Classifications

• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
  • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
  • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
  • C07K14/71—Receptors; Cell surface antigens; Cell surface determinants for growth factors; for growth regulators
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
  • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
  • C07K14/475—Growth factors; Growth regulators
  • C07K14/51—Bone morphogenetic factor; Osteogenins; Osteogenic factor; Bone-inducing factor
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
  • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
  • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
  • C12Q1/6897—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids involving reporter genes operably linked to promoters
• • G—PHYSICS
  • G01—MEASURING; TESTING
  • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
  • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
  • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
  • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
  • G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
• • G—PHYSICS
  • G01—MEASURING; TESTING
  • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
  • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
  • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
  • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
  • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
  • G01N33/566—Immunoassay; Biospecific binding assay; Materials therefor using specific carrier or receptor proteins as ligand binding reagents where possible specific carrier or receptor proteins are classified with their target compounds
  • G01N33/567—Immunoassay; Biospecific binding assay; Materials therefor using specific carrier or receptor proteins as ligand binding reagents where possible specific carrier or receptor proteins are classified with their target compounds utilising isolate of tissue or organ as binding agent

Definitions

• This invention relates to methods and constructs useful for identifying agonists and antagonists active at intracellular receptors.
• Steroid hormones such as estrogen, progesterone, androgens, glucocorticoids, and mineralocorticoids travel via the blood stream to their target cells, enter these cells, and then bind to steroid hormone receptors.
• the steroid hormone receptors exist in inactive apoprotein forms either in the cytoplasm or nucleus.
• the receptors Upon binding their respective hormonal ligands, the receptors become activated.
• the activated receptor can bind effectively to a hormone response element (HRE) on a chromosome and activate transcription of a cis-linked gene.
• HRE hormone response element
• the function of each domain is indicated by solid lines.
• the N-terminal A/B domain contains a transactivation function.
• the C region is responsible for DNA binding and receptor dimerization.
• the D region is a hinge region which allows the protein to bend or alter conformation.
• the E region is important for dimerization, transactivation, intramolecular repression and ligand binding.
• DNA sequences responsive to steroid hormones have been termed hormone response elements (HRES) .
• Evans et al. U.S. Patent 5,071,773, incorporated by reference herein, describes an assay by which hormone receptors, ligands for such receptors, and proteins having transcription activating properties of a hormone receptor, can be detected.
• the assay involves using a cell containing both a DNA encoding a receptor protein, and a DNA encoding a hormone responsive element (e.g.. a promoter) linked to an operative reporter gene.
• a suitable hormone or ligand is provided to the cell, a receptor-hormone is formed and delivered to an appropriate DNA-binding region to thereby activate the hormone responsive element and cause expression of the reporter gene.
• the expression product of the reporter gene is detected by standard procedures known to one skilled in the art.
• the present invention features a method for identifying agonists and antagonists of an intracellular receptor. These agonists and antagonists modulate the transcription activity of a promoter through a TAF region of the receptor in a cell.
• the present invention also features a method for using these agents to treat diseases and pathological conditions affected by an intracellular receptor, such as, but not limited to, breast cancer, endometrial cancer, fibroids, and endometriosis. This invention makes it possible to screen large collections of natural, semisynthetic, or synthetic compounds for therapeutic agents that affect the transcription activation activity of an intracellular receptor.
• the cell is so chosen that no, or minimal, transcription of the promoter occurs in the presence of a receptor having only an unmutated second TAF region corresponding to that mutated above (and not the other TAF region) .
• the cell is also chosen such that transcription of the promoter occurs in the presence of a receptor having the above nonmutated first TAF region alone.
• intracellular receptor an transcription polypeptide in the cytoplasm or nucleus of a cell whose transcription regulation activity is regulated by binding of small molecules such as steroid hormones, including, but not limited to, estrogen receptor (ER) , retinoid acid receptors (RAR) , retinoid X receptors (RXR) , glucocorticoid receptors (GR) , progesterone receptors (PR) , androgen receptors (AR) , mineralocorticoid receptor (MR) , thyroid hormone receptors (TR) , peroxisome proliferator activated receptor (PPAR) , and vitamin D receptors.
• ER estrogen receptor
• RAR retinoid acid receptors
• RXR retinoid X receptors
• GR progesterone receptors
• AR androgen receptors
• MR mineralocorticoid receptor
• TR peroxisome proliferator activated receptor
• PPAR peroxisome proliferator activated receptor
• TAF transactivation function domain located in an intracellular receptor having the ability to interact with a transcription target and activate the transcription from a promoter.
• a TAF region sometimes is referred to as an AF region.
• the A/B domain and E domain of a typical steroid hormone receptor contain TAF regions.
• Other TAF regions may be identified by deletions, site-directed mutagenesis and other methods known to those skilled in the art.
• functional context is meant the part of a TAF region that contains the functional activities of another TAF region with respect to agonist binding, dimerization, and heat shock protein interaction, but not with respect to the ability to activate transcription.
• the functional context of a TAF region can be preserved while the transcription activation activity of the TAF region is destroyed.
• receptor dimerization or the interaction of a hormone or transcription factor with the TAF region is altered to a minimum extent, or preferably unaltered, when certain mutations are made in the TAF region (e.g., a few amino acids (i.e., up to 10), or preferably only 1-3 amino acids are mutated in the TAF region) .
• Such interaction allows the fullfillment of transcription activation activity of another unaltered or non-mutated TAF region.
• the agent is a human hormone agonist or antagonist, and a nuclear receptor, e.g. , a human hormone receptor is encoded by the nucleic acid within the cell.
• the TAF2 region is mutated.
• the methods described herein allow rapid screening of potential agonists and antagonists of intracellular receptors, including, but not limited to, estrogen, progesterone, glucocorticoid, androgen and mineralocorticoid receptors.
• the assay may be conducted not only in the human derived cells, but also in other eucaryotic cell lines, such as chicken and yeast cell lines.
• the agonists and antagonists identified by this invention have advantages in treating diseases. For example, an estrogen agonist can be identified which is useful for treatment of osteoporosis. In osteoporosis, it appears as though TAFl activity alone is sufficient for prevention of bone loss. Thus, agonists having activity only at the TAFl region and not at the TAF2 region of the receptor are useful for disease treatment with no or fewer side effects.
• alterations could include altering the length or saturation characteristic of the alkyl chain (e.g., from 0-10 carbon atoms) that links the nitrogen- containing ring to the rest of the keoxifene compound.
• Other compounds that can be screened for a keoxifene- like profile include compounds with a chemical structure similar to tamoxifine or tamoxifine analogs. Those skilled in the art will readily recognize other modifications and substitutions that can be made to compounds that can be screened for a keoxifene-like profile.
• steroids and steroid analogues may exemplify agents identified by the present invention
• Applicant is particularly interested in the identification of agents of low molecular weight (less than 10,000 daltons, preferably less than 5,000, and most preferably less than 1,000) which can be readily formulated as useful therapeutic agents.
• Fig. 1 shows schematic diagrams of ER-wt, ER-TAF1,
• Cultures were treated with or without 10 "7 M 17-jS-estradiol (E 2 ) as indicated for 36 hours and assayed for / S-galactosidase and luciferase activity.
• LUC activity is normalized for jS-gal activity.
• the relative luciferase activity is calculated by dividing the normalized luciferase value at a given point by that obtained in the absence of a transfected receptor or ligand.
• a single experiment representative of four independent experiments is detailed above. Data shown indicate the mean ⁇ SE (m) of triplicate estimations.
• Fig. 2 shows schematic diagrams of ER-wt, ERN282G and ER-TAF2 (i.e., ER179C) mutants (Fig. 2A) and graphs indicating their transcription activation activities (Fig. 2B, C and D) .
• Fig. 3A, 3B and 3C CV1, HepG2 and HS578T cells were transiently co-transfected with 0.5 ⁇ g of the indicated receptor expression vector, 9.5 ⁇ g of C3-LUC reporter plasmid, 5 ⁇ g pRSV-/3-gal* and carrier DNA to a total amount of 20 ⁇ g DNA.
• a minus receptor control was included.
• Fig. 4 shows graphs indicating transcription activities of ER-TAF1 and ER-TAF2 (i.e. , ER179C) on different promoter constructs.
• Fig. 4A and 4B CV1 and HepG2 cells were transiently co-transfected with 0.5 ⁇ g of the indicated receptor expression vector, 9.5 ⁇ g of pA 2 -LUC reporter plasmid, 5 ⁇ g pRSV-j ⁇ -gal and carrier DNA to a total amount of 20 ⁇ g.
• Fig. 4C and D CV1 and HepG2 cells were co-transfected as described above, using the pEREMLT-LUC reporter. Cultures were treated with or without 10 "7 M
• Fig. 5 shows graphs indicating activation of ER-TAF1 and*ER-TAF2 (i.e., ER179C) by triphenylethylene-derived estrogen partial agonists.
• ER represents ER-wt
• ER m represents ER-TAF1
• TAF2 represents ER-TAF2 (i.e., ER-TAF2 (i.e., ER-TAF2
• TAF2 m represents ER-Null.
• HepG2 cells were co-transfected with 0.5 ⁇ g of the indicated receptor expression vectors, 9.5 ⁇ g of C3-LUC reporter, 5 ⁇ g of pRSV- ⁇ -gal and carrier DNA to a total amount of 20 ⁇ g.
• Fig. 7 is a schematic model showing TAFl and TAF2 as functionally dependent activators of transcription.
• TAF2 function of the receptor can be supplied by other transcription factors, allowing TAFl region of the receptor to function independently of TAF2. Therefore, binding of the receptor to DNA is synonymous with transactivation and can be accomplished by both estrogen agonists, as well as antagonists that permit delivery of the receptor to DNA.
• the partial agonist activity of the triphenylethylene-derived estrogen agonists depends on the conformation induced by the ligand and the effect that this conformation has on the presentation of TAFl to the transcription apparatus.
• Fig. 8 shows diagrams indicating that the partial agonist activities of the triphenylethylene derived antiestrogens depends on TAFl function.
• Fig. 9 is a diagram showing the effect of keoxifene (keox) on MCF-7 cell proliferation.
• the activity of estrogen in this assay is maximum at 10 ⁇ 10 M, and induces MCF-7 cell proliferation to 1500% of the control.
• Fig. 12 shows diagrams indicating schematic structure organization of PRB, PR-TAF1 (i.e., PRB (E907A;E911A) ) , PR-TAF2 (i.e., PRA) and PR-Null (i.e., PRA (E907A(E911A) ) .
• Plasmid phPRB or phPRB (E907A/E911A) was transfected into MCF-10 cells (A) or CV-1 cells (B) together with an MMTV-LUC reporter plasmid (10 ⁇ g/ml) and pCHHO (5 ⁇ g/ml) as an internal control.
• the amount of expression vector was chosen to permit maximal transcriptional activation in each cell line examined.
• the transfected cells were incubated for 40 h with increasing concentrations of progesterone as indicated, and assayed for luciferase and 3-galactoside activities. The data are presented as normalized luciferase (LUC) units.
• HeLa cells were transiently co-transfected with increasing concentrations of the hPR expression plasmid phPRB or phPRA (A), or phPRA or phPRA (E907A;E911A) (i.e., PR- TAF1) (B) together with a TAT-LUC reporter plasmid (10 ⁇ g/ml) and pCHllO (5 ⁇ g/ml) as an internal control.
• the transfected cells were incubated with or without 10 "7 M progesterone as indicated for 40 h and assayed for luciferase (LUC) units calculated as for Fig. 13.
• Fig. 18 is a graph showing an AR-TAF1 specific assay for screening AR-TAF1 agonists.
• Figure 19 shows the structure organization of GR-wt, GR-TAF1, GR-TAF2, GR-N-del and GR-Null.
• Fig. 20 shows the organization structures of GR-Gal4 constructs.
• Fig. 22 is a graph showing activation profiles obtained with different promoters.
• Cells were resuspended in 2-5X pellet volume of 10 mM Tris, 0.4 M KC1, 2 mM EDTA, 0.5 mM PMSF, 1 ⁇ g/ml aprotinin, 2 mM DTT, pH 7.6, and lysed by vortexing with 0.45-0.5 mm glass beads, intermittently with cooling on ice, until at least 90% of the cells were observed to be open. Extracts were centrifuged at 13,000xg and the supernatants were recovered. Protein concentrations were determined by Bio-Rad Protein Assay (Bio-Rad, Richmond, CA) .
• C-terminal region may function as a "repressor" .
• Plasmid ⁇ MTV-LUC containing a deletion of the sequences from +190 to -88 was obtained from Ron Evans (Salk Institute, San Diego, Calif.) .
• This plasmid was digested with HindiII to remove the glucocorticoid response elements, and five copies of a 33-bp oligonucleotide containing the consensus vitellogenin A2 estrogen response element were inserted.
• the sequence of the oligonucleotide used was 5'AATTAAAGTCAGGTCACAGTGACCTGATCAAA3' .
• GR-TAF2 and GR-N-Del plasmids were derived from GR- wt.
• GR was modified to add a NotI restriction site on the 5' side of the D ⁇ A binding domain and an Xhol site on the 3' side of the D ⁇ A binding domain.
• amino acids 77-262 were excised from GR-wt using Bglll.
• amino acids 9-385 were excised from GR-wt. The procedures were described previously by Hollenberg et al., Cell 49:39-46, 1987, incorporated by reference herein.
• compositions which can be used orally include push-fit capsules made of gelatin, as well as soft, sealed capsules made of gelatin and a plasticizer, such as glycerol or sorbitol.
• the push-fit capsules can contain the active ingredients in admixture with filler such as lactose, binders such as starches, and/or lubricants such as talc or magnesium stearate and, optionally, stabilizers.
• the active compounds may be dissolved or suspended in suitable liquids, such as fatty oils, liquid paraffin, or liquid polyethylene glycols.
• stabilizers may be added.

Landscapes

• Health & Medical Sciences (AREA)
• Life Sciences & Earth Sciences (AREA)
• Chemical & Material Sciences (AREA)
• Engineering & Computer Science (AREA)
• Immunology (AREA)
• Organic Chemistry (AREA)
• Molecular Biology (AREA)
• General Health & Medical Sciences (AREA)
• Biochemistry (AREA)
• Biomedical Technology (AREA)
• Proteomics, Peptides & Aminoacids (AREA)
• Genetics & Genomics (AREA)
• Medicinal Chemistry (AREA)
• Zoology (AREA)
• Urology & Nephrology (AREA)
• Hematology (AREA)
• Physics & Mathematics (AREA)
• Microbiology (AREA)
• Analytical Chemistry (AREA)
• Cell Biology (AREA)
• Biophysics (AREA)
• Biotechnology (AREA)
• Food Science & Technology (AREA)
• Gastroenterology & Hepatology (AREA)
• Toxicology (AREA)
• General Physics & Mathematics (AREA)
• Pathology (AREA)
• Wood Science & Technology (AREA)
• Tropical Medicine & Parasitology (AREA)
• Orthopedic Medicine & Surgery (AREA)
• Bioinformatics & Cheminformatics (AREA)
• General Engineering & Computer Science (AREA)
• Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Applications Claiming Priority (3)

Publications (1)

Family

ID=23916062

Family Applications (1)

Country Status (4)

Families Citing this family (13)

Family Cites Families (2)

• 1996
  • 1996-06-06 AU AU62639/96A patent/AU6263996A/en not_active Abandoned
  • 1996-06-06 EP EP96921406A patent/EP0832295A1/de not_active Withdrawn
  • 1996-06-06 WO PCT/US1996/009638 patent/WO1996041013A1/en not_active Application Discontinuation
  • 1996-06-06 CA CA 2222562 patent/CA2222562A1/en not_active Abandoned

Non-Patent Citations (1)

Also Published As

Similar Documents

Legal Events