Modified Nucleotides," that describes oligonucleotides containing nucleotide derivatives chemically modified at the 5- and 2'-positions of pyrimidines.
  • Patent Application Serial No. 08/264,029 filed June 22, 1994, entitled “Novel Method of Preparation of 2' Modified Pyrimidine Intramolecular Nucleophilic Displacement," describes novel methods for making 2'-modified nucleosides.
  • the SELEX method encompasses combining selected oligonucleotides with other selected oligonucleotides as described in United States Patent Application Serial No. 08/284,063, filed August 2, 1994, entitled “Systematic Evolution of Ligands by Exponential Enrichment: Chimeric SELEX”.
  • the SELEX method also includes combining the selected nucleic acid ligands with non-oligonucleotide functional units and United States Patent Application Serial No. 08/234,997, filed April 28, 1994, entitled “Systematic Evolution of Ligands by Exponential Enrichment: Blended SELEX” and United States Patent Application Serial No. 08/434,465, filed May 4, 1995, entitled "Nucleic Acid Ligand Complexes”.
  • the present invention applies the SELEX methodology to obtain nucleic acid ligands to lectin targets.
  • Lectin targets, or lectins include all the non-enzymatic carbohydrate-binding proteins of non-immune origin, which include, but are not limited to, those described above.
  • high affinity nucleic acid ligands to wheat germ agglutinin, and various selectin proteins have been isolated.
  • wheat germ agglutinin, wheat germ lectin and WGA are used interchangeably.
  • Wheat germ agglutinin (WGA) is widely used for isolation, purification and structural studies of glyco-conjugates. As outlined above, the selectins are important anti-inflammatory targets.
  • Antagonists to the selectins modulate extravasion of leukocytes at sites of inflammation and thereby reduce neutrophil caused host tissue damage.
  • SELEX technology high affinity antagonists of L-selectin, E- selectin and P-selectin mediated adhesion are isolated.
  • the present invention includes methods of identifying and producing nucleic acid ligands to lectins and the nucleic acid ligands so identified and produced. More particularly, nucleic acid ligands are provided that are capable of binding specifically to Wheat Germ Agglutinin (WGA), L-Selectin, E-selectin and P-selectin.
  • WGA Wheat Germ Agglutinin
  • L-Selectin L-Selectin
  • E-selectin E-selectin
  • P-selectin P-selectin
  • nucleic acid ligands and nucleic acid ligand sequences to lectins comprising the steps of (a) preparing a candidate mixture of nucleic acids, (b) partitioning between members of said candidate mixture on the basis of affinity to said lectin, and (c) amplifying the selected molecules to yield a mixture of nucleic acids enriched for nucleic acid sequences with a relatively higher affinity for binding to said lectin.
  • the present invention includes the nucleic acid ligands to lectins identified according to the above-described method, including those ligands to Wheat Germ Agglutinin listed in Table 2, those ligands to L-selectin listed in Tables 8, 12 and 16, and those ligands to P-selectin listed in Tables 19 and 25. Additionally, nucleic acid ligands to E-selectin and serum mannose binding protein are provided. Also included are nucleic acid ligands to lectins that are substantially homologous to any of the given ligands and that have substantially the same ability to bind lectins and antagonize the ability of the lectin to bind carbohydrates.
  • nucleic acid ligands to lectins that have substantially the same structural form as the ligands presented herein and that have substantially the same ability to bind lectins and antagonize the ability of the lectin to bind carbohydrates.
  • the present invention also includes modified nucleotide sequences based on the nucleic acid ligands identified herein and mixtures of the same.
  • the present invention also includes the use of the nucleic acid ligands in therapeutic, prophylactic and diagnostic applications.
  • Figure 1 shows consensus hairpin secondary structures for WGA 2'-NE_2 RNA ligands: (a) family 1, (b) family 2 and (c) family 3. Nucleotide sequence is in standard one letter code. Invariant nucleotides are in bold type. Nucleotides derived from fixed sequence are in lower case.
  • Figure 2 shows binding curves for the L-selectin SELEX second and ninth round 2'-NH2 RNA pools to peripheral blood lymphocytes (PBMCs).
  • Figure 3 shows binding curves for random 40N7 2 -NH2 RNA (SEQ ED
  • PBMC peripheral blood lymphocytes
  • Figure 4 shows the results of a competition experiment in which the binding of 5 nM 32 P-labeled F14.12 (SEQ ID NO: 78) to PBMCs (10 7 /ml) is competed with increasing concentrations of unlabeled F14.12 (SEQ ID NO: 78).
  • RNA Bound equals 100 x (net counts bound in the presence of competitor/net counts bound in the absence of competitor).
  • Figure 5 shows the results of a competition experiment in which the binding of 5 nM 3 P-labeled F14.12 (SEQ ID NO: 78) to PBMCs (10 7 /ml) is competed with increasing concentrations of the blocking monoclonal anti-L-selectin antibody, DREG-56, or an isotype matched, negative control antibody.
  • RNA Bound equals 100 x (net counts bound in the presence of competitor/net counts bound in the absence of competitor).
  • Figure 6 shows the results of a competitive ELISA assay in which the binding of soluble LS-Rg to immobilized sialyl-Lewis x /BS A conjugates is competed with increasing concentrations of unlabeled F14.12 (SEQ ID NO: 78). Binding of LS-Rg was monitored with an HRP conjugated anti-human IgG antibody. LS-Rg Bound equals 100 x (OD450 in the presence of competitor)/(OD450 in the absence of competitor). The observed OD450 was corrected for nonspecific binding by subtracting the OD450 in the absence of LS-Rg from the experimental values. In the absence of competitor the OD450 was 0.324 and in the absence of LS-Rg 0.052.
  • Binding of LS-Rg requires divalent cations; in the absence of competitor, replacement of Ca++/Mg ++ with 4 mM EDTA reduced the OD450 to 0.045.
  • Figure 7 shows hairpin secondary structures for representative L-selectin 2'NH2 RNA ligands: (a) F13.32 (SEQ. ID NO: 67), family I; (b) 6.16 (SEQ. ID NO: 67), family I; (b) 6.16 (SEQ. ID NO: 67), family I; (b) 6.16 (SEQ. ID NO: 67), family I; (b) 6.16 (SEQ. ID NO:
  • Figure 8 shows a schematic representation of each dimeric and mutimeric oligonucleotide complex: (a) dimeric branched oligonucleotide; (b) multivalent streptavidin bio-oUgonucleotide complex (A: streptavidin; B: biotin); (c) dimeric dumbell oligonucleotide; (d) dimeric fork oligonucleotide.
  • Figure 9 shows binding curves for the L-selectin SELEX fifteenth round ssDNA pool to PBMCs (10 7 /ml).
  • Figure 10 shows the results of a competition experiment in which the binding of 2 nM 32 P-labeled round 15 ssDNA to PBMCs (10 7 /ml) is competed with increasing concentrations of the blocking monoclonal anti-L-selectin antibody, DREG-56, or an isotype matched, negative control antibody.
  • RNA Bound equals 100 x (net counts bound in the presence of competitor/net counts bound in the absence of competitor).
  • Figure 11 shows L-selectin specific binding of LD201T1 (SEQ ID NO: 185) to human lymphocytes and granulocytes in whole blood
  • a FITC-LD201T1 binding to lymphocytes is competed by DREG-56, unlabeled LD201T1, and inhibited by EDTA.
  • b F1TC-LD201T1 binding to granulocytes is competed by DREG-56, unlabeled LD201T1, and inhibited by EDTA.
  • Figure 12 shows the consensus hairpin secondary structures for family 1 ssDNA ligands to L-selectin.
  • Nucleotide sequence is in standard one letter code. Invariant nucleotides are in bold type. The base pairs at highly variable positions are designated N-N'. To the right of the stem is a matrix showing the number of occurances of particular base pairs for the position in the stem that is on the same line.
  • Figure 13 shows that in vitro pre-treatment of human PBMC with NX288 (SEQ ID NO: 193) inhibits lymphocyte trafficking to SOD mouse PLN.
  • Human PBMC were purified from heparinised blood by a Ficoll-Hypaque gradient, washed twice with HBSS (calcium/magnesium free) and labeled with ⁇ C ⁇ (Amersham). After labeling, the cells were washed twice with HBSS (containing calcium and magnesium) and 1% bovine serum albumin (Sigma).
  • HBSS containing calcium and magnesium
  • bovine serum albumin Sigma
  • the cells were either untreated or mixed with either 13 pmol of antibody (DREG-56 or MEL- 14), or 4, 1, or 0.4 nmol of modified oligonucleotide.
  • 13 pmol of antibody DREG-56 or MEL- 14
  • 4 1, or 0.4 nmol of modified oligonucleotide.
  • PLN, MLN, Peyer's patches, spleen, liver, lungs, thymus, kidneys and bone marrow were removed and the counts incorporated into the organs determined by a Packard gamma counter. Values shown represent the mean ⁇ s.e. of triplicate samples, and are representative of 3 experiments.
  • Figure 14 shows that pre-injection of NX288 (SEQ ID NO: 193) inhibits human lymphocyte trafficking to SCID mouse PLN and MLN.
  • Human PBMC were purified, labeled, and washed as described above.
  • Cells were prepared as described in Figure 13.
  • Female SCID mice (6-12 weeks of age) were injected intravenously with 2xl ⁇ 6 cells. One to 5 min prior to injecting the cells, the animals were injected with either 15 pmol DREG-56 or 4 nmol modified oligonucleotide. Animals were scarificed 1 hour after injection of cells.
  • Counts incorporated into organs were quantified as described in Figure 13. Values shown represent the mean ⁇ s.e. of triplicate samples, and are representative of 2 experiments.
  • Figure 15 shows the consensus hairpin secondary structures for 2'-F RNA ligands to L-selectin.
  • Nucleotide sequence is in standard one letter code. Invariant nucleotides are in bold type. The base pairs at highly variable positions are designated N-N'. To the right of the stem is a matrix showing the number of occurances of particular base pairs for the position in the stem that is on the same line.
  • Figure 16 shows the consensus hairpin secondary structures for 2'-F RNA ligands to P-selectin.
  • Nucleotide sequence is in standard one letter code. Invariant nucleotides are in bold type. The base pairs at highly variable positions are designated N-N'. To the right of the stem is a matrix showing the number of occurances of particular base pairs for the position in the stem that is on the same line.
  • These applications, each specifically incorporated herein by reference, are collectively called the SELEX Patent Applications.
  • the SELEX process may be defined by the following series of steps:
  • a candidate mixture of nucleic acids of differing sequence is prepared.
  • the candidate mixture generally includes regions of fixed sequences (i.e., each of the members of the candidate mixture contains the same sequences in the same location) and regions of randomized sequences.
  • the fixed sequence regions are selected either: (a) to assist in the amplification steps described below, (b) to mimic a sequence known to bind to the target, or (c) to enhance the concentration of a given structural arrangement of the nucleic acids in the candidate mixture.
  • the randomized sequences can be totally randomized (i.e., the probability of finding a base at any position being one in four) or only partially randomized (e.g., the probability of finding a base at any location can be selected at any level between 0 and 100 percent).
  • the candidate mixture is contacted with the selected target under conditions favorable for binding between the target and members of the candidate mixture. Under these circumstances, the interaction between the target and the nucleic acids of the candidate mixture can be considered as forming nucleic acid- target pairs between the target and those nucleic acids having the strongest affinity for the target.
  • nucleic acids with the highest affinity for the target are partitioned from those nucleic acids with lesser affinity to the target. Because only an extremely small number of sequences (and possibly only one molecule of nucleic acid) corresponding to the highest affinity nucleic acids exist in the candidate mixture, it is generally desirable to set the partitioning criteria so that a significant amount of the nucleic acids in the candidate mixture (approximately .05-50%) are retained during partitioning.
  • nucleic acids selected during partitioning as having the relatively higher affinity to the target are then amplified to create a new candidate mixture that is enriched in nucleic acids having a relatively higher affinity for the target.
  • the newly formed candidate mixture contains fewer and fewer unique sequences, and the average degree of affinity of the nucleic acids to the target will generally increase.
  • the SELEX process will yield a candidate mixture containing one or a small number of unique nucleic acids representing those nucleic acids from the original candidate mixture having the highest affinity to the target molecule.
  • the SELEX Patent Applications describe and elaborate on this process in great detail. Included are targets that can be used in the process; methods for partitioning nucleic acids within a candidate mixture; and methods for amplifying partitioned nucleic acids to generate enriched candidate mixture.
  • the SELEX Patent Applications also describe ligands obtained to a number of target species, including both protein targets where the protein is and is not a nucleic acid binding protein.
  • This invention also includes the ligands as described above, wherein certain chemical modifications are made in order to increase the in vivo stability of the ligand or to enhance or mediate the delivery of the ligand.
  • modifications include chemical substitutions at the sugar and/ or phosphate and/or base positions of a given nucleic acid sequence. See, e.g., U.S. Patent Application Serial No. 08/117,991, filed September 9, 1993, entitled "High Affinity Nucleic Acid Ligands Containing Modified Nucleotides" which is specifically incorporated herein by reference. Additionally, in co-pending and commonly assigned U.S. Patent Application Serial No. 07/964,624, filed October 21, 1992 ('624), now U.S. Patent No.
  • nucleic acid ligands of the invention can be complexed with various other compounds, including but not limited to, lipophilic compounds or non-immunogenic, high molecular weight compounds.
  • Lipophilic compounds include, but are not limited to, cholesterol, dialkyl glycerol, and diacyl glycerol.
  • Non-immunogenic, high molecular weight compounds include, but are not Umited to, polyethylene glycol, dextran, albumin and magnetite.
  • the nucleic acid ligands described herein can be complexed with a lipophilic compound (e.g., cholesterol) or attached to or encapsulated in a complex comprised of lipophilic components (e.g., a liposome).
  • the complexed nucleic acid ligands can enhance the cellular uptake of the nucleic acid ligands by a cell for delivery of the nucleic acid ligands to an intracellular target.
  • the complexed nucleic acid ligands can also have enhanced pharmacokinetics and stability.
  • United States Patent Application Serial Number 08/434,465, filed May 4, 1995, entitled "Nucleic Acid Ligand Complexes,” which is herein incorporated by reference describes a method for preparing a therapeutic or diagnostic complex comprised of a nucleic acid ligand and a lipophilic compound or a non-immunogenic, high molecular weight compound.
  • nucleic acid ligands identified by such methods are useful for both therapeutic and diagnostic purposes.
  • Therapeutic uses include the treatment or prevention of diseases or medical conditions in human patients. Many of the therapeutic uses are described in the background of the invention, particularly, nucleic acid ligands to selectins are useful as anti- inflammatory agents. Antagonists to the selectins modulate extravasion of leukocytes at sites of inflammation and thereby reduce neutrophil caused host tissue damage. Diagnostic utilization may include both in vivo or in vitro diagnostic applications.
  • the SELEX method generally, and the specific adaptations of the SELEX method taught and claimed herein specifically, are particularly suited for diagnostic applications. SELEX identifies nucleic acid ligands that are able to bind targets with high affinity and with surprising specificity. These characteristics are, of course, the desired properties one skilled in the art would seek in a diagnostic ligand.
  • the nucleic acid ligands of the present invention may be routinely adapted for diagnostic purposes according to any number of techniques employed by those skilled in the art. Diagnostic agents need only be able to allow the user to identify the presence of a given target at a particular locale or concentration. Simply the ability to form binding pairs with the target may be sufficient to trigger a positive signal for diagnostic purposes. Those skilled in the art would also be able to adapt any nucleic acid ligand by procedures known in the art to incorporate a labeling tag in order to track the presence of such ligand. Such a tag could be used in a number of diagnostic procedures.
  • the nucleic acid ligands to lectin, particularly selectins, described herein may specifically be used for identification of the lectin proteins.
  • SELEX provides high affinity ligands of a target molecule. This represents a singular achievement that is unprecedented in the field of nucleic acids research.
  • the present invention applies the SELEX procedure to lectin targets. Specifically, the present invention describes the identification of nucleic acid ligands to Wheat Germ Agglutinin, and the selectins, specifically, L-selectin, P-selectin and E-selectin. In the Example section below, the experimental parameters used to isolate and identify the nucleic acid ligands to lectins are described.
  • the nucleic acid ligand (1) binds to the target in a manner capable of achieving the desired effect on the target; (2) be as small as possible to obtain the desired effect; (3) be as stable as possible; and (4) be a specific ligand to the chosen target. In most situations, it is preferred that the nucleic acid ligand have the highest possible affinity to the target.
  • a SELEX experiment was performed in search of nucleic acid ligands with specific high affinity for Wheat Germ Agglutinin from a degenerate library containing 50 random positions (50N).
  • This invention includes the specific nucleic acid ligands to Wheat Germ Agglutinin shown in Table 2 (SEQ ID NOS: 4-55), identified by the methods described in Examples 1 and 2.
  • RNA ligands containing 2'-NH2 modified pyrimidines are provided.
  • the scope of the ligands covered by this invention extends to all nucleic acid ligands of Wheat Germ Agglutinin, modified and unmodified, identified according to the SELEX procedure. More specifically, this invention includes nucleic acid sequences that are substantially homologous to the ligands shown in Table 2.
  • substantially homologous it is meant a degree of primary sequence homology in excess of 70%, most preferably in excess of 80%.
  • this invention also includes nucleic acid ligands that have substantially the same ability to bind Wheat Germ Agglutinin as the nucleic acid ligands shown in Table 2.
  • substantially the same ability to bind Wheat Germ Agglutinin means that the affinity is within a few orders of magnitude of the affinity of the ligands described herein. It is well within the skill of those of ordinary skill in the art to determine whether a given sequence — substantially homologous to those specifically described herein - has substantially the same ability to bind Wheat Germ Agglutinin.
  • RNA ligands containing 2'-NH2 or 2'-F pyrimidines and ssDNA ligands are provided.
  • nucleic acid ligands of L-selectin modified and unmodified, identified according to the SELEX procedure. More specifically, this invention includes nucleic acid sequences that are substantially homologous to the ligands shown in Tables 8, 12 and 16. By substantially homologous it is meant a degree of primary sequence homology in excess of 70%, most preferably in excess of 80%. A review of the sequence homologies of the ligands of L-selectin shown in Tables 8, 12 and 16 shows that sequences with little or no primary homology may have substantially the same ability to bind L-selectin.
  • this invention also includes nucleic acid ligands that have substantially the same ability to bind L-selectin as the nucleic acid ligands shown in Tables 8, 12 and 16.
  • Substantially the same ability to bind L- selectin means that the affinity is within a few orders of magnitude of the affinity of the ligands described herein. It is well within the skill of those of ordinary skill in the art to determine whether a given sequence -- substantially homologous to those specifically described herein - has substantially the same ability to bind L-selectin.
  • SELEX experiments were performed in search of nucleic acid ligands with specific high affinity for P-selectin from degenerate libraries containing 50 random positions (50N).
  • This invention includes the specific nucleic acid ligands to P-selectin shown in Tables 19 and 25 (SEQ ID NOS: 199- 247 and 251-290), identified by the methods described in Examples 27, 28, 35 and 36. Specifically, RNA ligands containing 2'-NH2 and 2'-F pyrimidines are provided. The scope of the ligands covered by this invention extends to all nucleic acid ligands of P-selectin, modified and unmodified, identified according to the SELEX procedure. More specifically, this invention includes nucleic acid sequences that are substantially homologous to the ligands shown in Tables 19 and 25.
  • substantially homologous it is meant a degree of primary sequence homology in excess of 70%, most preferably in excess of 80%.
  • sequence homologies of the ligands of P-selectin shown in Tables 19 and 25 shows that sequences with little or no primary homology may have substantially the same ability to bind P-selectin.
  • this invention also includes nucleic acid ligands that have substantially the same ability to bind P-selectin as the nucleic acid ligands shown in Tables 19 and 25.
  • Substantially the same ability to bind P-selectin means that the affinity is within a few orders of magnitude of the affinity of the ligands described herein.
  • the present invention includes multivalent Complexes comprising the nucleic acid ligands of the invention.
  • the mulivalent Complexes increase the binding energy to facilitate better binding affinities through slower off- rates of the nucleic acid ligands.
  • the multivalent Complexes may be useful at lower doses than their monomeric counterparts.
  • high molecular weight polyethylene glycol was included in some of the Complexes to decrease the in vivo clearance rate of the Complexes.
  • nucleic acid ligands to L-selectin were placed in multivalent Complexes.
  • nucleic acid ligands to lectins described herein are useful as pharmaceuticals.
  • This invention also includes a method for treating lectin-mediated diseases by administration of a nucleic acid ligand capable of binding to a lectin.
  • compositions of the nucleic acid ligands may be administered parenterally by injection, although other effective administration forms, such as intraarticular injection, inhalant mists, orally active formulations, transdermal iontophoresis or suppositories, are also envisioned.
  • One preferred carrier is physiological saline solution, but it is contemplated that other pharmaceutically acceptable carriers may also be used.
  • the carrier and the ligand constitute a physiologically-compatible, slow release formulation.
  • the primary solvent in such a carrier may be either aqueous or non- aqueous in nature.
  • the carrier may contain other pharmacologically- acceptable excipients for modifying or maintaining the pH, osmolarity, viscosity, clarity, color, sterility, stability, rate of dissolution, or odor of the formulation.
  • the carrier may contain still other pharmacologically-acceptable excipients for modifying or maintaining the stability, rate of dissolution, release, or absorption of the ligand.
  • excipients are those substances usually and customarily employed to formulate dosages for parental administration in either unit dose or multi-dose form.
  • the therapeutic composition may be stored in sterile vials as a solution, suspension, gel, emulsion, solid, or dehydrated or lyophilized powder. Such formulations may be stored either in a ready to use form or requiring reconstitution immediately prior to administration.
  • the manner of administering formulations containing nucleic acid ligands for systemic delivery may be via subcutaneous, intramuscular, intravenous, intranasal or vaginal or rectal suppository.
  • oligonucleotide selectin antagonists include:
  • mice for peritoneal inflammation (P. Pizcueta and F.W. Luscinskas, 1994, Am. J. Pathol. 145, 461-469), diabetes (A.C. Hanninen et al., 1992, J. Clin. Invest. 92, 2509-2515), lymphocyte trafficking (L.M. Bradley et al., 1994, J. Exp. Med., 2401-2406), glomerulonephritis (P.G. Tipping et al., 1994, Kidney Int. 46, 79-88), experimental allergic encephalomyelitis ( J.M. Dopp et al., 1994, J. Neuroimmunol.
  • nucleic acid ligands to lectins described herein are useful as pharmaceuticals and as diagnostic reagents.
  • Examples The following examples are illustrative of certain embodiments of the invention and are not to be construed as limiting the present invention in any way.
  • Examples 1-6 describe identification and characterization of 2'-NH2 RNA ligands to Wheat Germ Agglutinin.
  • Examples 7-12 described identification and characterization of 2 -NH2 RNA ligands to L-selectin.
  • Examples 13-21 describe identification and characterization of ssDNA ligands to L-selectin.
  • Examples 22-25 describe identification and characterization of 2'-F RNA ligands to L-selectin.
  • Example 26 describes identification of ssDNA ligands to P-selectin.
  • Examples 27- 39 describes identification and characterization of 2 -NH2 and 2'-F RNA ligands to
  • Example 40 describes identification of nucleic acid ligands to E-selectin.
  • Example 1 Nucleic Acid Ligands to Wheat Germ Agglutinin The experimental procedures outlined in this Example were used to identify and characterize nucleic acid ligands to wheat germ agglutinin (WGA) as described in Examples 2-6. Experimental Procedures A) Materials Wheat Germ Lectin (Triticum vulgare) Sepharose 6MB beads were purchased from Pharmacia Biotech. Wheat Germ Lectin, Wheat Germ Agglutinin, and WGA are used interchangeably herein.
  • WGA wheat germ agglutinin
  • Free Wheat Germ Lectin Triticum vulgare
  • all other lectins were obtained from E Y Laboratories; methyl-oc-D- mannopyranoside was from Calbiochem and N-acetyl-D-glucosamine, GlcNAc, and the trisaccharide N N N'-triacetylchitotriose, (GlcNAc)3, were purchased from
  • the DNA template for the initial RNA pool contained 50 random nucleotides, flanked by N9 5' and 3' fixed regions (50N9) 5' gggaaaagcgaaucauacacaaga-50N- gcuccgccagagaccaaccgagaa 3' (SEQ ID NO: 1). All C and U have 2 -NH2 substituted for 2'-OH for ribose.
  • the primers for the PCR were the following: 5' Primer 5' taatacgactcactatagggaaaagcgaatcatacacaaga 3' (SEQ ID NO: 2) and 3' Primer 5' ttctcggttggtctctggcggagc 3' (SEQ ED NO: 3).
  • the fixed regions of the starting random pool include DNA primer annealing sites for PCR and cDNA synthesis as well as the consensus T7 promoter region to allow in vitro transcription. These single-stranded DNA molecules were converted into double- stranded transcribable templates by PCR amplification.
  • PCR conditions were 50 mM KCl, 10 mM Tris-Cl, pH 8.3, 0.1% Triton X-100, 7.5 mM MgC_2, 1 mM of each dATP, dCTP, dGTP, and dTTP, and 25 U/ml of Taq DNA polymerase.
  • Transcription reactions contained 5 mM DNA template, 5 units/ ⁇ l T7 RNA polymerase, 40 mM Tris-Cl (pH 8.0), 12 mM MgCl2, 5 mM DTT, 1 mM spermidine, 0.002% Triton X-100, 4 % PEG 8000, 2 mM each of 2'-OH ATP, 2'- OH GTP, 2'-NH2 CTP, 2'-NH2 UTP, and 0.31 mM ⁇ - 32 P 2'-OH ATP.
  • the strategy for partitioning WGA/RNA complexes from unbound RNA was 1) to incubate the RNA pool with WGA immobilized on sepharose beads; 2) to remove unbound RNA by extensive washing; and 3) to specifically elute RNA molecules bound at the carbohydrate binding site by incubating the washed beads in buffer containing high concentrations of (GlcNAc)3.
  • the SELEX protocol is outlined in Table 1.
  • the WGA density on Wheat Germ Lectin Sepharose 6MB beads is approximately 5 mg/ml of gel or 116 ⁇ M (manufacturer's specifications).
  • the immobilized WGA was incubated with RNA at room temperature for 1 to 2 hours in a 2 ml siliconized column with constant rolling (Table 1). Unbound RNA was removed by extensive washing with HBSS. Bound RNA was eluted as two fractions; first, nonspecifically eluted RNA was removed by incubating and washing with 10 mM methyl- ⁇ -D-mannopyranoside in HBSS (Table 1).
  • a nitrocellulose filter partitioning method was used to determine the affinity of RNA ligands for WGA and for other proteins.
  • Filter discs nitrocellulose/cellulose acetate mixed matrix, 0.45 ⁇ m pore size, Millipore; or pure nitrocellulose, 0.45 ⁇ m pore size, Bio-Rad
  • Reaction mixtures containing 32 P labeled RNA pools and unlabeled WGA. were incubated in HBSS for 10 min at room temperature, filtered, and then immediately washed with 4 ml HBSS.
  • Kds were determined by least square fitting of the data points using the graphics program Kaleidagraph (Synergy Software, Reading , PA).
  • the sixth and eleventh round PCR products were re-amplified with primers which contain a BamHl or a EcoRl restriction endonuclease recognition site. Using these restriction sites the DNA sequences were inserted directionally into the pUC18 vector. These recombinant plasmids were transformed into E. coli strain JM109
  • Plasmid DNA was prepared according to the alkaline hydrolysis method (Zhou et al., 1990 Biotechniques 8:172-173) and about 72 clones were sequenced using the Sequenase protocol (United States Biochemical Corporation, Cleveland, OH). The sequences are provided in Table 2.
  • %[PL] [PL]/[PLo]*(M-B)+B
  • a non-linear least-squares fitting procedure was used as described by P.R. Bevington (1969) Data Reduction and Error jAnalysis for the Physical Sciences, McGraw-Hill publishers. The program used was originally written by Stanley J. Gill in MatLab and modified for competition analysis by Stanley C. Gill. The data were fit to equations 1-3 to obtain best fit parameters for K , M and B as a function of [CT] while leaving K and PT fixed.
  • Agglutination is a readily observed consequence of the interaction of a lectin with cells and requires that individual lectin molecules crosslink two or more cells. Lectin mediated agglutination can be inhibited by sugars with appropriate specificity.
  • Visual assay of the hemagglutinating activity of WGA and the inhibitory activity of RNA ligands, GlcNAc and (GlcNAc)3 was made in Falcon round bottom 96 well microtiter plates,- using sheep erythrocytes. Each well contained 54 ⁇ l of erythrocytes (2.5 x 10-*-* cells/ml) and 54 ⁇ l of test solution.
  • each test solution contained a WGA dilution from a 4-fold dilution series.
  • the final WGA concentrations ranged from 0.1 pM to 0.5 ⁇ M.
  • the test solutions contained 80 nM WGA (monomer) and a dilution from a 4-fold dilution series of the designated inhibitor. Reaction mixtures were incubated at room temperature for 2 hours, after which time no changes were observed in the precipitation patterns of erythrocytes.
  • erythrocytes settle as a compact pellet. Agglutinated cells form a more diffuse pellet. Consequently, in visual tests, the diameter of the pellet is diagnostic for agglutination.
  • the inhibition experiments included positive and negative controls for agglutination and appropriate controls to show that the inhibitors alone did not alter the normal precipitation pattern.
  • the starting RNA library for SELEX contained approximately 2 x IO 15 molecules (2 nmol RNA).
  • the SELEX protocol is outlined in Table 1. Binding of randomized RNA to WGA is undetectable at 36 ⁇ M WGA monomer. The dissociation constant of this interaction is estimated to be > 4 mM.
  • the percentage of input RNA eluted by (GlcNAc)3 increased from 0.05 % in the first round, to 28.5 % in round 5 (Table 1).
  • the bulk Kd of round 5 RNA was 600 nM (Table 1).
  • the Kd of round 11 RNA was 68 nM. Sequencing of the bulk starting RNA pool and sixth and eleventh round RNA revealed some nonrandomness in the variable region at the sixth round and increased nonrandomess at round eleven. To monitor the progess of SELEX, ligands were cloned and sequenced from round 6b and round 11. From each of the two rounds, 36 randomly picked clones were sequenced. Sequences were aligned manually and are shown in Table 2.
  • ligands sequences are shown in standard single letter code (Comish-Bowden, 1985 NAR 13: 3021-3030). Sequences that were isolated more than once are indicated by the parenthetical number, (n), following the ligand isolate number. These clones fall into nine sequence families (1 - 9) and a group of unrelated sequences (Orphans).
  • Alignment defines consensus sequences for families 1-4 and 6-9 (SEQ ID NOS: 56-63).
  • the consensus sequences of families 1-3 are long (20, 16 and 16, respectively) and very highly conserved.
  • the consensus sequences of families 1 and 2 contain two sequences in common: the trinucleotide TCG and the pentanucleotide ACGAA.
  • a related tetranucleotide, AACG occurs in family 3.
  • the variation in position of the consensus sequences within the variable regions indicates that the ligands do not require a specific sequence from either the 5' or 3' fixed region.
  • consensus sequences of family 1 and 2 are flanked by complementary sequences 5 or more nucleotides in length. These complementary sequences are not conserved and the majority include minor discontinuities. Family 3 also exhibits flanking complementary sequences, but these are more variable in length and structure and utilize two nucleotide pairs of conserved sequence.
  • the dissociation constants for representative members of families 1-9 and orphan ligands were determined by nitrocellulose filter binding experiments and are listed in Table 3. These calculations assume one RNA ligand binding site per WGA monomer. At the highest WGA concentration tested (36 ⁇ M WGA monomer), binding of random RNA is not observed, indicating a Kd at least 100-fold higher than the protein concentration or > 4 mM.
  • RNA ligands to WGA bind monophasically.
  • the range of measured dissociation constants is 1.4 nM to 840 nM.
  • the dissociation constants of these ligands are estimated to be greater than 20 ⁇ M.
  • eleventh round isolates have higher affinity than those from the sixth round.
  • the affinity of WGA ligands 6.8, 11.20 and 11.24 (SEQ ID NOS: 13, 40, and 19) for GlcNAc binding lectins from Ulex europaeus, Datura stramonium and Canavalia ensiformis were determined by nitrocellulose partitioning. The results of this determination are shown in Table 4.
  • the ligands are highly specific for WGA. For example, the affinity of ligand 11.20 for WGA is 1,500, 8,000 and > 15,000 fold greater than it is for the U. europaeus, D. stramonium and C. ensiformis lectins, respectively. The 8,000 fold difference in affinity for ligand 11.20 exhibited by T. vulgare and D.
  • stramonium compares to a 3 to 10 fold difference in their affinity for oligomers of GlcNAc and validates the proposition that competitive elution allows selection of oligonucleotide ligands with much greater specificity than monomeric and oligomeric saccharides (J.F.Crowley et al., 1984, Arch. Biochem. and Biophys. 231:524-533; Y.Nagata and M.Burger, 1974, supra; J-P.Privat et al., FEBS Letters 46:229-232).
  • RNA ligands 6.8 and 11.20 (SEQ ID NO: 13 and 40) completely inhibit WGA mediated agglutination of sheep erythrocytes (Table 6).
  • Ligand 11.24 (SEQ ID NO: 19) is not as effective, showing only partial inhibition at 2 ⁇ M, the highest concentration tested (Table 6).
  • (GlcNAc)3 and GlcNAc completely inhibit agglutination at higher concentrations, 8 ⁇ M and 800 ⁇ M, respectively, (Table 6; Monsigny et al., supra).
  • the inhibition of agglutination varifies the proposition that ligands isolated by this procedure will be antagonists of lectin function. Inhibition also suggests that more than one RNA ligand is bound per WGA dimer, since agglutination is a function of multiple carbohydrate binding sites.
  • nucleotides at two positions in a sequence covary according to Watson-Crick base pairing rules then the nucleotides at these positions are apt to be paired.
  • Nonconserved sequences especially those that vary in length are not apt to be directly involved in function, while highly conserved sequence are likely to be directly involved.
  • LS-Rg is a chimeric protein in which the extracellular domain of human L- selectin is joined to the Fc domain of a human G2 immunoglobulin (Norgard et al.,
  • ES-Rg, PS-Rg and CD22 ⁇ -Rg are analogous constructs of E-selectin, P-selectin and CD22 ⁇ joined to a human Gl immunoglobulin Fc domain (R.M. Nelson et al., 1993, supra; I. Stamenkovic et al., 1991, Cell 66, 1133-1144). Purified chimera were provided by A.Varki. Soluble P-selectin was purchased from R&D Systems. Protein A Sepharose 4 Fast Flow beads were purchased from Pharmacia Biotech. Anti-L-selectin monoclonal antibodies: SKI 1 was obtained from Becton-Dickinson, San Jose, CA; DREG-56, an L-selectin specific monoclonal antibody, was purchased from Endogen,
  • the SELEX procedure is described in detail in United States Patent 5,270,163 and elsewhere.
  • the nucleotide sequence of the synthetic DNA template for the LS-Rg SELEX was randomized at 40 positions. This variable region was flanked by N7 5' and 3' fixed regions (40N7).
  • 40N7 transcript has the sequence 5' gggaggacgaugcgg-40N-cagacgacucgcccga 3' (SEQ ID NO: 64). All C and U have 2 -NH2 substituted for 2'-OH on the ribose.
  • the primers for the PCR were the following: N7 5' Primer 5' taatacgactcactatagggaggacgatgcgg 3' (SEQ ID NO: 65)
  • the fixed regions include primer annealing sites for PCR and cDNA synthesis as well as a consensus T7 promoter to allow in vitro transcription.
  • the initial RNA pool was made by first Klenow extending 1 nmol of synthetic single stranded DNA and then transcribing the resulting double stranded molecules with T7 RNA polymerase. Klenow extension conditions: 3.5 nmols primer 5N7, 1.4 nmols 40N7, IX Klenow Buffer, 0.4 mM each of dATP, dCTP, dGTP and dTTP in a reaction volume of 1 ml.
  • RNA was the template for AMV reverse transcriptase mediated synthesis of single-stranded cDNA.
  • These single-stranded DNA molecules were converted into double-stranded transcription templates by PCR amplification.
  • PCR conditions were 50 mM KCl, 10 mM Tris-Cl, pH 8.3, 7.5 mM MgCl2, 1 mM of each dATP, dCTP, dGTP, and dTTP, and 25 U/ml of Taq DNA polymerase.
  • Transcription reactions contained 0.5 mM DNA template, 200 nM T7 RNA polymerase, 80 mM HEPES (pH 8.0), 12 mM MgC_2, 5 mM DTT, 2 mM spermidine, 2 mM each of 2 -OH ATP, 2'-OH GTP, 2'-NH2 CTP, 2'-NH2 UTP, and 250 nM ⁇ - 32 P 2'-OH ATP.
  • RNA pool was incubated with LS-Rg immobiUzed on protein A sepharose beads in HSMC buffer.
  • the unbound RNA was removed by extensive washing.
  • the RNA molecules bound at the carbohydrate binding site were specificaUy eluted by incubating the washed beads in HMSC buffer containing 5 mM EDTA in place of divalent cations. The 5 mM elution was followed by a non-specific 50 mM EDTA elution.
  • LS-Rg was coupled to protein A sepharose beads according to the manufacturer's instructions (Pharmacia Biotech).
  • the 5 mM EDTA elution is a variation of a specific site elution strategy. Although it is not a priori as specific as elution by carbohydrate competition, it is a general strategy for C-type (calcium dependent binding) lectins and is a practical alternative when the cost and/or concentration of the required carbohydrate competitor is unreasonable (as is the case with sialyl-Lewis x ). This scheme is expected to be fairly specific for ligands that form bonds with the lectin's bound
  • the density of immobilized LS-Rg was 16.7 pmols/ ⁇ l of Protein A Sepharose 4 Fast Flow beads.
  • the density of LS-Rg was reduced (Tables 7a and 7b), as needed, to increase the stringency of selection.
  • the SELEX was branched and continued in parallel at 4 °C (Table 7a) and at room temperature (Table 7b). Wash and elution buffers were equilibrated to the relevant incubation temperature.
  • SELEX was often done at more than one LS-Rg density. In each branch, the eluted material from only one LS-Rg density was carried forward.
  • RNA was batch adsorbed to 100 ⁇ l of protein A sepharose beads for 1 hour in a 2 ml siliconized column. Unbound RNA and RNA eluted with minimal washing (two volumes) were combined and used for SELEX input material. For SELEX, extensively washed, immobilized LS-Rg was batch incubated with pre-adsorbed RNA for 1 to 2 hours in a 2 ml siliconized column with constant rocking. Unbound RNA was removed by extensive batch washing (200 to 500 ⁇ l HSMC/wash).
  • Bound RNA was eluted as two fractions; first, bound RNA was eluted by incubating and washing columns with 5 mM EDTA in HSMC without divalent cations; second, the remaining elutable RNA was removed by incubating and/or washing with 50 mM EDTA in HSMC without divalents.
  • the percentage of input RNA that was eluted is recorded in Tables 7a and 7b.
  • an equal volume of protein A sepharose beads without LS-Rg was treated identically to the SELEX beads to determine background binding. All unadsorbed, wash and eluted fractions were counted in a Beckman LS6500 scintillation counter in order to monitor each round of SELEX.
  • a nitroceUulose filter partitioning method was used to determine the affinity of RNA ligands for LS-Rg and for other proteins.
  • Filter discs nitrocellulose/cellulose acetate mixed matrix, 0.45 ⁇ m pore size, MilHpore
  • Reaction mixtures containing 3 P labeled RNA pools and unlabeled LS-Rg, were incubated in HSMC for 10 - 20 min at 4 °C, room temperature or 37 °C, filtered, and then immediately washed with 4 ml HSMC at the same temperature.
  • LS-Rg is a dimeric protein that is the expression product of a recombinant gene constructed by fusing the DNA sequence that encodes the extracellular domains of human L-selectin to the DNA that encodes a human IgG2 Fc region.
  • affinity calculations we assume one RNA Hgand binding site per LS-Rg monomer (two per dimer). The monomer concentration is defined as 2 times the LS-Rg dimer concentration.
  • Kd equilibrium dissociation constant
  • Kds were determined by least square fitting
  • Kds were determined by least square fitting of the data points using the graphics program Kaleidagraph (Synergy Software, Reading , PA).
  • PBMCs peripheral blood mononuclear ceUs
  • the mononuclear cell layer was coUected, diluted in 10 ml of Ca ++ /Mg ++ -free DPBS (DPBS(-); Gibco 14190- 029) and centrifuged (225 g) for 10 minutes at room temperature. Cell pellets from two gradients were combined, resuspended in 10 ml of DPBS(-) and recentrifuged as described above. These pellets were resuspended in 100 ⁇ l of SMHCK buffer supplemented with 1% BSA. CeUs were counted in a hemocytometer, diluted to
  • test ligands were serially diluted in DPBS(-)/l%BSA to 2-times the desired final concentration approximately 10 minutes before use.
  • Equal volumes (25 ⁇ l) of each ligand dilution and the cell suspension (2xl0 7 cells/ml) were added to 0.65 ml eppendorf tubes, gently vortexed and incubated on ice for 30 minutes. At 15 minutes the tubes were revortexed.
  • the specificity of binding to PBMCs was tested by competition with the L- selectin specific blocking monoclonal antibody, DREG-56, while saturability of binding was tested by competition with unlabeled RNA.
  • LS-Rg to sialyl-Lewis x was tested in competive ELISA assays (C. Foxall et al., 1992, supra).
  • competive ELISA assays C. Foxall et al., 1992, supra.
  • the wells of Corning (25801) 96 well microtiter plates were coated with 100 ng of a sialyl-Lewis x /BSA conjugate, air dried overnight, washed with 300 ⁇ l of PBS(-) and then blocked with 1 % BSA in
  • RNA ligands were incubated with LS-Rg in SHMCK/1% BSA at room temperature for 15 min. After removal of the blocking solution, 50 ⁇ l of LS-Rg (lOnM) or a LS-Rg (lOnMVRNA ligand mix was added to the coated, blocked wells and incubated at room temperature for 60 minutes. The binding solution was removed, wells were washed with 300 ⁇ l of PBS(-) and then probed with HRP conjugated anti-human IgG, at room temperature to quantitate LS- Rg binding. After a 30 minute incubation at room temperature in the dark with OPD peroxidase substrate (Sigma P9187), the extent of LS-Rg binding and percent inhibition was determined from the OD450.
  • OPD peroxidase substrate Sigma P9187
  • the SELEX protocol is outlined in Tables 7a and 7b and Example 7.
  • the dissociation constant of randomized RNA to LS-Rg is estimated to be approximately 10 ⁇ M. No difference was observed in the RNA elution profiles with 5 mM EDTA from SELEX and background beads for rounds 1 and 2, while the 50 mM elution produced a 2-3 fold excess over background (Table 7a).
  • the 50 mM eluted RNA from rounds 1 and 2 were amplified for the input material for rounds 2 and 3, respectively.
  • Binding experiments with 6th round RNA revealed that the affinity of the evolving pool for L-selectin was temperature sensitive. Beginning with round 7, the SELEX was branched; one branch was continued at 4 °C (Table 7a) while the other was conducted at room temperature (Table 7b).
  • Bulk sequencing of 6th, 13th (rm temp) and 14th (4 °C) RNA pools revealed noticeable non-randomness at round six and dramatic non-randomess at the later rounds.
  • the 6th round RNA bound monophasically at 4 °C with a dissociation constant of approximately 40 nM, while the 13th and 14th round RNAs bound biphasically with high affinity Kds of approximately 700 pM.
  • the molar fraction of the two pools that bound with high affinity were 24 % and 65 %, respectively.
  • the binding of all tested pools required divalent cations.
  • the Kds of the 13th and 14th round pools increased to 45 nM and 480 nM, respectively (HSMC, minus Ca "1-1"
  • Hgands were cloned and sequenced from rounds 6, 13 (rm temp) and 14 (4 °C). Sequences were aligned manually and with the aid of a computer program that determines consensus sequences from frequently occurring local alignments.
  • ligand sequences are shown in standard single letter code (Cornish-Bowden, 1985 NAR 13: 3021-3030). The letter/number combination before the ".” in the Hgand name indicates whether it was cloned from the round 6, 13 or 14 pools. Only the evolved random region is shown in Table 8. Any portion of the fixed region is shown in lower case letters. By definition, each clone includes both the evolved sequence and the associated fixed region, unless specifically stated otherwise. From the sixth, thirteenth and fourteenth rounds, respectively, 26 of 48, 8 of 24 and 9 of 70 sequenced ligands were unique. A unique sequence is operationally defined as one that differs from all others by three or more nucleotides.
  • Sequences that were isolated more than once, are indicated by the parenthetical number, (n), following the ligand isolate number. These clones fall into thirteen sequence families (I - XHI) and a group of unrelated sequences (Orphans)(SEQ ID NOs: 67-117).
  • Ligands from family II dominate the final rounds: 60/70 ligands in round 14 and 9/24 in round 13.
  • Family II is represented by three mutational variations of a single sequence.
  • One explanation for the recovery of a single lineage is that the ligand' s information content is extremely high and was therefore represented by a unique species in the starting pool.
  • Family II ligands were not detected in the sixth round which is consistent with a low frequency in the initial population. An alternative explanation is sampling error. Note that a sequence of questionable relationship was detected in the sixth round. The best defined consensus sequences are those of family I, AUGUGUA
  • Family HI has two additional, variably spaced sequences, AGUC and ARUUAG, that may be conserved.
  • the tetranucleotide AUGW is found in the consensus sequence of famiHes I, HI, and VH and in families II, VE Q and IX. If this sequence is significant, it suggests that the conserved sequences of Hgands of family VHI are circularly permuted.
  • the sequence AGAA is found in the consensus sequence of famiHes IV and VI and in famiHes X and XIH.
  • L-selectin ligands were determined by nitrocellulose partitioning as described in Example 7. As indicated in Table 10, the ligands are highly specific for L-selectin. In general, a ligand's affinity for ES-Rg is 10 3 -fold lower and that for PS-Rg is about 10 4 -fold less than for LS-Rg. Binding above background is not observed for CD22 ⁇ -Rg at the highest protein concentration tested (660 nM), indicating that ligands do not bind the Fc domain of the chimeric constructs nor do they have affinity for the sialic acid binding site of an unrelated lectin.
  • the cloned ligand, F14.12 (SEQ ID NO: 78), also binds in a saturable fashion with a dissociation constant of 1.3 nM, while random 40N7 (SEQ ID NO: 64) resembles round 2 RNA ( Figure 3).
  • the saturability of binding is confirmed by the data in Figure 4; > 90% of 5 nM 32 P-labeled F14.12 RNA binding is competed by excess cold RNA. Specificity is demonstrated by the results in Figure 5; binding of 5 nM
  • Lewis x was determined by competition ELISA assays. As expected, 4 mM EDTA reduced LS-Rg binding 7.4-fold, while 20 mM round 2 RNA did not inhibit LS-Rg binding. Carbohydrate binding is known to be Ca" 1-1 " dependent; the affinity of round 2 RNA is too low to bind 10 nM LS-Rg (Table 7). In this assay F14.12 RNA inhibits LS-Rg binding in a concentration dependent manner with an IC50 of about 10 nM ( Figure 6). Complete inhibition is observed at 50 nM F14.12.
  • RNA ligands compete with sialyl-Lewis x for LS-Rg binding and support the contention that low concentrations of EDTA specificaUy elute ligands that bind the lectin domain's carbohydrate binding site.
  • nucleotides at two positions in a sequence covary according to Watson-Crick base pairing rules then the nucleotides at these positions are apt to be paired.
  • Nonconserved sequences, especially those that vary in length are not apt to be directly involved in function, while highly conserved sequence are likely to be directly involved.
  • the proposed structure for family El is also a hairpin with the conserved sequence, AACAUGAAGUA, contained within a variable length loop (Figure 7b).
  • the 5'-half of the stem is 5'-fixed sequence which may account in part for the less highly conserved sequence, AGUC.
  • the buffer for SELEX experiments was 1 mM CaCl2, 1 mM MgC_2, 100 mM NaCl, 10.0 mM HEPES, pH 7.4.
  • the buffer for all binding affinity experiments differed from the above in containing 125 mM NaCl, 5 mM KCl, and 20 mM HEPES, pH 7.4.
  • the SELEX procedure is described in detail in United States Patent 5,270,163 and elsewhere.
  • the strategy used for this ssDNA SELEX is essentially identical to that described in Example 7, paragraph B except as noted below.
  • the nucleotide sequence of the synthetic DNA template for the LS-Rg SELEX was randomized at 40 positions. This variable region was flanked by BH 5' and 3' fixed regions.
  • the random DNA template was termed 40BH (SEQ ID NO: 126) and had the following sequence: 5'-ctacctacgatctgactagc ⁇ 40N>gcttactctcatgtagttcc-3'.
  • the fixed regions include primer annealing sites for PCR amplification.
  • the initial DNA pool contained 500 pmols of each of two types of single-stranded DNA: 1) synthetic ssDNA and 2) PCR amplified, ssDNA from 1 nmol of synthetic ssDNA template. For subsequent rounds, eluted DNA was the template for PCR amplification.
  • PCR conditions were 50 mM KCl, 10 mM Tris-Cl, pH 8.3, 7.5 mM MgCl2, 1 mM of each dATP, dCTP, dGTP, and dTTP and 25 U/ml of the Stoffei fragment of Taq DNA polymerase.
  • double stranded DNAs were end-labeled using ⁇ 32 P-ATP.
  • Complementary strands were separated by electrophoresis through an 8% polyacrylamide7M urea gel. Strand separation results from the molecular weight difference of the strands due to biotintylation of the 3' PCR primer.
  • DNA strands were separated prior to end labelling in order to achieve high specific activity. Eluted fractions were processed by ethanol precipitation.
  • a nitroceUulose filter partitioning method was used to determine the affinity of ssDNA ligands for LS-Rg and for other proteins.
  • a Gibco BRL 96 well manifold was substituted for the 12 well MilHpore manifold used in Example 7 and radioactivity was determined with a Fujix BAS100 phosphorimager. Binding data were analyzed as described in Example 7, paragraph C.
  • PBMC peripheral blood mononuclear cells
  • the final concentration of whole blood was at least 70% (v/v). Stained, concentrated whole blood was diluted 1/15 in 140 mM NaCl, 5 mM KCl, 1 mM MgCl2, 1 mM CaCl2, 20 mM HEPES pH 7.4, 0.1% bovine serum albumin and 0.1% NaN3 immediately prior to flow cytometry on a Becton-Dickinson FACS CaHbur. Lymphocytes and granulocytes were gated using side scatter and CD45CyPE staining.
  • Dimeric oHgonucleotides were synthesized by standard solid state processes, with initiation from a 3'-3' Symmetric Linking CPG (Operon, Alameda, CA). Branched complexes contain two copies of a truncated L-selectin DNA ligand, each of which is linked by the 3' end to the above CPG via a five unit ethylene glycol spacer ( Figure 8A). Each Hgand is labeled with a fluorescein phosphoramidite at the 5' end (Glen Research, Sterling, VA). Branched dimers were made for 3 truncates of LD201T1 (SEQ ID NO: 142).
  • LD201T4 (SEQ ID NO: 187), LD201T10 (SEQ ED NO: 187) and LD201T1 (SEQ ED NO: 185).
  • Branched dimers were purified by gel electrophoresis.
  • Multivalent oligonucleotide complexes were produced by reacting biotintylated DNA ligands with either fluorescein or phycoerythrin labeled streptavidin (SA-FITC, SA-PE, respectively) ( Figure 8B).
  • Streptavidin (SA) is a tetrameric protein, each subunit of which has a biotin binding site. 5' and 3' biotintylated DNAs were synthesized by Operon Technologies, Inc (Alameda. CA) using BioTEG and BioTEG CPG (Glen Research, Sterling, VA), respectively. The expected stoichiometry is 2 to 4 DNA molecules per complex.
  • SA/bio-DNA complexes were made for 3 truncates of LD201(SEQ ID NO: 142).
  • the truncated ligands were LD201T4 (SEQ ID NO: 187), LD201T10 (SEQ ID NO: 188) and LD201T1 (SEQ ID NO: 185).
  • the bio-DNASA multivalent complexes were generated by incubating biotin modified oligonucleotide (1 mM) and fluoroscein labeled streptavidin (0.17 mM) in 150 mM NaCl, 20 mM HEPES pH 7.4 at room temperature for at least 2 hours. Oligonucleotide-streptavidin complexes were used directly from the reaction mixture without additional purification of the Complex from free streptavidin or oligonucleotide.
  • a "dumbell" DNA dimer complex was formulated from a homobifunctional N-hydroxysuccinimidyl (or NHS) active ester of polyethelene glycol, PEG 3400 MW, and a 29mer DNA oligonucleotide, NX303 (SEQ ID NO: 196), having a 5' terminal Amino Modifier C6 dT (Glen Research) and a 3'-3' terminal phosphodiester linkage (Figure 8C).
  • NX303 is a truncate of LD201 (SEQ ID NO: 142). The conjugation reaction was in DMSO with 1% TEA with excess equivalents of the DNA ligand to PEG.
  • the PEG conjugates were purified from the free oligonucleotide by reverse phase chromatography.
  • the dimer was then purified from the monomer by anion exchange HPLC.
  • the oligonucleotide was labeled at the 5' terminus with fluorescein as previously described.
  • a photo-crossHnking version of DNA Hgand LD201T4 (SEQ ID NO: 187) was synthesized by replacing nucleotide T15 ( Figure 12) with 5-bromo-deoxyuracil.
  • Precipitated material was centrifuged, vacuum dried and resuspended in 100 ⁇ l 0.1 M Tris pH 8.0, 10 mM CaCl2- Fourty-five ⁇ g chymotrypsin were added and after 20 min at 37 degrees C, the material was loaded onto an 8% polyacrylamide/7 M urea IXTBE gel and electrophoresed until the xylene cyanole had migrated 15 cm.
  • the gel was soaked for 5 min in IX TBE and then blotted for 30 min at 200 mAmp in IXTBE onto Immobilon-P (MiUipore). The membrane was washed for 2 min in water, air dried, and an autoradiograph taken.
  • the peptide was sequenced by Edman degradation, and the resulting sequence was LEKTLP_SRS YY.
  • the blank residue corresponds to the crossHnked amino acid, F82 of the lectin domain.
  • Human PBMC were purified from heparinised blood by a Ficoll-Hypaque gradient, washed twice with HBSS (calcium/magnesium free) and labeled with 51Cr (Amersham). After labeling, the cells were washed twice with HBSS (containing calcium and magnesium) and 1% bovine serum albumin (Sigma).
  • HBSS containing calcium and magnesium
  • bovine serum albumin Sigma.
  • Female SCED mice (6-12 weeks of age) were injected intravenously with 2x10 ⁇ cells. The cells were either untreated or mixed with either 13 pmol of antibody (DREG-56 or MEL- 14), or 4, 1, or 0.4 nmol of modified oligonucleotide (synthesis described below). One hour later the animals were anesthetized, a blood sample taken and the mice were euthanised.
  • PLN, MLN, Peyer's patches, spleen, liver, lungs, thymus, kidneys and bone marrow were removed and the counts incorporated into the organs determined by a Packard gamma counter.
  • 2x10*5 human PBMC, purified, labeled, and washed as described above were injected intravenously into female SCED mice without antibody or oligonucleotide pretreatment.
  • the animals were injected with either 15 pmol DREG-56 or 4 nmol modified oHgonucleotide.
  • Counts incorporated into organs were quantified as described above.
  • NX288 SEQ ID NO: 193
  • NX303 SEQ ED NO: 196
  • dT-5'-CE polystyrene support Glen Research
  • a 20,000 MW PEG2-NHS ester Shearwater Polymers, Huntsville, AL
  • the molar ratio, PEG:oligo, in the reactions was from 3: 1 to 10: 1.
  • the reactions were performed in 80:20 (v:v) 100 mM borate buffer pH 8: DMF at 37° C for one hour.
  • SLe x -BSA (Oxford GlycoSystems, Oxford, UK) in IX PBS, without CaC_2 and MgC_2, (GEBCO/BRL) was immobilized at 100 ng/well onto a microtiter plate by overnight incubation at 22° C. The wells were blocked for 1 h with the assay buffer consisting of 20 mM HEPES, 111 mM NaCl, 1 mM CaC_2, 1 mM MgCl2, 5 mM KCl, 8.9 mM NaOH, final pH 8, and 1% globulin-free BSA (Sigma).
  • reaction mixtures incubated for 90 min with orbital shaking, contained 5 nM L-Selectin-Rg, a 1:100 dilution of anti-human IgG-peroxidase conjugate (Sigma), and 0 - 50 nM of competitor in assay buffer. After incubation, the plate was washed with BSA-free assay buffer to remove unbound chimera-antibody complex and incubated for 25 min with O- phenylenediarnine dihydrochloride peroxidase substrate (Sigma) by shaking in the dark at 22° C. Absorbance was read at 450 nm on a Bio-Kinetics Reader, Model EL312e (Bio-Tek Instruments, Website. Values shown represent the mean ⁇ s.e from duplicate, or triplicate, samples from one representative experiment.
  • Example 14 ssDNA Ligands to L-Selectin
  • the initial round of SELEX was performed at 4 °C with an LS-Rg density of 16.7 pmol/ ⁇ l of protein A sepharose beads. Subsequent rounds were at room temperature except as noted in Table 11. The 2 mM EDTA elution was omitted from rounds 1-3. The signal to noise ratio of the 50 mM EDTA elution in these three rounds was 50, 12 and 25, respectively (Table 11). These DNAs were amplified for the input materials of rounds 2-4. Beginning with round 4, a 2 mM EDTA elution was added to the protocol. In this and all subsequent rounds, the 2 mM EDTA eluted DNA was ampHfied for the next round's input material.
  • ligand sequences are shown in standard single letter code (Comish-Bowden, 1985 NAR 13: 3021-3030). Only the evolved random region is shown in Table 12. Any portion of the fixed region is shown in lower case letters.
  • each clone includes both the evolved sequence and the associated fixed region, unless specifically stated otherwise
  • a unique sequence is operationally defined as one that differs from all others by three or more nucleotides. Sequences that were isolated more than once are indicated by the parenthetical number, (n), following the ligand isolate number. These clones fall into six families and a group of unrelated sequences or orphans (Table 12)(SEQ ID NOs: 129-180).
  • Family 1 is defined by ligands from 33 lineages and has a well defined consensus sequence, TACAAGGYGYT A VACGTA (SEQ ID NO: 181). The conservation of the CAAGG and ACG and their 6 nucleotide spacing is nearly absolute (Table 12). The consensus sequence is flanked by variable but complementary sequences that are 3 to 5 nucleotides in length. The statistical dominance of family 1 suggests that the properties of the bulk population are a reflection of those of family 1 Hgands. Note that ssDNA family I and 2'-NH2 family I share a common sequence, CAAGGCG and CAAGGYG, respectively.
  • Family 2 is represented by a single sequence and is related to family 1.
  • the Hgand contains the absolutely conserved CAAGG and highly conserved ACG of family 1 although the spacing between the two elements is strikingly different (23 compared to 6 nucleotides).
  • Families 4-6 are each defined by a small number of ligands which limits confidence in their consensus sequence, while family 7 is defined by a single sequence which precludes determination of a consensus. Family 5 appears to contain two conserved sequences, AGGGT and RCACGAYACA, the positions of which are circularly permuted.
  • the dissociation constants range from 43 pM to 1.8 nM which is at least a 5xl0 3 to 2x10-5 fold improvement over randomized ssDNA (Table 13).
  • the Kds range from 130 pM to 23 nM.
  • the extent of temperature sensitivity varies from insensitive (Hgands LD122 and LD127 (SEQ ID NO: 159 and 162)) to 80-fold (ligand LD112 (SEQ ID NO: 135)).
  • the affinity of those from round 15 is greater than that of those from round 13.
  • the difference in affinity at room temperature and 37°C is about 4-fold.
  • the affinity of representative cloned ligands for LS-Rg, ES-Rg, PS-Rg, CD22 ⁇ -Rg and WGA was determined by nitrocellulose partitioning and the results shown in Table 14.
  • the Hgands are highly specific for L-selectin.
  • the affinity for ES-Rg is about 10 3 -fold lower and that for PS-Rg is about 5xl0 3 -fold less than for LS-Rg. Binding above background is not observed for CD22 ⁇ -Rg or for WGA at
  • Round 15 ssDNA pool was tested for its ability to bind to L-selectin presented in the context of a peripheral blood mononuclear cell surface as described in Example 13, paragraph E.
  • the evolved pool was tested both for affinity and for specificity by competition with an anti-L-selectin monoclonal antibody.
  • Figure 9 shows that the round 15 ssDNA pool binds isolated PBMCs with a dissociation constant of approximately 1.6 nM and, as is expected for specific binding, in a saturable fashion.
  • Figure 10 directly demonstrates specificity of binding; in this experiment, binding of 2 nM 32 P-labeled round 15 ssDNA is completely competed by the anti-L-selectin blocking monoclonal antibody, DREG-56, but is unaffected by an isotype-matched irrelevant antibody.
  • LD201T1 SEQ ID NO: 185) was shown to bind human PBMC with high affinity. Binding was saturable, divalent cation dependent, and blocked by DREG-56.
  • nucleotides at two positions in a sequence covary according to Watson-Crick base pairing rules then the nucleotides at these positions are apt to be paired.
  • Nonconserved sequences, especially those that vary in length are not apt to be directly involved in function, while highly conserved sequence are likely to be directly involved.
  • the two invariant pairs, positions 7/20 and 10/19 are both standard Watson/Crick basepairs.
  • This structure provides a plausible basis for the direct involvement of invariant nucleotides (especially, A8, A9 and T15) in binding the target protein.
  • the site of oligonucleotide binding on L-selectin can be deduced from a set of competition experiments.
  • DREG56 is an anti-L-selectin, adhesion blocking monoclonal antibody that is known to bind to the lectin domain.
  • LD201T1 SEQ ED NO: 185
  • LD174T1 SEQ ID NO: 194
  • LD196T1 SEQ ID NO: 195
  • LD201T1, LD174T1, or LD196T1 prevented radio-labeled LD201T1 from binding to LS-Rg, consistent with the premise that the ligands bind the same or overlapping sites.
  • T15 of LD201T4 (SEQ ID NO: 187; Figure 12) is replaced with 5-bromo- uracil, the resulting DNA photo-crosslinks at high yield ( 17%) to LS-Rg following irradiation with an excimer laser as described in Example 13, paragraph G.
  • the high yield of crosslinking indicates a point contact between the protein and T15. Sequencing of the chymotryptic peptide corresponding to this point contact revealed a peptide deriving from the lectin domain; F82 is the crossHnking amino acid. Thus, F82 contacts T15 in a stacking arrangement that permits high yield photo- crossHnking.
  • Hgands show that more than the 26 nucleotide hairpin (Figure 12; Table 13) is required.
  • LD227T1 (SEQ ID NO: 192) derived from LD201 (SEQ ID NO: 173) and LD227 (SEQ ID NO: 134), respectively, bind with 20-fold and 100-fold lower affinity than their full length progenitors.
  • the affinity of LD201T3 (SEQ ID NO: 186), a41 nucleotide truncate of Hgand LD201, is reduced about 15-fold compared to the full length ligand, while the affinity of the 49-mer LD201T1 (SEQ ID NO: 185) is not significantly altered (Tables 12 and 13).
  • the two ligands do not present an obvious consensus structure.
  • Removal of the loop (LD201) or scrambling or truncating the sequence (LD227) diminishes affinity, suggesting that the bulged sequences may be directly involved in binding.
  • LD201T3 is longer than LD201T10, it is unable to form the single stranded loop and extended stem because of the position of the truncated ends.
  • Example 19 Inhibition of Binding to Sialyl Lewis Sialyl Lewis 51 is the minimal carbohydrate ligand bound by selectins.
  • LD201T1 SEQ ID NO: 185
  • LD174T1 SEQ ED NO: 194
  • LD196T1 SEQ ID NO: 19
  • Lymphocyte trafficking to peripheral lymph nodes is extremely dependent on L-selectin. Since the ssDNA Hgands binds to human but not rodent L-selectin, a xenogeneic lymphocyte trafficking system was established to evaluate in vivo efficacy. Human PBMC, labeled with - ⁇ lCr, were injected intravenously into SCED mice. Cell trafficking was determined 1 hour later. In this system, human ceUs traffic to peripheral and mesenteric lymph nodes (PLN and MLN). This accumulation is inhibited by DREG-56 ( Figure 13) but not MEL-14, a monoclonal antibody that blocks murine L-selectin-dependent trafficking.
  • NX288 (SEQ ID NO: 193) inhibited trafficking of cells to PLN ( Figure 13) and MLN in a dose-dependent fashion but had no effect on the accumulation of cells in other organs.
  • inhibition by the DNA ligand was comparable to that of DREG-56 ( 13 pmol), while a scrambled sequence had no significant effect ( Figure 13).
  • the activity of LD174T1 was similar to that of NX288.
  • Example 21 L-Selectin Nucleic Acid Ligand Multimers Multivalent Complexes were made in which two nucleic acid Hgands to L- selectin were conjugated together. Multivalent Complexes of nucleic acid Hgands are described in copending United States Patent Application Serial Number 08/434,465, filed May 4, 1995, entitled “Nucleic Acid Ligand Complexes" which is herein incorporated by reference in its entirety. These multivalent Complexes were intended to increase the binding energy to faciHtate better binding affinities through slower off-rates of the nucleic acid ligands. These multivalent Complexes may be useful at lower doses than their monomeric counterparts.
  • nucleic acid Hgands incorporated into the Complexes were LD201T1 (SEQ ID NO: 185), LD201T4 (SEQ ID NO: 187), LD201T10 (SEQ ID NO: 188) and NX303 (SEQ ED NO: 196).
  • Multivalent selectin nucleic acid ligand Complexes were produced as described in Example 13, paragraph F.
  • Kinetic competition experiments were performed on monomeric nucleic acid Hgands and multivalent Complexes. Kinetic competition experiments were performed with PBMC purified lymphocytes. Cells were stained as described above but used 10 nM oligonucleotide. The off-rate for monomeric, dimeric and multivalent Complexes was determined by addition of 500 nM unlabeled oHgonucleotide to ceUs stained with fluorescently labeled Hgand and measurement of the change in the mean fluorescence intensity as a function of time. The dissociation rate of a monomeric LD201T1 from L-selectin expressing human lymphocytes was approximately 0.005 sec-1, corresponding to a half-Hfe of roughly 2.4 minutes.
  • the LD201T1 branched dimer and biotin conjugate multivalent Complexes exhibited apparent off-rates several times slower than that observed for the monomeric ligand and as slow or slower than that observed for the anti-L-selectin blocking antibody DREG56, determined under the same conditions.
  • a multivalent Complex containing a non-binding nucleic acid sequence did not stain ceUs under identical conditions and did not compete in the off-rate experiments.
  • the off-rate of the LD201T4 dumbell and fork dimers is faster than the LD201T1 branched dimer and is better than all monomers tested.
  • the SELEX procedure is described in detail in United States Patent 5,270,163 and elsewhere. Procedures are essentially identical to those in Examples 7 and 13 except as noted.
  • the variable regions of synthetic DNA templates were randomized at either 30 or 40 positions and were flanked by N7 5' and 3' fixed regions producing transcripts 30N7 (SEQ ID NO: 292) and 40N7 (SEQ ID NO: 389).
  • the primers for the PCR were the following: N7 5" Primer 5' taatacgactcactatagggaggacgatgcgg 3' (SEQ ID NO: 65)
  • RNA pool was made by first Klenow extending 3 nmol of synthetic single stranded DNA and then transcribing the resulting double stranded molecules with T7 RNA polymerase. Klenow extension conditions: 6 nmols primer 5N7, 3 nmols 30N7 or 40n7, IX Klenow Buffer, 1.8 mM each of dATP, dCTP, dGTP and dTTP in a reaction volume of 0.5 ml.
  • RNA was the template for AMV reverse transcriptase mediated synthesis of single-stranded cDNA.
  • These single-stranded DNA molecules were converted into double-stranded transcription templates by PCR amplification.
  • PCR conditions were 50 mM KCl, 10 mM Tris-Cl, pH 8.3, 7.5 mM MgCl2, 0.2 mM of each dATP, dCTP, dGTP, and dTTP, and 100 U/ml of Taq DNA polymerase.
  • Transcription reactions contained one third of the purified PCR reaction, 200 nM T7 RNA polymerase, 80 mM HEPES (pH 8.0), 12 mM MgCl2, 5 mM DTT, 2 mM spermidine, 1 mM each of 2'-OH ATP, 2'-OH GTP, 3 mM each of 2'-F CTP, 2'-F UTP, and 250 nM ⁇ - 32 P 2'-OH ATP. Note that in all transcription reactions 2'-F CTP and 2'-F UTP replaced CTP and UTP.
  • the strategy for partitioning LS-Rg/RNA complexes from unbound RNA is outlined in Table 15 and is essentially identical to that of Example 7, paragraph B.
  • the density of immobilized LS-Rg was 10 pmols/ ⁇ l of Protein A Sepharose 4 Fast Flow beads.
  • LS-Rg was coupled to protein A sepharose beads according to the manufacturer's instructions (Pharmacia Biotech).
  • the density of LS-Rg was reduced (Table 15), as needed, to increase the stringency of selection.
  • both SELEXes were branched. One branch was continued as previously described (Example 7, paragraph B).
  • RNA pool was pre-annealed to oHgonucleotides that are complementary to the 5' and 3' fixed sequences. These rounds are termed "counter- selected" rounds.
  • RNA was batch adsorbed to 100 ⁇ l of protein A sepharose beads for 15 minutes in a 2 ml siliconized column. Unbound RNA and RNA eluted with minimal washing (two volumes) were combined and used for SELEX input material.
  • immobilized LS-Rg was batch incubated with pre-adsorbed RNA for 1 to 2 hours in a 2 ml column with constant rocking.
  • Unbound RNA was removed by extensive batch washing (500 ⁇ l SHMCK 140/wash). In addition, the counter selected rounds were extensively washed with buffer containing 200 nM of both complementary oHgos. Bound RNA was eluted as two fractions; first, bound RNA was eluted by incubating and washing columns with 100 ⁇ L 5 mM EDTA in SHMCK 140 without divalent cations; second, the remaining elutable RNA was removed by incubating and or washing with 500 ⁇ L 50 mM EDTA in SHMCK 140 without divalents. The percentage of input RNA that was eluted is recorded in Table 22.
  • a nitro ceUulose filter partitioning method was used to determine the affinity of RNA ligands for LS-Rg and for other proteins.
  • Filter discs nitrocellulose/cellulose acetate mixed matrix, 0.45 ⁇ m pore size, MilHpore
  • Reaction mixtures, containing 3 P labeled RNA pools and unlabeled LS-Rg. were incubated in SHMCK 140 for 10 - 20 min at 37 °C, and then immediately washed with 3 ml SHMCK 140.
  • the filters were air-dried and counted in a Beckman LS6500 liquid scintillation counter without fluor.
  • binding studies employed 96 well micro-titer manifolds essentially as described in Example 13, paragraph E.
  • peripheral blood mononuclear cells were purified on histoplaque by standard techniques.
  • PBMC peripheral blood mononuclear cells
  • fluorescein labeled FTTC-LD201T1 SEQ ED NO: 185
  • FTTC-LD201T1 SEQ ED NO: 185
  • SMHCK buffer 140 mM NaCl, 1 mM MgCl 2 , 1 mM CaCl 2 , 5 mM, KCl, 20 mM HEPES pH 7.4, 8.9 mM NaOH, 0.1% (w/v) BSA, 0.1% (w/v) sodium azide
  • Fluorescent staining of cells was quantified on a FACSCaliber fluorescent activated cell sorter (Becton Dickinson, San Jose, CA). The affinity of the 2'-F competitor was calculated from the
  • RNA pools for SELEX contained approximately IO 14 molecules (0.7 nmol RNA).
  • the SELEX protocol is outlined in Table 15 and Example 22. Al rounds were selected at 37°C. The dissociation constant of randomized RNA to LS-Rg is estimated to be approximately 10 ⁇ M. After six rounds the pool affinities had improved to approximately 300 nM. An aliquot of the RNA recovered from the seventh round was used as the starting material for the first counter-selected rounds. Five rounds of counter-selection and five additional standard rounds were performed in parallel.
  • ligand sequences are shown in standard single letter code (Cornish-Bowden, 1985 NAR 13: 3021-3030). Fixed region sequence is shown in lower case letters. By definition, each clone includes both the evolved sequence and the associated fixed region, unless specifically stated otherwise. A unique sequence is operationally defined as one that differs from all others by three or more nucleotides. Sequences that were isolated more than once are indicated by the parenthetical number, (n), following the ligand isolate number.
  • the 30N7 and 40N7 SELEX final pools shared a common major sequence fa ⁇ ly, even though identical sequences from the two SELEXes are rare (Table 16).
  • Most Hgands (72 of the 92 unique sequences) from the 30N7 and 40N7 SELEXes contain one of two related sequence motifs, RYGYGUUUUCRAGY or RYGYGUUWWUCRAGY. These motifs define family 1. Within the family there are three subfamilies. Subfamily la ligands (53/66) contain an additional sequence motif, CUYARRY, one nucleotide 5' to the family 1 consensus motifs. Subfamily lb (9/66 unique sequences) lacks the CUYARRY motif.
  • Subfamily lc (5/66) is also missing the CUYARRY motif, has an A inserted between the Y and G of consensus YGUU and lacks the consensus GA base pair. The significance of the sequence subfamilies is reflected in the postulated secondary structure of the ligands (Example 25).
  • a second family composed of 5 sequences, has a relatively well defined consensus: UACUAN 0 .,UGURCG...UYCACUAAGN 1.2 CCC (Table 16).
  • Family 3 has a short, unreliable consensus motif (Table 16).
  • the dissociation constants range from 34 pM to 315 nM at 37 °C. Binding affinity is not expected to be temperature sensitive since selection was at 37°C and 2'-F RNA forms thermal stable structures, but binding has not been tested at lower temperatures. For the most part, the extreme differences in affinity may be related to predicted secondary structure (Example 25).
  • FITC-conjugated DNA Hgand FTTC-LD201T1 (SEQ ED NO: 185) in the presence of increasing concentrations of unlabeled 2'-F ligands as described in Example 22, paragraph E.
  • Ligands LF1513 (SEQ ID NO: 321), LF1514 (SEQ ID NO: 297), LF1613 (SEQ ED NO: 331) andLF1618 (SEQ ID NO: 351) inhibited the binding of FTrC-LE 201Tl in a concentration dependent manner, with complete inhibition observed at competitor concentrations of 10 to 300 nM.
  • nucleotides at two positions in a sequence covary according to Watson-Crick base pairing rules then the nucleotides at these positions are apt to be paired.
  • Nonconserved sequences especially those that vary in length are not apt to be directly involved in function, while highly conserved sequence are likely to be directly involved.
  • the deduced secondary structure of family la Hgands from comparative analysis of 21 unique sequences is a hairpin motif (Figure 15) consisting of a 4 to 7 nucleotide terminal loop, a 6 base upper stem and a lower stem of 4 or more base pairs.
  • the consensus terminal loops are either a UUUU tetraloop or a UUWWU pentaloop. Hexa- and heptaloops are relatively rare.
  • the upper and lower stems are delineated by a 7 nucleotide bulge in the 5 '-half of the stem. Four of the six base pairs in the upper stem and all base pairs in the lower stem are supported by Watson- Crick covariation.
  • the loop closing GC While the other is a non-standard GA.
  • the lower stem is most often 4 or 5 base pairs long but can be extended. While the sequence of the upper stem is strongly conserved, that of the lower stem is not, with the possible exception of the YR' base pair adjacent to the internal bulge. This base pair appears to covary with the 3' position of the 7 nucleotide bulge in a manner which minimizes the HkeHhood of extending the upper stem. Both the sequence (CUYARRY) and length (7 nt) of the bulge are highly conserved.
  • the 7 nucleotide bulge, the upper stem and the 5' and 3' positions of the terminal loop are most apt to be directly involved in L- selectin binding.
  • the 5' U and 3' U of the terminal loop, the invariant GC and GA base pairs of the upper stem and the conserved C, U and A of the bulge are the mostly likely candidates.
  • the lower stem because of its variability in length and sequence, is less likely to be directly involved.
  • the simplest structure for this ligand is a UUUU tetraloop and a ten base pair, nearly perfect, consensus stem which is missing only the 7 nucleotide bulge.
  • the deduced secondary structure of family lb is similar to that of family la, except that the upper stem is usually 7 base pairs in length and that the single stranded bulge which does not have a highly conserved consensus is only 4 nucleotide long.
  • This structure may be an acceptable variation of the 1 a secondary structure with the upper stem's increased length allowing a shorter bulge; the affinity of ligand LF1511 (SEQ ID NO: 332) is 300 pM.
  • LF1618 (SEQ ID NO: 351), permits a UUUU tetraloop and "upper" stem of 7 base pairs but has neither a lower stem nor the consensus 7 nucleotide bulge sequence of la.
  • the upper stem differs from those of la and lb in that it has an unpaired A adjacent to the loop closing G and does not have the invariant GA base pair of la and lb.
  • the affinity of LF1618 is a modest 10 nM which suggests that family lc forms a less successful structure.
  • Predictions of minimal high affinity sequences for farmly 1 ligands can be made and serve as a partial test of the postulated secondary structure. Truncates which include only the upper stem and teiminal loop, LF1514T1 (SEQ ED NO: 385) or these two elements plus the 7 nucleotide bulge sequence, LF1514T2 (SEQ ED NO: 386), axe not expected to bind with high affinity. On the other hand, there is a reasonable, but not rigorous, expectation that Hgands truncated at the base of the lower consensus stem, LF1514T4 (SEQ ID NO: 387) and LF1807T4 (SEQ ED NO: 388), will bind with high affinity.
  • the affinities of LF1514T1 and LF1514T2 for LS-Rg were reduced at least 100-fold in comparison to full length LD1514 (SEQ ID NO: 297), whUe the affinity of LF1514T4 was reduced less than two fold and that of LF1807T4 approximately three-fold.
  • the correspondence between the predicted and observed truncate affinities supports the postulated secondary structure.
  • PS-Rg is a chimeric protein in which the lectin, EGF, and the first two CRD domains of human P-selectin are joined to the Fc domain of a human Gl immunoglobulin (R.M. Nelson et al., 1993, supra). Purified chimera is provided by A. Varki. Soluble P-selectin is purchased from R&D Systems. Unless otherwise indicated, all materials used in the ssDNA SELEX against the P- selectin/IgG, chimera, PS-Rg, are identical to those of Examples 7 and 13.
  • PS-Rg is a chimeric protein in which the extraceUular domain of human P- selectin is joined to the Fc domain of a human G2 immunoglobulin (Norgard et al., 1993, PNAS 90: 1068-1072).
  • ES-Rg and CD22 ⁇ -Rg are analogous constructs of E- selectin and CD22 ⁇ joined to a human Gl immunoglobulin Fc domain (R.M.
  • the SELEX procedure is described in detail in United States Patent 5,270, 163 and elsewhere.
  • the nucleotide sequence of the synthetic DNA template for the PS-Rg SELEX was randomized at 50 positions. This variable region was flanked by N8 5' and 3' fixed regions.
  • the transcript 50N8 has the sequence 5' gggagacaagaauaaacgcucaa-50N-uucgacaggaggcucacaacaggc 3' (SEQ ED NO: 390). All C and U have 2'-F substituted for 2'-OH on the ribose.
  • the primers for the PCR were the following: N8 5' Primer 5' taatacgactcactatagggagacaagaataaacgctcaa 3' (SEQ ED NO:
  • the fixed regions include primer annealing sites for PCR and cDNA synthesis as well as a consensus T7 promoter to allow in vitro transcription.
  • the initial RNA pool was made by first Klenow extending 1 nmol of synthetic single stranded DNA and then transcribing the resulting double stranded molecules with T7 RNA polymerase.
  • Klenow extension conditions 3.5 nmols primer 5N8, 1.4 nmols 40N8, IX Klenow Buffer, 0.4 mM each of dATP, dCTP, dGTP and dTTP in a reaction volume of 1 ml.
  • eluted RNA was the template for AMV reverse transcriptase mediated synthesis of single stranded cDNA. These single-stranded DNA molecules were converted into double-stranded transcription templates by PCR amplification.
  • PCR conditions were 50 mM KCl, 10 mM Tris-Cl, pH 8.3, 7.5 mM MgCl2, 1 mM of each dATP, dCTP, dGTP, and dTTP, and 25 U/ml of Taq DNA polymerase.
  • Transcription reactions contained 0.5 mM DNA template, 200 nM T7 RNA polymerase, 40 mM Tris-HCI (pH 8.0), 12 mM MgCl2, 5 mM DTT, 1 mM spermidine, 4% PEG 8000, 1 mM each of 2'-OH ATP and 2'-OH GTP, 3.3 mM each of 2'-F CTP and 2'-F UTP, and 250 nM ⁇ - 32 P 2'-OH ATP.
  • the density of immobilized PS-Rg was 20 pmols/ ⁇ l of Protein A Sepharose 4 Fast Flow beads.
  • the density of PS-Rg was reduced (Table 18), as needed, to increase the stringency of selection.
  • SELEX was often done at more than one PS-Rg density. At each round, the eluted material from only one PS-Rg density was carried forward.
  • RNA was batch adsorbed to 100 ⁇ l of protein A sepharose beads for 1 hour in a 2 ml siliconized column. Unbound RNA and RNA eluted with minimal washing (two volumes) were combined and used for SELEX input material. For SELEX, extensively washed, immobilized PS-Rg was batch incubated with pre-adsorbed RNA for 0.5 to 1 hours in a 2 ml siliconized column with frequent mixing. Unbound RNA was removed by extensive batch washing (500 ⁇ l HSMC/wash).
  • Bound RNA was eluted as two fractions; first, bound RNA was eluted by incubating and washing columns with 5 mM EDTA in HSMC without divalent cations; second, the remaining elutable RNA was removed by incubating and/or washing with 50 mM EDTA in HSMC without divalents.
  • the percentage of input RNA that was eluted is recorded in Table 18.
  • an equal volume of protein A sepharose beads without PS-Rg was treated identically to the SELEX beads to determine background binding. All unadsorbed, wash and eluted fractions were counted in a Beckman LS6500 scintillation counter in order to monitor each round of SELEX.
  • RNA was resuspended in 80 ⁇ l of H 2 O and 40 ⁇ l were reverse transcribed into cDNA by AMV reverse transcriptase at 48 ° C for 30 minutes, in 50 mM Tris-Cl pH (8.3), 60 mM NaCl, 6 mM Mg(OAc)2, 10 mM DTT, 200 pmol DNA primer, 0.4 mM each of dNTPs, and 0.4 unit ⁇ l AMV RT. Transcripts of the PCR product were used to initiate the next round of SELEX.
  • a nitroceUulose filter partitioning method was used to determine the affinity of RNA ligands for PS-Rg and for other proteins.
  • FUter discs nitrocellulose/cellulose acetate mixed matrix, 0.45 ⁇ m pore size, MilHpore
  • RNA pools and unlabeled PS-Rg were incubated in HSMC for 10 - 20 min at 4 °C, room temperature or 37 °C, filtered, and then immediately washed with 4 ml HSMC at the same temperature. The filters were air-dried and counted in a Beckman LS650O liquid scintillation counter without fluor.
  • PS-Rg is a dimeric protein that is the expression product of a recombinant gene constructed by fusing the DNA sequence that encodes the extracellular domains of human P-selectin to the DNA that encodes a human IgGl Fc region. For affinity calculations, one ligand binding site per PS-Rg monomer (two per dimer) were assumed. The monomer concentration is defined as 2 times the PS-Rg dimer concentration.
  • Kd equilibrium dissociation constant
  • Twelfth round PCR products were re-amplified with primers which contain either a BamHl or a Hi ⁇ DUL restriction endonuclease recognition site. Using these restriction sites, the DNA sequences were inserted directionally into the pUC9 vector. These recombinant plasmids were transformed into E. coli strain JM109 (Life Technologies, Gaithersburg, MD). Plasmid DNA was prepared according to the alkaline hydrolysis method (PERFECTprep, 5'-3', Boulder, CO). Approximately 50 clones were sequenced using the Sequenase protocol (Amersham, Arlington Heights, IL). The resulting Hgand sequences are shown in Table 19.
  • RNA ligands 32 P-labeled at the 5'-end for the 3' boundary and 32 P-labeled at the 3'-end for the 5' boundary, are hydrolyzed in 50 mM Na2CO3 pH 9 for 8 minutes at 95°C.
  • the resulting partial hydrolysate contains a population of end-labeled molecules whose hydrolyzed ends correspond to each of the purine positions in the full length molecule.
  • the hydrolysate is incubated with PS-Rg (at concentrations 5- fold above, below and at the measured Kd for the ligand).
  • the RNA concentration is significantly lower than the Kd.
  • the reaction is incubated at room temperature for 30 minutes, filtered, and then immediately washed with 5 ml HSMC at the same temperature.
  • RNA is extracted from the filter and then electrophoresed on an 8% denaturing gel adjacent to hydrolyzed RNA which has not been incubated with PS-Rg. Analysis is as described in Tuerk et. al. 1990, J. Mol. Biol. 213: 749.
  • RNA ligands are then incubated with concentrations of PS-Rg 2-fold above and 2.5-fold below the Kd of the unmodified Hgand at room temperature for 30 minutes, filtered, and then immediately washed with 5 ml HSMC at the same temperature.
  • the bound RNA (Selected RNA) is extracted from the filter and then hydrolyzed with 50 mM
  • Unselected RNA RNA which has not been exposed to binding and filtration
  • the ratio of intensities of the Unselected:Selected bands that correspond to the position in question are calculated.
  • the Unselected: Selected ratio when the position is mixed is compared to the mean ratio for that position from experiments in which, the position is not mixed. If the Unselected: Selected ratio of the mixed position is significantly greater than that when the position is not mixed, 2'-OMe may increase affinity. Conversely, if the ratio is significantly less, 2'-OMe may decrease affinity. If the ratios are not significantly different, 2'-OMe substitution has no affect.
  • CD61 or PE conjugated anti-CD62 antibody (Becton Dickinson) was incubated for
  • the FTTC-ligand incubations were diluted to 200 ⁇ l with BB+ and analyzed on a FACSCaUber flow cytometer.
  • the biotinylated-Hgand reactions were incubated with streptavidin-phycoerythrin (SA-PE) (Becton Dickinson) for 20 minutes at 4°C, before dilution and analysis. Wash steps with 500 ⁇ l BB+ and 700 x g spins have been used without compromising the quality of the results.
  • SA-PE streptavidin-phycoerythrin
  • RNA ligands were incubated with PS-Rg in HSMC/1% BSA at room temperature for 15 min.
  • PS-Rg (lOnM) or a PS-Rg (10nM)/RNA ligand mix was added to the coated, blocked wells and incubated at room temperature for 60 minutes. The binding solution was removed, wells were washed with 300 ⁇ l of PBS(-) and then probed with HRP conjugated anti-human IgG, at room temperature to quantitate PS- Rg binding. After a 30 minute incubation at room temperature in the dark with OPD peroxidase substrate (Sigma P9187), the extent of PS-Rg binding and percent inhibition was determined from the OD450.
  • OPD peroxidase substrate Sigma P9187
  • the starting RNA pool for SELEX contained approximately 10-*- 5 molecules (1 nmol RNA).
  • the SELEX protocol is outlined in Table 18.
  • the dissociation constant of randomized RNA to PS-Rg is estimated to be approximately 2.5 ⁇ M.
  • An eight-fold difference was observed in the RNA elution profiles with 5 mM EDTA from SELEX and background beads for rounds 1 and 2, while the 50 mM elution produced a 30-40 fold excess over background Table 18.
  • the 5 mM and 50 mM eluted RNAs were pooled and processed for the next round. Beginning with round 4, only the 5 mM eluate was processed for the following round.
  • the density of immobilized PS-Rg was reduced five fold in round 2 and again in round three without greatly reducing the fraction eluted from the column.
  • the density of immobilized PS-Rg was further reduced 1.6-fold in round 4 and remained at this density until round 8, with further reductions in protein density at later rounds.
  • the affinity of the selected pools rapidly increased and the pools gradually evolved biphasic binding characteristics.
  • Binding experiments with 12th round RNA revealed that the affinity of the evolving pool for P-selectin was not temperature sensitive.
  • Bulk sequencing of 2nd, 6th, 11th and 12th RNA pools revealed noticeable non-randomness by round twelve.
  • the 6th round RNA bound monophasicaUy at 37 °C with a dissociation constant of approximately 85 nM, while the 11th and 12th round RNAs bound biphasicaUy with high affinity Kds of approximately 100 and 20 pM, respectively.
  • the binding of all tested pools required divalent cations. In the absence of divalent cations, the Kds of the 12th round pools increased to > 10 nM. (HSMC, minus
  • the 12th round pool showed high specificity for PS-Rg with measured Kd's of 1.2 ⁇ M and 4.9 ⁇ M for ES-Rg and LS-Rg, respectively.
  • ligand sequences are shown in standard single letter code (Cornish-Bowden, 1985 NAR 13: 3021-3030). Fixed region sequence is shown in lower case letters. By definition, each clone includes both the evolved sequence and the associated fixed region, unless specifically stated otherwise. From the twelfth round, 21 of 44 sequenced ligands were unique. A unique sequence is operationally defined as one that differs from all others by three or more nucleotides. Sequences that were isolated more than once, are indicated by the parenthetical number, (n), following the ligand isolate number. These clones fall into five sequence families (1-5) and a group of two unrelated sequences (Orphans)(SEQ ED NOs: 199-219).
  • Family 1 is defined by 23 ligands from 13 independent lineages.
  • the consensus sequence is composed of two variably spaced sequences, CUCAACGAMC and CGCGAG (Table 19).
  • CUCAA of the consensus is from 5' fixed sequence which consequently minimizes variability and in turn reduces confidence in interpreting the importance of CUCAA or the paired GAG (see Example 27).
  • Families 2-5 are each represented by multiple isolates of a single sequence which precludes determination of consensus sequences.
  • the dissociation constants for representative ligands, including all orphans, were determined by nitroceUulose filter binding experiments and are Hsted in Table 20. These calculations assume two binding sites per chimera. The affinity of random RNA is estimated to be approximately 2.5 ⁇ M.
  • ligands bind monophasicaUy with dissociation constants ranging from 15 pM to 450 pM at 37 °C. Some of the highest affinity ligands bind biphasicaUy. FuU length ligands of famiHes 1-4 show no temperature dependence. The observed affinities substantiate the proposition that it is possible to isolate oHgonucleotide Hgands witii affinities that are several orders of magnitude greater than that of carbohydrate ligands.
  • the affinity of P-selectin ligands to ES-Rg, LS-Rg and CD22 ⁇ -Rg were determined by nitrocellulose partitioning. As indicated in Table 20, the Hgands are highly specific for P-selectin. In general, a Hgand's affinity for ES-Rg and LS-Rg is at least lO ⁇ -fold lower than for PS-Rg. Binding above background is not observed for CD22 ⁇ -Rg at the highest protein concentration tested (660 nM), indicating that ligands do not bind the Fc domain of the chimeric constructs nor do they have affinity for the sialic acid binding site of this unrelated lectin. The specificity of oHgonucleotide ligand binding contrasts sharply with the binding of cognate carbohydrates by the selectins and confirms the proposition that SELEX Hgands will have greater specificity than carbohydrate ligands.
  • OHgonucleotide ligands eluted by 2-5 mM EDTA, are expected to derive part of their binding energy from contacts with the lectin domain's bound Ca “1"" - " and consequently, are expected to compete with sialyl-Lewis x for binding.
  • the selected oligonucleotide ligands competitively inhibit PS-Rg binding to immobilized sialyl-Lewis x with IC50s ranging from 1 to 4 nM (Table 20).
  • Hgand PF377 SEQ ID NO: 206 has an IC50 of approximately 2 nM. Complete inhibition is attained at 10 nM Hgand.
  • Example 31 Secondary Structure of High Affinity Ligands
  • comparative analysis of aHgned sequences allows deduction of secondary structure and structure-function relationships. If the nucleotides at two positions in a sequence covary according to Watson-Crick base pairing rules, then the nucleotides at these positions are apt to be paired. Nonconserved sequences, especially those that vary in length are not apt to be directly involved in function, while highly conserved sequences are likely to be directly involved.
  • Boundary experiments were performed on a number of P-selectin ligands as described in Example 27 and the results are shown in Table 21.
  • the results for family 1 Hgands are consistent with their proposed secondary structure.
  • the composite boundary species vary in size from 38-90 nucleotides, but are 40-45 nucleotides in family 1. Affinities of these truncated ligands are shown in Table 22.
  • the truncates lose no more than 10-fold in affinity in comparison to the full length, effectively inhibit the binding of PS-Rg to sialyl-Lewis x and maintain binding specificity for PS-Rg (Table 22). These data validate the boundary method for identifying the minimal high affinity binding element of the RNA ligands.
  • Binding to platelets is P-selectin specific by the criteria that 1) oligonucleotides that do not bind PS-Rg do not bind platelets; 2) that binding of PF377sl to platelets is divalent cation dependent; and most importantly 3) that binding is inhibited by the anti-P-selectin adhesion blocking monoclonal antibody Gl, but not by an isotype control antibody.
  • the SELEX procedure is described in detail in US patent 5,270,163 and elsewhere.
  • the nucleotide sequence of the synthetic DNA template for the PS-Rg SELEX was randomized at 50 positions. This variable region was flanked by N8 5' and 3' fixed regions.
  • the transcript 50N8 has the sequence 5' gggagacaagaauaaac gcucaa-50N-uucgacaggaggcucacaacaggc 3' (SEQ ED NO: 248). All C and U have 2'-NH2 substituted for 2'-OH on the ribose.
  • the primers for the PCR were the following:
  • a nitroceUulose filter partitioning method was used to determine the affinity of RNA ligands for PS-Rg and for other proteins. Either a Gibco BRL 96 well manifold, as described in Example 23 or a 12 well MilHpore manifold (Example 7C) was used for these experiments. Binding data were analyzed as described in Example 7, paragraph C.
  • Twelfth round PCR products were re-amplified with primers which contain either a BamHl or a HnDEH restriction endonuclease recognition site. Approximately 75 ligands were cloned and sequenced using the procedures described in Example 7, paragraph D. The resulting sequences are shown in Table 25.
  • the SELEX protocol is outlined in Table 24. The initial round of SELEX was performed at 37 °C with an PS-Rg density of 20 pmol/ ⁇ l of protein A sepharose beads. Subsequent rounds were all at 37°C. In the first round there was no signal above background for the 5 mM EDTA elution, whereas the 50 mM EDTA elution had a signal 7 fold above background, consequently, the two elutions were combined and processed for the next round. This scheme was continued through round 6.
  • each clone includes both the evolved sequence and the associated fixed region, unless specifically stated otherwise. From the twelfth round, 40/61 sequenced ligands were unique. A unique sequence is operationally defined as one that differs from all others by three or more nucleotides. Sequences that were isolated more than once are indicated by the parenthetical number, (n), following the ligand isolate number.
  • Ligands from family 1 dominate the final pool containing 16/61 sequences, which are derived from multiple lineages. Families 2 and 3 are represented by slight mutational variations of a single sequence. Sequences labeled as "others" do not have any obvious similarities. Family 1 is characterized by the consensus sequence GGGAAGAAGAC (SEQ ID NO: 291).
  • the dissociation constants of representative ligands are shown in Table 26. These calculations assume two RNA ligand binding sites per chimera. The affinity of random 2-NH2 RNA is estimated to be approximately 10 ⁇ M. At 37°C, the dissociation constants range from 60 pM to 50 nM which is at least a lxl 0 3 to 1x10*5 f 0 jd improvement over randomized 2'-NH2 RNA (Table 26). There is a marked temperature sensitivity for Clone PA350 (SEQ ID NO:
  • Example 37 Specificity of 2'-NH2_RNA Ligands to P-Selectin
  • the ligands are highly specific for P-selectin.
  • the affinity for ES-Rg is about 600-fold lower and that for LS-Rg is about 5xlO*5-fold less than for PS-Rg. Binding above background is not observed for CD22 ⁇ -Rg indicating that ligands neither bind the Fc domain of the chimeric constructs nor have affinity for unrelated siaUc acid binding sites.
  • oligonucleotide Hgand binding contrasts sharply with the binding of cognate carbohydrates by the selectins and reconfirms the proposition that SELEX ligands will have greater specificity than carbohydrate ligands.
  • FITC-labeled ligand PA350 (FITC-350) (SEQ ID NO: 252) was tested for its abUity to bind to P-selectin presented in the context of a platelet cell surface by flow cytometry experiments as described in Example 23, paragraph G.
  • FTEC-PA350 for binding to P-selectin was tested by competition experiments in which FTTC-PA350 and unlabeled blocking monoclonal antibody Gl were simultaneously added to stimulated platelets. Gl effectively competes with FTTC-PA350 for binding to platelets, while an isotype matched control has little or no effect which demonstrates that FTTC-PA350 specifically binds to P-selectin.
  • the specificity of binding is further verified by the observation that oligonucleotide binding is saturable; binding of 10 nM FTEC-PA350 is inhibited by 200 nM unlabeled PA350.
  • the binding of FTTC-PA350 is dependent on divalent cations; at 10 nM FTTC-PA350 activated platelets are not stained in excess of autofluorescence in the presence of 5 mM EDTA.
  • ligands PA341 SEQ ID NO: 251
  • PA350 SEQ ID NO: 252
  • IC50s ranging from 2 to 5 nM (Table 26). This result is typical of high affinity Hgands and is reasonable under the experimental conditions.
  • the IC50s of ligands whose Kds are much lower than the PS-Rg concentration (10 nM) are limited by the protein concentration and are expected to be approximately one half the PS-Rg concentration.
  • ES-Rg is a chimeric protein in which the extracellular domain of human E- selectin is joined to the Fc domain of a human Gl immunoglobulin (R.M. Nelson et al., 1993, supra). Purified chimera were provided by A. Varki. Unless otherwise indicated, all materials used in this SELEX are sirmlar to those of Examples 7 and 13.
  • RNA Loading Conditions Rounds 1-5, 2hrs @ room temperature on roller; incubation time reduced to 1 hr. for Rounds 6-11.
  • RNA Elution Conditions Rounds 1-5, 200 ⁇ l of 2 mM (GlcNAc)3,
  • Rounds 7-8 200 ⁇ l of 0.2 mM (GlcNAc) 3, incubated as in round 6; wash twice with same buffer; washed sequentially with 3x 200 ⁇ l each, of 0.5, 1.0, 1.5, 2.0 and 10 mM (GlcNAc) 3.
  • RNA Eluted percentage of input RNA eluted with (GlcNAc) 3
  • RNA Amplified percentage of input RNA amplified
  • Rounds 1-5 entire eluted RNA sample amplified.
  • Rounds 6-11 pooled 2mM and 10 mM RNA, amplified for subsequent round.
  • the Kds of ligands that show ⁇ 5 % binding at 1 ⁇ M WGA is estimated to be > 20 ⁇ M.
  • K c is the dissociation constant of (GlcNAc) 3 calculated from these data, assuming competitive inhibition and two RNA ligand binding sites per dimer.
  • L-Selectin Rg was immobilized on Protein A Sepharose 4 Fast Flow. Protein A density is approximately 6mg/ml drained gel (143 ⁇ M).
  • RNA was eluted by incubating the extensively-washed columns in 100 ⁇ L of HEPES buffered EDTA (pH7.4) for 30 minutes on a roller followed by three 100 ⁇ L HEPES buffered EDTA washes.
  • L-Selectin Rg was immobilized on Protein A Sepharose 4 Fast Flow. Protein A density is approximately 6mg/ml drained gel (143 ⁇ M) .
  • RNA was eluted by incubating the extensively-washed columns in 100 ⁇ L of HEPES buffered EDTA (pH7.4) for 30 minutes on a roller followed by three 100 ⁇ L HEPES buffered EDTA washes.
  • Kds of monophasic binding ligands are indicated by a single number; the high affinity Kd (ie., Kdl), the mole fraction binding with Kdl, an ⁇ 3- the low affinity Kd (ie., Kd2l are presented for biphasic binding ligands.
  • Binding Buffer Rounds 1-9 10 mM HEPES, pH at room temp w/NaOH to 7.4
  • Elution Buffers replace divalent cations with EDTA
  • CGCATCCACATAGTTC AAGGGGCTACAC GAAATATTGCA TACCCCTTGgGCCTCATAGAC AAGGTCTTAAAC GTTAGC CACATGCCTGACGCGGTAC AAGGCCTGG AC GTAACGTTG TAGTGCTCCACGTATTC AAGGTGCTAAAC GAAGACGGCCT
  • CAAGGTAACCAGTAC AAGGTGCTAAAC GTAATGGCTTCG ACCCCCGACCCGAGTAC AAGGCATTCGAC GTAATCTGGT
  • LD191 147 AGGGAGAAC AAGGTGCTAAAC GTTTATCTACACTTCACCT D128(3) 148 AGGACC AAGGTGTTAAAC GGCTCCCCTGGCTATGCCTCTT
  • LD139 150 GGAC AAGGCACTCGAC GTAGTTTATAACTCCCTCCGGgCC
  • GTAACCAGTAC AAGGTGCTAAAC GTAATGGCTTCGqcttac
  • LD181 ( 3 ) 157 CAT CAAGGACTTTGCCCGAAACCCTAGGTTCACG TGTGGG Fami ly 4
  • LD174 ( 2 ) 158 CATTCACCATGGCCCCTTCCTACGTATGTTCTGCGGGTG D122 159 GCAACGTGGCCCCGTT TAGCTCATTTGACCGTTCCATCCG LD239 160 CCACAGACAATCGCAGTCCCCGTG TAGCTCTGGGTGTCT LD533 180 GCAGCGTGGCCCTGTT TAGCTCATTTGACCGTTCCATCCG
  • LD196 163 TGGCGGTACGGGCCGTGCACCCACTTACCTGGGAAGTGA LD229 164 CTCTGCTTACCTCATGTAGTTCCAAGCTTGGCGTAATCATG
  • Truncate D196 tl 195 agcTGGCGGTACGGGCCGTGCACCCACTTACCTGGGAAGTGAgctta
  • LF1835(4*) gggaggacnaugcgg UCUAGGCaUCGCUAUUCUUUACUGAUAUAAUUACUCCCCU cagacgacucgcccga 376 monster gggaggacgaugcgg AGUw GCNCGGUCCAGUCACAUCCwAUCCC cagacGacucgcccga 377 F1522 gggaggacgAugcgg CUCUCAUAUkGwGUrUUyUUCmUUCsrGGCUCAAACAAyyCCCCCAA 378

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Animal Behavior & Ethology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Immunology (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Urology & Nephrology (AREA)
  • Hematology (AREA)
  • Rheumatology (AREA)
  • Analytical Chemistry (AREA)
  • Oncology (AREA)
  • Dermatology (AREA)
  • Biochemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Physics & Mathematics (AREA)
  • Neurosurgery (AREA)
  • Transplantation (AREA)
  • Diabetes (AREA)
  • Neurology (AREA)
  • Cardiology (AREA)
  • Vascular Medicine (AREA)
  • Communicable Diseases (AREA)
  • Heart & Thoracic Surgery (AREA)
  • Pain & Pain Management (AREA)

Abstract

La présente invention décrit des ligands oligonucléotidiques à haute affinité pour les lectines, spécifiquement des ligands d'acide nucléique possédant la capacité de se lier aux lectines, à l'agglutinine de germe de blé, à la L-sélectine, E-sélectine et P-sélectine. Elle décrit également des procédés pour obtenir ces ligands.
EP96923232A 1995-06-07 1996-06-05 Ligands d'acide nucleique a haute affinite pour les lectines Withdrawn EP0840739A4 (fr)

Applications Claiming Priority (9)

Application Number Priority Date Filing Date Title
US47782995A 1995-06-07 1995-06-07
US479724 1995-06-07
US08/472,256 US6001988A (en) 1990-06-11 1995-06-07 High affinity nucleic acid ligands to lectins
US472255 1995-06-07
US08/472,255 US5766853A (en) 1990-06-11 1995-06-07 Method for identification of high affinity nucleic acid ligands to selectins
US477829 1995-06-07
US472256 1995-06-07
US08/479,724 US5780228A (en) 1990-06-11 1995-06-07 High affinity nucleic acid ligands to lectins
PCT/US1996/009455 WO1996040703A1 (fr) 1995-06-07 1996-06-05 Ligands d'acide nucleique a haute affinite pour les lectines

Publications (2)

Publication Number Publication Date
EP0840739A1 true EP0840739A1 (fr) 1998-05-13
EP0840739A4 EP0840739A4 (fr) 2006-02-01

Family

ID=27504168

Family Applications (1)

Application Number Title Priority Date Filing Date
EP96923232A Withdrawn EP0840739A4 (fr) 1995-06-07 1996-06-05 Ligands d'acide nucleique a haute affinite pour les lectines

Country Status (5)

Country Link
EP (1) EP0840739A4 (fr)
JP (2) JPH11507526A (fr)
AU (1) AU725590B2 (fr)
CA (1) CA2223275A1 (fr)
WO (1) WO1996040703A1 (fr)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU2017248189B2 (en) * 2016-04-08 2021-04-29 Translate Bio, Inc. Multimeric coding nucleic acid and uses thereof

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5270163A (en) * 1990-06-11 1993-12-14 University Research Corporation Methods for identifying nucleic acid ligands
WO1994009158A1 (fr) * 1992-10-14 1994-04-28 University Research Corporation Procede de selection d'acides nucleiques basee sur la structure
WO1996034876A1 (fr) * 1995-05-04 1996-11-07 Nexstar Pharmaceuticals, Inc. Complexes de ligands d'acide nucleique
US6280932B1 (en) * 1990-06-11 2001-08-28 Gilead Sciences, Inc. High affinity nucleic acid ligands to lectins

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5489677A (en) * 1990-07-27 1996-02-06 Isis Pharmaceuticals, Inc. Oligonucleoside linkages containing adjacent oxygen and nitrogen atoms
IE920562A1 (en) * 1991-02-21 1992-08-26 Gilead Sciences Aptamer specific for biomolecules and method of making
EP0584229B1 (fr) * 1991-05-06 2003-07-23 Genentech, Inc. Un ligand de selectine

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5270163A (en) * 1990-06-11 1993-12-14 University Research Corporation Methods for identifying nucleic acid ligands
US6280932B1 (en) * 1990-06-11 2001-08-28 Gilead Sciences, Inc. High affinity nucleic acid ligands to lectins
US20030059769A1 (en) * 1990-06-11 2003-03-27 Parma David H. High affinity nucleic acid ligands to lectins
WO1994009158A1 (fr) * 1992-10-14 1994-04-28 University Research Corporation Procede de selection d'acides nucleiques basee sur la structure
WO1996034876A1 (fr) * 1995-05-04 1996-11-07 Nexstar Pharmaceuticals, Inc. Complexes de ligands d'acide nucleique

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
HICKE B J ET AL: "DNA aptamers block L-selectin function in vivo. Inhibition of human lymphocyte trafficking in SCID mice." THE JOURNAL OF CLINICAL INVESTIGATION. 15 DEC 1996, vol. 98, no. 12, 15 December 1996 (1996-12-15), pages 2688-2692, XP002294403 ISSN: 0021-9738 *
O'CONNELL D ET AL: "Calcium-dependent oligonucleotide antagonists specific for L-selectin." PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF THE UNITED STATES OF AMERICA. 11 JUN 1996, vol. 93, no. 12, 11 June 1996 (1996-06-11), pages 5883-5887, XP002294404 ISSN: 0027-8424 *
See also references of WO9640703A1 *

Also Published As

Publication number Publication date
JP2009039126A (ja) 2009-02-26
EP0840739A4 (fr) 2006-02-01
JPH11507526A (ja) 1999-07-06
CA2223275A1 (fr) 1996-12-19
AU725590B2 (en) 2000-10-12
WO1996040703A1 (fr) 1996-12-19
AU6450796A (en) 1996-12-30

Similar Documents

Publication Publication Date Title
US6280932B1 (en) High affinity nucleic acid ligands to lectins
US6001988A (en) High affinity nucleic acid ligands to lectins
US5780228A (en) High affinity nucleic acid ligands to lectins
AU777043B2 (en) Nucleic acid ligands to CD40ligand
AU663053B2 (en) Nucleic acid ligands
US5763595A (en) Systematic evolution of ligands by exponential enrichment: Chemi-SELEX
US6140490A (en) High affinity nucleic acid ligands of complement system proteins
AU692469B2 (en) Nucleic acid ligands and improved methods for producing the same
US6346611B1 (en) High affinity TGfβ nucleic acid ligands and inhibitors
US6300074B1 (en) Systematic evolution of ligands by exponential enrichment: Chemi-SELEX
AU689087B2 (en) Nucleic acid ligands and methods for producing the same
IL147872A (en) Legendic nucleic acids of tensin-C
US5766853A (en) Method for identification of high affinity nucleic acid ligands to selectins
US20090118481A1 (en) High Affinity Nucleic Acid Ligands To Lectins
AU725590B2 (en) High affinity nucleic acid ligands to lectins
EP0888374B1 (fr) ACIDES NUCLEIQUES LIGANDS A FORTE AFFINITE POUR LA PROTEINE C1q DU SYSTEME COMPLEMENTAIRE
WO2000012530A1 (fr) CLIVAGE DIRIGE SUR SITE dU DE CONJUGUES COVALENTS
Jensen Systematic Evolution Of Ligands By Exponential Enrichment: Chemi-selex

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 19971121

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AT BE CH DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE

RAP1 Party data changed (applicant data changed or rights of an application transferred)

Owner name: GILEAD SCIENCES, INC.

A4 Supplementary search report drawn up and despatched

Effective date: 20051220

GRAP Despatch of communication of intention to grant a patent

Free format text: ORIGINAL CODE: EPIDOSNIGR1

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20100129